Previous Article | Next Article 
Molecular and Cellular Biology, February 2001, p. 811-813, Vol. 21, No. 3
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.3.811-813.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Generation of a Mouse Model for Arginase II
Deficiency by Targeted Disruption of the Arginase II Gene
Ou
Shi,1
Sidney
M.
Morris Jr.,2
Huda
Zoghbi,1,3
Carl W.
Porter,4 and
William E.
O'Brien1,*
Department of Molecular and Human
Genetics1 and Department of
Pediatrics,3 Baylor College of Medicine,
Houston, Texas 77030; Department of Molecular Genetics and
Biochemistry, University of Pittsburgh, Pittsburgh, Pennsylvania
152612; and Grace Cancer Drug Center,
Roswell Park Cancer Institute, Buffalo, New York
142634
Received 6 September 2000/Accepted 8 November 2000
 |
ABSTRACT |
Mammals express two isoforms of arginase, designated types I and
II. Arginase I is a component of the urea cycle, and inherited defects
in arginase I have deleterious consequences in humans. In contrast, the
physiologic role of arginase II has not been defined, and no
deficiencies in arginase II have been identified in humans. Mice with a
disruption in the arginase II gene were created to investigate the role
of this enzyme. Homozygous arginase II-deficient mice were viable and
apparently indistinguishable from wild-type mice, except for an
elevated plasma arginine level which indicates that arginase II plays
an important role in arginine homeostasis.
 |
INTRODUCTION |
Recognition of the importance of
arginine in mammalian physiology has risen dramatically with the
demonstration that it is the substrate for synthesis of nitric oxide.
Arginine is not generally considered to be an essential amino acid in
healthy adults, but it is essential in several species of newborn
animals (15, 16). Moreover, arginine depletion can occur
in pathophysiologic conditions such as sepsis and trauma (8,
9) or following surgical resection of the small bowel
(23). Regulation of arginine homeostasis is complex and
involves dietary intake, synthesis in the kidney, and its utilization
by arginases and other arginine catabolic enzymes (1, 17).
Arginase (L-arginine ureohydrolase, EC 3.4.3.1) catalyzes
the hydrolysis of arginine to ornithine and urea. In mammals, there are
two isoforms of arginase. Arginase I is found in the cytosol and is the
isoform that participates in the urea cycle and is expressed at high
levels in the liver of ureotelic animals. The arginase I cDNA and gene
have been cloned (4, 5, 11), and extensive reviews are
available (7, 10). A deficiency in arginase I in humans
results in the clinical disease argininemia (2). In
contrast to arginase I, arginase II is localized in the mitochondria.
It has a wide tissue distribution, being most highly expressed in the
prostate and kidney and poorly expressed in the liver (18,
22). The role of arginase II in mammalian physiology is not
completely understood but is speculated to involve the synthesis of
proline and glutamate and/or polyamines (24). No human
disease has been associated with a deficiency in arginase II. The cDNA
and gene for arginase II have been cloned (6, 18, 20, 22).
In an effort to provide insight into the physiological role of arginase
II, we constructed a murine model for the deficiency of this gene.
 |
MATERIALS AND METHODS |
DNA was prepared from tail clippings of 3-week-old pups.
Genotyping was performed by Southern hybridization and PCR. Primers used for PCRs were the following: forward primer for both the wild-type
and mutant genes, TCCTTTCTCCTGTCTAATTC, reverse primer for
the wild-type gene, CTAGCATCTAATTGACTGCC; and reverse primer for the mutant gene, CCATGATGGATACTTTCTC. The PCR product
for the wild-type gene was 510 bp in length, and for the mutant it was
900 bp in length.
Determination of arginase activity.
Mice were bred until 8 to 10 weeks old. Single kidneys were removed from the animals at
autopsy, weighed, and placed in a fivefold volume (weight per volume)
of lysis buffer (0.1 M NaCl, 10 mM Tris [pH 8.0]). Samples were
homogenized thoroughly with a PRO Scientific, Inc., model PRO250
homogenizer in a glass tube. The enzyme assay protocol was adapted from
that of Nuzum and Snodgrass (19).
Plasma and urine arginine analysis.
Plasma was taken from
the animals by orbital sinus bleeding with heparinized capillary tubes
(Fisher catalog no. 2501). Amino acid levels were determined on a
Beckman model 6300 amino acid analyzer.
Statistical analysis.
Data were analyzed using analysis of
variance tests. A P value of less than 0.01 was considered
to be significant.
 |
RESULTS |
Generation of mice lacking a functional arginase II gene.
A
20-kb fragment of mouse genomic DNA containing the arginase II gene was
isolated by screening a 129sv/Ev mouse genomic library in lambda FIXII
vector (Stratagene catalog no. 946305) (20). This phage
contained exons 3 to 7 of the arginase II gene as confirmed by
sequencing. The targeting vector was constructed by removing an
internal KpnI fragment and replacing it with a neomycin
resistance cassette containing an RNA polymerase II promoter and bovine
growth hormone polyadenylation sequence (12, 21) (Fig.
