MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, J.
Right arrow Articles by Liu, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, J.
Right arrow Articles by Liu, Y.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, December 2001, p. 8213-8224, Vol. 21, No. 23
0270-7306/01/$04.00+0   DOI: 10.1128/MCB.21.23.8213-8224.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Transcriptional Induction of MKP-1 in Response to Stress Is Associated with Histone H3 Phosphorylation-Acetylation

Ji Li,1 Myriam Gorospe,1 Dorothy Hutter,1,dagger Janice Barnes,1 Stephen M. Keyse,2 and Yusen Liu1,*

Laboratory of Cellular and Molecular Biology, National Institute on Aging-Intramural Research Program, National Institutes of Health, Baltimore, Maryland 21224,1 and ICRF Molecular Pharmacology Unit, Biomedical Research Centre, Ninewells Hospital, Dundee, United Kingdom2

Received 13 August 2001/Accepted 7 September 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Mitogen-activated protein (MAP) kinase phosphatase 1 (MKP-1) has been shown to play a critical role in mediating the feedback control of MAP kinase cascades in a variety of cellular processes, including proliferation and stress responsiveness. Although MKP-1 expression is induced by a broad array of extracellular stimuli, the mechanisms mediating its induction remain poorly understood. Here we show that MKP-1 mRNA was potently induced by arsenite and ultraviolet light and modestly increased by heat shock and hydrogen peroxide. Interestingly, arsenite also dramatically induces phosphorylation-acetylation of histone H3 at a global level which precedes the induction of MKP-1 mRNA. The transcriptional induction of MKP-1, histone H3 modification, and elevation in MKP-1 mRNA in response to arsenite are all partially prevented by the p38 MAP kinase inhibitor SB203580, suggesting that the p38 pathway is involved in these processes. Finally, analysis of the DNA brought down by chromatin immunoprecipitation (ChIP) reveals that arsenite induces phosphorylation-acetylation of histone H3 associated with the MKP-1 gene and enhances binding of RNA polymerase II to MKP-1 chromatin. ChIP assays following exposure to other stress agents reveal various degrees of histone H3 modification at the MKP-1 chromatin. The differential contribution of p38 and ERK MAP kinases in mediating MKP-1 induction by different stress agents further illustrates the complexity and versatility of stress-induced MKP-1 expression. Our results strongly suggest that chromatin remodeling after stress contributes to the transcriptional induction of MKP-1.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The mitogen-activated protein (MAP) kinases play a central role in orchestrating many short- and long-term changes in the cell in response to extracellular stimuli (50). To date, three major MAP kinase subfamilies have been well characterized in mammalian cells: the extracellular signal-regulated kinase (ERK), the c-Jun N-terminal kinases/stress-activated protein kinase (JNK/SAPK), and p38 (11, 40, 50). Thus far, numerous proteins with a wide spectrum of biological functions have been identified as the targets of MAP kinase cascades, including protein kinases, cytoskeletal components, phospholipase A2, stalhmin, and the Na+/H+ antipump NHE1 (6, 23, 42). In addition to the proteins that function on the membrane or in the cytoplasm, MAP kinases also play a crucial role in regulating gene transcription. Upon activation, MAP kinases translocate from the cytoplasm to the nucleus, where they phosphorylate and activate a multitude of transcription factors, including c-Myc, c-Jun, c-Fos, Elk-1, and ATF-2, ultimately resulting in enhanced gene transcription (8, 24, 58). The fact that a broad variety of extracellular signals conscript MAP kinase cascades to convey their specific messages suggests that MAP kinase cascades serve a myriad of purposes and the cascades need to be tightly controlled.

The activities of all MAP kinases are regulated through reversible phosphorylation of two different amino acid residues (threonine and tyrosine) in the Thr-Xaa-Tyr signature motifs in their kinase subdomain VIII, where Xaa represents a characteristic of each MAP kinase subfamily (11, 40, 50). Activation of MAP kinases is catalyzed by their cognate dual-specificity MAP kinase kinases, whereas inactivation is primarily achieved by a group of MAP kinase phosphatases (MKPs) (9, 34). So far, 10 MKP family members have been cloned, and some of them are encoded by immediate-early genes, such as MKP-1, MKP-2, PAC-1, and B23 (1, 35, 51, 55, 60). Since these proteins are localized in the nucleus and their expression can be induced by conditions that also activate MAP kinases, they are believed to play an important role in the attenuation of MAP kinase-mediated gene transcription (55, 60).

MKP-1, also referred to as 3CH134, CL100, or ERP, is the archetype of the MKP family (14, 35, 46, 55). In a number of systems, it has been demonstrated that the induction of MKP-1 is concomitant with the inactivation of MAP kinases (43, 49, 55). Both in vitro and in vivo MKP-1 is able to interact with and effectively inhibit members of all three MAP kinase subfamilies (8, 32, 53, 55). Recent studies have demonstrated that MKP-1 protein can be stabilized by ERK-mediated phosphorylation (7) and that the catalytic activity of MKP-1 can also be stimulated through substrate binding (32, 53). These findings indicate that the activity of MKP-1 is controlled through multiple mechanisms involving both transcriptional and posttranslational regulation.

Although the induction of MKP-1 expression by a broad variety of extracellular stimuli has been well documented (14, 34, 35, 39, 43, 46, 63), the underlying mechanisms regulating MKP-1 expression remain unclear. In this report, we studied the mechanisms involved in MKP-1 induction by a number of stresses, including ultraviolet light (UVC), H2O2, heat shock, and the tumor promoter arsenite. We found that MKP-1 mRNA is potently induced by arsenite and UVC and modestly increased by heat shock and H2O2. Arsenite and to a lesser extent UVC, also stimulated the activity of a 3-kbp MKP-1 promoter. We demonstrated that MKP-1 induction by arsenite and UVC was primarily mediated through the p38 MAP kinase cascade while the ERK pathway played a predominant role in mediating MKP-1 induction by heat shock and H2O2. We further found that arsenite induced the phosphorylation and acetylation of histone H3 which preceded MKP-1 induction. Treatment with the deacetylase inhibitor trichostatin A (TSA) increased basal MKP-1 expression and augmented arsenite-induced MKP-1 transcription. Finally, we demonstrated that arsenite induced the phosphorylation-acetylation of histone H3 on the MKP-1 chromatin and increased the association of RNA polymerase II with the MKP-1 gene. Enhanced histone H3 phosphorylation-acetylation of the MKP-1 chromatin is also observed in cells treated with UVC and H2O2. Our results suggest that chromatin remodeling after stress may play an important role in MKP-1 transcriptional activation.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cell culture, transfection, and treatments. Mouse C3H 10T1/2 cells (American Type Culture Collection) were cultured in minimum essential medium (Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal bovine serum (FBS) (HyClone, Logan, Utah). Transfection of C3H 10T1/2 cells was performed using Fugene 6 reagent (Roche Molecular Biochemicals, Indianapolis, Ind.) according to the manufacturer's specifications. Subconfluent cultures were rendered quiescent by serum starvation in minimal essential medium containing 0.5% FBS for 36 h prior to treatment. Treatment of the cells with UVC was performed as previously described (43). Heat shock treatment was carried out by switching to medium that was preheated to 42°C and incubating the cells in a 42°C chamber. Arsenite, H2O2, and TSA were directly added to the culture medium. U0126 (Promega, Madison, Wis.) and SB203580 (Sigma, St. Louis, Mo.), dissolved in dimethyl sulfoxide, were added to the medium to a final concentration of 10 µM 15 min prior to treatments.

