Previous Article | Next Article 
Molecular and Cellular Biology, December 2001, p. 8117-8128, Vol. 21, No. 23
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.23.8117-8128.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Telomere Formation by Rap1p Binding Site Arrays
Reveals End-Specific Length Regulation Requirements and Active
Telomeric Recombination
Simona
Grossi,
Alessandro
Bianchi,
Pascal
Damay, and
David
Shore*
Department of Molecular Biology, University
of Geneva, 1211 Geneva 4, Switzerland
Received 13 June 2001/Returned for modification 11 July
2001/Accepted 29 August 2001
 |
ABSTRACT |
Rap1p, the major telomere repeat binding protein in yeast, has been
implicated in both de novo telomere formation and telomere length
regulation. To characterize the role of Rap1p in these processes in
more detail, we studied the generation of telomeres in vivo from linear
DNA substrates containing defined arrays of Rap1p binding sites.
Consistent with previous work, our results indicate that synthetic
Rap1p binding sites within the internal half of a telomeric array are
recognized as an integral part of the telomere complex in an
orientation-independent manner that is largely insensitive to the
precise spacing between adjacent sites. By extending the lengths of
these constructs, we found that several different Rap1p site arrays
could never be found at the very distal end of a telomere, even when
correctly oriented. Instead, these synthetic arrays were always
followed by a short (
100-bp) "cap" of genuine TG repeat
sequence, indicating a remarkably strict sequence requirement for an
end-specific function(s) of the telomere. Despite this fact, even
misoriented Rap1p site arrays promote telomere formation when they are
placed at the distal end of a telomere-healing substrate, provided that
at least a single correctly oriented site is present within the array.
Surprisingly, these heterogeneous arrays of Rap1p binding sites
generate telomeres through a RAD52-dependent fusion
resolution reaction that results in an inversion of the original array.
Our results provide new insights into the nature of telomere end
capping and reveal one way by which recombination can resolve a defect
in this process.
 |
INTRODUCTION |
Telomeres, the specialized
protein-DNA complexes that constitute the ends of eukaryotic
chromosomes, permit the complete replication of chromosome ends and
allow the cell to distinguish these natural ends from accidental DNA
breaks (reviewed recently in reference 27). The complete
replication of telomeric DNA, which cannot be accomplished by
conventional DNA polymerases, is carried out in most organisms by a
cellular reverse transcriptase, called telomerase, that carries its own
RNA template (42). Telomerase generates simple repeat
sequences (TTAGGG in mammals and most other eukaryotes but
TG1-3 in the yeast Saccharomyces
cerevisiae) in which the GT-rich strand forms the 3' end of the
chromosome. TG1-3 repeat tracts in yeast, which
vary in length from
250 to 350 bp, form very high affinity binding
sites for the multifunctional regulatory protein Rap1
(26). Because of the irregular nature of the repeats, the
disposition of Rap1p binding sites does not appear to be constant,
though an average of one site per
18 bp has been measured in one
study (11). In mammalian cells, the regular TTAGGG
telomeric repeats are longer (and more heterogeneous in length) than
the related repeats in yeast (
10 kb in humans and up to 50 kb in the
mouse, Mus musculus). Telomere repeat DNA in mammalian cells
is bound by at least two distinct, related proteins, TRF1 and TRF2
(2, 4, 7).
The unusual mechanism of telomere DNA replication imposes a regulatory
problem on the cell. Telomerase addition must be sufficient to
counteract either replicative loss or degradation of terminal sequences, yet unregulated addition of repeats can be detrimental to
cell growth (36, 49). Consequently, telomere length is regulated about a fixed average value. This fact implies a cellular mechanism to measure telomere length and to then regulate telomerase addition, end degradation, or both, accordingly. Recent studies of both
yeast and mammalian cells suggest that this is accomplished, at least
in part, by a negative-feedback system involving the telomere repeat
binding proteins (34, 46, 50, 54) that is likely to act in
cis on the telomerase complex (33). These studies suggest that the metric of telomere length is not the TG repeat
tract per se but rather the number of proteins bound to it. In yeast, a
complex between Rap1p and two interacting factors, Rif1p and Rif2p
(15, 58), may generate a number-dependent structural
transition that controls telomerase access or activity at the telomere
(48). Interestingly, Rap1p also appears to be directly
involved in promoting the de novo formation of telomeres at DNA ends in
vivo (30, 31, 45).
Here we have examined in more detail the role of Rap1p in telomere
formation and length regulation by using arrays of synthetic Rap1p
binding sites of varying number, spacing, and orientation to generate
telomeres in vivo. This has allowed us to study telomeres composed, at
least in part, of a defined arrangement of Rap1p binding sites, a
situation that cannot be attained with the native TG1-3 repeats of S. cerevisiae. Our
results extend previous work (34, 45, 46) by demonstrating
a certain degree of flexibility in the sequence, spacing, and
orientation requirements for Rap1p binding sites when the synthetic
arrays contain fewer binding sites than a native telomere. In addition,
we found an unexpected sensitivity of either the length regulation or
telomerase addition mechanisms to the precise sequence present at the
extreme end of a telomeric array. For example, several Rap1p site
arrays that contributed to telomere length regulation when present
within the internal half of a telomere failed to do so when present
distally and were never recovered at the very end of a telomere.
Likewise, "misoriented" arrays, in which the CA-rich sequence was
present on the 3' end, contributed to telomere length regulation only when present internally. Strikingly, however, misoriented arrays made a
quantitative contribution to telomere healing regardless of their
location (proximal or distal) in the healing substrate as long as they
were present together with at least one correctly oriented site.
Examination of the telomeres resulting from substrates with distal
misoriented sites revealed a robust mechanism of sequence rearrangement
between telomeric repeats. We discuss these results in terms of models
for a special role of the end in telomere length regulation and in the
formation of a "cap" structure that protects the chromosome end
from DNA recombination and repair machinery.
 |
MATERIALS AND METHODS |
Yeast strains and methods.
All strains employed were
derivatives of W303-1B (MAT
leu2-3,
112 his3-11, 15 ura3-1,
ade2-1, trp1-1,
can1-100) (53). Standard methods for
yeast growth and manipulation were used throughout (1).
Strain YS293, used in HO cutting experiments, is derived from a
RAD5 version of W303-1B (a generous gift of Hannah Klein). It carries a partial deletion of the Y alpha and Z1 regions at the
MAT locus, which eliminates the HO recognition site, and
contains a copy of the HO endonuclease gene, driven by the
GAL1 promoter and integrated at the HIS3 locus.
An HO cleavage site was introduced into this strain at the
ADH4 locus by transformation with
SacI-KpnI-cleaved pGS45. YS312 is derived from
YS293 by replacement of the RAD52 gene by KanMX4.
Details of these constructs are available upon request.
Plasmids.
Telomere-healing constructs containing Rap1p
binding site array constructs were made using a modified version of
pADH4UCA (12) in which an oligonucleotide encoding
BamHI, BglII, and KpnI sites was
introduced into the unique BamHI site. Oligonucleotides encoding Rap1p binding sites were introduced between the
BamHI and BglII sites, and head-to-tail arrays
were generated by a reiterative cloning strategy, details of which are
available upon request, in which BamHI and BglII
sites were directly joined. The DNA sequences of the binding site
oligonucleotides are as follows (the consensus Rap1p binding site
sequences are underlined, and the BamHI overhangs are in
parentheses): dimer 15- and 20-bp spacing sites,
5'(GATC)CTACACCCATACACCTTACACCCAGACACCA3'; 17-bp spacing site, 5'(GATC)CACACCCATACAA3';
22-bp spacing site, 5'(GATC)CGTACACCCATACATCGA3'; 27-bp spacing
site, 5'(GATC)CTGTGTACACCCATACATCGTCA3'; 31-bp
spacing site,
5'(GATC)CGTGTTGACACCCATACATTGGTGATA3'. The complements of these oligonucleotides begin with the sequence 5'(GATC)3', which forms the BglII-compatible end, and lack
sequences complementary to the GATC sequence at the 5' end of the first set. Annealing of the complementary oligonucleotides produces a duplex
that will anneal to and restore a BamHI site at one end and
a BglII site at the other end. The sequence between the
native TG repeat and the most proximal BamHI restriction
site (or BglII, in the case of misoriented Rap1p site
arrays) is 5' TCTCTCACATCTACCTCTACTCTG(GGATCC) 3' and is the
same for all of the constructs tested.
Plasmid pGS45, used to generate a novel HO cut site near the left arm
of chromosome VII, contains the following elements inserted between the
KpnI and SacI sites of pBluescript KS(+): a
region of homology to the MNT2 gene, the URA3
gene, a 24-bp recognition site for the HO endonuclease, an array of 12 misoriented Rap1 binding sites followed by 2 correctly oriented Rap1
binding sites, the ADE2 gene, and a region of homology to
the ADH4 gene (see Fig. 7). Transformation with the
SacI/KpnI-digested plasmid results in the
replacement of sequences between MNT2 and ADH4 at
chromosome VII-L with the KpnI-SacI insert. Both
the MNT2 and ADH4 open reading frames are
disrupted as a consequence. Additional details of this plasmid are
available upon request.
