Previous Article | Next Article 
Molecular and Cellular Biology, February 2001, p. 765-770, Vol. 21, No. 3
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.3.765-770.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Molecular Cloning and Functional Analysis of
Mouse C-Terminal Kinesin Motor KifC3
Zhaohuai
Yang,1
Chun-hong
Xia,1
Elizabeth A.
Roberts,1
Kevin
Bush,2
Sanjay K.
Nigam,2 and
Lawrence S. B.
Goldstein1,*
Howard Hughes Medical Institute, Department
of Cellular and Molecular Medicine,1 and
Howard Hughes Medical Institute, Departments of Pediatrics and
Medicine,2 University of California San
Diego, La Jolla, California 92093
Received 7 November 2000/Accepted 10 November 2000
 |
ABSTRACT |
Proteins of the kinesin superfamily define a class of
microtubule-dependent motors that play crucial roles in cell division and intracellular transport. To study the molecular mechanism of
intracellular transport involving microtubule-dependent motors, a cDNA
encoding a new kinesin-like protein called KifC3 was cloned from a
mouse brain cDNA library. Sequence and secondary structure analysis
revealed that KifC3 is a member of the C-terminal motor family. In
contrast to other mouse C-terminal motors, KifC3 is apparently
ubiquitous and may have a general role in intracellular transport. To
understand the in vivo function of the KifC3 gene, we used
homologous recombination in embryonic stem cells to construct knockout
mouse strains for the KifC3 gene. Homozygous mutants of the
KifC3 gene are viable, reproduce normally, and apparently develop normally. These results suggest that KifC3 is
dispensable for normal development and reproduction in the mouse.
| |
INTRODUCTION |
Microtubule-dependent motors of the
kinesin superfamily have undergone structural and functional
diversification during evolution and play crucial roles in cell
division and intracellular transport (5, 7). Members of
this superfamily use the energy of ATP hydrolysis to translocate
cargoes along microtubules or to carry out other cellular activities
and share extensive sequence similarity within a motor domain
containing the microtubule and ATP binding sites (24). As
a group, kinesins can be categorized by their motility as either
plus-end- or minus-end-directed motors. While most kinesins such as
true kinesin (conventional kinesins or kinesin I) are
plus-end-directed motors, so far all tested members of the
C-terminal kinesins are minus-end-directed motors (2). One
distinct feature of the C-terminal kinesins is that they share the same
"reverse" structural organization in which the motor domain is
located at the C terminus of the polypeptide chain. Most C-terminal
kinesins have been suggested to play roles in cell division. Examples
from this family include (but are not limited to) three fungal
C-terminal kinesins, KAR3 (14) in Saccharomyces cerevisiae, klpA (18) in Aspergillus
nidulans, and pkl1 (19) in Schizosaccharomyces
pombe; ncd (13, 26) in Drosophila
melanogaster; XCTK2 (25) in Xenopus
laevis; HSET (1) in humans; KifC1 (22), KifC4 (29), and KifC5 (17) in mice; and CHO2
(12) in Chinese hamster ovary cells. Each of these may
play a role in mitotic and/or meiotic spindle assembly or in driving or
maintaining spindle pole separation.
Recently, isolation of several new genes encoding C-terminal kinesins
identified from different species expanded the variety of suggested
functions and structures of the C-terminal kinesin motors. In mouse,
the C-terminal motor KifC2 was specifically expressed in neural
tissues such as brain, spinal cord, and sciatic nerve (6,
22). The cellular location of the KifC2 proteins was found
mainly in neural cell bodies and dendrites as well as axons, which
suggests that KifC2 may play roles in dendrite and axonal transport.
Interestingly, a new class of C-terminal kinesins called kinesin-like
calmodulin-binding proteins (KCBP) was isolated first in plants
(20, 27) and then in sea urchin eggs (21). One distinguishing feature of KCBP is a calmodulin-binding domain adjacent to its motor domain, which has the ability to bind calmodulin in the presence of Ca2+. KCBP in Arabidopsis was
localized to mitotic microtubule arrays, suggesting a role for KCBP in
establishing mitotic microtubule arrays mediated by
Ca2+-calmodulin (11, 16).