MKP-1 promoter-luciferase reporter assays. To generate the MKP-1-Luc reporter construct (see Fig. 1B), a 3.2-kbp NcoI fragment from human MKP-1 genomic DNA was cloned into the luciferase reporter vector pGL3-Enhancer (Promega) using standard techniques. This MKP-1 genomic fragment spans positions -2975 to +247 (where position +1 refers to the transcription initiation site) of the human MKP-1 gene (27). The MKP-1-Luc reporter construct together with pCH110 (SV40-lacZ) (Promega) were transiently transfected into C3H 10T1/2 cells. To establish cells stably carrying the MKP-1-Luc reporter, the reporter together with pcDNA3 (Invitrogen, Carlsbad, Calif.) was transfected into C3H 10T1/2 cells. After transfection, cells were selected in medium containing 500 µg of G418 per ml for 2 weeks. The resulting stable clones were pooled and maintained in medium containing 150 µg of G418 per ml. After arsenite or H2O2 treatment, the medium was removed and replaced with fresh medium containing 0.5% FBS. Six hours later, cells were harvested and luciferase activity was measured as previously described (43). beta -Galactosidase activity was measured with a Galacto-Light kit (Tropix, Applied Biosystems, Bedford, Mass.) after the cell extract was heated at 48°C for 1 h to denature the endogenous enzyme. Luciferase activity was normalized to beta -galactosidase values in transient-transfection assays and expressed in relative light units.

Western blot analysis and indirect immunofluorescence. To detect the modification of histone H3, crude histone proteins were extracted using sulfuric acid according to the procedures described by Cheung et al. (18). Samples were resolved on 12% NuPAGE gels (Invitrogen) using MES (morpholineethanesulfonic acid) buffer. To analyze the phosphorylation status of p38 or p44/p42 ERK, whole-cell lysates containing 20 µg of protein were resolved on a 10% NuPAGE gel using MOPS (morpholinepropanesulfonic acid) buffer. Immunoblotting was performed as described previously (16). Rabbit polyclonal antibodies against phospho-p38, total p38, phospho-p44/p42 ERK MAP kinases, phospho-histone H3 (Ser-10), and total histone H3 were purchased from Cell Signaling (Beverly, Mass.). Rabbit polyclonal antibodies recognizing phosphoacetyl-histone H3 (Ser-10, Lys-14) and acetyl-histone H3 (Lys-14) were purchased from Upstate Biotechnology (Lake Placid, N.Y.). Mouse monoclonal antibody against p44/p42 ERK was purchased from Transduction Laboratories (Lexington, Ky.).

In the immunofluorescence studies, Alexa 488-conjugated goat anti-rabbit and Alexa 568-conjugated goat anti-mouse secondary antibodies (Molecular Probes, Eugene, Oreg.) were used according to the manufacturer's protocols. Phospho-histone H3 was detected using a rabbit polyclonal antibody specific to Ser-10 phosphorylated histone H3 (Cell Signaling). Total histone H3 was detected using a mouse monoclonal antibody recognizing both phosphorylated and unphosphorylated histone H3 (a generous gift from William M. James, Intergen Discovery Products, Gaithersburg, Md.) (52). DAPI (4',6'-diamidino-2-phenylindole) staining was performed as previously described (15). Samples were visualized by either fluorescence microscopy (Carl Zeiss, Thornwood, N.Y.) or confocal microscopy (Zeiss LSM-410 inverted confocal microscope equipped with a 63× NA 1.4 oil immersion objective). The confocal pinhole was set to obtain a spatial resolution of 0.4 µm in the horizontal plane and 1 µm in the axial dimension. Image processing and presentation were done using MataMorph 4.6.3 software (Universal Imaging, Inc., West Chester, Pa.).

MSK1 activity assay. The activity of MSK1 in cell lysates was assayed essentially as previously described by Deak et al. (25). Briefly, MSK1 was first immunoprecipitated from the cell lysates (1.6 mg of protein per sample) using a sheep polyclonal antibody (Upstate Biotechnology), extensively washed, and incubated at 30°C for 30 min in a 50-µl reaction volume containing 50 mM Tris-HCl (pH 7.5), 0.1 mM EGTA, 13 mM beta -mercaptoethanol, 10 mM MgCl2, 10 µM protein kinase A inhibitor (Sigma), 1 µM microcystin-LR, 20 µM ATP, 10 µCi of [gamma -32P]ATP, and 30 µM Crosstide (GRPRTSSFAEG) (Upstate Biotechnology). After termination of the kinase reaction, 10 µl of the reaction solution was loaded onto a SpinZyme phosphocellulose unit (Pierce, Rockford, Ill.). The phosphocellulose unit was washed four times with 150 mM phosphoric acid, and incorporation of 32P into the peptide was determined by liquid scintillation counting.

Northern blot analysis. Total RNA was isolated with STAT-60 (Tel-Test B, Friendswood, Tex.). Northern blot analysis was performed as described previously (43). MKP-1 and c-fos mRNAs were detected using mouse MKP-1 and rat c-fos cDNA, respectively, as probes (21, 55). The mRNAs encoding beta -actin and beta -globin were detected using cDNA fragments from mouse EST clones (AA726293 and AI596092, respectively) as probes.

ChIP and PCR analysis. Chromatin was cross-linked using formaldehyde, broken down to an average size of ~2 kbp through brief sonication as described by Clayton et al. (20), and dissolved in radioimmunoprecipitation assay (RIPA) buffer (10 mM Tris-HCl [pH 8.0], 1% Triton X-100, 0.1% sodium dodecyl sulfate, 0.1% sodium deoxycholate, 1 mM EDTA, 0.5 mM EGTA, 140 mM NaCl, 10 mM sodium butyrate, 20 mM beta -glycerophosphate, 100 µM sodium orthovanadate, 2 µM leupeptin, 2 µM pepstatin A, and 1 mM phenylmethylsulfonyl fluoride [PMSF]). The resulting chromatin solution was divided equally for isolating input DNA and performing chromatin immunoprecipitation (ChIP) assays. Chromatin solutions were first incubated for 2 h at 4°C with 10 µl of rabbit preimmune serum 10 µl of purified antibody either specifically against phospho-histone H3 (Ser-10) (Cell Signaling) or specifically recognizing phosphoacetyl-histone H3 (Ser-10, Lys-14) (Upstate Biotechnology), or 10 µl of antiserum against RNA polymerase II (a generous gift from Michael Dahmus). Then bovine serum albumin (final concentration, 200 µg/ml), sonicated lambda  phage DNA (5 µg), and protein A-Sepharose beads (Pharmacia, Piscataway, N.J.) were added to the solutions and incubated overnight with gentle rotation at 4°C. The beads were washed three times with RIPA buffer, three times with RIPA buffer containing 500 mM NaCl, three times with washing buffer (10 mM Tris-HCl [pH 8.0], 0.25 M LiCl, 1 mM EDTA, 1 mM EGTA, 1% NP-40, 1% sodium deoxycholate, 20 mM beta -glycerophosphate, 10 mM sodium butyrate, 100 µM sodium orthovanadate, 2 µM leupeptin, 2 µM pepstatin A, and 1 mM PMSF), three times with buffer A (10 mM Tris-HCl [pH 7.5], 1 mM EDTA, 10 mM sodium butyrate, 20 mM beta -glycerophosphate, 2 µM leupeptin, 2 µM pepstatin A, and 1 mM PMSF), and twice with buffer B (10 mM Tris-HCl [pH 7.5], 1 mM EDTA, 10 mM sodium butyrate, 20 mM beta -glycerophosphate). The beads were first treated with RNase A (50 µg/ml) for 1 h at 37°C and then with proteinase K (100 µg/ml) overnight. The input and immunoprecipitated chromatins were incubated at 65°C for >= 6 h to reverse the formaldehyde cross-links. The DNA was extracted with pheno-chloroform, precipitated with ethanol, and dissolved in water.

A pair of primers (TCAGCGGGGAGTTTTTGTG and CTGTGAGTGACCCTCAAAGTGG) was synthesized according to the sequence of the mouse MKP-1 gene. With these primers, a 229-bp fragment that covers part of the second intron and third exon of the mouse MKP-1 gene (46) can be amplified by PCR using mouse genomic DNA as a template. The primer pair CACGGCCGGTCCCTGTTGTTC and GTCGCGGTTGGAGTAGTAGGCG was used to amplify a 287-bp fragment of the c-fos promoter (18) using PCR. The beta -actin primer pair AACACCCCAGCCATGTACG and ATGTCACGCACGATTTCCC (254-bp product) and the beta -globin primer pair CAGTGAGTGGCACAGCATCC and CAGTCAGGTGCACCATGA TGT (247-bp product) were used in PCRs to amplify the respective sequences. For quantification, primers were end labeled with [gamma -32P]ATP using T4 polynucleotide kinase and purified according to standard procedures. PCR amplification was carried out using the following parameters: 5 min at 94°C followed by 29 to 34 cycles of denaturation (94°C for 30 s), annealing (for 30 s, temperature optimized for each primer pair), and extension (72°C for 30 s) and an additional 10-min extension period after the final cycle. PCR products were resolved on 10% polyacrylamide-Tris-borate-EDTA gels and quantified using a PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.).