Telomere Southern blots and telomere length measurements.
Yeast DNA was isolated from overnight cultures, and 1 µg was digested
with the appropriate enzymes. DNA fragments were separated by
electrophoresis in 1.5% agarose gels, transferred to HyBond N+
membranes, and hybridized to random-primed probes (either a 1.1-kb
URA3 or a 0.5-kb ADE2 fragment) by standard
procedures. The membranes were then autoradiographed on X-ray film or
with a phosphorimager (Bio-Rad Molecular Imager FX). The midpoints of
the telomere band distributions were determined with the Bio-Rad Quantity One program, using the internal ura3-1
control band in each lane as a size reference. The values reported are
averages of at least two independent transformants. The variation
between different clones was typically <10% of the total telomere
tract length, and often <5%.
Telomere-healing assays.
Yeast transformations to measure
telomere-healing efficiency were done using the "best" LiOAc method
of Gietz and coworkers (http://www.umanitoba.ca/faculties/medicine/biochem/gietz/Trafo.html). In order to compare the telomere-healing efficiencies of different plasmids, competent cells (aliquots of the same culture) were transformed with equivalent amounts of different plasmids digested with
the appropriate enzymes to generate a linear DNA fragment with Rap1p
binding sites at one end, URA3 in the middle, and a fragment
of ADH4 at the other end. The ADH4 end directs
homologous recombination to the endogenous ADH4 locus on
chromosome VII-L, replacing the
20 kb of sequence between
ADH4 and the native chromosome VII-L telomere
(12). Cells were plated on synthetic complete (SC) medium
lacking uracil (SC-Ura), and Ura+ transformants
were replicated on SC plates containing 1 g of 5-fluoroorotic acid
(FOA)/liter. The number of Ura+ and
FOAr colonies was taken as a measure of telomere
formation at the ADH4 locus. The experiment was repeated
three times for each plasmid, and the average values were calculated
after normalization to the number of Leu+
colonies arising from transformation of the same batch of competent cells with the plasmid pRS315 (LEU2 CENVI).
For HO endonuclease induction, cells were grown in preinduction medium
(yeast extract-peptone [YP] plus 2% glucose) at 30°C
to a
density of 5 × 10
6/ml, washed, and
resuspended in YP plus 2% galactose. Samples
were removed at the
indicated time points, and genomic DNA was
prepared and analyzed by
Southern blotting using a 0.5-kb
ADE2 hybridization probe as
described
above.
 |
RESULTS |
Generation of telomeres from synthetic arrays of Rap1p binding
sites.
To begin to examine more systematically the role of Rap1p
in telomere formation and length regulation, we constructed and tested
sets of telomere-healing substrates (12) containing tandem arrays of Rap1p binding sites with varied site orientation and spacing.
The first series of arrays that we tested was based upon a 35-bp
oligonucleotide containing two consensus Rap1p binding sites (5,
13) whose sequence deviates from the strict GT/AC strand bias of
native telomere repeats at a single position within each binding site
and within both flanking spacer regions. We used a reiterative cloning
strategy (see Materials and Methods) to generate head-to-tail arrays
with 2, 4, 8, and 16 copies of this oligonucleotide (4, 8, 16, and 32 binding sites) in either a native ("correct") orientation, in which
the TG-rich strand runs 5' to 3' towards the healing end, or a
misoriented configuration (Fig. 1A). In
both cases the synthetic arrays were followed by a short 80-bp tract of
correctly oriented, native TG1-3 repeat
"seed" sequence. Because of the precise disposition of the two
Rap1p binding sites in the original oligonucleotide, the arrays have an
alternating 15- and 20-bp spacing between adjacent sites.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 1.
Effect of the Rap1p binding site number and
orientation on telomere length regulation. (A) Schematic representation
of constructs used to generate a new telomere at the
ADH4 locus on chromosome VII-L (see Materials and
Methods for details). The solid arrowheads represent synthetic Rap1p
binding sites (n, number of Rap1p sites as shown in panel B),
either in the correct (pointing left) or incorrect orientation. The
unit oligonucleotide in these arrays contains two Rap1p binding sites,
with an alternating 15- and 20-bp spacing between adjacent sites. The
four open arrowheads represent 80 bp of TG1-3 sequence at
the end of the healing substrate. R, EcoRI; B,
BamHI; Bg, BglII; H,
HindIII; S, SalI. (B) Southern blot
analysis of telomeres generated from
EcoRI-SalI fragments shown in panel A
containing the indicated number of Rap1p sites, either correctly
oriented (left) or misoriented (right). The URA3 probe
detects the endogenous ura3-1 locus and a
diffuse telomeric band in the case of HindIII digest
(top). To probe for the presence of the distal restriction site on the
arrays (BamHI or BglII), the appropriate
double digests were examined (bottom). (C) Results of the analysis in
panel B are shown graphically. The average length of the
TG1-3 tract is plotted as a function of the number of
binding sites present in the transforming constructs (see the text for
explanation).
|
|
After transformation and selection for Ura
+
clones, the new telomeres generated from these synthetic arrays
were examined by
Southern blotting with a
URA3 probe (Fig.
1A). Digestion with
HindIII yields two hybridizing
fragments: one containing the telomeric
URA3 gene and the
other containing the endogenous
ura3 gene, which
serves as
an internal size marker. A double digestion with either
HindIII and
BamHI (for the correctly oriented
arrays) or
HindIII
and
BglII (for the
misoriented arrays) allows us to determine
whether the healed telomeres
still contain the complete synthetic
array of Rap1p binding sites
adjacent to
URA3. The difference
between the average
HindIII fragment size and the size of the
HindIII-plus-
BamHI (or
HindIII-plus-
BglII) fragments provides
an
indirect measure of the average amount of TG
1-3
repeat
present on the healed
telomeres.
In the case of the correctly oriented arrays (Fig.
1B, left), the
HindIII telomeric
URA3 fragments generated
from different
synthetic arrays were very similar in length (

1,350
to 1,400
bp, corresponding to 250 to 300 bp of
TG
1-3 repeat) and
essentially identical to the
wild-type telomere formed by TG
1-3 repeat
sequence alone. The presence of the synthetic Rap1p binding
sites in
these telomeres, at least those generated from arrays
with two, four,
or eight binding sites, was confirmed by the presence
of discrete
HindIII-
BamHI fragments of the expected size.
The
fact that the sums of the lengths of the synthetic arrays plus
the
distal TG
1-3 tract are very similar in every
case indicates
that the cell recognizes these synthetic Rap1p arrays as
being
essentially identical to endogenous TG
1-3
repeats with respect
to telomere length regulation. For the constructs
with either
16 or 32 binding sites, the
HindIII-
BamHI and
HindIII
fragments
were indistinguishable, suggesting that the normal processes
of
telomere shortening and telomerase elongation had removed (at
least)
the ends of the synthetic arrays in these two cases and
replaced them
with TG
1-3 repeat
sequence.
Another way of expressing these results (Fig.
1C, left) is to plot the
number of Rap1p binding sites in the synthetic array
versus the length
of TG
1-3 repeat sequence in the resulting
telomere, which is given by the
HindIII fragment length
minus
the
HindIII-
BamHI fragment length. This
shows that there is an
inverse-linear relationship between the number
of synthetic sites
and the amount of TG
1-3
repeat, at least for telomeres made
from arrays of two, four, or eight
Rap1p sites, where this calculation
can be made. Specifically, we find
that for each additional synthetic
Rap1p binding site added to the
array there is a corresponding
"loss" of approximately 18 bp of
distal TG
1-3 repeat sequence.
This value is
remarkably close to the estimated density of Rap1p
binding sites in
native TG
1-3 repeat sequence that was derived
from biochemical experiments (
11). The slight telomere
shortening
observed for the constructs containing 8, 16, or 32 synthetic
sites, relative to those with fewer or no such sites,
suggests
that the average site spacing in the synthetic arrays (17.5 bp
per site) is slightly shorter than that which actually occurs
in native
repeats. To be certain that Rap1p binding, rather than
some other
unknown feature of these arrays, was responsible for
the measured
effect on TG
1-3 repeat addition, we constructed
and tested a series of mutated versions of this oligonucleotide
in
which the middle cytosine at each of the two C
3
stretches was
changed to a guanine, which abolishes Rap1p binding.