In this paper, we report our results of a functional analysis of the
mouse kinesin motor KifC3. Sequence and secondary structure analysis
revealed that KifC3 is a member of the C-terminal motor family. In
contrast to other mouse C-terminal motors KifC1 (22), KifC4 (29), and KifC5 (17), which are
primarily expressed in proliferative tissues and cell lines, and KifC2
(6, 22), which is specifically expressed in neural
tissues, KifC3 is apparently ubiquitous. The expression pattern of
KifC3 suggests that it has a general role in intracellular transport.
To understand the in vivo function, we developed knockout mouse strains
for the KifC3 gene. Surprisingly, homozygous mutants of the
KifC3 gene are viable, reproduce normally, and apparently
develop normally. These results suggest that KifC3 is dispensable for
normal development and reproduction in the mouse.
| |
MATERIALS AND METHODS |
Cloning and sequence analysis of KifC3.
A PCR fragment
encoding the KifC3 partial motor domain was used for isolating a KifC3
cDNA clone from a BALB/c neonatal mouse brain cDNA library as
previously described (29). A 3.0-kb, apparently full-length KifC3 cDNA was completely sequenced on both strands. DNA
sequence analysis was performed with the University of Wisconsin Genetics Computer Group (UWGCG) Sequence Analysis software package (4).
Northern blot analysis.
Total RNA was prepared from mouse
tissues by guanidinium isothiocyanate extraction as previously
described (3) and analyzed in 1% formaldehyde agarose
gels by standard methods (23). RNA was transferred to
GeneScreen Plus membrane (NEN) in 10× SSC (1× SSC is 0.15 M NaCl plus
0.015 M sodium citrate). Prehybridization and hybridization were
performed in 6× SSC, 5× Denhardt's solution, 1% sodium dodecyl
sulfate, and 100 µg of single-stranded DNA per ml at 65°C. Final
washes were carried out at 65°C in 0.2× SSC and 0.1% sodium dodecyl sulfate.
Generation of targeting vector and ES cells.
We made a
targeting vector starting with one 12.5-kb DNA
SalI/NheI fragment (see Fig. 3A) isolated from a
129/SvJ genomic library (a gift from the laboratory of Jamey Marth) by
using the full-length KifC3 cDNA. One 6.5-kb DNA fragment between the
first ClaI and BglII (see Fig. 3A) encoding amino
acid residues from 197 to 507 of the KifC3 protein was replaced by an
SA-IRES-
geo cassette (15). This cassette contains an
en-2 splice acceptor (SA), an internal ribosome entry site (IRES), and
a fusion of genes lacZ and neo (geo). The
targeting vector was linearized with SalI (see Fig. 3A) and
introduced into R1 embryonic stem (ES) cells by electroporation as
previously described (10). The targeted KifC3 allele was
detected by Southern blotting of ES cell genomic DNA using a 1.0-kb
SalI/EcoRV DNA fragment (see Fig. 3A). The
targeted KifC3 allele was confirmed by Southern blotting
with different restriction enzymes and probes.
Generation and genotypes of KifC3 knockout mice.
Chimeric
mice (129/SvJ-derived ES cells in blastocysts of C57BL/6J mice) were
generated as previously described (10). Heterozygous mice
were used for interbreeding to produce knockout
(KifC3
/) and wild-type (KifC3+/+) mice. A
set of four primers was used for genotyping the mice. Two primers based
on KifC3 sequences (forward, TGCAGCGGCAGGTGCTGAAG; reverse,
AGGTTCTCGTGTACTGCCTT) were used for PCR to amplify a 800-bp
DNA fragment which is missed in the KifC3 mutant locus. Another two
primers (a forward primer based on the lacZ sequence, GATGGATTGCACGCAGGTTCT; a reverse primer based on the gene
neo, AGGTAGCCGGATCAAGCGTAT) were used for
amplifying a 450-bp DNA fragment which is missed in the wild-type
KifC3 locus. The genotypes of the KifC3 mice as determined by PCR were
confirmed by Southern blotting.
Analysis of KifC3 knockout mice.
Gross and histopathological
analysis employed standard techniques. Littermate KifC3+/+
and KifC3/ mice were examined for appearance, posture,
circadian activity, home cage assessment, rotarod task performance,
balance, and fear conditioning. These behavioral tests were carried out
using standard protocols.
Nucleotide sequence accession number.