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Induction of MKP-1 in mouse embryo fibroblasts. MKP-1 expression in C3H 10T1/2 mouse embryo fibroblasts following treatment with various stresses was investigated by Northern blotting. While basal MKP-1 mRNA levels were very low, arsenite treatment resulted in a potent increase in MKP-1 mRNA abundance. Exposure to short-wavelength UVC also resulted in a strong induction of MKP-1 mRNA. Consistent with a previous report (35), MKP-1 mRNA was induced by both heat shock and H2O2, although the magnitude of induction was lower than that seen following arsenite treatment (Fig. 1A). The induction of MKP-1 mRNA by each of these treatments was strictly time dependent (Fig. 1A).


View larger version (23K):
[in this window]
[in a new window]
  		FIG. 1.   Induction of MKP-1 expression in C3H 10T1/2 cells by different stresses. (A) Time course of MKP-1 mRNA induction by arsenite (400 µM), UVC (20 J/m2), heat shock (42°C), and H2O2 (400 µM). MKP-1 mRNA expression was assessed by Northern blotting using total RNA. RNA loading was indicated by 18S rRNA. (B) Diagram of the MKP-1-Luc reporter. UTR, untranslated region; SV40, simian virus 40. (C) Activation of the MKP-1-Luc reporter in response to different treatments in C3H 10T1/2 cells transiently transfected with 10 µg of the luciferase reporter together with 2 µg of pCH110 (SV40-lacZ). Luciferase activity was normalized to beta -galactosidase measurements and expressed in relative light units (RLU). (D) Activation of the luciferase reporter in transfected cells that stably expressed the MKP-1-Luc construct. For the luciferase assays, cells were either heat shocked at 42°C for 45 min, treated for 3 h with either 100 µM arsenite or 200 µM H2O2, or irradiated with UVC (10 J/m2). Data in panels C and D are means plus standard errors of the means from three independent experiments.

To examine whether MKP-1 induction was mediated through enhanced transcription, a luciferase reporter construct was generated using a human MKP-1 genomic DNA fragment spanning nucleotides -2975 to +247, where nucleotide +1 is the transcription start site (Fig. 1B). This reporter was transiently transfected into C3H 10T1/2 cells, and luciferase activity was assayed after treatment of cells with arsenite, H2O2, heat shock, or UVC. To our surprise, none of these treatments had an appreciable effect on MKP-1-Luc reporter activity in the transient-transfection assays (Fig. 1C). However, when the construct was stably integrated into C3H 10T1/2 cells, treatment of the pooled cells with 100 µM arsenite for 3 h resulted in a six-fold increase in MKP-1 promoter activity (Fig. 1D). UVC irradiation also modestly enhanced MKP-1-Luc reporter activity. In contrast, neither heat shock nor H2O2 had a significant effect on the activity of the ectopic MKP-1 promoter (Fig. 1D).

Both p38 and ERK are implicated in the transcriptional induction of MKP-1. To investigate the role of MAP kinase pathways in the transcriptional induction of MKP-1, the effects of the MEK1/2 inhibitor U0126 and the p38 inhibitor SB203580 on MKP-1 expression were examined. Northern blot analysis indicated that SB203580 substantially inhibited MKP-1 mRNA induction by arsenite, reducing the MKP-1 mRNA level by more than 70%. In contrast, the MEK inhibitor U0126 had no significant effect on MKP-1 mRNA induction by arsenite (Fig. 2A). Likewise, SB203580, but not U0126, significantly attenuated MKP-1 mRNA induction by UVC (Fig. 2A). Interestingly, U0126 significantly inhibited MKP-1 induction by both heat shock and H2O2, while SB203580 had little inhibitory effect on MKP-1 induction by these treatments (Fig. 2A). Further evidence that p38 regulates the transcriptional induction of MKP-1 by arsenite was obtained in assays showing SB203580-mediated inhibition of the MKP-1-Luc reporter, with little effect by the MEK inhibitor U0126 (Fig. 2B).


View larger version (27K):
[in this window]
[in a new window]
  		FIG. 2.   Role of ERK and p38 in mediating MKP-1 induction by stress in C3H 10T1/2 cells. (A) Northern blot analysis to monitor MKP-1 mRNA levels in response to arsenite (400 µM), UVC (20 J/m2), heat shock (42°C) (HS), or H2O2 (400 µM). U0126 (10 µM) or SB203580 (10 µM) was added to the medium 15 min before stimulation with the stress agents. Cells were harvested 1 h after exposure to stress. MKP-1 mRNA signals were normalized to 18S rRNA signals and expressed as MKP-1 mRNA induction relative to the levels in control cells. Values are means plus standard errors of the means from three independent experiments. DMSO, dimethyl sulfoxide. (B) Effects of U0126 and SB203580 on MKP-1-Luc reporter activation induced by arsenite (100 µM, 3 h). Data are means plus standard errors of the means from three independent experiments. (C) Kinetics of ERK activation. Western blotting was done with an antibody specific for phosphorylated ERK1/2 (upper panel) or an antibody recognizing total ERK (lower panel). (D) Kinetics of p38 activation. A Western blot using an antibody specific for phospho-p38 (upper panel) or an antibody for total p38 (lower panel) is shown. Cells were stimulated with arsenite (400 µM), UVC (20 J/m2), heat shock (42°C), or H2O2 (400 µM) for the indicated times or left untreated.

To understand the molecular basis underlying MKP-1 induction in response to stress, we examined the activation kinetics of both ERK and p38 following exposure to a variety of stress treatments. Activation of ERK and p38 was monitored by Western blot analysis using antibodies specific to the respective phosphorylated isoforms. While ERK MAP kinases were potently activated by H2O2 and heat shock, they were only modestly activated by UVC irradiation and weakly stimulated by arsenite (Fig. 2C). By contrast, arsenite substantially stimulated p38 phosphorylation, which increased with time. UVC irradiation also resulted in a significant increase in p38 phosphorylation. Unlike arsenite and UVC, heat shock was a poor activator of p38 at the 60-min time point while H2O2 did not affect p38 phosphorylation under the conditions of the assay (Fig. 2D). Western blotting to assess the levels of both phosphorylated and nonphosphorylated kinases revealed that protein loading was comparable among all samples (Fig. 2C and D). Taken together, these results suggest that both p38 and ERK contribute to the induction of MKP-1 expression and the contributions of different MAP kinase subfamilies vary according to the kinetics and magnitude of their activation.

Differential phosphorylation and acetylation of histone H3 in response to stress stimulation correlate with MSK1 activity. Recent studies have provided abundant evidence to suggest that the phosphorylation-acetylation of histone H3 following mitogenic stimulation plays an important role in mediating transcriptional activation of immediate-early genes such as c-fos and c-jun (13, 18, 20, 56). Since MKP-1 is also an immediate-early gene, we tested whether histone H3 phosphorylation-acetylation might be involved in MKP-1 induction by arsenite. Following stimulation of C3H 10T1/2 with arsenite for various lengths of time, phosphorylated histone H3 was detected by indirect immunofluorescence using an antibody that specifically recognized phospho-histone H3 (Ser-10). Since epidermal growth factor (EGF) together with anisomycin has been shown to induce histone H3 phosphorylation and superinduction of immediate-early genes (20), this combination treatment was used as a positive control (Fig. 3A). Compared with control cells, where the level of phosphorylated histone H3 was low, arsenite triggered a rapid accumulation of phospho-histone H3 in the nucleus. The levels of phosphorylated histone H3 after exposure to arsenite for 60 min were comparable to those seen with the combination of EGF and anisomycin (Fig. 3A).