Transformation
with mutant arrays containing 2, 4, 8, 16, or 32 sites,
followed
by the 80-bp TG
1-3 repeat seed, yielded
telomeres that retained
all of the synthetic sites, followed in each
case by 250 to 300
bp of TG
1-3 repeat (data not
shown). Apparently these mutant
arrays, though very similar in sequence
to the original arrays
and having the same TG/CA strand bias, are not
recognized as part
of the telomeric TG
1-3 repeat
tract.
Rap1p binding site orientation is important only at the distal end
of the telomere.
An analysis of telomeres derived from the
misoriented arrays (Fig. 1B, right) revealed both similarities and
differences in comparison to the correctly oriented arrays. Arrays
containing two, four, or eight misoriented sites behaved
indistinguishably from the corresponding correctly oriented arrays. It
thus appears that the telomere length regulatory machinery treats these
arrays of misoriented sites, in one case constituting about one-half of
the telomere, as if they were correctly oriented native
TG1-3 repeats. Strikingly, however, constructs
with 16 and 32 misoriented sites generated abnormally elongated
telomeres that contained the complete synthetic site array, as judged
by the presence of a BglII site at the same position as in
the original transforming DNA (Fig. 1B, bottom right, and data not
shown). In both cases, these telomeres appeared to also contain a
terminal cap of TG1-3 repeat about 100 bp in
length. This deviation from a linear relationship between the number of
Rap1p binding sites in the synthetic array and
TG1-3 tract length is shown graphically in Fig.
1C, right. These observations indicate that the telomere length
regulatory machinery recognizes a long array of misoriented Rap1p
binding sites as being different from an identical, correctly oriented array. One obvious explanation for this difference is that normal erosion of the elongated, misoriented arrays would expose a CA-rich strand running 5' to 3' towards the telomere end that would not provide
a suitable substrate for telomerase and/or the end protection machinery. Such ends would then be lost, and only those containing the
TG repeat buffer would then be present in the Southern blots. A more
detailed analysis of these abnormal telomeres will be presented elsewhere.
Effect of altered Rap1p binding site spacing on telomere length
regulation.
The correctly oriented alternating 15- and 20-bp
spacing arrays of Rap1p binding sites described above appear to be
recognized remarkably well as normal telomeric DNA. To investigate
whether this is due to some unique sequence or spacing feature of the oligonucleotide used to assemble these arrays, we generated and tested
four sets of different arrays. Using the same cloning strategy, this
time with oligonucleotides encoding a single Rap1p binding site, we
created correctly oriented arrays with site-to-site spacing of 17, 22, 27, and 31 bp. For each oligonucleotide, constructs with one, two,
four, and eight sites were generated, and in several cases 6-mer,
12-mer, and 16-mer arrays were also made. In every case, the arrays
were followed by a short (80-bp) tract of genuine TG1-3 seed sequence, as before (Fig.
2, top). The new sites again conformed to
consensus sequences and were identical to the original dimer
oligonucleotide sites within the more conserved first half-site
(17) but differed slightly at the end of the second
half-site. Despite these slight differences, the new sites bound Rap1p
in vitro with affinities indistinguishable from that of the original
dimer site, with one exception (data not shown; see below).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
The effect of Rap1p binding site spacing on telomere
length regulation. (Top) Schematic representation of the constructs
used to generate a novel telomere at chromosome VII-L (Fig. 1). Arrays
of 2 to 32 (n) Rap1p binding sites with site-to-site spacing of 17, 22, 27, or 31 bp (see Materials and Methods) were created. See the legend
to Fig. 1 for definitions of symbols. (Bottom) Telomeres generated from
the constructs shown (top) were analyzed by Southern blotting, and the
results of this analysis are shown graphically (as in Fig. 1C).
|
|
All of these new constructs generated Ura
+
colonies at frequencies similar to that of the original dimer site
arrays (data
not shown). For each construct, several independent
transformants
were examined by Southern blotting, as described above,
in order
to determine the average telomere length and to probe for the
presence of the
BamHI site at the distal end of the
synthetic
site array. The results of this telomere length analysis are
shown
graphically in Fig.
2 (bottom), where the calculated
TG
1-3 repeat length is plotted against the
number of synthetic Rap1p
binding sites in the array, as in Fig.
1C.
In marked contrast to the results obtained with the 15- and 20-bp
spacing arrays, the 17- and 31- bp spacing arrays had little
or no
effect on the amount of TG
1-3 in the healed
telomeres,
which in every case were in the range of

200 to 300 bp.
It would
appear, therefore, that these particular synthetic arrays of
Rap1p
binding sites are not recognized as part of the
TG
1-3 tract
by the telomere length regulatory
system, or only minimally so.
The failure of the 17-bp array to support
proper length regulation
is likely to be a consequence of reduced Rap1p
binding to these
sites (data not shown), possibly due to steric
hindrance at this
particular site phasing (
16; D. Rhodes,
personal communication).
The small but reproducible loss of

5 to 10 bp of TG
1-3 repeat per site for these constructs
might be explained by occupancy
of alternating sites in this array.
Interestingly, Ray and Runge
(
46) found that a particular
6-mer array of Rap1p sites with
an even smaller site spacing (13 bp)
could be counted normally.
However, this observation is consistent with
a prediction from
the structural studies that a 13-bp spacing between
sites, unlike
the 17-bp spacing, should accommodate continuous Rap1p
binding
(D. Rhodes, personal communication). The failure to detect a
strong
response of the system to the 31-bp spacing array is somewhat
surprising in light of the finding that a 6-mer array of Rap1p
binding
sites with a spacing of 35 bp can be efficiently counted
(
46). We do not know the reason for this apparent
discrepancy,
but one possibility might be that the rotational
disposition of
sites on the 31-bp array is unfavorable. Alternatively,
some other
sequence feature of this site, unrelated to its ability to
bind
Rap1p, might prevent its recognition as a telomeric
sequence.
The 22- and 27-bp spacing arrays, though, gave a roughly proportional
decrease in added TG
1-3 repeat as the number of
synthetic sites increased from one to eight. We conclude from
this that
site spacings of 22 and 27 bp are consistent with recognition
by the
"counting" mechanism, at least for arrays up to eight sites
long,
which occupy the centromere-proximal half of the telomere.
However, we
consistently noted a slight deviation in the inverse-linear
relationship between site number and amount of
TG
1-3 repeat
added for the two longer arrays (12 or 16 sites) of the 22- and
27-bp spacing oligonucleotides. Whereas a
16-site array of the
15- and 20-bp spacing oligonucleotide was
recognized as a complete
telomere, the same number of synthetic binding
sites present in
the 22- or 27-bp spacing arrays always generated
telomeres with

100 bp of additional TG
1-3
repeat (Fig.
2), all of which
retained the
BamHI site at the
end of the array (data not
shown).
Abnormal telomere length regulation in long Rap1p binding site
arrays points to an end-specific defect.
To investigate further
the apparently altered length regulation properties of the 22- and
27-bp spacing arrays, we constructed a much longer (32-mer) array with
the 27-bp spacing sites (Fig. 3, top).
This array contained approximately twice the number of Rap1p binding
sites present at an average-length native telomere and was capped by an
80-bp native TG1-3 sequence. If the 27-bp
spacing sites could be counted, at least to some extent, one might
expect to observe telomeres shorter than the 32-mer array itself in
which the distal BamHI site would be lost in the process of
telomere shortening. Alternatively, if the 32 sites in this array are
still not sufficient to constitute a stable telomere, one might imagine
that telomerase-generated repeats (or the 80-bp
TG1-3 seed at the end) would make up the missing information and allow for the generation of a stable, though abnormally long, telomere array.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 3.
Long telomeres containing 32 Rap1p binding sites at a
density of 1 site per 27 bp shorten by internal deletion of synthetic
sites. (Top) Schematic representation of the relevant parts of plasmid
pE243, which contains 32 synthetic Rap1p binding sites with
site-to-site spacing of 27 bp. See the legend to Fig. 1 for definitions
of symbols. (Bottom) Lanes 1 to 10, telomeres from five independent
Ura+ transformants obtained with
EcoRI/SalI-digested pE243 were analyzed
following HindIII/BamHI digestion (lanes
1 to 5) or HindIII digestion (lanes 6 to 10) of the same
samples. Lanes marked E56 contain genomic DNA from a strain lacking
synthetic sites but containing adjacent BamHI and
BglII sites between URA3 and the
TG1-3 tract. Lanes 11 to 14, telomeres from four
independent Ura+ transformants obtained by transformation
with a SalI/BamHI fragment of pE243 were
analyzed after HindIII digestion. The arrow to the left
of the autoradiogram indicates the size of the pE243
HindIII-BamHI fragment.
|
|
As shown in Fig.
3 (bottom), however, a quite different result was
obtained with the 32-mer array. Telomere healing was efficient
with
this construct but led to the generation of individual clones
with
remarkably different average telomere lengths. What was particularly
striking was that most of the novel telomeres examined (13 of
15 [Fig.