Sequence data for
KifC3 were submitted to EMBL and GenBank under accession no. AF013118.
| |
RESULTS |
Cloning and sequence analysis of the KifC3 cDNA.
As described
(29), several cDNAs encoding new kinesin-like motors were
identified and cloned from a mouse brain cDNA library. One of those
clones was designated KifC3 because its motor domain is located at the
C terminus of the protein. This clone has a total length of 3,000 bp
and contains a single open reading frame that predicts a 710-amino-acid
polypeptide (90 kDa) with the conserved motor domain at its C terminus
(Fig. 1).
View larger version (131K):
[in this window]
[in a new window]
|
FIG. 1.
Sequence analysis of KifC3. Predicted amino acid
sequence alignment of KifC3 with KifC1, KifC2, hKifC3, and fKif2.
Identical amino acids and conserved, but not identical, amino acids in
the five polypeptides are shown in black and shaded boxes,
respectively. The alignment was performed with the UWGCG software
package (4) and boxed with the program BOXSHADE 3.21 (http://www.ch.embnet.org/software/BOX_form.html). These sequence
data are available from EMBL and GenBank under the following accession
numbers: KifC1, D49544; KifC2, U92949; KifC3, AF013118; hKifC3,
AF004426; and fKifC2, U64819.
|
|
Comparison of the sequence of KifC3 to other members of the kinesin
superfamily using the UWGCG program PILEUP (
4) indicated
that KifC3 is a member of the C-terminal kinesin family, which
contains
the conserved motor domain at the C-terminal end of the
proteins. To
date, all tested members of the C-terminal family
have
minus-end-directed microtubule motor activity. Thus, it is
conceivable
that KifC3 is a motor protein which has minus-end-directed
microtubule
motor activity. Except for human KifC3 (hKifC3) (
8)
and
fish Kif2 (fKif2) (
9), the conserved region between KifC3
and other C-terminal motors is primarily limited to the conserved
C-terminal motor domain (Fig.
1). However, KifC3 is very similar
to
hKifC3 (95.9% amino acid identity in the whole protein) and
fKif2
(69.4% amino acid identity in the whole protein). In
contrast,
KifC3 is only 55.3% identical to KifC1 in the whole
protein, even
though both KifC1 and KifC3 are C-terminal motors in
mice. These
results suggest that mouse KifC3 is a homologue of hKifC3
and
fKif2.
KifC3 expression patterns.
To probe the biological role of
KifC3, Northern analysis was used to examine its expression patterns in
various mouse tissues and cell lines (Fig.
2). KifC3 carries two transcripts of 3.3 and 2.3 kb (Fig. 2A). While the transcript of 2.3 kb is only present in
testis, the other transcript is apparently ubiquitous in mouse tissues
and cell lines, even though KifC3 expression is more abundant in kidney
and testis. By comparison, KifC4, a C-terminal motor in mouse cells
which has been suggested to play roles in cell division
(29), is present only in highly proliferative cells such
as ES cells and testis cells (Fig. 2B), and Kif3C, an N-terminal motor
in mouse which has been suggested to play its role in axonal transport
(28, 29), is present only in brain (Fig. 2C). The expression pattern may suggest that KifC3 has a general role in intracellular transport.
View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
Analysis of expression of KifC3 in mouse tissues and
cell lines. A set of duplicate Northern blots was probed with KifC3 (A)
(two transcripts of 3.3 and 2.3 kb were detected in most mouse tissues
and cell lines), KifC4 (B) (one transcript of 2.3 kb was detected only
in ES cells and testis), and KifC3 (C) (two transcripts of 7.2 and 4.3 kb were detected only in brain).
|
|
Deletion of KifC3 gene in mice.
To explore the in
vivo function of the KifC3 gene, we generated a mouse strain
lacking a 6.5-kb DNA fragment in the KifC3 gene. The
strategy for targeting the KifC3 gene in ES cells is shown
in Fig. 3A. The 6.5-kb DNA fragment
encodes amino acid residues 197 to 507 of the KifC3 protein, and the
deleted region contains half of its 
-coiled-coil domain and half of
its motor domain. The deleted motor domain contains functional ATP
binding and ATPase activity sites. The targeting vector was
introduced into R1 ES cells, and G418-resistant clones were selected
and analyzed by Southern analysis. Several independent clones with a
deletion in the KifC3 gene were obtained (Fig. 3B). In
Southern blot analysis, when the ES cell genomic DNA was cut with
EcoRI and probed with a 1.0-kb
SalI/EcoRV DNA fragment, the wild-type and
targeted KifC3 alleles were detected as 10- and 8-kb bands,
respectively (Fig. 3B). The deletion in ES cells was confirmed with
different restriction enzymes and probes in Southern analysis.
