Previous Article | Next Article 
Molecular and Cellular Biology, December 2001, p. 8575-8591, Vol. 21, No. 24
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.24.8575-8591.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Insights into Regulation and Function of the Major Stress-Induced
hsp70 Molecular Chaperone In Vivo: Analysis of Mice with Targeted
Gene Disruption of the hsp70.1 or
hsp70.3 Gene
Lei
Huang,
Nahid F.
Mivechi, and
Demetrius
Moskophidis*
Institute of Molecular Medicine and Genetics,
Medical College of Georgia, Augusta, Georgia 30912
Received 11 May 2001/Returned for modification 21 July
2001/Accepted 21 September 2001
 |
ABSTRACT |
The murine hsp70 gene family includes the
evolutionarily conserved hsp70.1 and
hsp70.3 genes, which are the major
proteins induced by heat and other stress stimuli.
hsp70.1 and
hsp70.3 encode identical proteins which
protect cells and facilitate their recovery from stress-induced damage.
While the hsp70 gene family has been widely studied and
the roles of the proteins it encodes as molecular chaperones in a range
of human pathologies are appreciated, little is known about the
developmental regulation of hsp70.1 and
hsp70.3 expression and the in vivo
biological function of their products. To directly study the
physiological role of these proteins in vivo, we have generated mice
deficient in heat shock protein 70 (hsp70) by replacing the
hsp70.1 or
hsp70.3 gene with an in-frame
-galactosidase sequence. We report here that the expression of
hsp70.1 and
hsp70.3 is developmentally regulated at
the transcriptional level, and an overlapping expression pattern for
both genes is observed during embryo development and in the tissues of
adult mice. hsp70.1
/
or
hsp70.3
/
mice are viable
and fertile, with no obvious morphological abnormalities. In late
embryonic stage and adult mice, both genes are expressed constitutively
in tissues exposed directly to the environment (the epidermis and
cornea) and in certain internal organs (the epithelium of the tongue,
esophagus, and forestomach, and the kidney, bladder, and hippocampus).
Exposure of mice to thermal stress results in the rapid induction and
expression of hsp70, especially in organs not constitutively expressing
hsp70 (the liver, pancreas, heart, lung, adrenal cortex, and
intestine). Despite functional compensation in the
single-gene-deficient mice by the intact homologous gene (i.e.,
hsp70.3 in
hsp70.1
/
mice and vice
versa), a marked reduction in hsp70 protein expression was observed in
tissues under both normal and heat stress conditions. At the cellular
level, inactivation of hsp70.1 or
hsp70.3 resulted in deficient maintenance
of acquired thermotolerance and increased sensitivity to heat
stress-induced apoptosis. The additive or synergistic effects exhibited
by coexpression of both hsp70 genes, and the
evolutionary significance of the presence of both hsp70 genes, is hence underlined.
 |
INTRODUCTION |
The cellular response to stresses,
including exposure to environmental (UV radiation, heat shock, heavy
metals), pathological (infections, fever, inflammation, malignancy,
ischemia) or physiological (growth factors, hormonal stimulation,
tissue development) stimuli, is represented at the molecular level by
rapid synthesis of molecular chaperones such as the heat shock family
of stress proteins (heat shock proteins [hsp's]) (for reviews, see
references 4, 10, 23, 28, 29, and 41). This response is
remarkably conserved in prokaryotic and eukaryotic cells and is widely
believed to play a pivotal role in host defense and survival
(30). The induction of hsp's in response to stress serves
to protect against the initial insult, augment recovery, and produce a
state of resistance to subsequent stress (thermotolerance) (15,
28). This protective role of hsp's is attributed to several
functional properties, including an active participation in the folding
of proteins by minimizing incorrect interactions within and between
molecules, maintenance of proteins in their native folded states, and
the repair or promotion of the degradation of misfolded proteins
(1, 16). In addition, hsp's can function in cellular
protection by modulating the engagement and/or progression of apoptosis
induced by a variety of stress stimuli (2). Besides the
well-established role of hsp's in cell survival, widespread clinical
interest exists in their chaperone function during a range of human
pathologies, including neurodegenerative conditions (such as
amyloidosis, prion disease, and Alzheimer's disease) and various
cardiovascular diseases (including myocardial ischemia, cardiac
hypertrophy, stroke, and blood vessel injury) (4, 37, 41).
A critical role in the cellular response to acute stress situations has
been assigned to the hsp70 protein family, which is an abundant
and highly conserved group of proteins in eukaryotic cells that
contains members that are constitutively expressed and inducibly
regulated and/or targeted to different intracellular organelles. In the
mouse, the hsp70 family contains at least seven proteins, including the
heat shock cognate protein (Hsc70), the glucose regulated proteins
Grp75 and Grp78, the spermatocyte-specific hsp70.2, and the
testis-specific Hsc70t. In addition, the exposure of cells to stress
insults activates a survival response via induction of the intronless
hsp70.1 and hsp70.3 genes
(designated hsp70i). These genes encode identical proteins
of 68 kDa and are located approximately 8 kb apart within the major
histocompatibility complex class III locus (14, 18, 19).
The molecular chaperone function of the hsp70 protein family relies on
the ATP-regulated association of hsp70 with hydrophobic segments in the
substrate polypeptide (6, 33). All hsp70 proteins contain
a conserved 44-kDa NH2-terminal ATPase domain, a
more variable COOH-terminal domain that contains a 15-kDa peptide
binding site, and a 10-kDa module with an undefined function. The
ATP-bound form of the protein has a low affinity for substrates
compared to the ADP-bound form. Thus, these proteins bind a linear
peptide intermediate, which is mediated by cycles of ATP binding and
hydrolysis, followed by ADP-ATP exchange and release. hsp70 chaperone
activity is further regulated by a number of other cochaperones (e.g.,
hsp40, hip, hop) (7, 17).
The rapid induction of hsp70i (hsp70.1 or hsp70.3) protein expression
during acute stress stimuli in the cell represents a unique feature of
the physiological function of these molecules. As a result, there is
widespread interest in the regulatory networks and mechanisms of
hsp70i expression in cells and tissues in vivo. It is well
known that hsp70i expression is accomplished by mechanisms of
transcriptional activation and translation involving heat shock transcription factors (HSFs). Members of the murine HSF family (HSF1,
HSF2, or HSF4) bind to heat shock elements (alternatively oriented
pentanucleotide 5'-nGAAn-3' units) in the promoters of hsp genes and regulate their transcription (35,
48). HSF1 is ubiquitously expressed and is the most effective
transactivator of stress-induced expression of hsp70i genes.
In contrast, HSF2 has been proposed to regulate hsp70i
expression during specific stages of development, whereas the function
of the more recently described HSF4 is unknown (12, 42).
Despite extensive studies of HSF function in the cells of complex
organisms, little specific knowledge is available about the
contribution of HSFs to the regulation of tissue- and cell-specific
expression of hsp's, particularly that of
hsp70.1 or hsp70.3, under
normal or stress conditions in vivo. However, some evidence indicates
that hsp70i genes are also constitutively expressed under
physiological conditions in certain tissues, suggesting that such
expression is not solely regulated by HSF1. Indeed, it has been shown
that hsp70.1 is transcribed at the onset of
zygotic genome activation (two-cell stage) and that this spontaneous
expression is regulated by transcription factors other than HSFs (e.g.,
Sp1) (5), although other studies using a heterologous
hsp70.1 promoter to regulate transgene expression have also implicated a role for HSF1 in such spontaneous hsp70.1 expression. (8, 24, 25, 44). Furthermore,
immunohistochemical studies have provided evidence for constitutive
expression of hsp70i in certain tissues of adult mice, such as the
epithelial layer of the skin (31). However, an important
caveat is that many of these studies have relied on studying hsp70i
expression using truncated hsp70 promoter sequences to
regulate transgene (
-galactosidase or luciferase) expression,
conditions that may not faithfully reproduce its normal activity.
Together, the available evidence concerning tissue-specific
hsp70i expression is insufficient to define a specific role
for hsp70 during development or in the adult.
Given the existence of multiple hsp70 family members
(including the stress-induced hsp70.1 and
hsp70.3) with close sequence homology, it has
been hitherto impossible to determine the precise functional
contribution of each gene in cellular protection from stress in vivo
and how the individual hsp70s functionally relate to each other. Direct
evidence exists that shows that hsp70i has multiple roles in protection
against stress-induced cell death via a cell-protective process known
as thermotolerance (or cytoprotection), in which initial sublethal
exposure of cells to heat (hyperthermic preconditioning) or other
stress stimuli can profoundly attenuate all of the heat-induced changes
to a subsequent, more-severe, stress challenge that normally results in
extensive cell death. Conversely, abrogation of hsp70i expression or
neutralization of its function renders cells sensitive to apoptosis
while overexpression of hsp70i in most cells provides protection from
cell death triggered by a variety of stress stimuli, including
hyperthermia, oxidative stress, chemotherapy agents, and radiation
(27). These observations clearly demonstrate the
cytoprotective properties of hsp70i; however, it is less clear how this
is accomplished. Growing evidence from studies using cell-free systems
or cell lines engineered to overexpress hsp70 have suggested that this
molecule can inhibit apoptosis following a variety of treatments by
modulating the stress-induced intrinsic apoptotic pathway, which
mediates cell death through the mitochondria by release of cytochrome
c from the mitochondrial intermembrane space. It has been
reported that hsp70i functions at both the level of cytochrome
c release and initiator caspase activation and that the
chaperone function of hsp70i is required for these effects
(36). Additionally, hsp70i can exhibit an antiapoptotic
function via direct association with the caspase recruitment domain of
Apaf-1 and inhibition of apoptosome formation (3, 40).