View larger version (51K):
[in this window]
[in a new window]
  		FIG. 3.   Immunofluorescent detection of Ser-10-phosphorylated histone H3. C3H 10T1/2 cells were treated with arsenite (400 µM) for the indicated times. Histone H3 phosphorylation was detected by indirect immunofluorescence. (A) Time course of histone H3 phosphorylation in response to arsenite treatment. (Upper panels) Immunofluorescent detection of phosphohistone H3 (Ser-10) (Phos-H3); (lower panels) DAPI staining of cell nuclei. Cells treated with EGF (50 ng/ml) and anisomycin (10 µg/ml) (An) for 60 min were included as a positive control. (B) Confocal microscopy of histone H3 phosphorylation. Unstimulated cells (control), cells treated with arsenite (400 µM) for 60 min, or cells stimulated with EGF (50 ng/ml) together with anisomycin (10 µg/ml) for 60 min were first stained with a rabbit phospho-histone H3 antibody (green signal) and then stained with a mouse monoclonal antibody against total histone H3 (red signal). Representative fluorescent images are shown.

It has been reported that EGF-stimulated histone H3 phosphorylation is restricted to a small subset of nucleosomes that are associated with active gene transcription (4, 5, 17, 18, 20). Recently, it was found that in Drosophila salivary glands, heat shock significantly stimulated histone H3 phosphorylation at a few loci where the heat shock protein genes are located, while the global level of phosphorylated histone H3 decreased dramatically (47). To investigate whether arsenite stimulates phosphorylation of histone H3 throughout the entire nucleus or at a few loci, confocal microscopy was performed using a rabbit polyclonal antibody specifically recognizing Ser-10-phosphorylated histone H3. A mouse monoclonal antibody recognizing both phosphorylated and nonphosphorylated histone H3 was used to visualize all histone H3 proteins (Fig. 3B). In unstimulated cells, only a few loci were intensely stained by the phospho-histone H3 antibody (Fig. 3B). In cells stimulated with EGF and anisomycin, phospho-histone H3 was markedly more abundant and formed a punctate staining pattern in the nucleus (Fig. 3B). Like EGF and anisomycin, arsenite stimulation also resulted in a dramatic increase in phospho-histone H3, revealing a similar punctate staining pattern in the nucleus (Fig. 3B). The marked difference between the staining patterns of the phosphorylated histone H3 and those of the total histone H3 protein in arsenite-stimulated cells strongly suggests that arsenite induces the phosphorylation of a subset of histone H3 molecules (Fig. 3B).

To further examine the effect of various stresses on histone H3 modification, histone proteins were extracted with sulfuric acid from cells stimulated with arsenite, UVC, heat shock, and H2O2. Histone H3 modification was examined by Western blot analysis using antibodies specific for either phospho-histone H3 (Ser-10) or dually modified histone H3 (Ser-10, Lys-14). Arsenite stimulated a rapid phosphorylation of histone H3 in a time-dependent manner. This modification was visible within 10 min after the addition of arsenite to the medium and continued to increase over the time period studied (Fig. 4A). Phosphoacetyl-histone H3 increased in a time-dependent fashion with kinetics similar to that of histone H3 phosphorylation (Fig. 4A), supporting the notion that phosphorylation and acetylation of histone H3 are tightly coupled events (17). Interestingly, the p38 inhibitor SB203580 modestly reduced arsenite-triggered phosphorylation-acetylation of histone H3, while the MEK inhibitor U0126 had little effect (Fig. 4A). Unlike arsenite, which profoundly stimulated histone H3 phosphorylation and acetylation, exposure to 20 J of UVC per m2 decreased the levels of both phosphorylated and phosphoacetylated histone H3 at a global level, while higher doses (200 and 400 J/m2) of UVC irradiation significantly increased global histone H3 phosphorylation and acetylation (Fig. 4B). Interestingly, treatment of cells with both heat shock (42°C) and H2O2 (400 µM) significantly decreased global histone H3 modification (Fig. 4C).


View larger version (42K):
[in this window]
[in a new window]
  		FIG. 4.   Global levels of histone H3 phosphorylation-acetylation in cells stimulated with stress. C3H 10T1/2 cells were treated with arsenite (400 µM), UVC (20, 200, and 400 J/m2), heat shock (42°C), or H2O2 (400 µM) for the indicated times in the absence or presence of U0126 or SB203580. Cells were lysed to extract crude histone proteins. Western blot analysis was performed on the crude histone samples using an antibody specific to phospho-histone H3 (Ser-10) (Phos-H3), phosphoacetylated histone H3 (Ser-10, Lys-14) (Phos-Ac-H3), or total histone H3. (A) Histone H3 phosphorylation-acetylation in cells treated with arsenite. The graph shows the relative levels of phospho-histone H3. (B) Histone H3 phosphorylation-acetylation in cells irradiated by UVC. (C) Histone H3 phosphorylation-acetylation in cells stimulated by heat shock (42°C) (HS) or H2O2 (400 µM).

MSK1 activation by stress agents. MSK1 is a protein kinase that can be activated by both mitogens and stress, and it lies downstream of both p38 and ERK (25). Recent studies suggest that MSK1 may play an important role in mediating the phosphorylation of histone H3, thus serving as a link between the MAP kinase cascades and the nucleosomal events (56). To examine whether MSK1 could be involved in histone H3 phosphorylation and thus be implicated in MKP-1 induction by stress, we examined the kinetics of MSK1 activation following exposure to stressful treatments. MSK1 was immunoprecipitated and assayed using a synthetic peptide (Crosstide) as a substrate (25) and was found to be significantly activated by all four stresses. Arsenite was found to be the best inducer, eliciting a >10-fold increase in MSK1 activity within 10 min and a sustained >20-fold increase after 1 h of arsenite exposure (Fig. 5A). Although other treatments, including UVC, heat shock, and H2O2, also significantly activated MSK1, this elevated activity was transient and decreased soon thereafter (Fig. 5A). Consistent with previous reports that p38 plays a dominant role in mediating MSK1 activation by arsenite (25), SB203580 abolished MSK1 activation by arsenite while U0126 had little effect on its activation (Fig. 5B). The overall similar kinetics between histone H3 phosphorylation and MSK1 activation and the similar susceptibility profiles for the two MAP kinase inhibitors strongly support the notion that MSK1 may play a significant role in modulating histone H3 modifications in response to stress.


View larger version (17K):
[in this window]
[in a new window]
  		FIG. 5.   Activation of MSK1 in response to stress. C3H 10T1/2 cells were treated for the times indicated. MSK1 activity in cell lysates was assayed using a Crosstide peptide as a substrate. (A) Kinetics of MSK1 activation in cells stimulated with arsenite (400 µM), UVC (20 J/m2), heat shock (42°C) (HS), or H2O2 (400 µM). (B) Effect of U0126 or SB203580 on MSK1 activation triggered by arsenite. Cells were stimulated with arsenite (400 µM) for 60 min in the presence of either U0126 or SB203580 and harvested to assess MSK1 activity. The data are means plus standard errors of the means from three independent experiments, with each determination carried out in duplicate.

Histone deacetylase inhibitor TSA augments MKP-1 induction. To assess the influence of histone modification on MKP-1 induction, the effect of the deacetylase inhibitor TSA (20) on MKP-1 expression was examined. Indeed, pretreatment of cells with TSA augmented histone H3 acetylation on Lys-14, as revealed by Western blotting (Fig. 6A). On Northern blots, TSA alone was found to significantly enhance basal MKP-1 mRNA levels and to substantially augment MKP-1 mRNA induction by arsenite (Fig. 6B). The effect of TSA on MKP-1 promoter activity, examined using cells stably carrying the MKP-1-Luc reporter, revealed results similar to those seen by Northern blot analysis: the MKP-1 promoter activity was three- to six-fold higher in TSA-treated cells and was further induced by the addition of arsenite (Fig. 6C).