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 3.
Generation and analysis of KifC3 mutants in ES cells.
(A) Strategy for generating KifC3 knockout mice. One 6.5-kb DNA
fragment between ClaI and BglII was replaced with
an SA-IRES-geo cassette. This cassette contains an en-2 SA, an IRES,
and a fusion of lacZ and neo genes (geo). The
targeting vector was linearized with SalI. (B) Southern
analysis of ES cells. The wild-type (WT) and targeted KifC3 (Mut)
alleles were detected as 10- and 8-kb bands, respectively, in Southern
blot analysis of ES cell genomic DNA cut with EcoRI (RI) and
probed with a 1.0-kb SalI/RcoRV fragment. RV,
RcoRV; Bam, BamHI.
|
|
When the 129/SvJ-derived ES cells with a deletion in the
KifC3 gene were injected into the blastocysts of C57BL/6J
mice, several
chimeras were generated. When the chimeras were
backcrossed to
C57BL/6J mice, heterozygous mice were obtained. The
heterozygous
mice were used for interbreeding to produce knockout
(KifC3
/) and wild-type (KifC3
+/+) mice. The
deletion was confirmed first by PCR and Southern blot
analysis (Fig.
4A) and then by
Northern blot analysis (Fig.
4B).
In genomic PCR analysis of the KifC3
mice, an 800-bp DNA fragment,
which represents the
KifC3
wild-type allele, is found in both
the wild-type (+/+) and heterozygous
(+/
) mice but not in the
homozygous mutants (
/
). In contrast, a
450-bp DNA fragment,
which represents the
KifC3 mutated
allele, is found in both the
heterozygous (+/
) and homozygous (
/
)
mutants, but not in the
wild type (+/+). The results from PCR analysis
were confirmed
by Southern blot analysis using the same enzyme and
probe as described
in the legend to Fig.
3B (Fig.
4A). In Northern blot
analysis
of total RNA obtained from kidney and testis tissue of the
knockout
mice and wild-type littermates, no KifC3-specific mRNA was
observed
in KifC3 homozygous mutants with the cDNA corresponding to
the
deleted region of the
KifC3 gene (Fig.
4B). The same
results were
obtained using a cDNA probe corresponding to the 3'
nondeleted
region.
View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4.
Analysis of KifC3 knockout mice. (A) PCR and Southern
analysis of the KifC3 knockout mice. The primers for PCR and probe for
Southern analysis are described in Materials and Methods. (B) Northern
analysis of KifC3 knockout mice. Total RNA was isolated from the kidney
and testis of KifC3 mice (+/+, +/, and /), and the Northern blot
was probed with a cDNA fragment, which corresponds to the deleted
region of the KifC3 gene.
|
|
Analysis of KifC3 knockout mice.
Mice that carried one copy of
the deleted gene were interbred to generate litters that were +/+,
+/, and / for KifC3 as determined by genomic PCR and Southern
blot analysis. Of 169 offspring from heterozygous parents, there
were 48 wild-type (+/+), 79 heterozygous (+/), and 42 homozygous (/) animals. The ratios of +/+, +/, and / mice
from the heterozygous parents yielded the predicted Mendelian ratios of
1:2:1 (0.75 > P [
2 = 1.14] > 0.50) as expected for nonlethal alleles. Thus, the KifC3 knockout pups
were no less viable than their wild-type and heterozygous littermates.
Mice heterozygous or homozygous for the KifC3 deletion appeared
healthy, developed normally, and did not display any impairment of
reproductive capacity and neonatal survival. The breeding pairs with
either heterozygous × heterozygous or homozygous × homozygous animals produced litters similar in size to those produced
by wild-type breeding pairs, demonstrating that the absence of the
KifC3 protein does not hinder the fertility of male or female mice.