3 and data not shown]), regardless of length, retained
the
BamHI site at the distal end of the synthetic site array and
appeared to be capped by

50 to 100 bp of
TG
1-3 sequence.
Because many of these telomeres
were shorter than the original
32-mer array itself, it appeared that
shortening had occurred
not by deletion from the end but rather by an
internal loss of
sequences within the 32-mer array. The repetitive
nature of the
arrays suggests that this might have occurred through a
homology-dependent
mechanism. In any event, the behavior of this 27-bp
spacing array
was clearly different from that seen with the 15- and
20-bp spacing
arrays, where constructs with 16 or 32 sites rapidly
generated
normal-length telomeres through a mechanism that removed
sequences
from the end of the array (Fig.
1 and data not shown).
Despite
the inability of the 27-bp spacing array to shorten in a normal
fashion, this array by itself (that is, lacking an 80-bp
TG
1-3 cap) can act as a substrate for telomere
formation in the transformation
assay (Fig.
3, lanes 11 to 14). Taken
together, these data point
to an end-specific function that is absent
or at least partially
defective in the 22- and 27-bp spacing arrays but
intact in the
15- or 20-bp spacing array. This function is unlikely to
be related
to Rap1p binding per se but instead may reflect stringent
sequence
requirements for an end-specific factor(s) required for proper
regulation of telomerase access or activity or for telomere end
protection (see Results and Discussion). Although the 22- and
27-bp
arrays differ in sequence from the 15- and 20-bp spacing
array in both
the spacer regions and part of the Rap1p binding
site itself, we do not
know at present which difference(s) causes
their altered
behavior.
Misoriented Rap1p binding sites can contribute to telomere
formation.
In addition to their role in telomere length
regulation, Rap1p binding sites and the Rap1p carboxy terminus are
known to promote de novo telomere formation in transformation-based
telomere-healing assays (30, 31, 45) by an unknown
mechanism(s). Given that inverted Rap1p binding site arrays within the
centromere-proximal part of a telomere can be counted by the length
regulation system (Fig. 1), we asked whether they might also contribute
quantitatively to telomere formation, provided that correctly oriented
sites were present at the end of the array. Figure
4A shows that this is
indeed the case. As little as one correctly oriented site at the end of
a long (16-mer) array of misoriented sites allowed for very efficient
telomere formation. In all cases examined (Fig. 4A and data not shown),
misoriented sites make a quantitative contribution to healing
efficiency similar to that observed for correctly oriented sites. As
expected (39), arrays containing only misoriented Rap1p
binding sites completely fail to form telomeres in this assay (data not
shown).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4.
Misoriented Rap1p binding sites contribute to telomere
formation in combination with correctly oriented sites. (A) Schematic
representations of mixed-array telomere-healing constructs (top). N,
NcoI; B, BamHI; Bg, BglII;
S, SalI. The solid arrows represent synthetic 15- and
20-bp spacing Rap1p binding sites (nA, number of distal Rap1p binding
sites, pointing left; nB, number of proximal Rap1p binging sites,
pointing right), either in the native or in the opposite orientation,
except for the distal site nA = 1, which is derived from the
monomer 22-bp spacing site. The number of Ura+ and
FOA+ transformants generated with
BamHI/SalI fragments is plotted as a
function of array length and orientation (bottom). Open bars, nA = 2; solid bars, nA = 1. (B) Lanes 1 to 10, telomeres from 10 independent Ura+ transformants generated by pE269 (nA = 1; nB = 16) were analyzed as described in the legend to Fig. 1B, except that
NcoI digestion was used instead of
HindIII. The lanes marked E56 contain DNA from cells
with only adjacent BamHI and BglII sites
between the TG1-3 telomeric tract and URA3.
(C) Telomere-healing efficiency (bottom), measured as for panel A, for
a series of constructs containing terminal misoriented Rap1p
binding sites (top). Open bars, nB = 2; solid bars, nB = 4.
|
|
Despite the high efficiency at which telomeres are generated from these
mixed-orientation arrays, Southern blot analysis indicates
that their
structure and length regulation is often abnormal.
For example,
telomeres generated from the construct with 16 misoriented
sites and a
single correctly oriented terminal site are slightly
longer on average
and considerably more heterogeneous than telomeres
generated by a
natural TG
1-3 seed sequence alone (Fig.
4B).
Remarkably, the
BglII restriction site between the
incorrectly
and correctly oriented arrays is present in most telomeres
but
displaced slightly towards the proximal end of the array. In one
example (Fig.
4B, clone 3), this movement was more dramatic, and
the
resulting telomeres in this case more closely resemble wild-type
telomeres in average length and distribution. This shortening
of the
internal portion of the telomere array is reminiscent of
the behavior
of the long (32-mer) arrays of 27-bp spacing sites
(Fig.
3) and is
suggestive of a high rate of recombinational rearrangement
not observed
with the correctly oriented 15- and 20-bp spacing
arrays.
Efficient telomere formation by distal misoriented Rap1p binding
sites is associated with array rearrangements.
Taken together, the
results described above suggest that telomere formation might not occur
at all with constructs containing misoriented Rap1p binding sites at
the terminus. We tested this idea and found that it is not true. As
shown in Fig. 4C, several different types of arrays with distal
misoriented sites readily generated stable transformants. Although
these reactions were not as efficient on a per-site basis as arrays
with correctly oriented termini, a clear increase in efficiency was
observed as the numbers of misoriented sites increased.
Surprisingly, none of the telomeres that resulted from these healing
reactions retained the internal
BamHI restriction site
separating the distal misoriented arrays from the proximal, correctly
oriented arrays (see below). One explanation for this result is
that
the external misoriented sites had been lost in the process
of telomere
formation, either by exonucleolytic degradation or
incomplete
replication. However, it is difficult to imagine how
misoriented sites
could contribute to telomere formation if they
are lost in the process.
We therefore considered an alternative
hypothesis, namely that a
recombinational rearrangement of the
mixed arrays occurs at some point
during telomere formation such
that the restriction site between the
two arrays ends up at a
more distal position. This site might then be
lost, either through
normal sequence turnover at the distal end of the
telomere or
through a more directed nucleolytic process (see
Discussion).
A schematic representation of how this might occur is
shown in
Fig.
5, where we consider the
possibility of either intermolecular
reactions between sister
chromatids (Fig.
5A) or intramolecular
events (Fig.
5B).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 5.
Telomere formation by mixed-orientation Rap1p site
arrays occurs through array rearrangement. Models involving
intermolecular (A) or intramolecular (B) recombination pathways that
could explain the role of misoriented terminal Rap1p binding sites in
telomere formation. Open and solid arrowheads in the original
transforming DNA represent correctly oriented and misoriented Rap1p
binding sites, respectively. (C) Experimental evidence that telomere
formation by arrays terminating in misoriented Rap1p binding sites
occurs through a process of array inversion. (Top) Schematic
representation of the healing construct pE373, in which the external
array of misoriented Rap1p binding sites contains an intervening
BglII restriction site (B, BamHI; Bg,
BglII; N, NcoI; S,
SalI). The BamHI and
BglII sites in the control parental vector (pE56)
are shown for reference. (Bottom) Lanes 1 to 10, telomeres from 10 independent Ura+ transformants of pE373 were analyzed by
Southern blotting, after digestion with the indicated enzymes, using a
URA3 probe. Genomic DNA from a transformant with pE56
and digests of pE373 plasmid DNA are shown for size references.
|
|
A key prediction of these recombinational models is that an external
restriction site placed within the misoriented array
(
BglII)
would assume a more internal position after the rearrangement
relative
to the (originally) internal site (
BamHI) separating
the two
arrays. We therefore constructed and tested a healing
substrate of this
type. Southern blot analysis of the telomeres
resulting from this
construct (Fig.
5C) gave a result in striking
accord with the
recombination models outlined above. In all (10
of 10) of the telomeres
analyzed, the (centromere-proximal)
BamHI
site was lost,
despite the fact that in most cases (9 of 10) the
more distal
BglII site, within the misoriented array, was still
present,
at least in a fraction of the telomeres from each culture.
In those
cases where the
BglII site has been lost, it seems likely
that this has occurred through the normal process of sequence
turnover
at the telomere end. Consistent with this interpretation,
those
transformants in which the
BglII site is located in a more
proximal position (Fig.
5C, lanes 1, 4, and 7) display the smallest
fraction of telomeres in which the site is no longer present.
In
summary, these data are thus inconsistent with models in which
the
misoriented sites are lost during the healing process
itself.
Evidence that telomere formation by site rearrangement occurs at a
step following chromosomal integration.
The presumptive
recombination reactions that led to the telomeres shown in Fig. 5C
might have occurred during the transformation process itself, with the
exogenously added DNA serving as the substrate. Alternatively,
rearrangement might proceed following integration of the transforming
DNA into the chromosome, by either sister chromatid interactions (Fig.