View larger version (27K):
[in this window]
[in a new window]
  		FIG. 6.   Effect of TSA on MKP-1 expression. (A) Histone H3 acetylation in cells treated with TSA. C3H 10T1/2 cells were treated with 500 ng of TSA per ml for the indicated times and harvested to extract crude histone proteins. Western blotting was performed using an antibody specifically recognizing acetyl-histone H3 (Lys-14) (Ac-H3). (B) Northern blot analysis of MKP-1 mRNA. C3H 10T1/2 cells were either pretreated with TSA (500 ng/ml) for the times indicated or received no pretreatment. Cells were either left unstimulated or further stimulated with arsenite (400 µM) for 30 min. The relative mRNA induction is quantitatively shown in the graph. Cells pretreated with TSA for 0 h refers to cells that did not receive TSA pretreatment. (C) Effect of TSA on MKP-1-Luc reporter activity in unstimulated and arsenite-stimulated C3H 10T1/2 cells. C3H 10T1/2 cells carrying the MKP-1-Luc reporter were either pretreated with 500 ng of TSA per ml for the indicated times or left untreated. Cells were then stimulated with 100 µM arsenite for 3 h. Six hours later, luciferase activity was assayed and normalized to protein amount. Data are relative to the basal luciferase activity: luciferase activity in treated cells/luciferase activity in untreated cells.

Transcriptional induction of MKP-1 is associated with phosphorylation and acetylation of histone H3 on the MKP-1 chromatin. To examine whether arsenite stimulates phosphorylation of histone H3 proteins associated with the MKP-1 gene, control and arsenite-stimulated cells were treated with formaldehyde to cross-link chromatin, chromatin-associated proteins, and genomic DNA. Following solubilization with sodium dodecyl sulfate and sonication, ChIP assays were carried out using antibodies specifically recognizing either phospho-histone H3, phosphoacetyl-histone H3, or RNA polymerase II. Genomic DNA present in the immunoprecipitates was extracted and analyzed by PCR using 32P-labeled primers derived from the mouse genes. The specificity and accuracy of these assays were monitored by performing mock ChIP reactions in the absence of antibody, carrying out PCR assays in the linear range of amplification, and executing PCR amplifications using DNA from the input chromatins as templates (Fig. 7A, C, and D). ChIP assays showed an approximate 3.2-fold increase in the levels of phosphorylated histone H3 on the MKP-1 chromatin following exposure to arsenite (Fig. 7A). Interestingly, SB203580 substantially inhibited histone H3 phosphorylation at the MKP-1 chromatin. The association between histone H3 phosphorylation and MKP-1 transcription was demonstrated by ChIP assays using an antibody against RNA polymerase II. RNA polymerase II associated with the MKP-1 gene was significantly increased after arsenite treatment but was considerably inhibited by pretreatment with SB203580 (Fig. 7A). However, neither treatment had appreciable effects on either the amount of phospho-histone H3 or the amount of RNA polymerase II associated with the chromatin of the housekeeping gene beta -actin (Fig. 7A). In addition, treatment of cells with arsenite did not induce histone H3 phosphorylation or RNA polymerase II association at the chromatin of a transcriptionally inactive gene beta -globin (Fig. 7A). These results suggest that arsenite induces nucleosomal changes and activates transcription at only a subset of genes. This notion was supported by Northern blot analysis. Arsenite treatment did not significantly change the beta -actin mRNA levels, even though it potently induced the transcription of both MKP-1 and c-fos (Fig. 7B). No beta -globin mRNA was detected in C3H 10T1/2 cells under any treatment conditions, while a strong signal was detected in the positive control RNA (differentiated erythroleukemic cells) (Fig. 7B).


View larger version (51K):
[in this window]
[in a new window]
  		FIG. 7.   Phosphorylation-acetylation of histone H3 on the MKP-1 chromatin. (A) Phosphorylation of histone H3 (Ser-10) and association of RNA polymerase II (Pol II) with MKP-1 chromatin in control and arsenite-treated cells. C3H 10T1/2 cells were treated with 400 µM arsenite for 60 min in the presence or absence of SB203580. ChIP assays were performed using anti-phospho-H3 antibody, anti-Pol II antiserum, or preimmune serum (Ab-). The DNA recovered from the antibody-bound fractions as well as the DNA from input chromatin (Input) were analyzed for the presence of MKP-1, beta -actin, and beta -globin sequences by PCR using 32P-labeled primers. Results of representative experiments are shown. (B) Levels of MKP-1, c-fos, beta -actin, and beta -globin mRNAs in cells stimulated with arsenite (400 µM) (Ars). U0126 or SB203580 (each 10 µM) was added to the medium 15 min prior to the addition of arsenite. That equal amounts of RNA were loaded was assessed by blotting with 18S rRNA. RNA from differentiated erythroleukemic BB88 cells was used as a positive control for beta -globin mRNA. (C) ChIP assays performed on arsenite-stimulated cells using anti-phosphoacetyl-histone H3 antibodies. The DNA recovered from the antibody-bound fractions, the DNA from input chromatin, and the genomic DNA were analyzed by hot PCR for MKP-1 and c-fos. (D) ChIP assays performed using an antibody specific to phosphoacetylated histone H3 on cells stimulated by UVC (20 J/m2, 60 min) and H2O2 (400 µM, 60 min). The DNA recovered was analyzed for MKP-1 and c-fos sequences by PCR. The DNA recovered was analyzed for MKP-1 and c-fos sequences by PCR. Numbers below the gels are intensities of the bands quantitated using a densitometer and expressed as the difference in band intensity in treated versus untreated cells.

ChIP assays were also performed using an antibody specific to dually modified histone H3 (phosphorylated Ser-10, acetylated Lys-14) at the MKP-1 and c-fos loci. Arsenite significantly increased phosphoacetylation of histone H3 at the MKP-1 chromatin, a process that was notably inhibited by SB203580 (Fig. 7C). Arsenite treatment also enhanced histone H3 phosphorylation-acetylation at the c-fos chromatin. However, SB203580 had little effect on this process (Fig. 7C), an observation that is consistent with Northern blotting results showing a more prominent role for ERK than for p38 in arsenite-mediated c-fos induction (Fig. 7B). Examination of histone H3 modification at the loci of MKP-1 and c-fos in cells treated by UVC or H2O2 revealed that phosphorylation-acetylation was enhanced at these loci, although the change triggered by H2O2 was less prominent (Fig. 7D). Taken together, our results suggest that nucleosomal changes mediated by histone H3 modification play an important role in mediating the transcriptional induction of MKP-1 by stress stimuli.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Histone H3 modification and activation of MKP-1 transcription. MKP-1 can be induced by a myriad of extracellular stimuli, including growth factors and stresses (34, 46), but the mechanisms contributing to its induction remain unclear. In this study, we explored the mechanisms involved in MKP-1 induction by a variety of stresses, including UVC, heat shock, H2O2, and arsenite. We showed that in C3H 10T1/2 cells MKP-1 mRNA was strongly increased by exposure to arsenite and UVC and modestly induced by heat shock and H2O2. Using pharmacological inhibitors specific for the ERK and p38 cascades, MKP-1 induction by arsenite and UVC was found to be predominantly mediated by the p38 pathway, while MKP-1 induction by heat shock and H2O2 was primarily dependent on the ERK pathway (Fig. 2). These differential contributions of the two MAP kinase subfamilies to MKP-1 expression can be explained by the differential activation of these kinases by each treatment. Arsenite potently activated p38 but only weakly stimulated ERK. UVC significantly activated p38 even though it also resulted in a transient activation of the ERK cascade. On the other hand, heat shock and H2O2 potently activated ERK, while they had little effect on p38 activity (Fig. 2).