Another point in the apoptotic pathway that can be modulated by hsp70i
is c-Jun NH2-terminal kinase (JNK) signaling, which precedes apoptotic cell death following heat shock and ethanol exposure as well as via stimulation with cytokines or UV irradiation (20, 26). It has been proposed that hsp70i acts by
preventing JNK activation, although the importance of this intervention
is less clear (13). In the case of tumor necrosis
factor-induced apoptosis, hsp70i can rescue cells from apoptosis
downstream of JNK activation. Clearly, hsp70i affects multiple
apoptotic pathways, and cell type-specific differences may account for
the various points of hsp70i intervention.
Elucidation of the role of the hsp70i genes in response to
environmental and physiological stress requires a direct in vivo study
of hsp70.1 and hsp70.3
expression in specific cell and tissue types and examination of their
functional contribution to the stress response. To this end, we have
generated mice deficient in the hsp70i genes by replacing
the entire coding sequence of hsp70.1 or
hsp70.3 with an in-frame
-galactosidase gene.
This allows for the study of hsp70.1 or
hsp70.3 function in vivo and enables examination
of tissue- and cell-specific regulation of these genes at both the
transcriptional and protein levels during development and in the adult
mouse under normal or stress conditions. Here we report that
inactivation of hsp70.1 or
hsp70.3 gene results in a marked reduction in
hsp70i protein synthesis in different mouse tissues under both normal
and heat stress conditions. This was reflected by deficient maintenance
of acquired thermotolerance and increased sensitivity to heat
stress-induced apoptosis. Direct in vivo evidence for tissue-specific
constitutive expression and inducible expression of hsp70i under stress
conditions is also provided, suggesting the existence of separate
mechanisms to control hsp70i expression under physiological versus
pathological conditions.
 |
MATERIALS AND METHODS |
Construction of targeting vectors and generation of mice
deficient in either the hsp70.1 or hsp70.3
gene.
The 5' and 3' ends of the hsp70.1 and
hsp70.3 gene fragments used in the construction
of the targeting vectors were isolated from a 129/SvJ mouse genomic
library (lambda fixII vector; Stratagene, La Jolla, Calif.) by
hybridization with a human hsp70.1 cDNA probe (19). Restriction mapping, oligonucleotide hybridization,
and sequencing confirmed that four overlapping phage clones contained both murine hsp70.1 and
hsp70.3 loci, including several kilobases of 5'-
and 3'-flanking sequences. Targeting vector construction was based on a
lacZ-neo-tk (pN-Z-tk2) template
plasmid vector containing a
-galactosidase (lacZ) gene
fragment with the bovine growth hormone poly(A) signal
[lacZ-poly(A)], a neomycin resistance gene driven by the
thymidine kinase (tk) promoter with the simian virus
40 poly(A) signal [tk/neo-poly(A)], and flanking
tk gene cassettes. The tk/neo-poly(A) fragment
was flanked by Cre recombinase recognition (loxP)
sequences to allow removal of the selectable marker gene from the
targeted locus by intercrossing the mutant mice with transgenic mice
expressing the cre gene. Essentially, nearly the entire
coding sequence of hsp70.1 or
hsp70.3 (codons 1 to 633) was replaced in frame
with the lacZ-neo cassette using the proximal 4.5 kb and distal 4 kb for hsp70.1 and 4.5 and 3.5 kb
for hsp70.3, respectively. Targeting vectors were
linearized at the unique SalI site for embryonic stem (ES)
cell transfection. ES cells (D3; Incyte Genomics, St. Louis, Mo.) were
electroporated with the linearized targeting vectors and selected for
double resistance to G418 (200 µg/ml) and
2'-fluoro-2'-deoxy-1b-D-arabino-furanosyl-S-iodo-uracil (FIAU) (ganciclovir, 2 µM) following a standard protocol
(Incyte Genomics). Doubly resistant clones were screened by Southern
blotting. Correct targeting was confirmed by Southern blotting with
flanking genomic (external to the targeting vectors) and
lacZ-neo probes. Briefly,
BamHI-digested genomic DNA was hybridized with an external probe to yield bands of 6 and 9 kb for the
hsp70.3 wild-type and targeted loci,
respectively. For the hsp70.1 wild-type and
targeted loci, hybridization of EcoRI-digested genomic DNA
with an external probe yielded bands of 12 and 9 kb, respectively. ES
cell clones were microinjected into C57BL/6 blastocysts, and several
germ line transmitting chimeric mice were obtained. Genotyping of mice was performed by Southern blotting with external probes or by PCR with
primers 1 (annealing to the hsp70.3 and
hsp70.1 coding regions, 5'
AGATCACCATCACCAACGACAAG), 2 (annealing to the neo gene, 5' CTTGGGTGGAGAGGCTATTC), 3 (binding to the
hsp70.3 allele 3' untranslated region, 5'
GTGCAATACACAAAGTAACTGAAAGAC), and 4 (annealing to the
hsp70.1 gene 3' untranslated region, 5'
GACAGTAATCGGTGCCACAAG). For the detection of the wild-type
or targeted hsp70.3 allele, primers 1, 2, and 3 were used in combination, and for the wild-type or targeted
hsp70.1 allele, primers 1, 2, and 4 were used in
combination. The expected PCR products for the wild-type and targeted
loci are fragments of 0.6 and 1.1 kb for hsp70.3 and of 0.5 and 1.0 kb
for hsp70.1, respectively.
Histology.
Embryos recovered at embryonic day 17 (E17) or
tissues harvested from adult mice were embedded in OCT compound,
snap-frozen in a dry ice 2-methyl-butane bath, sectioned, air dried,
and fixed in 0.2% glutaraldehyde in phosphate-buffered saline (pH 7.3)
with 2 mM MgCl2 for 10 min. Sections from each
tissue specimen were stained with either hematoxylin or
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
for
-galactosidase activity (Molecular Probes, Eugene, Oreg.). All
sections were counterstained with eosin and subjected to gross and
microscopic pathological analysis.
Whole-body hyperthermic challenge.
Wild-type (+/+),
heterozygous (+/
), or homozygous (
/
)
hsp70.3 or hsp70.1 adult
mice were semi-immersed in a circulating water bath at 42°C for 45 min and left to recover for 6 to 8 h before euthanatization.
Tissues were prepared for histological examination as described above.
Untreated mice were used as controls.
Thermal response and kinetics of thermotolerance induction in
CFU-GM obtained from hsp70.3- or hsp70.1-deficient mice.
Bone
marrow cells from +/+, +/
, or
/
hsp70.1 or
hsp70.3 mice were tested for their ability to
develop thermotolerance (34). Bone marrow cells were
heated at 43°C for 20 min and challenged with a more-severe heat
(44°C for 40 min) at the times indicated during the recovery period
at 37°C. Cells were subsequently plated and incubated at 37°C in
5% CO2 for 8 days. Colonies of granulocytes, macrophages, or a mixture of granulocytes and macrophages were counted
microscopically. The colony forming efficiency of untreated CFU
granulocytes/macrophages (CFU-GM) was approximately
2/103 nucleated cells. Cells were plated at
various concentrations (1 × 105 to 16 × 105 cells per dish) depending on the given
treatment. The percentage survival was calculated by the following
formula: percent survival = [(number of colonies after severe
heat challenge/number of cells plated)/(number of colonies after
primary heat/number of cells plated)] × 100.
Western blot analysis for hsp70 protein expression.
Whole-cell extracts (35 µg of total protein) were subjected to sodium
dodecyl sulfate-10% polyacrylamide gel electrophoresis and
transferred to a nitrocellulose filter (Bio-Rad, Hercules, Calif.).
Immunodetection using the enhanced chemiluminescence (ECL) method (ECL
kit; Amersham, Piscataway, N.J.) was performed according to the
manufacturer's instructions. The membrane was probed first with a
monoclonal antibody specific for the heat-inducible hsp70 (C92;
Amersham), antibody reacting to both Hsc70 and heat-inducible hsp70
(3A3; Affinity BioReagents Inc., Golden, Colo.), or antibody specific
to
-galactosidase (Promega, Madison, Wis.), and then it was probed
with an appropriate horseradish peroxidase-conjugated second antibody.