5A) or an intrachromatid "loop inversion" reaction (Fig. 5B). To
try to distinguish between these two possibilities, we performed a
cotransformation experiment using the two DNA molecules diagrammed in
Fig. 6B. In this reaction, only one
fragment contains homology to sequences in the host strain (ADH4) and is thus capable of chromosomal integration.
However, this fragment contains only two terminal Rap1p binding sites
and is thus unable to promote efficient telomere formation by itself. The cotransforming DNA, however, contains two correctly oriented Rap1p
sites followed by a long (8-mer) array of misoriented sites that could,
in principle, recombine with the short array on the first fragment to
generate a stable telomere through a mechanism(s) such as those
outlined in Fig. 5. Because the URA3 gene was deleted in the
host strain, this fragment could not form Ura+
colonies through any mechanism involving homologous recombination. As
shown in Fig. 6B, this cotransformation yielded many fewer colonies
(
100-fold less) than the original mixed-array control transformation
(Fig. 6A), suggesting that intermolecular recombination of the
transforming DNA itself is not a major pathway for telomere formation
in this system. Nonetheless, the transformants that were obtained are
likely to have resulted from intermolecular recombination events, since
control transformations with either single molecule failed to yield any
transformants (data not shown). Interestingly, when an array
"donor" containing only misoriented sites fused to the
URA3 gene was used in the cotransformation, no transformants
were obtained (Fig. 6C). This observation suggests that the apposition
of correctly oriented and misoriented sites in a donor molecule (Fig.
6B) may promote the resolution of recombinant molecules into stable
telomeres (see Discussion).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 6.
Telomere formation is not promoted by bimolecular
interactions between transforming DNA molecules containing Rap1p site
arrays. (A) Mixed-orientation construct (similar to that shown in Fig.
5C) and a representative transformation plate (SC-Ura) derived from
this DNA. (B) Two DNA molecules used in a cotransformation assay, the
results of which are shown on the right. (C) Cotransformation similar
to that depicted in panel B but in which the donor DNA molecule
(containing a truncated URA3 gene) lacks an internal
head-to-head arrangement of Rap1p binding sites. See the legend to Fig.
5 for definitions of symbols.
|
|
A RAD52-dependent fusion breakage pathway for
telomere formation from mixed Rap1p binding site arrays.
To
examine the process of telomere formation from these mixed Rap1p
binding site arrays in more detail, we turned to a different assay in
which telomeres are generated at a unique chromosomal break created by
HO endonuclease cleavage (see Materials and Methods). A similar
telomere formation assay has been described recently by Diede and
Gottschling (8). One advantage of the HO cleavage assay
over the transformation system is that a much larger fraction of cells
in the culture undergo telomere formation, owing to the fact that HO
cutting is considerably more efficient than DNA transformation and
subsequent homologous recombination. Consequently, telomere formation
in the HO assay can be examined directly by Southern blotting.
The results of such an assay using a substrate analogous to the
mixed-array molecule described previously are shown in Fig.
7. Several features of this healing
reaction are worth emphasizing.
First, although HO cleavage was
essentially complete by 4 to 6
h (Fig.
7C and data not shown), the
final heterogeneous distribution
of telomere products was not present
in significant amounts until
sometime after 21 h. Second, and of
particular importance here,
is the appearance in the
BstXI-digested samples of a complex set
of bands following
HO cleavage (Fig.
7C). These bands, ranging
in size between

1.1 and 1.3 kb, correspond to the sizes predicted
for the joining of
two chromatids by homologous exchange between
a misoriented and a
correctly oriented array after HO cutting
(Fig.
5A and
7B).
Significantly, these putative recombinant molecules
disappeared as the
final telomere products appeared, strongly
suggesting that they were
intermediates in the telomere formation
process. Supporting this
proposition, we observed the simultaneous
appearance of a novel set of
BstXI-
BglII bands consistent with
homologous
recombination between different arrays at a select
number of registers
within the arrays. As predicted by the proposed
resolution mechanism,
following homologous exchange between arrays,
these
BstXI-
BglII bands persist in the final healed
telomeres.
Also consistent with the recombination models in Fig.
5 is
the
transient appearance of a set of
BamHI sites at
positions corresponding
to the eventual telomere ends (Fig.
7C,
BstXI/
BamHI digest). These
BamHI sites
are predicted to be the sites of a resolution reaction
that generates
an end suitable for telomerase access and proper
end protection (Fig.
5A).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 7.
Telomere formation from mixed-orientation Rap1p site
arrays at a chromosome break: evidence for
RAD52-dependent recombination intermediates. (A)
Schematic representation of the chromosome VII-L telomere in which the
region spanning the MNT2 and ADH4 loci
has been replaced by a DNA fragment containing the URA3
gene, an HO cut site, an array of mixed-orientation Rap1p binding sites
(Fig. 5), and the ADE2 gene. The expected sizes of
BstXI-BamHI,
BstXI-BglII, and BstXI-HO
fragments detected by the 0.5-kb ADE2 probe are
indicated. (B) Schematic representation of predicted
intermediate(s) resulting from head-to-head joining of HO-cut sister
chromatids by homologous recombination within Rap1p site arrays (Fig.
5A). The size range of novel BstXI fragments is
indicated below the diagram. (C) Southern blot analysis of the kinetics
of telomere formation in strain YS293 following galactose induction of
HO for the indicated time (t, in hours). The blot was probed with the
0.5-kb ADE2 fragment indicated in panel A. The asterisk
indicates the BstXI fragment generated following HO
cleavage (the 13-kb BstXI fragment present before HO
cutting is not shown on this blot), the solid arrow shows the position
of the original BstXI-BglII fragment, and
the open arrow indicates the original
BstXI-BamHI fragment. The bracket on the
left indicates the position of a set of BstXI fragments
that arise following HO cutting (see panel B). (D) Southern blot
analysis of chromosome VII-L telomeres from the
rad52::KanMX mutant strain
YS312 (otherwise isogenic to YS293) following galactose induction of
HO, as for panel C.
|
|
An additional advantage of the HO cut assay is that it does not impose
any obvious requirement for recombination. Consistent
with this notion,
telomere formation from HO breaks adjacent to
correctly oriented arrays
of Rap1p binding sites is completely
independent of
RAD52
function (data not shown). Strikingly, however,
telomere formation from
the mixed-orientation Rap1p arrays is
largely blocked by deletion of
RAD52, and none of the purported
intermediates in this
process are detected following HO cleavage
(Fig.
7D). These genetic
data indicate a unique requirement for
recombination in telomere
formation from the mixed arrays and
support our claim that the
molecules observed by Southern blot
analysis during telomere formation
from these substrates are in
fact recombination
intermediates.
 |
DISCUSSION |
We have used synthetic arrays of Rap1p binding sites in
telomere-healing assays to explore the role of Rap1p in de novo
telomere formation and telomere length regulation. Although our results are broadly consistent with a model in which the number of Rap1p molecules bound to the chromosome end serves as a measure of telomere length (34, 46, 48), they also point to special sequence constraints at the very end of the telomere repeat array, apparently unrelated to Rap1p binding, that are critical for normal telomere homeostasis. In the absence of a proper telomere end DNA structure, two
different responses were observed. In one case, a buffer of genuine
TG1-3 was consistently found on telomeres with
abnormally long (but unstable) arrays of Rap1p binding sites.
Remarkably, in cases where mixed-orientation arrays terminated with
misoriented Rap1p binding sites, an active recombinational process,
apparently involving end-to-end fusion and subsequent resolution of
sister chromatids, was able to efficiently restore a proper telomere end structure.
Effect of Rap1p site spacing and orientation on telomere length
sensing.
By varying the total number and spacing between synthetic
Rap1p binding sites in different telomere-healing constructs, we have
been able to test more rigorously the idea that telomeric TG1-3 repeat tract length is sensed and
regulated according to the number of bound Rap1p molecules (34,
45, 46). Telomere length measurements show that for Rap1p
binding site arrays containing up to at least eight sites, and with
site-to-site spacing of 15 and 20, 22, or 27 bp, there is a
quantitative inverse-linear relationship between the number of sites in
an array and the amount of TG1-3 repeat sequence
added by telomerase after transformation and integration. In other
words, the telomere length regulatory mechanism responds to the number
of Rap1p binding sites within the arrays and not to their length per
se, at least over this range of site spacing. Our measured value of the
TG1-3 repeat length equivalent for a single
synthetic Rap1p binding site is approximately 16 to 20 bp, very similar
to the average spacing between Rap1p molecules estimated from in vitro
measurements on genuine telomeric TG1-3 repeat
DNA (11). Finally, we note that the orientation of sites in this range (one to eight sites) had no significant impact on their
ability to be counted. These conclusions are consistent with previous
work in which either 80 or 270 bp of genuine telomere tract DNA or
arrays of six Rap1p binding sites (both either correctly oriented or
misoriented) were examined (34, 45, 46). In the present
study, we found that Rap1p sites within arrays with site spacings of 17 or 31 bp did not effectively contribute to telomere length regulation.