An interesting finding from this study is that arsenite potently stimulates phosphorylation-acetylation of histone H3. Similar to combined treatment with EGF and anisomycin (4), arsenite did not increase histone H3 phosphorylation uniformly throughout the entire genome, but it did do so at a number of specific loci (Fig. 3B). By contrast, heat shock and H2O2 treatments actually decreased global histone H3 modification (Fig. 4). As for UVC, low doses of irradiation (20 J/m2) decreased histone phosphorylation-acetylation, while high doses (200 and 400 J/m2) significantly enhanced phosphorylation-acetylation of histone H3 (Fig. 4B), in agreement with a previous report (10). Since histone acetylation levels have long been believed to correlate with the transcription status of many genes (17, 28, 38, 57), decreases in global histone H3 phosphorylation-acetylation may represent a cellular defense mechanism to halt the transcription of nonessential genes. As previously reported, exposure to heat stress as well as to moderate doses of oxidative stress represses the expression of many genes (2, 45). Very recently, Nowak and Corces demonstrated that heat shock of Drosophila salivary gland dramatically decreases global histone H3 phosphorylation while it substantially increases histone H3 phosphorylation at a few loci containing the genes encoding heat shock proteins (47).

Recent studies have demonstrated that in response to mitogenic stimuli, histone H3 phosphorylation-acetylation occurs preferentially at the c-fos promoter in an ERK-dependent manner (18, 20). In addition to c-fos, c-jun- and c-myc-associated nucleosomes have been reported to undergo preferential histone H3 phosphoacetylation upon gene activation (13, 20, 30). In the present study, we found that arsenite, as well as UVC and H2O2, also induced phosphorylation-acetylation of histone H3 at the c-fos promoter (Fig. 7C and D). That arsenite-triggered MKP-1 transcriptional induction is mediated by histone modification is supported by the following findings: (i) histone H3 phosphorylation and acetylation preceded MKP-1 mRNA induction (compare Fig. 1A with Fig. 4A); (ii) treatment with the deacetylase inhibitor TSA increased MKP-1 basal transcription and also augmented arsenite-induced MKP-1 expression (Fig. 6); (iii) SB203580 partially inhibited histone H3 phosphorylation-acetylation induced by arsenite and also compromised the transcriptional induction of MKP-1 as indicated by the attenuated MKP-1 mRNA increase and abolished MKP-1-Luc reporter activation (Fig. 2A and B and 4A); and (iv) arsenite-stimulated histone H3 phosphorylation and acetylation on the MKP-1 chromatin correlated with the enhanced RNA polymerase II binding to the MKP-1 gene (Fig. 7A and C), and both processes were inhibited by SB203580. It should be noted that the close association between MKP-1 induction and histone modification observed in arsenite-treated cells is likely to be seen also with other stresses. UVC irradiation, and to a lesser extent H2O2, also enhanced histone H3 phosphorylation-acetylation at the MKP-1 chromatin (Fig. 7D), despite the global reduction in phosphorylated-acetylated histone H3 following these treatments (Fig. 4B and C).

Although the strong correlations between histone H3 modification and transcriptional activation of MKP-1 suggest that the two processes are mechanistically linked, the exact mechanisms involved in stress-triggered MKP-1 transcription are still unclear. Histone modification triggered by stressful stimuli could influence MKP-1 transcription through two possible mechanisms. The phosphoepitope on histone H3 may provide binding sites for the recruitment of coactivators such as p300/CBP or chromatin remodeling complexes, thus facilitating the assembly of active transcription complexes (17, 28, 44). Alternatively, phosphorylation may mediate changes in the nucleosome structure, thus increasing chromatin accessibility to transcription factors and ultimately leading to enhanced transcription (17, 22). The fact that the histone deacetylase inhibitor substantially induced MKP-1 expression (Fig. 6) indicates that histone acetylation alone can enhance MKP-1 transcription. Since MKP-1 can be induced by a myriad of extracellular stimuli, it is possible that MKP-1 induction by some treatments may involve only histone H3 acetylation.

An intriguing observation from this study is that a ~3-kbp MKP-1 promoter is sufficient for its activation by some but not all treatments. We found that arsenite, and to a lesser extent UVC, but not heat shock or H2O2, significantly stimulated luciferase activity from this reporter (Fig. 1D). Similarly, neither serum nor a cyclic AMP (cAMP) analog could increase the MKP-1-Luc reporter activity (data not shown), even though both agents have been shown to potently increase MKP-1 mRNA (14, 46). Preliminary studies in our laboratory indicate that the increase in MKP-1 mRNA levels in response to extracellular stimuli such as serum, H2O2, and heat shock is primarily due to enhanced transcription rather than increased mRNA stability (data not shown). This is consistent with the report that induction of MKP-1 expression by hypoxia involves transcriptional activation, not mRNA stabilization (41). Two possibilities could account for the lack of response of the MKP-1-Luc reporter to these treatments (H2O2, heat shock, serum, and cAMP). First, it is possible that the transcriptional activation of MKP-1 by certain treatments, such as serum, cAMP, heat shock and H2O2, involves chromatin remodeling of a genomic segment larger than that used here, as described for beta -globin (64). Secondly, transcriptional activation of MKP-1 could be mediated through multiple cis elements via cooperation of distinct transcription factors. In many genes, transcriptional control elements have been identified in either far upstream or far downstream regions from the transcription initiation site or even in their introns (19, 29, 33). Although the 2,975-bp promoter used in our studies contains a number of consensus cis-element sequences (including two cAMP response elements, an AP-1-binding site, a heat shock element, and an E box [54]), it may still lack the critical cis element(s) responsible for the transcriptional activation of the endogenous MKP-1 gene by these treatments. Future studies are required to explore these possibilities.

Role of the p38 pathway in arsenite-triggered histone H3 modification. We have shown that both the nucleosomal changes and the MKP-1 gene induction in response to arsenite are partially mediated by p38. The fact that the MEK inhibitor U0126 had little effect on histone H3 modification is in good agreement with the relatively weaker and transient nature of ERK activation by arsenite (Fig. 2C) (16). Differences in histone H3 phosphorylation triggered by different stresses may be explained by the differential kinase activations induced by these treatments. It is worth noting that unlike other stresses, such as heat shock, UVC, or H2O2, arsenite caused a potent and sustained activation of p38 (Fig. 2D), which was likely due to the inhibitory effect of arsenite on MAP kinase phosphatases (12), including MKP-1 (data not shown). The sustained p38 activation correlated tightly with the activation kinetics of MSK1, which has been recently implicated in histone H3 phosphorylation (56) (Fig. 5). The overall similar kinetics of MSK1 activation and histone H3 phosphorylation suggests that histone modification in response to arsenite could be mediated, at least in part, by MSK1 (Fig. 4 and 5). This possibility is supported by the finding that both processes were inhibited by SB203580 but not U0126 (Fig. 5). It is important to note that, in addition to p38, other signals generated by arsenite may also contribute to histone H3 phosphorylation-acetylation. Such a notion is consistent with the observation that SB203580 did not completely abolish arsenite-triggered histone H3 modification (Fig. 4A) while activation of MAPKAPK2/3, a direct target of p38, was virtually eliminated (data not shown). In addition to protein kinases regulated by the MAP kinase cascades (RSK2 and MSK1), cAMP-dependent protein kinase has also been implicated in histone H3 phosphorylation (61). Protein kinases responsible for histone H3 phosphorylation during mitosis were recently identified in lower eukaryotic organisms (26, 31, 59). It is possible that some of these kinases could be activated by arsenite and contribute to the histone H3 phosphorylation induced by arsenite.

Arsenite is a potent carcinogen that has been implicated in the development of skin and bladder cancers (3). We have previously demonstrated that arsenite can stimulate EGF receptor activity and induce the expression of c-jun, c-fos, and c-myc (16) (Fig. 7). ChIP assays indicated that arsenite also stimulates the phosphorylation-acetylation of histone H3 on the chromatin associated with the c-fos promoter (Fig. 7). Paradoxically, arsenite is also a very effective therapeutic agent for the treatment of a subset of acute promyelocytic leukemia (APL) associated with retinoic acid receptor gene translocation (36, 48). Interestingly, recent studies have suggested that failure to initiate histone acetylation at retinoic acid-regulated genes is responsible for the development of APL (36, 37). Furthermore, histone deacetylase inhibitors together with retinoic acid can stimulate the differentiation of the subset of APL that is insensitive to arsenite (36, 62). Our finding that arsenite induces histone H3 phosphorylation-acetylation may provide additional insight into the mechanisms for both the carcinogenic properties and the therapeutic effects of arsenite.