After ECL detection, the membrane was stripped and reprobed with a
rabbit polyclonal antibody specific to actin (Sigma, St. Louis, Mo.)
and horseradish peroxidase-conjugated anti-rabbit serum and detected
with ECL again. The blot was probed for actin with specific rabbit
polyclonal antibody (Sigma) to ensure that equivalent amounts of
protein were present in each lane.
Apoptosis and survival of MEFs deficient in expression of hsp70.1
or hsp70.3 following thermal challenge.
Mouse embryonic
fibroblasts (MEFs) were prepared from day 14 embryos and cultured in
Dulbecco's modified Eagle's medium supplemented with 10% fetal
bovine serum. To induce thermotolerance, cells were preconditioned with
a relatively mild heat shock (43°C for 20 min) and allowed to recover
at 37°C for 6 or 24 h before challenge with a lethal heat shock
(45°C for 30 min). Analyses were performed following a further
recovery at 37°C for 24 h. Cell viability and the level of
apoptosis after heat challenge were measured by staining with annexin
V-fluorescein isothiocyanate (FITC) and propidium iodide (Apoptosis
Detection kit; R & D Systems, Minneapolis, Minn.) according to the
manufacturer's instructions and analyzed using a FACSCalibur cytometer
(Becton Dickinson).
Measurement of caspase activity and cytochrome c
release.
Apoptotic caspase activity was assayed by immunoblotting
total cell lysates (50 µg of protein) with either antibody specific to caspase 9 (AAP; StressGen, Victoria, Canada) or antibody (H-250; Santa Cruz Biotechnology, Santa Cruz, Calif.) to one of the caspase substrates, poly(ADP-ribose) polymerase (PARP). For the detection of
cytochrome c release from the mitochondria, we followed the previously described procedures (50). The S-100 fraction
was prepared as follows. Following heat treatment of MEFs, cell pellets were washed once in ice-cold phosphate-buffered saline and resuspended with 5 volumes of buffer (20 mM HEPES-KOH [pH 7.5], 10 mM KCl, 1.5 mM
MgCl2, 1 mM sodium EDTA, 1 mM sodium EGTA, 1 mM
dithiothreitol, and 0.1 mM phenylmethylsulfonyl fluoride) containing
250 mM sucrose. Cells were homogenized and centrifuged at 10,000 × g for 15 min at 4°C. The supernatant of the 10,000 × g spin was further centrifuged at 100,000 × g for 1 h at 4°C, and equal amounts of protein (30 µg) present in the supernatant (S-100 fraction) were examined for
cytochrome c release by immunoblotting using antibody
specific to mouse cytochrome c (Pharmingen, San Diego,
Calif.).
 |
RESULTS |
Generation of mice deficient either in
hsp70.1 or
hsp70.3 by targeted gene replacement with
-galactosidase.
To study the function and transcriptional
regulation of hsp70.1 and
hsp70.3 in vivo, we devised a gene deletion
strategy involving replacement of nearly the entire
hsp70.1 or hsp70.3 coding
sequence with a lacZ-neo cassette (Fig.
1A and D). Five D3
embryonic cell clones resistant to G418 and FIAU, three clones
heterozygous for the inactivated hsp70.3 gene and
two clones heterozygous for the hsp70.1
gene, transmitted the disrupted allele to the germ line. Correct
targeting was demonstrated by Southern blotting with flanking 3'
genomic, external to the targeting vectors, and
neo-lacZ probes (Fig. 1B and E), and routine
genotyping of mice was performed by PCR (Fig. 1C and F). All
experiments using homozygous, heterozygous, or wild-type controls were
performed on F2 C57BL/6-129/SvJ mixed background
littermates from F1 heterozygous crosses. To
avoid potential interference of the tk-neo marker
gene on the expression of LacZ under the hsp70.3
or hsp70.1 promoter, mice were bred with C57BL/6
mice expressing the cre gene (provided by Pandelakis Koni,
Institute of Molecular Medicine and Genetics, Medical College of
Georgia, Augusta) to remove the neomycin selection marker. Experiments
presented in this report have been performed with mice containing the
selection marker in the targeted locus. However, analyses with mice in
which the neomycin gene has been removed from the targeted allele
confirm these results (data not shown). The
hsp70.1
/
or
hsp70.3
/
mice were
viable, born at the expected Mendelian distribution, and fertile, and
no distinguishable morphological or microscopic abnormalities were
detected in the different tissues analyzed.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1.
Construction of the targeting vectors for
hsp70.1 and
hsp70.3 genes and generation of mice
deficient for the hsp70.1 or
hsp70.3 gene. Restriction map of the
hsp70.3 (A) or
hsp70.1 (D) gene, showing the wild-type
allele (top), the targeting vector (middle), and the predicted targeted
allele following homologous recombination (bottom). The position of the
neo-lacZ and TK cassettes and probes for
Southern blotting analyses are indicated. The vectors were designed so
that the promoter of each hsp70.1 or
hsp70.3 gene drives the -galactosidase
expression. The probe to detect correct gene targeting by Southern
blotting was a 3' fragment of 0.4 kb
(BamHI-HindIII) for the
hsp70.3 gene locus and a 1.2-kb
(BamHI-BamHI) fragment for the
hsp70.1 gene locus. The restriction
enzymes are designated as follows: R, EcoRI; B,
BamHI; A, ApaI; N,
NotI; H, HindIII; E, EcoCRI.
Arrows indicate gene orientation for the
hsp70.1 or
hsp70.3 allele. (B and D) Southern
blotting analyses of tail DNA derived from wild-type (+/+),
heterozygous (+/ ), or homozygous ( / )
hsp70.3 mice (B) or
hsp70.1 mutant mice (D). The replacement
of the hsp70.3 gene by the
neo-lacZ cassette yields a 9-kb fragment
in addition to the 6-kb wild-type fragment, and replacement of the
hsp70.1 gene yields 12- and 9-kb
fragments. (C and F) PCR-based genotyping assay amplifies fragments of
0.6 and 1.1 kb for the wild-type and targeted
hsp70.3 loci (C) and fragments of 0.5 and
1.0 kb for the hsp70.1 loci (F),
respectively.
|
|
Tissue-specific expression of hsp70.3
and hsp70.1 during embryonic development
and in tissues of adult mice.
The remarkable inducibility of
hsp70i under acute stress conditions (i.e., thermal stress) led to the
current consensus that tightly controlled regulatory mechanisms have
evolved to ensure that this protein becomes active at the right time
and place but is otherwise silent. The tissue- and cell-specific hsp70i
expression profile, a critical aspect for understanding hsp70i function
in vivo, has not been well defined, primarily because of the lack of
adequate experimental approaches to monitor hsp70i expression in vivo.
To precisely study cell- and tissue-specific
hsp70i
expression, we have visualized

-galactosidase activity in the organs
of
hsp70.1+/
and
hsp70.3+/
mice that
faithfully reproduce the
hsp70i allele transcriptional
activity. We first sought to obtain direct evidence for spontaneous
hsp70i expression during embryo development in the absence
of
defined stress. From the mid-gestational stage (E12.5) onwards,
intense staining was visualized in the nasopharyngeal area and
later
(E14) over the entire skin surface. A clearer picture of
constitutive
tissue-specific
hsp70i expression was seen in late
gestational stage (E17) embryos, when organogenesis is essentially
complete, as shown in Fig.
2. An
overlapping expression pattern
was observed for both
hsp70i genes with remarkably high levels
detected over the
entire epidermis, cornea (not shown), oronasal
mucosa (including the
tongue and lips), and gastrointestinal tract
(on the epithelia of the
esophagus and forestomach). Note that
no expression of hsp70i was
observed on the epithelium of the
stomach. In the urinary system, both
genes were expressed in the
renal tubuli and bladder epithelium (Fig.
2). No significant expression
has been observed in other embryonic
tissues (data not shown),
indicating a restricted pattern for hsp70i
expression. Histological
analysis of tissues from neonates (day 1 or 2 after birth) revealed
similar patterns for spontaneous gene expression
(data not shown).
In addition, as shown in Fig.
3, the observed patterns
of
hsp70i expression were unaltered in the tissues of adult
(8 to 12 week
old) mice, with an exception found in the brain. Here,
marked
hsp70i expression was visualized in the hippocampus (dentate
gyrus,
C1, C2, and C3 regions) of cerebral sections from adult mice,
whereas no expression was seen in brain tissues derived from embryos
or
neonates.


View larger version (243K):
[in this window]
[in a new window]
|
FIG. 2.
Tissue-specific constitutive expression of hsp70.3 or
hsp70.3 during late embryonic development.
hsp70.1+/ and
hsp70.3+/ embryos were
recovered at E17, frozen, sectioned, and fixed and stained with X-Gal.
Sections were counterstained with eosin (pink). Arrows indicate blue
-galactosidase expression. Tissues presented are from the skin,
nasal cavity, tongue, esophagus, stomach, forestomach, and kidney. Note
that hsp70i expression was observed only in the
epithelium of the forestomach (arrow), whereas no constitutive
expression was noted in the stomach epithelium. Magnification for the
tongue, stomach, and forestomach, ×20. Magnification for the skin,
×200. Magnification for all other tissues, ×50.
|
|


View larger version (223K):
[in this window]
[in a new window]
|
FIG. 3.