At a gross phenotypic level, the absence of KifC3 had no discernible
impact. KifC3
/ mice were indistinguishable from their
wild-type littermates
with respect to body weight, body length, head
length, and tail
length. In addition, they exhibited no macroscopic or
microscopic
alterations in all organs examined (spleen, kidney, brain,
testis,
retina, and heart). Figure
5
shows the morphology of kidney tissue
from wild-type (Fig.
5A, C, and
E) and KifC3 knockout (Fig.
5B,
D, and F) mice. We found no differences
in white or red blood
cell counts or in levels of hemoglobin between
wild-type and knockout
mice, nor were alterations in embryonic
development observed.
Biochemical analysis of serum samples (potassium,
chloride, glucose,
blood urea nitrogen, creatinine, total protein,
albumin, total
bilirubin, aspartate transaminase, alanine transaminase,
alkaline
phosphatase, gamma glutamyltransferase, calcium, phosphorus,
cholesterol,
triglycerides, and globulin) and urine samples (color,
clarity,
glucose, ketones, occult blood, protein, nitrite, bilirubin,
specific
gravity, pH, urobilinogen, leukocyte esterase, epithelial
cells,
casts, mucus, white blood cells, red blood cells, and crystals)
did not show any difference between wild-type and knockout mice.
These
results suggest that KifC3 is dispensable for normal development
and
reproduction in mice.
View larger version (215K):
[in this window]
[in a new window]
|
FIG. 5.
Morphology of kidney tissue from wild-type (A, C, and E)
and knockout (B, D, and F) mice. Kidneys from adult animals were
isolated, fixed in paraformaldehyde, and embedded in paraffin. Sections
were stained with hematoxylin and eosin. Bar = 100 µm (A to D)
and 50 µm (E and F).
|
|
| |
DISCUSSION |
Our analysis of a new mouse kinesin motor, KifC3, adds to the
variety of known structures and functions of the kinesin C-terminal motors. We explored the functions of this new kinesin motor gene by
using molecular biological and mouse genetic approaches.
The ubiquitous expression of the KifC3 gene in mouse tissue
may suggest that KifC3 has a wide biological function. As shown by
Northern blot analysis, KifC3 is apparently expressed more abundantly
in retina and kidney, which indicates that KifC3 may have a function
related to retina and kidney function. However, when the
KifC3 gene was disrupted the kidneys and retinas apparently function normally in homozygous mutant mice. When serum and urine samples from the mutated mice were subjected to a variety of chemical analyses, the results did not show any difference between the mutants
and their littermates, which suggests that kidneys in the mutant mice
function normally. When a variety of histological analyses were used to
examine the kidney tissue section, no difference was found between the
KifC3 mutants and their wild-type littermates. It was reported that in
both fish and human retinas, antibodies against fKif2, which may be a
homologue of mouse KifC3 and hKifC3, strongly labeled photoreceptor
terminals in the outer plexiform layer. The data suggested that KifC3
may play some role in the photoreceptor synapse (9).
However, when retinal tissue was subjected to a variety of histological
and immunofluorescence analyses, no difference was observed between the
KifC3 mutant mice and their littermates. Thus, the function of the
KifC3 protein will have to be explored further. Results of the studies
carried out with mice we report in this paper may facilitate
exploration of the function of the KifC3 gene in the future.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: HHMI/CMM, Room
334, University of California San Diego, 9500 Gilman Dr., La
Jolla, CA 92093-0683. Phone: (858) 534-9702. Fax: (858) 534-9701. E-mail: lgoldstein{at}ucsd.edu.
| |
REFERENCES |
| 1.
|
Ando, A.,
Y. Y. Kikuti,
H. Kawata,
N. Okamoto,
T. Imai,
T. Eki,
K. Yokoyama,
E. Soeda,
T. Ikemura,
K. Abe, et al.
1994.
Cloning of a new kinesin-related gene located at the centromeric end of the human MHC region.
Immunogenetics
39:194-200[Medline].
|
| 2.
|
Bloom, G. S., and S. A. Endow.
1995.
Motor proteins 1: kinesins.
Protein Profile
2:1105-1171[Medline].
|
| 3.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 4.
|
Devereux, J.,
P. Haeberli, and O. Smithies.
1984.
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res.