    ACKNOWLEDGMENTS

We are grateful to Magdalena Juhaszova and Steven Sollot for assistance in confocal analysis. We thank Michael Dahmus for providing the antiserum against polymerase II, William James for histone H3 antibody, and Jacques Huot for providing the MAPKAPK2/3 antibody. We are grateful to David Allis, Peter Cheung, and Dario Alessi for discussions and advice. We express our gratitude to Jennifer Martindale for assistance in the luciferase assays and to Nikki J. Holbrook for discussions and critical reading of the manuscript.


    FOOTNOTES

* Corresponding author. Mailing address: Box 12, Laboratory of Cellular and Molecular Biology, National Institute on Aging, NIH, 5600 Nathan Shock Drive, Baltimore, MD 21224. Phone: (410) 558-8442. Fax: (410) 558-8335. E-mail: yusen-liu{at}nih.gov.

dagger Present address: Department of Biology, Villanova University, Villanova, PA 19085.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Alessi, D. R., C. Smythe, and S. M. Keyse. 1993. The human CL100 gene encodes a Tyr/Thr-protein phosphatase which potently and specifically inactivates MAP kinase and suppresses its activation by oncogenic ras in Xenopus oocyte extracts. Oncogene 8:2015-2020[Medline].
2. Ashburner, M., and J. J. Bonner. 1979. The induction of gene activity in Drosophila by heat shock. Cell 17:241-254[CrossRef][Medline].
3. Bagla, P., and J. Kaiser. 1996. India's spreading health crisis draws global arsenic experts. Science 274:174-175[CrossRef][Medline].
4. Barratt, M. J., C. A. Hazzalin, E. Cano, and L. C. Mahadevan. 1994. Mitogen-stimulated phosphorylation of histone H3 is targeted to a small hyperacetylation-sensitive fraction. Proc. Natl. Acad. Sci. USA 91:4781-4785[Abstract/Free Full Text].
5. Barratt, M. J., C. A. Hazzalin, N. Zhelev, and L. C. Mahadevan. 1994. A mitogen-and anisomycin-stimulated kinase phosphorylates HMG-14 in its basic amino-terminal domain in vivo and on isolated mononucleosomes. EMBO J. 13:4524-4535[Medline].
6. Bianchini, L., G. L'Allemain, and J. Pouyssegur. 1997. The p42/p44 mitogen-activated protein kinase cascade is determinant in mediating activation of the Na+/H+ exchanger (NHE1 isoform) in response to growth factors. J. Biol. Chem. 272:271-279[Abstract/Free Full Text].
7. Brondello, J. M., J. Pouyssegur, and F. R. McKenzie. 1999. Reduced MAP kinase phosphatase-1 degradation after p42/p44MAPK-dependent phosphorylation. Science 286:2514-2517[Abstract/Free Full Text].
8. Brunet, A., D. Roux, P. Lenormand, S. Dowd, S. Keyse, and J. Pouyssegur. 1999. Nuclear translocation of p42/p44 mitogen-activated protein kinase is required for growth factor-induced gene expression and cell cycle entry. EMBO J. 18:664-674[CrossRef][Medline].
9. Camps, M., A. Nichols, and S. Arkinstall. 2000. Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB J. 14:6-16[Abstract/Free Full Text].
10. Cano, E., C. A. Hazzalin, E. Kardalinou, R. S. Buckle, and L. C. Mahadevan. 1995. Neither ERK nor JNK/SAPK MAP kinase subtypes are essential for histone H3/HMG-14 phosphorylation or c-fos and c-jun induction. J. Cell Sci. 108(Pt. 11):3599-3609[Abstract].
11. Cano, E., and L. C. Mahadevan. 1995. Parallel signal processing among mammalian MAPKs. Trends Biochem. Sci. 20:117-122[CrossRef][Medline].
12. Cavigelli, M., W. W. Li, A. Lin, B. Su, K. Yoshioka, and M. Karin. 1996. The tumor promoter arsenite stimulates AP-1 activity by inhibiting a JNK phosphatase. EMBO J. 15:6269-6279[Medline].
13. Chadee, D. N., M. J. Hendzel, C. P. Tylipski, C. D. Allis, D. P. Bazett-Jones, J. A. Wright, and J. R. Davie. 1999. Increased Ser-10 phosphorylation of histone H3 in mitogen-stimulated and oncogene-transformed mouse fibroblasts. J. Biol. Chem. 274:24914-24920[Abstract/Free Full Text].
14. Charles, C. H., A. S. Abler, and L. F. Lau. 1992. cDNA sequence of a growth factor-inducible immediate early gene and characterization of its encoded protein. Oncogene 7:187-190[Medline].
15. Chen, P., D. Hutter, X. Yang, M. Gorospe, R. J. Davis, and Y. Liu. 2001. Discordance between the binding affinity of mitogen-activated protein kinase subfamily members for MKP-2 and their ability to catalytically activate the phosphatase. J. Biol. Chem. 276:29440-29449[Abstract/Free Full Text].
16. Chen, W., J. L. Martindale, N. J. Holbrook, and Y. Liu. 1998. Tumor promoter arsenite activates extracellular signal-regulated kinase through a signaling pathway mediated by epidermal growth factor receptor and Shc. Mol. Cell. Biol. 18:5178-5188[Abstract/Free Full Text].
17. Cheung, P., C. D. Allis, and P. Sassone-Corsi. 2000. Signaling to chromatin through histone modifications. Cell 103:263-271[CrossRef][Medline].
18. Cheung, P., K. G. Tanner, W. L. Cheung, P. Sassone-Corsi, J. M. Denu, and C. D. Allis. 2000. Synergistic coupling of histone H3 phosphorylation and acetylation in response to epidermal growth factor stimulation. Mol. Cell 5:905-915[CrossRef][Medline].
19. Choi, O. R., and J. D. Engel. 1986. A 3' enhancer is required for temporal and tissue-specific transcriptional activation of the chicken adult beta -globin gene. Nature 323:731-734[CrossRef][Medline].
20. Clayton, A. L., S. Rose, M. J. Barratt, and L. C. Mahadevan. 2000. Phosphoacetylation of histone H3 on c-fos- and c-jun-associated nucleosomes upon gene activation. EMBO J. 19:3714-3726[CrossRef][Medline].
21. Curran, T., M. B. Gordon, K. L. Rubino, and L. C. Sambucetti. 1987. Isolation and characterization of the c-fos(rat) cDNA and analysis of post-translational modification in vitro. Oncogene 2:79-84[Medline].
22. Davie, J. R., and V. A. Spencer. 1999. Control of histone modifications. J. Cell. Biochem. Suppl. 32-33:141-148.
23. Davis, R. J. 1993. The mitogen-activated protein kinase signal transduction pathway. J. Biol. Chem. 268:14553-14556[Free Full Text].
24. Davis, R. J. 1995. Transcriptional regulation by MAP kinases. Mol. Reprod. Dev. 42:459-467[CrossRef][Medline].
25. Deak, M., A. D. Clifton, L. M. Lucocq, and D. R. Alessi. 1998. Mitogen- and stress-activated protein kinase-1 (MSK1) is directly activated by MAPK and SAPK2/p38, and may mediate activation of CREB. EMBO J. 17:4426-4441[CrossRef][Medline].
26. De Souza, C. P., A. H. Osmani, L. P. Wu, J. L. Spotts, and S. A. Osmani. 2000. Mitotic histone H3 phosphorylation by the NIMA kinase in Aspergillus nidulans. Cell 102:293-302[CrossRef][Medline].
27. Emslie, E. A., T. A. Jones, D. Sheer, and S. M. Keyse. 1994. The CL100 gene, which encodes a dual specificity (Tyr/Thr) MAP kinase phosphatase, is highly conserved and maps to human chromosome 5q34. Hum. Genet. 93:513-516[Medline].