1). The construction also included the
herpes simplex virus thymidine kinase gene for selection (3,
13). In the final construct, parts of exons 4 and 5 of the
arginase gene were deleted, and the result was a frame shift in the
final mRNA product. The embryonic stem cell line was electroporated
with the linearized targeting vector DNA, and neomycin-resistant
colonies were selected in G418-containing medium Successfully targeted
cell lines were identified by Southern blot hybridization with both a
5' flanking probe and a 3' flanking probe.

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 1.
Generation of a targeted disruption of the murine
arginase II locus. The structure of the arginase II gene used for
construction is illustrated on the upper line, and the final targeting
construct is shown below. The final construct spans a total of 6.7 kb
from the 5' EcoRI site to the 3' SacI site. The
KpnI-to-KpnI fragment that was targeted contains
portions of exons 4 and 5. The positions of the 5' and 3' probes used
for delineation of the targeted event are illustrated. Restriction
enzymes are designated as follows: E, EcoRI; K,
KpnI; S, SacI. The selectable markers are
neomycin acetyltransferase (NEO) and herpes simplex virus thymidylate
kinase (TK). Exons are represented by shaded boxes and are designated
E3 through E7.
|
|
Two positive colonies were expanded. Homologous recombination was
confirmed by Southern blotting. Cells from two of the clones
were
injected into C57BL/6J blastocysts and gave rise to germ
line chimeras.
Male chimeras with germ line transmission were
bred to C57BL/6J females
to establish hybrid F1 progeny. Confirmation
that the appropriate
genomic rearrangement had occurred was provided
by Southern analysis of
the DNA from all genotypes (Fig.
2).

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 2.
Proof of transmittal of the disrupted allele. A Southern
blot of DNA, isolated as described, digested with KpnI, and
hybridized with radioactively labeled 5' probe or 3' probe is shown.
The genotypes of the samples are designated above the lanes, and the
sizes of the fragments are shown on the right of each panel.
|
|
Heterozygous (
argII/
argII
mut) mice
were interbred and produced the expected 1:2:1 ratio of wild-type,
heterozygous, and homozygous
offspring (327 animals analyzed).
Functional inactivation of the
arginase II gene was confirmed by
assaying the enzyme in the kidney.
The data shown in Table
1 demonstrate that enzymatic activity
for
arginase is completely deficient in the kidney of homozygous
arginase
II-deficient animals. Interestingly, the level of activity
in
heterozygous animals is less than the normal amount but not
the
expected half-normal level. The significance of this observation,
if
any, is difficult to assess due to the large variation encountered
in
this assay. Northern blotting of mRNA from the mutant animals
revealed
the presence of a band similar in both intensity and
size to the normal
arginase II mRNA, as expected for a transcript
of the modified gene.
Homozygous arginase II-deficient animals are completely fertile and do
not have a readily distinguishable phenotype. The results
of all
anatomical and histochemical studies on mutant animals
were within
normal
limits.
Polyamine and amino acid analysis.
Given the potential role of
arginase in amino acid and polyamine biosynthesis, we evaluated these
pathways with metabolite assays. Polyamines were measured in several
tissues including brain, liver, kidney, and testes. No significant
differences were detected between mutant and normal animals. We also
analyzed polyamines in cultured skin fibroblasts from both mutant and
normal animals and found no significant differences. Plasma amino acid
levels in adult mice were measured at 8 to 10 weeks of age. These data are provided in Table 2. There was a
significant difference in plasma arginine levels between wild-type and
homozygous arginase II-deficient animals (P = 0.0017)
and between wild-type and heterozygous animals (P = 0.0008). There was a trend toward elevated ornithine levels in the
homozygous arginase II-deficient mice, but the differences were not
statistically significant. The other amino acids showed no significant
differences among the genotypes. Analysis of urinary amino acids did
not reveal any significant differences between wild-type and mutant
animals.
 |
DISCUSSION |
In the present study, we demonstrate that we have created mice
deficient in arginase II. The mice had hyperargininemia but were normal
with respect to related amino acids (Table 2).
Results of metabolic-labeling studies have suggested that arginase
degradation and/or dietary intake are the primary regulators of
arginine homeostasis. In support of this notion, our results indicate
that arginine catabolism via arginase II is an important factor in
arginine homeostasis. Furthermore, the absence of any significant
alteration in plasma citrulline levels (Table 2) suggests that there
have been no compensatory changes in rates of arginine synthesis via
the intestinal-renal axis in the homozygous arginase II-deficient mice.
The activity of arginase II in the mammary gland is greatly increased
during lactogenesis, and it has been postulated that this occurs to
enhance the capacity for synthesis of proline or glutamate for milk
(14, 25). However, there was no apparent deficiency in
nutrients in the milk of homozygous arginase II-deficient mice, because
the growth rates of their pups prior to weaning were indistinguishable
from those of wild-type pups.