Tissue-specific constitutive hsp70.1 and hsp70.3
expression in adult mice. Tissues from wild-type controls
(C57BL/6-129/SvJ)F2,
hsp70.1+/ , or
hsp70.3+/ adult mice (8 to
12 weeks old) were harvested, frozen, sectioned, and fixed and stained
with X-Gal. Sections were counterstained with eosin (pink). Arrows
indicate blue -galactosidase activity. hsp70i
expression is shown for the skin, tongue, esophagus, forestomach,
hippocampus, cornea, kidney, glomeruli, and bladder. Magnification for
the hippocampus, ×30. Magnification for the esophagus and kidney,
×70. Magnification for the skin, tongue, and forestomach, ×145.
Magnification for all other tissues, ×290.
|
|
In agreement with the histological findings reported above and with
earlier reports, there was no major difference in the
patterns of basal
(constitutive) hsp70i protein expression, as
detected by Western
blotting, in the tissues of adult mice (Fig.
4). However, comparison of protein levels
indicated that the total
amount of hsp70i decreased slightly (in +/

mice) or substantially
(in

/

mice) in comparison to control (+/+)
animals. This indicates
a lack of hsp70.3 or hsp70.1 compensation in
the overall hsp70i
protein expression level by the intact homologous
gene (i.e.,
hsp70.3 in
hsp70.1
/
mice and vice
versa). This observation was further confirmed
by indirect
immunohistochemical labeling of tissue sections using
antibody against
hsp70i (data not shown). Thus, the basal expression
of
hsp70i in certain tissues of embryonic and postnatal mice
suggests
that tissue-specific regulatory mechanisms operate to control
hsp70i expression under normal conditions.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Tissue-specific constitutive hsp70i protein expression
is diminished in hsp70.1- or hsp70.3-deficient
adult mice compared to wild-type controls. Levels of hsp70i protein
were assessed by immunoblotting protein extracts from the brain, skin,
esophagus, forestomach, and kidney tissues harvested from wild-type
(+/+), heterozygous (+/ ), or homozygous ( / )
hsp70.1 or
hsp70.3 mice. As a control for equal
protein loading, the blot was probed for actin.
|
|
hsp70.1 or
hsp70.3 gene activity is rapidly
up-regulated following thermal stress in tissues lacking constitutive
expression.
We next examined the effects of heat shock on
expression of hsp70i in tissues of adult mice.
hsp70.1+/
or
hsp70.3+/
mice were
exposed to a mild whole-body thermal stress (42°C for 45 min), and
hsp70i expression was assessed 6 h later. In agreement with
earlier observations of increased hsp70i protein levels following heat
shock, hsp70.1 or hsp70.3 expression increased dramatically in multiple
tissues, especially those lacking basal hsp70i expression. As shown in
Fig. 5, remarkably high
levels of hsp70i expression were observed in the liver, small
intestine, pancreas (although, interestingly, no expression was found
on the islets of Langerhans), and adrenal cortex. In the spleen, hsp70i
expression was found in a few accessory cells in the marginal zone and
in vascular endothelial cells. No detectable expression in lymphoid
cells was observed (data not shown). Expression of hsp70i in the heart was largely limited to cardiac muscles and the cardiovascular system
(coronary arterial vessels). In the testis, marked expression was found
in the interstitial (Leydig) cells, although spermatocytes lacked
hsp70 expression.


View larger version (227K):
[in this window]
[in a new window]
|
FIG. 5.
Tissue-specific hsp70.1
and hsp70.3 induction following
whole-body hyperthermic treatment of adult mice.
hsp70.1+/ and
hsp70.3+/ adult mice (8 to
12 weeks old) were semi-immersed in a circulating water bath at 42°C
for 45 min and left to recover for 6 h before euthanatization.
Untreated hsp70.1+/ mice
were used as controls (left panels). Tissues were prepared and stained
for -galactosidase activity as described in the legend to Fig. 3.
Arrows indicate blue -galactosidase staining. No -galactosidase
activity was detected in any of the tissue sections in wild-type mice
(data not shown). hsp70.1 or
hsp70.3 expression is shown for the
liver, small intestine, pancreas, adrenal gland, spleen, heart, and
testis. Magnification for the adrenal gland and heart, ×70.
Magnification for all other tissues, ×145.
|
|
As expected, hsp70i protein levels, as determined by Western blotting,
increased dramatically following heat shock in wild-type
control
animals.
hsp70.1+/
or
hsp70.3+/ 
mice exhibited
slightly reduced (less than twofold) levels compared
to wild-type mice
(data not shown), whereas a further significant
reduction in hsp70i
protein concentration (five- to eightfold)
was observed with the
hsp70.1
/
or
hsp70.3
/
mice (Fig.
6). As only slightly reduced levels
(compared to those
of wild-type mice) of basal or induced hsp70i
protein were detected
in heterozygous mice, it is unlikely that
inactivation of one
copy of the
hsp70.1 or
hsp70.3 allele altered the physiological
hsp70i
expression pattern in our analyses.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 6.
Reduced induction of hsp70i protein expression following
whole-body hyperthermic treatment in
hsp70.1- and
hsp70.3-deficient adult mice. Wild-type
(+/+), heterozygous (+/ ), or homozygous ( / )
hsp70.1- or
hsp70.3-deficient mice were anesthetized,
subjected to heat shock (42°C for 45 min), and allowed to recover for
6 h before euthanasia (indicated 42°C). Controls were mice
anesthetized but not exposed to heat shock (indicated C). Protein
extracts from different tissues were assessed by immunoblotting with
antibody specific to hsp70i (C92). The data show heat-induced hsp70i
protein levels in a selection of mouse tissues (heart, liver, pancreas,
and intestine) that lack basal (constitutive) hsp70i
expression.
|
|
Inactivation of the hsp70.1 or
hsp70.3 gene results in deficient
maintenance of acquired thermotolerance in bone marrow cells.
The
rapid induction of hsp70i in response to stress is thought to be
fundamental to the cellular protection process. Thus, an increased
level of hsp70i protein following sublethal heat stress, or
hyperthermic preconditioning, profoundly attenuates all of the
heat-induced cellular changes to a subsequent severe heat challenge (thermotolerance).
To determine whether inactivation of the individual
hsp70i
genes results in thermal sensitivity, we determined the thermal
response of bone marrow progenitors (CFU-GM) using a colony formation
assay as a quantitative measurement of cell survival. The ability
of
CFU-GM bone marrow cells to survive a second heat shock, which
corresponds to their ability to develop thermotolerance, was tested.
All cell types were preconditioned with a sublethal heat challenge
(43°C for 20 min) and were allowed to recover for various times
before exposure to a subsequent lethal heat challenge (44°C for
40 min). Exposure of nonpreconditioned cells to severe heat stress
showed
similar survival rates (approximately 0.01% surviving fraction)
regardless of the genotype. However, thermal preconditioning of
wild-type cells produced a significant level of thermotolerance
that
protects them from subsequent thermal stress (Fig.
7A). Cells
from heterozygous mice were
slightly more susceptible to thermal
stress then were cells from
wild-type mice. In contrast, preconditioned
cells from homozygous
hsp70i
/
mice were significantly more
susceptible to heat challenge (10-fold
at 24 h) than were cells
from wild-type mice. Interestingly, inactivation
of
hsp70.1 resulted in a more-rapid decay in
thermotolerance than
did deletion of
hsp70.3. The
capacity of
hsp70i-deficient bone
marrow cells to develop
thermotolerance correlated inversely with
hsp70 levels. This is
reflected by studying the kinetics of

-galactosidase
expression and
hsp70 protein synthesis after heat shock of bone
marrow derived from
+/+, +/

, or

/

mice (Fig.
7B and C). In
general, the kinetics of

-galactosidase expression in bone marrow
cells correlated closely
with the kinetics of hsp70i protein synthesis
in cells from wild-type
mice. No

-galactosidase expression was
detected under normal
physiological growth conditions; however,
the levels of

-galactosidase expression increased substantially
after heat shock
in bone marrow cells derived from heterozygous
or homozygous mutant
mice. In contrast to that observed with wild-type
mice, where heat
shock (43°C for 20 min) substantially increased
the hsp70i protein
level, we found that the level of hsp70i was
reduced in heterozygous
mutant mice to ~50% of the wild-type level
(as quantitated by
densitometry from results of immunoblotting
with C92 antibody). As
expected, a further, more dramatic, reduction
in the hsp70i protein
levels (five- to eightfold) was observed
with the homozygous
hsp70.1- or
hsp70.3-deficient mice. Note that
expression of
the hsp70 protein was detected with an antibody
specific to
stress-inducible hsp70i (designated C92) or an antibody
that detects
both inducible hsp70 and constitutively expressed
Hsc70 proteins
(designated 3A3).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 7.