28. Grunstein, M. 1997. Histone acetylation in chromatin structure and transcription. Nature 389:349-352[CrossRef][Medline].
29. Harrison, P. R., M. Plumb, J. Frampton, B. Thiele, K. Macleod, J. Chester, L. Chambers, J. Fleming, J. O'Prey, M. Walker, et al. 1990. Regulation of erythroid-specific gene expression. Biomed. Biochim. Acta 49:S5-S10[Medline].
30. Hazzalin, C. A., E. Cano, A. Cuenda, M. J. Barratt, P. Cohen, and L. C. Mahadevan. 1996. p38/RK is essential for stress-induced nuclear responses: JNK/SAPKs and c-Jun/ATF-2 phosphorylation are insufficient. Curr. Biol. 6:1028-1031[CrossRef][Medline].
31. Hsu, J. Y., Z. W. Sun, X. Li, M. Reuben, K. Tatchell, D. K. Bishop, J. M. Grushcow, C. J. Brame, J. A. Caldwell, D. F. Hunt, R. Lin, M. M. Smith, and C. D. Allis. 2000. Mitotic phosphorylation of histone H3 is governed by Ipl1/aurora kinase and Glc7/PP1 phosphatase in budding yeast and nematodes. Cell 102:279-291[CrossRef][Medline].
32. Hutter, D., P. Chen, J. Barnes, and Y. Liu. 2000. Catalytic activation of mitogen-activated protein (MAP) kinase phosphatase-1 by binding to p38 MAP kinase: critical role of the p38 C-terminal domain in its negative regulation. Biochem. J. 352(Pt. 1):155-163.
33. Kastan, M. B., Q. Zhan, W. S. el Deiry, F. Carrier, T. Jacks, W. V. Walsh, B. S. Plunkett, B. Vogelstein, and A. J. Fornace. 1992. A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell 71:587-597[CrossRef][Medline].
34. Keyse, S. M. 2000. Protein phosphatases and the regulation of mitogen-activated protein kinase signalling. Curr. Opin. Cell. Biol. 12:186-192[CrossRef][Medline].
35. Keyse, S. M., and E. A. Emslie. 1992. Oxidative stress and heat shock induce a human gene encoding a protein-tyrosine phosphatase. Nature 359:644-647[CrossRef][Medline].
36. Kitamura, K., S. Hoshi, M. Koike, H. Kiyoi, H. Saito, and T. Naoe. 2000. Histone deacetylase inhibitor but not arsenic trioxide differentiates acute promyelocytic leukaemia cells with t(11;17) in combination with all-trans retinoic acid. Br. J. Haematol. 108:696-702[CrossRef][Medline].
37. Kosugi, H., M. Towatari, S. Hatano, K. Kitamura, H. Kiyoi, T. Kinoshita, M. Tanimoto, T. Murate, K. Kawashima, H. Saito, and T. Naoe. 1999. Histone deacetylase inhibitors are the potent inducer/enhancer of differentiation in acute myeloid leukemia: a new approach to anti-leukemia therapy. Leukemia 13:1316-1324[CrossRef][Medline].
38. Kouzarides, T. 2000. Acetylation: a regulatory modification to rival phosphorylation? EMBO J. 19:1176-1179[CrossRef][Medline].
39. Kwak, S. P., D. J. Hakes, K. J. Martell, and J. E. Dixon. 1994. Isolation and characterization of a human dual specificity protein-tyrosine phosphatase gene. J. Biol. Chem. 269:3596-3604[Abstract/Free Full Text].
40. Kyriakis, J. M., and J. Avruch. 1996. Protein kinase cascades activated by stress and inflammatory cytokines. Bioessays 18:567-577[CrossRef][Medline].
41. Laderoute, K. R., H. L. Mendonca, J. M. Calaoagan, A. M. Knapp, A. J. Giaccia, and P. J. Stork. 1999. Mitogen-activated protein kinase phosphatase-1 (MKP-1) expression is induced by low oxygen conditions found in solid tumor microenvironments. A candidate MKP for the inactivation of hypoxia-inducible stress-activated protein kinase/c-Jun N-terminal protein kinase activity. J. Biol. Chem. 274:12890-12897[Abstract/Free Full Text].
42. Lewis, T. S., J. B. Hunt, L. D. Aveline, K. R. Jonscher, D. F. Louie, J. M. Yeh, T. S. Nahreini, K. A. Resing, and N. G. Ahn. 2000. Identification of novel MAP kinase pathway signaling targets by functional proteomics and mass spectrometry. Mol. Cell 6:1343-1354[CrossRef][Medline].
43. Liu, Y., M. Gorospe, C. Yang, and N. J. Holbrook. 1995. Role of mitogen-activated protein kinase phosphatase during the cellular response to genotoxic stress. Inhibition of c-Jun N-terminal kinase activity and AP-1-dependent gene activation. J. Biol. Chem. 270:8377-8380[Abstract/Free Full Text].
44. Magnaghi-Jaulin, L., S. Ait-Si-Ali, and A. Harel-Bellan. 1999. Histone acetylation in signal transduction by growth regulatory signals. Semin. Cell Dev. Biol. 10:197-203[CrossRef][Medline].
45. Morel, Y., and R. Barouki. 1999. Repression of gene expression by oxidative stress. Biochem. J. 342(Pt. 3):481-496.
46. Noguchi, T., R. Metz, L. Chen, M.-G. Mattéi, D. Carrasco, and R. Bravo. 1993. Structure, mapping, and expression of erp, a growth factor-inducible gene encoding a nontransmembrane protein tyrosine phosphatase, and effect of ERP on cell growth. Mol. Cell. Biol. 13:5195-5205[Abstract/Free Full Text].
47. Nowak, S. J., and V. G. Corces. 2000. Phosphorylation of histone H3 correlates with transcriptionally active loci. Genes Dev. 14:3003-3013[Abstract/Free Full Text].
48. Powell, B. L. 2001. Acute progranulocytic leukemia. Curr. Opin. Oncol. 13:8-13[CrossRef][Medline].
49. Raingeaud, J., S. Gupta, J. S. Rogers, M. Dickens, J. Han, R. J. Ulevitch, and R. J. Davis. 1995. Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine. J. Biol. Chem. 270:7420-7426[Abstract/Free Full Text].
50. Robinson, M. J., and M. H. Cobb. 1997. Mitogen-activated protein kinase pathways. Curr. Opin. Cell Biol. 9:180-186[CrossRef][Medline].
51. Rohan, P. J., P. Davis, C. A. Moskaluk, M. Kearns, H. Krutzsch, U. Siebenlist, and K. Kelly. 1993. PAC-1: a mitogen-induced nuclear protein tyrosine phosphatase. Science 259:1763-1766[Abstract/Free Full Text].
52. Sauve, D. M., H. J. Anderson, J. M. Ray, W. M. James, and M. Roberge. 1999. Phosphorylation-induced rearrangement of the histone H3 NH2-terminal domain during mitotic chromosome condensation. J. Cell. Biol. 145:225-235[Abstract/Free Full Text].
53. Slack, D. N., O.-M. Seternes, M. Gabrielson, and S. M. Keyse. 2001. Distinct binding determinants for ERK2/p38a and JNK MAP kinases mediate catalytic activation and substrate selectivity of MAP kinase phosphatase-1. J. Biol. Chem. 276:16491-16500[Abstract/Free Full Text].
54. Sommer, A., H. Burkhardt, S. M. Keyse, and B. Luscher. 2000. Synergistic activation of the mkp-1 gene by protein kinase A signaling and USF, but not c-Myc. FEBS Lett. 474:146-150[CrossRef][Medline].
55. Sun, H., C. H. Charles, L. F. Lau, and N. K. Tonks. 1993. MKP-1 (3CH134), an immediate early gene product, is a dual specificity phosphatase that dephosphorylates MAP kinase in vivo. Cell 75:487-493[CrossRef][Medline].
56. Thomson, S., A. L. Clayton, C. A. Hazzalin, S. Rose, M. J. Barratt, and L. C. Mahadevan. 1999. The nucleosomal response associated with immediate-early gene induction is mediated via alter