In the former case, poor binding in vitro by Rap1p (data not shown),
probably due to steric hindrance between adjacent sites, could easily
explain the in vivo result. However, the 31-bp spacing arrays bind
Rap1p in vitro with high affinity, so their failure to participate
efficiently in telomere length regulation must be due to some other
sequence feature of these arrays, or perhaps to the rotational
disposition of the Rap1p binding sites. It seems unlikely that the
longer distance between sites is responsible for the loss of function,
since a 6-mer array of Rap1p sites with an even larger spacing (35 bp) contributed normally to telomere length regulation
(46).
Unique properties of the distal ends of telomere arrays: evidence
for a capping function with stringent DNA sequence requirements.
By extending the synthetic Rap1p binding site arrays to include 16 or
32 sites, we discovered a striking difference between the behavior of
the 15- and 20-bp spacing array and the two other well-counted arrays
(22- and 27-bp spacing). In the former case, we consistently observed
efficient formation of normal-length telomeres, where the distal
restriction site at the end of the synthetic array was lost. This
suggests, particularly for the case of the 32-mer, that the synthetic
array had blocked telomerase addition and shortened through a normal
process of sequence turnover involving loss of sites from the end. This
type of gradual end erosion has been observed under several different
circumstances, for example, in the absence of telomerase
(29) or when telomere arrays elongated by temporary
exposure to a rap1-17 mutant background are
allowed to return to normal length in a wild-type cell (22, 33). In contrast, the 16-mer and 32-mer arrays with 22- or 27-bp spacing typically formed abnormally long telomeres (Fig. 3 and data not
shown). Furthermore, even though telomeres formed from the 32-mer array
were often shorter than the original array, they did not appear to have
shortened by sequence loss from the end, since in almost all cases they
had retained the distal restriction site on the original array.
Instead, these elongated telomeres are more likely to have shortened
through a recombinational mechanism such as telomere rapid deletion
(24).
How can one explain this dramatic difference between the 15- and 20-bp
spacing array and the 22- or 27-bp spacing arrays?
Perhaps the simplest
explanation would be that the length-sensing
mechanism breaks down for
the 22- and 27-bp spacing arrays as
their site numbers approach that of
a native telomere. This might
result from physical constraints on a
folded protein-DNA complex
generated by the arrays, Rap1p, and
additional interacting factors
(e.g., the Rif proteins). Even if this
were the case, we note
that the cells would appear to distinguish the
32-mer arrays from
the 16-mers, since they consistently add a smaller
amount of TG
1-3 repeat to the former than to the
latter (data not shown). This
observation suggests that the longer
arrays are sensed as having
more Rap1p binding sites than the shorter
ones but that they may
never be sensed as having either their actual
number of sites
or even the minimal number (

15 or 16 sites) normally
required
for length homeostasis. A second model would hold that the 22-
and 27-bp arrays do not support efficient telomerase addition.
According to this idea, when these sequences are exposed at a
telomere
end, that end will not be able to act as a telomerase
substrate.
Consequently, such telomeres will then undergo a process
of gradual
attrition like that which occurs in mutants lacking
telomerase. This
explanation seems unlikely for several reasons.
First, we do not
observe a subpopulation of telomeres undergoing
gradual shortening (as
is seen in
EST mutants), so one would have
to propose that
such telomeres are unusually unstable. In addition,
we find that the
22- and 27-bp arrays are perfectly competent
in telomere formation in
the absence of a TG
1-3 seed, suggesting
that
they can act as telomerase substrates (Fig.
3, lanes 11 to
14).
A third possible explanation for our observations, which we favor, is
that an end-specific function, not directly related
to Rap1p binding,
is required to properly regulate telomerase
or an essential end
protection function. For example, both Cdc13p
and Tel2p bind
specifically to single-stranded TG-rich telomeric
repeat DNA and are
required for normal telomere length regulation
(
18,
19,
25,
41,
47). Either or both of these proteins
might require a specific
sequence at the end of the telomere array,
not provided by the 22- and
27-bp spacing arrays, in order to
bind or function properly.
Alternatively, the 22- and 27-bp arrays
might fail to form a
specialized DNA structure involving the array
terminus that would be
required for telomerase repression, such
as the t-loop, now observed in
several different organisms (
14,
38,
40). Whatever the
precise mechanism, we propose that exposure
of the 22- or 27-bp spacing
sequences near the telomere end, perhaps
within only the proximal part
of the resected 3' overhang (
56,
57), often results in a
complete loss of telomerase repression
such that additional
TG
1-3 sequences are always rapidly
added. A
mechanism of this sort would explain the presence of
the distal
restriction site and a buffer of TG
1-3 sequence
that is almost always observed beyond the synthetic arrays (Fig.
3).
This proposed end-specific defect of the 22- and 27-bp spacing
arrays
might be related to a phenomenon referred to as telomere
uncapping that
occurs both in
Kluyveromyces lactis and in
S. cerevisiae strains when certain mutated repeat sequences are added
to telomere
ends (
20,
21,
35,
36,
44,
49). Interestingly,
when
wild-type repeats are then added to these mutated ends, telomere
elongation is arrested. However, these capped telomeres do not
return
to their normal length but instead retain the added wild-type
terminal
cap (
21,
49), analogous to the
TG
1-3 sequence
that caps the 22- and 27-bp
arrays in our experiments. The parallel
between these two systems lends
appeal to the capping idea, but
it should be pointed out that the
precise molecular nature of
the proposed cap is still a matter of
speculation (
3). We would
also note that this proposed
special property of the distal end
is perfectly consistent with a model
in which the cell "senses"
telomere length by a mechanism that
measures the number of Rap1p
molecules bound along the complete
TG
1-3 tract. In the model
described here, the
end-specific factor(s) is required to execute
telomerase regulation in
response to a signal generated by array-bound
Rap1p
molecules.
A novel recombinational pathway promoting stable telomere
formation.
We were surprised to observe that distal misoriented
Rap1p binding sites can contribute to the efficiency of telomere
formation, since they are never found at the ends of the resulting
telomeres. One possible scenario to explain this observation would be
that such sites could stabilize the end, through binding of Rap1p or other factors, until their gradual loss would expose a resected G-rich
3' overhang for Cdc13p binding and telomerase loading (10, 25,
41). However, the telomeres that result from these mixed arrays
are clearly generated by a site rearrangement process that requires
RAD52 function (Fig. 7). Direct analysis of this reaction by
Southern blotting strongly suggests that it proceeds through a
transient intermediate involving head-to-head fusion of telomeres on
sister chromatids, presumably through homologous recombination between
their repeat arrays. At present, we cannot distinguish between two
different models for this interchromatid reaction, one involving
homologous exchange and the other based upon a break-induced replication (or break copy duplication) mechanism (32,
37). It is also important to note that we cannot exclude the
possibility that some fraction of the rearrangement events we observe
occur through an intramolecular pathway (Fig. 5B).
A role for recombination in either telomere formation or maintenance in
yeast has been documented in several different contexts,
both in the
presence (
9,
43,
55) and in the absence (
6,
23,
28,
35,
51,
52) of functional telomerase enzyme.
The telomere array
rearrangement that we have described here would
seem to differ from
previously described telomere recombination
reactions in that it
apparently involves a transient, head-to-head
telomere fusion
intermediate. Although we still do not know how
these fusions are
resolved to make a functional telomere, it is
interesting that in a
cotransformation assay with two incomplete
substrates the generation of
telomeres (as measured by Ura
+ transformants)
depended upon the presence of a head-to-head arrangement
of Rap1p sites
on the end donor molecule (compare Fig.
6B to
6C).
Early studies of
telomere formation demonstrated a robust mechanism
for the conversion
of circular plasmids to linear plasmids by
resolution of head-to-head
telomere arrays, possibly through cutting
of a Holiday junction-like
intermediate (
39) (Fig.
5A). A similar
mechanism may thus
play a role in the later stages of telomere
formation by the
mixed-orientation arrays, where the fused chromatids
need to be
resolved (broken apart) to expose an end containing
correctly oriented
Rap1p binding
sites.
As mentioned above, the formation of stable, rearranged telomeres from
the mixed-array substrates is an efficient reaction
in both the
transformation and HO cut assays, in the sense that
individual cells
have a high probability of giving rise to a colony
in which the
majority of cells have a normal telomere structure.