Thermotolerance induction in bone marrow cells. (A) Bone
marrow progenitors from hsp70.3- or
hsp70.1-deficient mice exhibit reduced capacity in
maintenance of thermotolerance. Bone marrow cells from +/+ ( ), +/
( ), or / ( ) hsp70.1 or
hsp70.3 mice were tested for their
ability to develop thermotolerance. Cells preconditioned to heat
(43°C for 20 min) were rechallenged with a more-severe heat (44°C
for 40 min) at the times indicated during the recovery period at
37°C. The cells were subsequently plated for colony formation of
granulocytes, macrophages, or a mixture of both granulocytes and
macrophages, which were counted microscopically after the incubation of
the cells at 37°C for 8 days. The data represent percent survival for
each time point as described in Materials and Methods. Error bars
indicate the standard errors of the means for three replicates. (B and
C) The kinetics of heat-induced hsp70i protein expression in bone
marrow cells is significantly reduced in hsp70.3- or
hsp70.1-deficient mice. Bone marrow cells harvested from
hsp70.1 or
hsp70.3 +/+, +/ , or / mice were
left untreated or were heated at 43°C for 20 min. Cells were then
incubated at 37°C for 1, 2, 4, 6, or 24 h before collection and
analysis by immunoblotting with 35 µg of total cellular protein. The
antibodies used are indicated on the left. -Gal is a mouse
monoclonal antibody specific to -galactosidase protein. C92
recognizes the heat-inducible hsp70. 3A3 recognizes both the
constitutive and the heat-inducible hsp70. A rabbit polyclonal antibody
specific to actin was used as an indicator of loading. Protein
extracted from non-heat-treated cells was used as a control (indicated
C). Note that in hsp70.1 /
bone marrow cells, an hsp70 protein band is still obtained. This
represents hsp70.3 protein; the converse is true in
hsp70.3 / mice.
|
|
Inactivation of the hsp70.1 or
hsp70.3 gene results in increased
sensitivity to thermal stress-induced apoptotic cell death in
MEFs.
It has been suggested that the mode of hsp70i action in
acquired thermotolerance is the prevention of apoptotic death. hsp70i may function in this respect at both the level of cytochrome
c release and initiator caspase activation via direct
association with the caspase recruitment domain of Apaf-1 and
inhibition of apoptosome formation. However, the physiological
importance of this pathway is undefined.
To further clarify the requirement of hsp70i (hsp70.1 versus hsp70.3)
in cellular protection against thermal stress, and in
particular to
thermotolerance, we generated and studied primary
MEFs that differ only
in the presence or absence of
hsp70.1 or
hsp70.3. The growth rate of MEFs deficient in
hsp70.1 or
hsp70.3 was
similar to that of wild-type MEFs (data not shown). A more
striking
observation was made when we determined the apoptotic
cell death of the
thermotolerant MEF population using annexin
V-FITC. As the data
presented in Fig.
8A indicate,
we observed
a substantial reduction in
thermotolerance development, although
this was observed to a greater
extent in
hsp70.1- than in
hsp70.3-deficient
MEFs, compared to that in
wild-type cells. In addition, as predicted,
exposure of wild-type MEFs
to sublethal heat shock resulted in
dramatic induction of hsp70i
expression. However, hsp70i levels
were markedly reduced in
hsp70i-deficient MEFs (Fig.
8B).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 8.
Cumulative expression of both hsp70 genes
after heat shock is essential for maximal levels of thermotolerance
development and maintenance. (A) Inactivation of hsp70.1 or
hsp70.3 genes results in deficient maintenance of acquired
thermotolerance in MEFs. To induce thermotolerance, MEFs were
preconditioned with a relatively mild heat shock (43°C for 20 min)
and allowed to recover at 37°C for 6 or 24 h before challenge
with a lethal heat shock (45°C for 30 min). Analyses were performed,
following a further recovery at 37°C for 24 h, by staining
with annexin V-FITC and propidium iodide and by a
fluorescence-activated cell sorter. Percent cell survival of
heat-treated cell populations was calculated based on the staining
profile (annexin and propidium iodide double negative). Filled
bars, control MEFs; hashed bars, hsp70.3 /
MEFs; open bars, hsp70.1 / MEFs. (B) Exposure
of hsp70.1- or hsp70.3-deficient MEFs to
sublethal heat shock resulted in dramatically reduced induction of
hsp70i expression. MEFs derived from +/+, +/ , or /
hsp70.1 or
hsp70.3 mice were heat treated (43°C
for 20 min), and protein was extracted following recovery at 37°C for
the indicated time. hsp70i protein expression was detected by
immunoblotting with antibody specific to hsp70i (C92). Protein
extracted from non-heat-treated cells was used as a control (indicated
C). hsp70.3 or
hsp70.1 transcriptional activity was
detected by -galactosidase protein analysis, and actin was used as
an indicator of loading as described in Materials and Methods. (C)
Inactivation of hsp70.1 and hsp70.3 genes
increases MEF susceptibility to cell death through activation of the
intrinsic apoptotic pathway. MEFs derived from +/+ or /
hsp70.1 or
hsp70.3 mice were preconditioned with a
relatively mild heat shock (43°C for 20 min) and allowed to recover
at 37°C for 6 or 24 h before challenge with a lethal heat shock
(45°C for 30 min). Analyses were carried out following a further
recovery at 37°C for 24 h, except for cytochrome
c, which was analyzed following the 6-h recovery period.
Procaspase 9, PARP, mitochondrial cytochrome c release,
and actin, as a control for loading, from heat-treated cells were
assayed by immunoblotting. Protein extracted from non-heat-treated
cells was used as a control (indicated C). The lane designated
45°C represents protein extracted from cells heated 45°C for
30 min with no preconditioning treatment.
|
|
Next the requirement that, and the extent to which, hsp70i promotes
cell survival by inhibiting the intrinsic apoptotic pathway
was
assessed by examining the cytochrome
c/Apaf-1/caspase
9/caspase
3 pathway in wild-type and
hsp70.1- or
hsp70.3-deficient MEFs.
Note that heat-induced apoptosis can
be manifested by activation
of caspase 9 and cleavage of the caspase 3 substrate PARP. Protein
immunoblot analysis confirmed that caspase 9 was processed from
the proenzyme (46 kDa) to its active form (37 and 35 kDa) when
MEFs preconditioned to heat (43°C for 20 min) were exposed
to
severe heat shock (45°C for 30 min) (Fig.
8C). However, under
conditions of thermotolerance induction, the processing of procaspase
9 was significantly increased in
hsp70.1-deficient,
or to a lesser
degree in
hsp70.3-deficient, MEFs
compared to wild-type MEFs (Fig.
8C). A similar result was observed for
PARP processing. Our additional
observations revealed an increase in
mitochondrial cytochrome
c release, as detected by
immunoblot analysis, in
hsp70.1- or
hsp70.3-deficient MEFs compared to wild-type
MEFs. This was most
clearly seen for cells exposed to a severe heat
challenge, following
6 h of recovery from a relatively mild heat
shock (Fig.
8C). Thus,
selective susceptibility of
hsp70.1- or
hsp70.3-deficient MEFs
to heat reflects increased
cytochrome
c release from mitochondria
(correlating with
increased mitochondrial membrane permeability)
and caspase
activation.
Together, these observations suggest that the cumulative expression of
both
hsp70i genes after heat shock is essential for
maximal
levels of thermotolerance development and maintenance
and that a lack
of either gene reduces the ability of the cells
to maintain a tolerant
state. Thus, the duplication of the
hsp70.3 and
hsp70.1 genes does not represent simple
redundancy, but expression
of these genes is additive and is required
for the full protection
of bone marrow progenitors or MEFs and probably
other tissues
after
stress.
 |
DISCUSSION |
Although the functional and physical features of hsp70i as a
molecular chaperone have been well studied in vitro, their precise physiological roles and the regulatory networks that determine cell-
and tissue-specific expression of this chaperone molecule in vivo are
not well understood. The current paradigm is that tightly controlled
regulatory mechanisms have evolved to ensure that hsp70i
becomes active at the right time and place under acute stress
conditions (i.e., thermal stress) but is otherwise silent. However,
evidence of spontaneous hsp70i protein expression during embryo
development and postnatal growth has challenged this view (25,
31, 43). Another important issue concerns the functional requirement for both hsp70.1 and
hsp70.3 genes, which encode identical proteins,
not only in defense of the host against proteotoxic damage during
adverse (patho)physiological conditions but also under normal
conditions during development and in the adult. In the study described
here, gene targeting was used to generate mice harboring a null
mutation of the genes encoding hsp70i with an insertion of a
-galactosidase gene into the hsp70.3 or
hsp70.1 locus. Analyses conducted with these
animal models provide direct evidence that hsp70i is not
only up-regulated in response to stressful stimuli but also that
transcriptional programs exist for tissue-restricted constitutive
expression of this protein under normal conditions. The tissue-specific
expression patterns observed for the hsp70.3 and
hsp70.1 genes are virtually indistinguishable,
suggesting a similar mode of regulation for both genes at the
transcriptional level. While hsp70.3- or
hsp70.1-deficient mice are viable and fertile and
exhibit no obvious phenotypic abnormalities, inactivation of the
hsp70.1 or hsp70.3 gene
results in a marked reduction in hsp70i protein synthesis in different
mouse tissues under both normal and heat stress conditions. This is
reflected by increased sensitivity to thermal stress-induced apoptosis.