12:387-395.
|
| 5.
|
Goldstein, L. S., and A. V. Philp.
1999.
The road less traveled: emerging principles of kinesin motor utilization.
Annu. Rev. Cell Dev. Biol.
15:141-183[CrossRef][Medline].
|
| 6.
|
Hanlon, D. W.,
Z. Yang, and L. S. Goldstein.
1997.
Characterization of KIFC2, a neuronal kinesin superfamily member in mouse.
Neuron
18:439-451[CrossRef][Medline].
|
| 7.
|
Hirokawa, N.
1998.
Kinesin and dynein superfamily proteins and the mechanism of organelle transport.
Science
279:519-526[Abstract/Free Full Text].
|
| 8.
|
Hoang, E.,
L. Bost-Usinger, and B. Burnside.
1999.
Characterization of a novel C-kinesin (KIFC3) abundantly expressed in vertebrate retina and RPE.
Exp. Eye Res.
69:57-68[CrossRef][Medline].
|
| 9.
|
Hoang, E. H.,
J. L. Whitehead,
A. C. Dosé, and B. Burnside.
1998.
Cloning of a novel C-terminal kinesin (KIFC3) that maps to human chromosome 16q13-q21 and thus is a candidate gene for Bardet-Biedl syndrome.
Genomics
52:219-222[CrossRef][Medline].
|
| 10.
|
Joyner, A. L.
1993.
Gene targeting: a practical approach.
IRL Press at Oxford University Press, Oxford, United Kingdom.
|
| 11.
|
Kao, Y. L.,
B. E. Deavours,
K. K. Phelps,
R. A. Walker, and A. S. Reddy.
2000.
Bundling of microtubules by motor and tail domains of a kinesin-like calmodulin-binding protein from Arabidopsis: regulation by Ca(2+)/calmodulin.
Biochem. Biophys. Res. Commun.
267:201-207[CrossRef][Medline].
|
| 12.
|
Kuriyama, R.,
M. Kofron,
R. Essner,
T. Kato,
S. Dragas-Granoic,
C. K. Omoto, and A. Khodjakov.
1995.
Characterization of a minus end-directed kinesin-like motor protein from cultured mammalian cells.
J. Cell Biol.
129:1049-1059[Abstract/Free Full Text].
|
| 13.
|
McDonald, H. B.,
R. J. Stewart, and L. S. Goldstein.
1990.
The kinesin-like ncd protein of Drosophila is a minus end-directed microtubule motor.
Cell
63:1159-1165[CrossRef][Medline].
|
| 14.
|
Meluh, P. B., and M. D. Rose.
1990.
KAR3, a kinesin-related gene required for yeast nuclear fusion.
Cell
60:1029-1041[CrossRef][Medline]. (Erratum, 61:548.)
|
| 15.
|
Mountford, P.,
B. Zevnik,
A. Düwel,
J. Nichols,
M. Li,
C. Dani,
M. Robertson,
I. Chambers, and A. Smith.
1994.
Dicistronic targeting constructs: reporters and modifiers of mammalian gene expression.
Proc. Natl. Acad. Sci. USA
91:4303-4307[Abstract/Free Full Text].
|
| 16.
|
Narasimhulu, S. B.,
Y. L. Kao, and A. S. Reddy.
1997.
Interaction of Arabidopsis kinesin-like calmodulin-binding protein with tubulin subunits: modulation by Ca(2+)-calmodulin.
Plant J.
12:1139-1149[CrossRef][Medline].
|
| 17.
|
Navolanic, P. M., and A. O. Sperry.
2000.
Identification of isoforms of a mitotic motor in mammalian spermatogenesis.
Biol. Reprod.
62:1360-1369[Abstract/Free Full Text].
|
| 18.
|
O'Connell, M. J.,
P. B. Meluh,
M. D. Rose, and N. R. Morris.
1993.
Suppression of the bimC4 mitotic spindle defect by deletion of klpA, a gene encoding a KAR3-related kinesin-like protein in Aspergillus nidulans.
J. Cell Biol.
120:153-162[Abstract/Free Full Text].
|
| 19.
|
Pidoux, A. L.,
M. LeDizet, and W. Z. Cande.
1996.
Fission yeast pkl1 is a kinesin-related protein involved in mitotic spindle function.