It is interesting
to compare these events to those that allow
for survival of cells
lacking telomerase, a process also dependent
upon recombination. In the
case of telomerase-deficient cells,
senescence is the most common
outcome, with survivors arising
at a very low (and difficult to
measure) frequency (
6,
23,
28,
35,
51,
52). Although the
reason for this difference
is not clear, it might at least in part be
explained by the fact
that telomerase-negative cells need to
successfully repair all
of their 32 telomeres in order to live, whereas
our experiments
require that only a single telomere be healed. Another
possibility,
though, is that native telomere ends, even when shortening
in
the absence of telomerase, are more protected (capped) from
recombination
reactions than are terminal, misoriented Rap1p sites in
telomerase-positive
cells. We clearly need to know more about the
proteins assembled
at these two different types of telomeres before
this issue can
be
resolved.
 |
ACKNOWLEDGMENTS |
We thank Ted Young and Odile Bronchain for their thoughtful
comments on the manuscript, Rodney Rothstein and James Haber for stimulating discussions and useful suggestions, all the members of the
Shore laboratory for their continued help and advice, and Nicolas
Roggli for help with figures and artwork.
This work was supported by grants from the Swiss National Science
Foundation and the Swiss Cancer League and by funds provided by the
Canton of Geneva. A. Bianchi was supported by postdoctoral fellowships
from EMBO and the Human Frontier Science Program.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology, University of Geneva, 30, Quai Ernest-Ansermet, 1211 Geneva 4, Switzerland. Phone: 41-22-702-6183. Fax: 41-22-702-6868. E-mail: David.Shore{at}molbio.unige.ch.
 |
REFERENCES |
| 1.
|
Adams, A.,
D. E. Gottschling,
C. A. Kaiser, and T. Stearns.
1997.
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 2.
|
Bilaud, T.,
C. E. Koering,
E. Binet-Brasselet,
K. Ancelin,
A. Pollice,
S. M. Gasser, and E. Gilson.
1996.
The telobox, a Myb-related telomeric DNA binding motif found in proteins from yeast, plants and human.
Nucleic Acids Res.
24:1294-1303[Abstract/Free Full Text].
|
| 3.
|
Blackburn, E. H.
2000.
Telomere states and cell fates.
Nature
408:53-56[CrossRef][Medline].
|
| 4.
|
Broccoli, D.,
A. Smogorzewska,
L. Chong, and T. de Lange.
1997.
Human telomeres contain two distinct Myb-related proteins, TRF1 and TRF2.
Nat. Genet.
17:231-235[CrossRef][Medline].
|
| 5.
|
Buchman, A. R.,
W. J. Kimmerly,
J. Rine, and R. D. Kornberg.
1988.
Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae.
Mol. Cell. Biol.
8:210-225[Abstract/Free Full Text].
|
| 6.
|
Chen, Q.,
A. Ijpma, and C. W. Greider.
2001.
Two survivor pathways that allow growth in the absence of telomerase are generated by distinct telomere recombination events.
Mol. Cell. Biol.
21:1819-1827[Abstract/Free Full Text].
|
| 7.
|
Chong, L.,
B. van Steensel,
D. Broccoli,
H. Erdjument-Bromage,
J. Hanish,
P. Tempst, and T. de Lange.
1995.
A human telomeric protein.
Science
270:1663-1667[Abstract/Free Full Text].
|
| 8.
|
Diede, S. J., and D. E. Gottschling.
1999.
Telomerase-mediated telomere addition in vivo requires DNA primase and DNA polymerases alpha and delta.
Cell
99:723-733[CrossRef][Medline].
|
| 9.
|
Dunn, B.,
P. Szauter,
M. L. Pardue, and J. W. Szostak.
1984.
Transfer of yeast telomeres to linear plasmids by recombination.
Cell
39:191-201[CrossRef][Medline].
|
| 10.
|
Evans, S. K., and V. Lundblad.
1999.
Est1 and Cdc13 as comediators of telomerase access.
Science
286:117-120[Abstract/Free Full Text].
|
| 11.
|
Gilson, E.,
M. Roberge,
R. Giraldo,
D. Rhodes, and S. M. Gasser.
1993.
Distortion of the DNA double helix by RAP1 at silencers and multiple telomeric binding sites.
J. Mol. Biol.
231:293-310[CrossRef][Medline].
|
| 12.
|
Gottschling, D. E.,
O. M. Aparicio,
B. L. Billington, and V. A. Zakian.
1990.
Position effect at S. cerevisiae telomeres: reversible repression of Pol II transcription.
Cell
63:751-762[CrossRef][Medline].
|
| 13.
|
Graham, I. R., and A. Chambers.
1994.
Use of a selection technique to identify the diversity of binding sites for the yeast rap1 transcription factor.
Nucleic Acids Res.
22:124-130[Abstract/Free Full Text].
|
| 14.
|
Griffith, J. D.,
L. Comeau,
S. Rosenfield,
R. M. Stansel,
A. Bianchi,
H. Moss, and T. de Lange.
1999.
Mammalian telomeres end in a large duplex loop.
Cell
97:503-514[CrossRef][Medline].
|
| 15.
|
Hardy, C. F. J.,
L. Sussel, and D. Shore.
1992.
A RAP1-interacting protein involved in silencing and telomere length regulation.
Genes Dev.
6:801-814[Abstract/Free Full Text].
|
| 16.
|
Konig, P.,
L. Fairall, and D. Rhodes.
1998.
Sequence-specific DNA recognition by the myb-like domain of the human telomere binding protein TRF1: a model for the protein-DNA complex.
Nucleic Acids Res.
26:1731-1740[Abstract/Free Full Text].
|
| 17.
|
Konig, P.,
R. Giraldo,
L. Chapman, and D. Rhodes.
1996.
The crystal structure of the DNA-binding domain of yeast RAP1 in complex with telomeric DNA.
Cell
85:125-136[CrossRef][Medline].
|
| 18.
|
Kota, R. S., and K. W. Runge.
1999.
Tel2p, a regulator of yeast telomeric length in vivo, binds to single-stranded telomeric DNA in vitro.
Chromosoma
108:278-290[CrossRef][Medline].
|
| 19.
|
Kota, R. S., and K. W. Runge.
1998.
The yeast telomere length regulator TEL2 encodes a protein that binds to telomeric DNA.
Nucleic Acids Res.
26:1528-1535[Abstract/Free Full Text].
|
| 20.
|
Krauskopf, A., and E. H. Blackburn.
1996.
Control of telomere growth by interactions of RAP1 with the most distal telomeric repeats.
Nature
383:354-357[CrossRef][Medline].
|
| 21.
|
Krauskopf, A., and E. H. Blackburn.
1998.
Rap1 protein regulates telomere turnover in yeast.
Proc. Natl. Acad. Sci. USA
95:12486-12491[Abstract/Free Full Text].
|
| 22.
|
Kyrion, G.,
K. A. Boakye, and A. J. Lustig.
1992.
C-terminal truncation of RAP1 results in the deregulation of telomere size, stability, and function in Saccharomyces cerevisiae.
Mol. Cell. Biol.
12:5159-5173[Abstract/Free Full Text].
|
| 23.
|
Le, S.,
J. K. Moore,
J. E. Haber, and C. W. Greider.
1999.
RAD50 and RAD51 define two pathways that collaborate to maintain telomeres in the absence of telomerase.
Genetics
152:143-152[Abstract/Free Full Text].
|
| 24.
|
Li, B., and A. J. Lustig.
1996.
A novel mechanism for telomere size control in Saccharomyces cerevisiae.
Genes Dev.
10:1310-1326[Abstract/Free Full Text].
|
| 25.
|
Lin, J. J., and V. A. Zakian.
1996.
The Saccharomyces CDC13 protein is a single-strand TG1-3 telomeric DNA-binding protein in vitro that affects telomere behavior in vivo.
Proc. Natl. Acad. Sci. USA
93:13760-13765[Abstract/Free Full Text].
|
| 26.
|
Longtine, M. S.,
N. M. Wilson,
M. E. Petracek, and J. Berman.
1989.
A yeast telomere binding activity binds to two related telomere sequence motifs and is indistinguishable from RAP1.
Curr. Genet.
16:225-239[CrossRef][Medline].
|
| 27.
|
Lundblad, V.
2000.
DNA ends: maintenance of chromosome termini versus repair of double strand breaks.
Mutat. Res.
451:227-240[Medline].
|
| 28.
|
Lundblad, V., and E. H. Blackburn.
1993.
An alternative pathway for yeast telomere maintenance rescues est1- senescence.
Cell
73:347-360[CrossRef][Medline].
|
| 29.
|
Lundblad, V., and J. W. Szostak.
1989.
A mutant with a defect in telomere elongation leads to senescence in yeast.
Cell
57:633-643[CrossRef][Medline].
|
| 30.
|
Lustig, A. J.
1992.
Hoogsteen G-G base pairing is dispensable for telomere healing in yeast.
Nucleic Acids Res.