It is interesting that disruption of one hsp70 allele seems
to reduce overall hsp70 protein levels, despite the presence of a
nondisrupted allele. This phenomenon is particularly notable following
heat stress (Fig. 6, liver). While we currently have no explanation for
this observation, it is possible that one hsp70 gene may
influence the accumulation of other hsp70's at the protein level,
perhaps by acting to chaperone correct protein folding. Clearly, this is worthy of further investigation, and these studies are under way in
our laboratory. Overall, these findings suggest a redundancy of the
individual genes in embryonic development but a requirement for both
genes for optimal responses to stresses such as heat shock.
It is of great interest to understand the mechanisms and factors that
determine stress-induced versus persistent expression of
hsp70i under normal conditions, which is restricted to
certain tissues throughout embryonic development and in the adult. The remarkable induction of hsp70 in Drosophila melanogaster can
be achieved by a wide range of regulatory strategies, including the presence of multiple hsp70 genes in the genome
(21), the maintenance of an open chromatin configuration
on these genes even at normal temperatures (47) with RNA
polymerase arrested at the transcription start site (39),
and activation and nuclear transport of preexisting transcription
factors (HSFs) within 1 min of temperature shift (46).
These elaborate regulatory mechanisms have been proposed not only to
ensure rapid induction of hsp70 upon heat shock but also to maintain a
basal level of hsp70 expression at normal temperature and in the
absence of detectable stress. It is likely that similar mechanisms are
operative for the rapid stress-inducible or constitutive hsp70i
expression in mammals. However, direct evidence for this is lacking. It
should be noted that the pattern of constitutive and induced hsp70i
expression in the mouse, as detected by staining for
-galactosidase
activity in this study, faithfully reveals the expression pattern of
the endogenous hsp70i genes. However the data obtained by
this method differ significantly from existing data in the literature
(8, 24, 25, 44). This is due to the fact that many of the
previous studies conducted in this context have relied on studying
hsp70i expression using hsp70 promoter sequences to regulate
transgene (lacZ or luciferase) expression, conditions that
may not strictly reproduce its normal distribution. Tissue-restricted
or poor gene expression is not an infrequent effect in transgenic mice
and may result from the site of chromosomal integration of the
transgene and/or an inability to include in the expression vector all
sequences required to establish its native epigenetic organization. The
fact that the hsp70i promoter (an approximately 0.5 to 0.7 kb sequence upstream from the start of transcription) mostly restricts
expression of reporter genes to certain tissues and to stress-inducible
conditions leads us to predict that additional, as yet unidentified,
transcriptional regulatory elements are required for constitutive
expression of hsp70i and that they are located in distant
regions flanking the hsp70.1 or
hsp70.3 gene.
Transcriptional activation of hsp70i is mostly dependent on
the activation of the presynthesized HSFs which thereafter acquire the
ability to bind the tetrameric heat shock elements present in the
proximal promoter sequences of the hsp70.1 and
hsp70.3 genes. In addition to playing a key role
in the response to noxious stimuli, HSFs are widely believed to play a
role in spontaneous hsp70i expression during embryogenesis and
postnatal growth. However, only indirect and circumstantial evidence
exists for this, and such data remains open to the criticisms detailed
above. As far as the regulation of the tissue-specific hsp70i response
to stress is concerned, the role of HSF1 as the critical factor for
hsp70i protein synthesis following thermal stress is well characterized (35, 49). In this regard, analyses using the genetic
approach of breeding hsp70.1+/
-galactosidase mice on the HSF1-deficient genetic
background reveal that heat-induced hsp70i expression in mouse tissues
is entirely controlled by HSF1, but no significant changes in
constitutive hsp70i expression are observed, which suggests that HSF1
is not required for organ-specific expression of hsp70i (unpublished data). While these results suggest that HSF1 is indispensable for the
inducible expression of hsp70i upon thermal stress and obviously cannot
be functionally compensated for by other transcription factors, for
example, the structurally related HSF2, the specific function of these
factors in constitutive hsp70i expression remains unresolved. As HSF2
is found to be expressed ubiquitously both in tissues with inducible or
constitutive hsp70i expression (11, 38), it is less likely
that this factor is the key player in constitutive hsp70i expression.
In addition to the double overlapping heat shock element motifs, the
highly conserved promoter (approximately 300 bp) of both
hsp70.1 and hsp70.3
contains an array of regulatory elements, including at least two Sp1
boxes. Hence, it has been proposed that spontaneous expression of hsp70
in the embryo is regulated via Sp1 transcriptional activity
(5). However, it is difficult to explain a tissue-specific
regulated hsp70i expression solely on the basis of such a
ubiquitous transcription factor as Sp1. Thus, relatively little is
currently understood about the regulation of tissue-specific
constitutive expression of hsp70i in the absence of a measurable stress
response and its basal homeostatic function in particular tissues.
Clearly, the complexity of the molecular interaction between
transcription factors (mostly unknown) and trans or
cis regulatory elements on the hsp70i locus make it difficult to analyze their contribution to the specific pattern of
hsp70i expression. However, cooperation between transcription factors
(combinatory regulation) as a mechanism for conferring tissue-specificity may help to explain the hsp70i expression
patterns in our study. Thus, a combination of ubiquitous transcription factors (for example, many cell types produce Sp1, AP1, or AP2, and
putative binding sites for such factors are present in the hsp70i promoter regions), perhaps in combination with cell
type-specific factor(s), may regulate constitutive hsp70i expression in
a tissue-specific manner. Finally, continuous expression of hsp70 can
inhibit cell growth, and forced expression of hsp70 in
Drosophila cells can cause a reduction in growth without
affecting viability (9), but in other experimental
settings has been shown to be involved in differentiation and cell
proliferation (22, 45). It is apparent that these opposing
functional features of hsp70 depend on the level of hsp70i expression
in particular cells or tissues; for example, forced expression of hsp70
in cancerous cells can promote oncogenic transformation. Whether
tissue-specific constitutive hsp70i expression will also have
growth-inhibiting or -promoting effects cannot be easily assessed, but
it is likely that such effects will depend on several other factors,
such as cell cycle regulators. Further investigation of such
interactions using the models described in this report will likely
prove of value in elucidating these opposing facets of hsp70i
expression. Clearly, the characteristic tissue-specific developmentally
regulated pattern of hsp70i expression in this study is suggestive of
the involvement of this molecule in the differentiation and/or
proliferation of cells, perhaps acting to ensure protein fidelity in
the development and maintenance of tissue-specific cellular components.
An increased demand for the chaperoning function of hsp70 occurs at
many stages in the life of a cell and determines the outcome of a cell
faced with death. It is well known that stressful conditions, including
heat shock, may lead to cell death by three distinct modes:
reproductive (clonogenic) cell death, apoptosis, and necrosis. While
little is known about the mechanisms of stress-induced necrosis or
reproductive death, in apoptosis the initial damage does not directly
kill the cell but initiates specific signaling pathways that lead to
cellular suicide. The rapid induction of hsp70i in the response to
stress is thought to be fundamental to the cellular protection process.
In this regard, there is compelling evidence that resistance to stress
by cells primed with a mild heat shock that induces hsp's (especially
hsp70i) may be due to down-regulation of the signaling events that
initiate apoptosis. Increased sensitivity to thermal stress in MEFs
deficient in either the hsp70.3 or
hsp70.1 gene reported in this study can be
explained at least partially via the function of hsp70i in modulation
of the stress-induced intrinsic apoptotic pathway. However, heat shock
can also induce a caspase-independent type of cell death, which is
distinct from classical apoptosis and has been proposed to involve JNK
protein kinase activity (13, 32, 36). Evidence for
heat-induced JNK activity that remains at relatively higher levels for
a prolonged period in MEFs deficient in the
hsp70.1 or hsp70.3 gene
versus the wild type supports this hypothesis (data not shown).
Participation of hsp70i and heat shock-activated kinases in the
caspase-independent cell death of MEFs is likely. Definitive assessment
of the physiological importance of the above pathways in cellular
protection from apoptosis in response to harmful stress stimuli would
provide new insights into the role of hsp70i in different pathological
states in vivo. Together, the hsp70i gene products may
affect multiple apoptotic pathways, and cell type-specific differences
may account for the various points of hsp70i intervention in different
tissues. The availability of hsp70.1- and
hsp70.3-deficient mice provides an opportunity to
explore not only the extent to which the antiapoptotic function of
hsp70i is required in the protection of various tissues and cell types
from stress damage but also will enable us to investigate the molecular
basis for the antiapoptotic function of hsp70i. In addition,
identification and characterization of regulatory elements determining
tissue-specific constitutive and inducible expression of
hsp70.1 and hsp70.3 under
environmental stress conditions should provide valuable insights into
the role of hsp's as factors in the development and maintenance of
tissue-specific functions in a host. Finally, the use of these animal
models will allow the examination of whether hsp70i activity can be
compensated for by other members of the hsp family or whether hsp70i
has a unique function in cellular protection from environmental stress. Thus, these mutant mice provide a valuable experimental model to
achieve a better understanding of the fundamental cellular processes in
which hsp70i molecular chaperones engage in the response to
environmental stresses as well as to determine their role in clinically
relevant pathologies in humans.
 |
ACKNOWLEDGMENTS |
We thank Graeme Price for helpful discussions and suggestions and
Jing Zhang, Levent Keskintepe, and Hyan Qin for expert technical assistance.