Mol. Biol. Cell
7:1639-1655[Abstract].
|
| 20.
|
Reddy, A. S.,
F. Safadi,
S. B. Narasimhulu,
M. Golovkin, and X. Hu.
1996.
A novel plant calmodulin-binding protein with a kinesin heavy chain motor domain.
J. Biol. Chem.
271:7052-7060[Abstract/Free Full Text].
|
| 21.
|
Rogers, G. C.,
C. L. Hart,
K. P. Wedaman, and J. M. Scholey.
1999.
Identification of kinesin-C, a calmodulin-binding carboxy-terminal kinesin in animal (Strongylocentrotus purpuratus) cells.
J. Mol. Biol.
294:1-8[CrossRef][Medline].
|
| 22.
|
Saito, N.,
Y. Okada,
Y. Noda,
Y. Kinoshita,
S. Kondo, and N. Hirokawa.
1997.
KIFC2 is a novel neuron-specific C-terminal type kinesin superfamily motor for dendritic transport of multivesicular body-like organelles.
Neuron
18:425-438[CrossRef][Medline].
|
| 23.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 24.
|
Vale, R. D., and R. J. Fletterick.
1997.
The design plan of kinesin motors.
Annu. Rev. Cell Dev. Biol.
13:745-777[CrossRef][Medline].
|
| 25.
|
Walczak, C. E.,
S. Verma, and T. J. Mitchison.
1997.
XCTK2: a kinesin-related protein that promotes mitotic spindle assembly in Xenopus laevis egg extracts.
J. Cell Biol.
136:859-870[Abstract/Free Full Text].
|
| 26.
|
Walker, R. A.,
E. D. Salmon, and S. A. Endow.
1990.
The Drosophila claret segregation protein is a minus-end directed motor molecule.
Nature
347:780-782[CrossRef][Medline].
|
| 27.
|
Wang, W.,
D. Takezawa,
S. B. Narasimhulu,
A. S. Reddy, and B. W. Poovaiah.
1996.
A novel kinesin-like protein with a calmodulin-binding domain.
Plant Mol. Biol.
31:87-100[CrossRef][Medline].
|
| 28.
|
Yang, Z., and L. S. Goldstein.
1998.
Characterization of the KIF3C neural kinesin-like motor from mouse.
Mol. Biol. Cell
9:249-261[Abstract/Free Full Text].
|
| 29.
|
Yang, Z.,
D. W. Hanlon,
J. R. Marszalek, and L. S. Goldstein.
1997.
Identification, partial characterization, and genetic mapping of kinesin-like protein genes in mouse.
Genomics
45:123-131[CrossRef][Medline].
|
Molecular and Cellular Biology, February 2001, p. 765-770, Vol. 21, No. 3
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.3.765-770.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nath, S., Bananis, E., Sarkar, S., Stockert, R. J., Sperry, A. O., Murray, J. W., Wolkoff, A. W.
(2007). Kif5B and Kifc1 Interact and Are Required for Motility and Fission of Early Endocytic Vesicles in Mouse Liver. Mol. Biol. Cell
18: 1839-1849
[Abstract]
[Full Text]
-
Xu, Y., Takeda, S., Nakata, T., Noda, Y., Tanaka, Y., Hirokawa, N.
(2002). Role of KIFC3 motor protein in Golgi positioning and integration. JCB
158: 293-303
[Abstract]
[Full Text]
-
DeGiorgis, J. A., Reese, T. S., Bearer, E. L.
(2002). Association of a Nonmuscle Myosin II with Axoplasmic Organelles. Mol. Biol. Cell
13: 1046-1057
[Abstract]
[Full Text]
-
Noda, Y., Okada, Y., Saito, N., Setou, M., Xu, Y., Zhang, Z., Hirokawa, N.
(2001). KIFC3, a microtubule minus end-directed motor for the apical transport of annexin XIIIb-associated Triton-insoluble membranes. JCB
155: 77-88
[Abstract]
[Full Text]
-
Yang, Z., Roberts, E. A., Goldstein, L. S. B.
(2001). Functional Analysis of Mouse C-Terminal Kinesin Motor KifC2. Mol. Cell. Biol.
21: 2463-2466
[Abstract]
[Full Text]
Top
Abstract
Introduction