20:3021-3028[Abstract/Free Full Text].
|
| 31.
|
Lustig, A. J.,
S. Kurtz, and D. Shore.
1990.
Involvement of the silencer and UAS binding protein RAP1 in regulation of telomere length.
Science
250:549-553[Abstract/Free Full Text].
|
| 32.
|
Malkova, A.,
E. L. Ivanov, and J. E. Haber.
1996.
Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced DNA replication.
Proc. Natl. Acad. Sci. USA
93:7131-7136[Abstract/Free Full Text].
|
| 33.
|
Marcand, S.,
V. Brevet, and E. Gilson.
1999.
Progressive cis-inhibition of telomerase upon telomere elongation.
EMBO J.
18:3509-3519[CrossRef][Medline].
|
| 34.
|
Marcand, S.,
E. Gilson, and D. Shore.
1997.
A protein-counting mechanism for telomere length regulation in yeast.
Science
275:986-990[Abstract/Free Full Text].
|
| 35.
|
McEachern, M. J., and E. H. Blackburn.
1996.
Cap-prevented recombination between terminal telomeric repeat arrays (telomere CPR) maintains telomeres in Kluyveromyces lactis lacking telomerase.
Genes Dev.
10:1822-1834[Abstract/Free Full Text].
|
| 36.
|
McEachern, M. J., and E. H. Blackburn.
1995.
Runaway telomere elongation caused by telomerase RNA gene mutations.
Nature
376:403-409[CrossRef][Medline].
|
| 37.
|
Morrow, D. M.,
C. Connelly, and P. Hieter.
1997.
"Break copy" duplication: a model for chromosome fragment formation in Saccharomyces cerevisiae.
Genetics
147:371-382[Abstract].
|
| 38.
|
Munoz-Jordan, J. L.,
G. A. Cross,
T. Lange, and J. D. Griffith.
2001.
t-loops at trypanosome telomeres.
EMBO J.
20:579-588[CrossRef][Medline].
|
| 39.
|
Murray, A. W.,
T. E. Claus, and J. W. Szostak.
1988.
Characterization of two telomeric DNA processing reactions in Saccharomyces cerevisiae.
Mol. Cell. Biol.
8:4642-4650[Abstract/Free Full Text].
|
| 40.
|
Murti, K. G., and D. M. Prescott.
1999.
Telomeres of polytene chromosomes in a ciliated protozoan terminate in duplex DNA loops.
Proc. Natl. Acad. Sci. USA
96:14436-14439[Abstract/Free Full Text].
|
| 41.
|
Nugent, C. I.,
T. R. Hughes,
N. F. Lue, and V. Lundblad.
1996.
Cdc13p: a single-strand telomeric DNA-binding protein with a dual role in yeast telomere maintenance.
Science
274:249-252[Abstract/Free Full Text].
|
| 42.
|
Nugent, C. I., and V. Lundblad.
1998.
The telomerase reverse transcriptase: components and regulation.
Genes Dev.
12:1073-1085[Free Full Text].
|
| 43.
|
Pluta, A. F., and V. A. Zakian.
1989.
Recombination occurs during telomere formation in yeast.
Nature
337:429-433[CrossRef][Medline].
|
| 44.
|
Prescott, J. C., and E. H. Blackburn.
2000.
Telomerase RNA template mutations reveal sequence-specific requirements for the activation and repression of telomerase action at telomeres.
Mol. Cell. Biol.
20:2941-2948[Abstract/Free Full Text].
|
| 45.
|
Ray, A., and K. W. Runge.
1998.
The C terminus of the major yeast telomere binding protein Rap1p enhances telomere formation.
Mol. Cell. Biol.
18:1284-1295[Abstract/Free Full Text].
|
| 46.
|
Ray, A., and K. W. Runge.
1999.
The yeast telomere length counting machinery is sensitive to sequences at the telomere-nontelomere junction.
Mol. Cell. Biol.
19:31-45[Abstract/Free Full Text].
|
| 47.
|
Runge, K. W., and V. A. Zakian.
1996.
TEL2, an essential gene required for telomere length regulation and telomere position effect in Saccharomyces cerevisiae.
Mol. Cell. Biol.
16:3094-3105[Abstract].
|
| 48.
|
Shore, D.
1997.
Telomere length regulation: getting the measure of chromosome ends.
Biol. Chem.
378:591-597.
|
| 49.
|
Smith, C. D., and E. H. Blackburn.
1999.
Uncapping and deregulation of telomeres lead to detrimental cellular consequences in yeast.
J. Cell Biol.
145:203-214[Abstract/Free Full Text].
|
| 50.
|
Smogorzewska, A.,
B. van Steensel,
A. Bianchi,
S. Oelmann,
M. R. Schaefer,
G. Schnapp, and T. de Lange.
2000.
Control of human telomere length by TRF1 and TRF2.
Mol. Cell. Biol.
20:1659-1668[Abstract/Free Full Text].
|
| 51.
|
Teng, S.,
J. Chang,
B. McCowan, and V. A. Zakian.
2000.
Telomerase-independent lengthening of yeast telomeres occurs by an abrupt Rad50p-dependent, Rif-inhibited recombinational process.
Mol. Cell
6:947-952[CrossRef][Medline].
|
| 52.
|
Teng, S. C., and V. A. Zakian.
1999.
Telomere-telomere recombination is an efficient bypass pathway for telomere maintenance in Saccharomyces cerevisiae.
Mol. Cell. Biol.
19:8083-8093[Abstract/Free Full Text].
|
| 53.
|
Thomas, B. J., and R. Rothstein.
1989.
The genetic control of direct-repeat recombination in Saccharomyces: the effect of rad52 and rad1 on mitotic recombination at GAL10, a transcriptionally regulated gene.
Genetics
123:725-738[Abstract/Free Full Text].
|
| 54.
|
van Steensel, B., and T. de Lange.
1997.
Control of telomere length by the human telomeric protein TRF1.
Nature
385:740-743[CrossRef][Medline].
|
| 55.
|
Wang, S. S., and V. A. Zakian.
1990.
Telomere-telomere recombination provides an express pathway for telomere acquisition.
Nature
345:456-458[CrossRef][Medline].
|
| 56.
|
Wellinger, R. J.,
K. Ethier,
P. Labrecque, and V. A. Zakian.
1996.
Evidence for a new step in telomere maintenance.
Cell
85:423-433[CrossRef][Medline].
|
| 57.
|
Wellinger, R. J.,
A. J. Wolf, and V. A. Zakian.
1993.
Saccharomyces telomeres acquire single-strand TG1-3 tails late in S phase.
Cell
72:51-60[CrossRef][Medline].
|
| 58.
|
Wotton, D., and D. Shore.
1997.
A novel Rap1p-interacting factor, Rif2p, cooperates with Rif1p to regulate telomere length in Saccharomyces cerevisiae.
Genes Dev.
11:748-760[Abstract/Free Full Text].
|
Molecular and Cellular Biology, December 2001, p. 8117-8128, Vol. 21, No. 23
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.23.8117-8128.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bechard, L. H., Butuner, B. D., Peterson, G. J., McRae, W., Topcu, Z., McEachern, M. J.
(2009). Mutant Telomeric Repeats in Yeast Can Disrupt the Negative Regulation of Recombination-Mediated Telomere Maintenance and Create an Alternative Lengthening of Telomeres-Like Phenotype. Mol. Cell. Biol.
29: 626-639
[Abstract]
[Full Text]
-
Negrini, S., Ribaud, V., Bianchi, A., Shore, D.
(2007). DNA breaks are masked by multiple Rap1 binding in yeast: implications for telomere capping and telomerase regulation. Genes Dev.
21: 292-302
[Abstract]
[Full Text]
-
Levy, D. L., Blackburn, E. H.
(2004). Counting of Rif1p and Rif2p on Saccharomyces cerevisiae Telomeres Regulates Telomere Length. Mol. Cell. Biol.
24: 10857-10867
[Abstract]
[Full Text]
-
Kim, S.-h., Beausejour, C., Davalos, A. R., Kaminker, P., Heo, S.-J., Campisi, J.
(2004). TIN2 Mediates Functions of TRF2 at Human Telomeres. J. Biol. Chem.
279: 43799-43804
[Abstract]
[Full Text]
-
Grossi, S., Puglisi, A., Dmitriev, P. V., Lopes, M., Shore, D.
(2004). Pol12, the B subunit of DNA polymerase {alpha}, functions in both telomere capping and length regulation. Genes Dev.
18: 992-1006
[Abstract]
[Full Text]
-
Underwood, D. H., Carroll, C., McEachern, M. J.
(2004). Genetic Dissection of the Kluyveromyces lactis Telomere and Evidence for Telomere Capping Defects in TER1 Mutants with Long Telomeres. Eukaryot Cell
3: 369-384
[Abstract]
[Full Text]