This work was supported by National Institutes of Health grants GM63218
(to D.M.) and CA62130 (to N.F.M.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Molecular Medicine and Genetics, Medical College of Georgia, 1120 15th St. CB-2803, Augusta, GA 30912-3175. Phone: (706) 721-8738. Fax: (706)
721-8732. E-mail: moskophidis{at}immag.mcg.edu.
 |
REFERENCES |
| 1.
|
Agashe, V. R., and F.-U. Hartl.
2000.
Role of molecular chaperones in cytoplasmic protein folding.
Semin. Cell Dev. Biol.
11:15-25[CrossRef][Medline].
|
| 2.
|
Beere, H. M., and D. R. Green.
2001.
Stress-management heat shock protein-70 and the regulation of apoptosis.
Trends Cell Biol.
11:6-10[CrossRef][Medline].
|
| 3.
|
Beere, H. M.,
B. B. Wolf,
K. Cain,
D. D. Mosser,
A. Mahboubi,
T. Kuwana,
P. Tailor,
R. I. Morimoto,
G. M. Cohen, and D. R. Green.
2000.
Heat-shock protein 70 inhibits apoptosis by preventing recruitment of procaspase-9 to the Apaf-1 apoptosome.
Nat. Cell Biol.
2:469-475[CrossRef][Medline].
|
| 4.
|
Benjamin, I. J., and D. R. McMillan.
1998.
Stress (heat shock) proteins, molecular chaperones in cardiovascular biology and disease.
Circ. Res.
83:117-132[Abstract/Free Full Text].
|
| 5.
|
Bevilacqua, A.,
M. T. Fiorenza, and F. Mangia.
1997.
Developmental activation of an episomic hsp 70 gene promoter in two-cell mouse embryos by transcription factor SP1.
Nucleic Acids Res.
25:1333-1338[Abstract/Free Full Text].
|
| 6.
|
Bukau, B., and A. L. Horwich.
1998.
The HSP-70 and HSP-60 chaperone machines.
Cell
92:351-366[CrossRef][Medline].
|
| 7.
|
Chen, S., and D. F. Smith.
1998.
Hop as an adaptor in the hsp 70 and hsp 90 chaperone machinery.
J. Biol. Chem.
273:35194-35200[Abstract/Free Full Text].
|
| 8.
|
Christians, E.,
E. Michel, and J. P. Renard.
1997.
Developmental control of heat shock and chaperone gene expression.
Cell. Mol. Life Sci.
53:168-178[CrossRef][Medline].
|
| 9.
|
Feder, J. H.,
J. M. Rossi,
N. Solomon, and S. Lindquist.
1992.
The consequences of expressing hsp70 in Drosophila cells at normal temperatures.
Genes Dev.
6:1402-1413[Abstract/Free Full Text].
|
| 10.
|
Feder, M. E., and G. E. Hofmann.
1999.
Heat shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology.
Annu. Rev. Physiol.
61:243-282[CrossRef][Medline].
|
| 11.
|
Fiorenza, M. T.,
T. Farkas,
M. Dissing,
D. Kolding, and V. Zimarino.
1995.
Complex expression of murine heat shock transcription factors.
Nucleic Acids Res.
23:467-474[Abstract/Free Full Text].
|
| 12.
|
Freijtag, W.,
Y. Zhang,
R. Dai,
M. G. Anderson, and N. F. Mivechi.
2001.
Heat shock factor-4 (HSF-4a) represses basal transcription through interaction with TFIIF.
J. Biol. Chem.
18:14685-14694.
|
| 13.
|
Gabai, V. L.,
J. A. Yaglom,
V. Volloch,
A. B. Meriin,
T. Force,
M. Koutroumanis,
B. Massie,
D. D. Mosser, and M. Y. Sherman.
2000.
Hsp72-mediated suppression of c-Jun N-terminal kinase is implicated in development of tolerance to caspase-independent cell death.
Mol. Cell. Biol.
20:6826-6836[Abstract/Free Full Text].
|
| 14.
|
Gaskins, H. R.,
M. Prochazka,
J. H. Nadeau,
V. W. Henson, and E. H. Leiter.
1990.
Localization of a mouse heat shock Hsp70 gene within the H-2 complex.
Immunogenetics
32:286-289[Medline].
|
| 15.
|
Gerner, E. W., and M. J. Schneider.
1975.
Induced thermal resistance in HeLa cells.
Nature
256:500-502[CrossRef][Medline].
|
| 16.
|
Gething, M. J., and J. Sambrook.
1992.
Protein folding in the cell.
Nature
355:33-45[CrossRef][Medline].
|
| 17.
|
Glover, J., and S. Lindquist.
1998.
Hsp104, Hsp-70 and Hsp-40: a novel chaperone system that rescues previously aggregated proteins.
Cell
94:73-82[CrossRef][Medline].
|
| 18.
|
Gunther, E. G., and L. Walter.
1994.
Genetic aspects of the hsp 70 multigene family in vertebrates.
Experientia
50:987-1001[CrossRef][Medline].
|
| 19.
|
Hunt, C., and S. Calderwood.
1990.
Characterization and sequence of a mouse hsp 70 gene and its expression in mouse cell lines.
Gene
87:199-204[CrossRef][Medline].
|
| 20.
|
Ip, Y. T., and R. J. Davis.
1998.
Signal transduction by the c-Jun N-terminal kinase (JNK)-from inflammation to development.
Curr. Opin. Cell Biol.
10:205-219[CrossRef][Medline].
|
| 21.
|
Ish-Horowicz, D.,
S. M. Pinchin,
P. Shedl,
S. Artavanis-Tsakonas, and M. E. Mirault.
1979.
Genetic and molecular analysis of the 87A7 and 87C1 heat-inducible loci of D. melanogaster.
Cell
18:1351-1358[CrossRef][Medline].
|
| 22.
|
Jaattela, M.
1995.
Overexpression of hsp70 confers tumorigenecity to mouse fibrosarcoma cells.
Int. J. Cancer
60:689-693[Medline].
|
| 23.
|
Jolly, C., and R. I. Morimoto.
2000.
Role of heat shock response and molecular chaperones in oncogenesis and cell death.
J. Natl. Cancer Inst.
92:1564-1572[Abstract/Free Full Text].
|
| 24.
|
Kothary, R.,
S. Clapoff,
S. Darling,
M. D. Perry,
L. A. Morgan, and J. Rossant.
1989.
Inducible expression of an hsp68-lacZ hybrid gene in transgenic mice.
Development
105:707-714[Abstract/Free Full Text].
|
| 25.
|
Kothary, R.,
M. D. Perry,
L. A. Moran, and J. Rossant.
1987.
Cell-lineage-specific expression of the mouse hsp68 gene during embryogenesis.
Dev. Biol.
121:342-348[CrossRef][Medline].
|
| 26.
|
Kyriakis, J. M., and J. Avruch.
1996.
Protein kinase cascades activated by stress and inflammatory cytokines.
Bioessays
18:567-577[CrossRef][Medline].
|
| 27.
|
Li, G. C., and N. F. Mivechi.
1999.
Heat shock protein 70, p. 43-68.
In
D. S. Latchman (ed.), Handbook of experimental pharmacology, vol. 136. Springer-Verlag KG, Berlin, Germany.
|
| 28.
|
Li, G. C., and N. F. Mivechi.
1986.
Thermotolerance in mammalian systems: a review, vol. I.
CRC Press, Inc., Boca Raton, Fla.
|
| 29.
|
Lindquist, S.
1986.
The heat shock response.
Annu. Rev. Biochem.
55:1151-1191[CrossRef][Medline].
|
| 30.
|
Lindquist, S., and E. A. Craig.
1988.
The heat shock proteins.
Annu. Rev. Genet.
22:631-677[CrossRef][Medline].
|
| 31.
|
McMurtry, A. L.,
K. Cho,
L. J. T. Young,
C. F. Nelson, and D. G. Greenhalgh.
1999.
Expression of hsp 70 in healing wounds of diabetic and nondiabetic mice.
J. Surg. Res.
86:36-41[CrossRef][Medline].
|
| 32.
|
Meriin, A. B.,
J. A. Yaglom,
V. L. Gabai,
D. D. Mosser,
L. Zon, and M. Y. Sherman.
1999.
Protein-damaging stresses activate c-Jun N-terminal kinase via inhibition of its dephosphorylation: a novel pathway controlled by HSP72.
Mol. Cell. Biol.
19:2547-2555[Abstract/Free Full Text].
|
| 33.
|
Milarski, K. L., and R. I. Morimoto.
1989.
Mutational analysis of the human hsp 70 protein: distinct domains for nucleolar localization and adenosine triphosphate binding.
J. Cell Biol.
109:1947-1962[Abstract/Free Full Text].
|
| 34.
|
Mivechi, N. F., and G. C. Li.
1986.
Lack of development of thermotolerance in early progenitors of murine bone marrow cells.
Cancer Res.
46:198-202[Abstract/Free Full Text].
|
| 35.
|
Morimoto, R. I.
1998.
Regulation of the heat shock transcriptional response: cross talk between a family of heat shock factors, molecular chaperones, and negative regulators.
Genes Dev.
12:3788-3796[Free Full Text].
|
| 36.
|
Mosser, D. D.,
A. W. Caron,
L. Bourget,
A. B. Merliin,
M. Y. Sherman,
R. I. Morimoto, and B. Massie.
2000.
The chaperone function of hsp70 is required for protection against stress-induced apoptosis.
Mol. Cell. Biol.
20:7146-7159[Abstract/Free Full Text].
|
| 37.
|
Planas, A. M.,
M. A. Soriano,
A. Estrada,
O. Sanz,
F. Martin, and I. Ferrer.
1997.
The heat shock stress response after brain lesions: induction of 72 kDa heat shock protein (cell types involved, axonal transport, transcriptional regulation) and protein synthesis inhibition.
Prog. Neurobiol.
51:607-636[CrossRef][Medline].
|
| 38.
|
Rallu, M.,
M. Loones,
Y. Lallemand,
R. Morimoto,
M. Morange, and V. Metger.
1997.
Function and regulation of heat shock factor 2 during mouse embryogenesis.
Proc. Natl. Acad. Sci. USA
94:2392-2397[Abstract/Free Full Text].
|
| 39.
|
Rougvie, A. E., and J. T. Lis.
1988.
The RNA polymerase II molecule at the 5' end of the uninduced hsp70 gene of D. melanogaster is transcriptionally engaged.
Cell
54:795-804[CrossRef][Medline].
|
| 40.
|
Saleh, A.,
S. M. Srinivasula,
L. Balkir,
P. D. Robbins, and E. S. Alnemri.
2000.
Negative regulation of the Apaf-1 apoptosome by Hsp70.
Nat. Cell Biol.
2:476-483[CrossRef][Medline].
|
| 41.
|
Smith, D. F.,
L. Whitesell, and E. Katsanis.
1998.
Molecular chaperones: biology and prospects for pharmacological intervention.
Pharmacol. Rev.
50:493-513[Abstract/Free Full Text].
|
| 42.
|
Tanabe, M.,
N. Sasai,
K. Nagata,
X.-D. Liu,
P. C. C. Liu,
D. J. Thiele, and A. Nakai.
1999.
The mammalian HSF4 gene generates both an activator and a repressor of heat shock genes by alternative splicing.
J. Biol. Chem.
274:27845-27856[Abstract/Free Full Text].
|
| 43.
|
Tanguay, R. M., and E. W. Khandjian.
1993.
Tissue-specific expression of heat shock proteins of the mouse in the absence of stress.
Dev. Genet.
14:112-118[CrossRef][Medline].
|
| 44.
|
Thomson, E. M.,
E. Legouy,
E. Christians, and J.-P. Renard.
1995.
Progressive maturation of chromatin structure regulates hsp 70.1 gene expression in the preimplantation mouse embryo.
Development
121:3425-3437[Abstract].
|
| 45.
|
Volloch, V., and M. Y. Sherman.
1999.
Oncogenic potential of hsp 72.
Oncogene
18:3648-3651[CrossRef][Medline].
|
| 46.
|
Wang, Z., and S. Lindquist.
1998.
Developmentally regulated nuclear transport of transcription factors in Drosophila embryos enable the heat shock response.
Development
125:4841-4850[Abstract].
|
| 47.
|
Wu, C.
1980.
The 5' ends of Drosophila heat shock genes in chromatin are hypersensitive to DNase I.
Nature
286:854-860[CrossRef][Medline].
|
| 48.
|
Wu, C.
1995.
Heat shock transcription factors: structure and regulation.
Annu. Rev. Cell Dev. Biol.
11:441-469[CrossRef][Medline].
|
| 49.
|
Xiao, X. Z.,
X. X. Zuo,
A. A. Davis,
D. R. McMillan,
B. B. Curry,
J. A. Richardson, and I. J. Benjamin.
1999.
HSF1 is required for extra-embryonic development, postnatal growth and protection during inflammatory responses in mice.
EMBO J.
21:5943-5952[CrossRef][Medline].
|
| 50.
|
Yang, J.,
X. Liu,
K. Bhalla,
C. N. Kim,
A. M. Ibrado,
J. Cai,
T.-S. Peng,
D. P. Jones, and X. Wang.
1997.
Prevention of apoptosis by Bcl2: release of cytochrome c from mitochondria blocked.
Science
275:1129-1132[Abstract/Free Full Text].
|
Molecular and Cellular Biology, December 2001, p. 8575-8591, Vol. 21, No. 24
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.24.8575-8591.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chin, P. Y., Macpherson, A. M., Thompson, J. G., Lane, M., Robertson, S. A.
(2009). Stress response genes are suppressed in mouse preimplantation embryos by granulocyte-macrophage colony-stimulating factor (GM-CSF). Hum Reprod
24: 2997-3009
[Abstract]
[Full Text]
-
Vanderwaal, R. P., Maggi, L. B. Jr., Weber, J. D., Hunt, C. R., Roti Roti, J. L.
(2009). Nucleophosmin Redistribution following Heat Shock: A Role in Heat-Induced Radiosensitization. Cancer Res.
69: 6454-6462
[Abstract]
[Full Text]
-
Metchat, A., Akerfelt, M., Bierkamp, C., Delsinne, V., Sistonen, L., Alexandre, H., Christians, E. S.
(2009). Mammalian Heat Shock Factor 1 Is Essential for Oocyte Meiosis and Directly Regulates Hsp90{alpha} Expression. J. Biol. Chem.
284: 9521-9528
[Abstract]
[Full Text]
-
Hwang, S. O., Boswell, S. A., Seo, J.-S., Lee, S. W.
(2008). Novel Oxidative Stress-responsive Gene ERS25 Functions as a Regulator of the Heat-shock and Cell Death Response. J. Biol. Chem.
283: 13063-13069
[Abstract]
[Full Text]
-
Flowers, M. T., Keller, M. P., Choi, Y., Lan, H., Kendziorski, C., Ntambi, J. M., Attie, A. D.
(2008). Liver gene expression analysis reveals endoplasmic reticulum stress and metabolic dysfunction in SCD1-deficient mice fed a very low-fat diet. Physiol. Genomics
33: 361-372
[Abstract]
[Full Text]
-
Lee, J.-S., Lee, J.-J., Seo, J.-S.
(2005). HSP70 Deficiency Results in Activation of c-Jun N-terminal Kinase, Extracellular Signal-regulated Kinase, and Caspase-3 in Hyperosmolarity-induced Apoptosis. J. Biol. Chem.
280: 6634-6641
[Abstract]
[Full Text]
-
Gilks, N., Kedersha, N., Ayodele, M., Shen, L., Stoecklin, G., Dember, L. M., Anderson, P.
(2004). Stress Granule Assembly Is Mediated by Prion-like Aggregation of TIA-1. Mol. Biol. Cell
15: 5383-5398
[Abstract]
[Full Text]
-
Deora, A. B., Kreitzer, G., Jacovina, A. T., Hajjar, K. A.
(2004). An Annexin 2 Phosphorylation Switch Mediates p11-dependent Translocation of Annexin 2 to the Cell Surface. J. Biol. Chem.
279: 43411-43418
[Abstract]
[Full Text]
-
Katschinski, D. M.
(2004). On Heat and Cells and Proteins. Physiology
19: 11-15
[Abstract]
[Full Text]
-
Hafizur, R. Md., Yano, M., Gotoh, T., Mori, M., Terada, K.
(2004). Modulation of Chaperone Activities of Hsp70 and Hsp70-2 by a Mammalian DnaJ/Hsp40 Homolog, DjA4. J Biochem
135: 193-200
[Abstract]
[Full Text]
-
Izu, H., Inouye, S., Fujimoto, M., Shiraishi, K., Naito, K., Nakai, A.
(2004). Heat Shock Transcription Factor 1 Is Involved in Quality-Control Mechanisms in Male Germ Cells. Biol. Reprod.
70: 18-24
[Abstract]
[Full Text]
-
Li, Y., Roth, S., Laser, M., Ma, J.-x., Crosson, C. E.
(2003). Retinal Preconditioning and the Induction of Heat-Shock Protein 27. IOVS
44: 1299-1304
[Abstract]
[Full Text]