Unlike the cases of arginase I deficiency, our results suggest that a
deficiency in arginase II in humans is possibly a benign trait, at
least in otherwise healthy individuals. However, it is possible that a
deficiency in arginase II would be deleterious under conditions of
disease or injury, and experiments are under way to test this possibility.
 |
ACKNOWLEDGMENT |
This work was supported in part by NIH grant GM57384 to W.E.O.
and S.M.M.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030. Phone: (713) 798-5484. Fax: (713) 798-8937. E-mail:
wobrien{at}bcm.tmc.edu.
 |
REFERENCES |
| 1.
|
Beaumier, L.,
L. Castillo,
A. M. Ajami, and V. R. Young.
1995.
Urea cycle intermediate kinetics and nitrate excretion at normal and "therapeutic" intakes of arginine in humans.
Am. J. Physiol.
269:E884-E896[Abstract/Free Full Text].
|
| 2.
|
Brusilow, S. W., and A. L. Horwich.
1995.
Urea cycle enzymes, p. 1187-1232.
In
C. R. Scriver, A. L. Beaudet, and W. L. Sly (ed.), The metabolic and molecular bases of inherited disease, vol. 1. McGraw-Hill, Inc., New York, N.Y.
|
| 3.
|
Castillo, L.,
T. E. Chapman,
M. Sanchez,
Y. M. Yu,
J. F. Burke,
A. M. Ajami,
J. Vogt, and V. R. Young.
1993.
Plasma arginine and citrulline kinetics in adults given adequate and arginine-free diets.
Proc. Natl. Acad. Sci. USA
90:7749-7753[Abstract/Free Full Text].
|
| 4.
|
Dizikes, G. J.,
W. W. Grody,
R. M. Kern, and S. D. Cederbaum.
1986.
Isolation of human liver arginase cDNA and demonstration of nonhomology between the two human arginase genes.
Biochem. Biophys. Res. Commun.
141:53-59[CrossRef][Medline].
|
| 5.
|
Dizikes, G. J.,
E. B. Spector, and S. D. Cederbaum.
1986.
Cloning of rat liver arginase cDNA and elucidation of regulation of arginase gene expression in H4 rat hepatoma cells.
Somat. Cell Mol. Genet.
12:375-384[CrossRef][Medline].
|
| 6.
|
Gotoh, T.,
T. Sonoki,
A. Nagasaki,
K. Terada,
M. Takiguchi, and M. Mori.
1996.
Molecular cloning of cDNA for nonhepatic mitochondrial arginase (arginase II) and comparison of its induction with nitric oxide synthase in a murine macrophage-like cell line.
FEBS Lett.
395:119-122[CrossRef][Medline].
|
| 7.
|
Iyer, R. K.,
J. M. Bando,
C. P. Jenkinson,
J. G. Vockley,
P. S. Kim,
R. M. Kern,
S. D. Cederbaum, and W. W. Grody.
1998.
Cloning and characterization of the mouse and rat type II arginase genes.
Mol. Gen. Metab.
63:168-175[CrossRef][Medline].
|
| 8.
|
Jeevanandam, M.,
L. Ramias, and W. R. Schiller.
1991.
Altered plasma free amino acid levels in obese traumatized man.
Metabolism
40:385-390[CrossRef][Medline].
|
| 9.
|
Jeevanandam, M.,
D. H. Young,
L. Ramias, and W. R. Schiller.
1990.
Effect of major trauma on plasma free amino acid concentrations in geriatric patients.
Am. J. Clin. Nutr.
51:1040-1045[Abstract/Free Full Text].
|
| 10.
|
Jenkinson, C. P.,
W. W. Grody, and S. D. Cederbaum.
1996.
Comparative properties of arginases.
Comp. Biochem. Physiol. B
114B:107-132[CrossRef][Medline].
|
| 11.
|
Kawamoto, S.,
Y. Amaya,
K. Murakami,
F. Tokunaga,
S. Iwanaga,
K. Kobayashi,
T. Saheki,
S. Kimura, and M. Mori.
1987.
Complete nucleotide sequence of cDNA and deduced amino acid sequence of rat liver arginase.
J. Biol. Chem.
262:6280-6283[Abstract/Free Full Text].
|
| 12.
|
Mansour, S. L.,
K. R. Thomas, and M. R. Capecchi.
1988.
Disruption of the proto-oncogene int-2 in mouse embryo-derived stem cells: a general strategy for targeting mutations to non-selectable genes.
Nature
336:348-352[CrossRef][Medline].
|
| 13.
|
McMahon, A. P., and A. Bradley.
1990.
The Wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain.
Cell
62:1073-1085[CrossRef][Medline].
|
| 14.
|
Mezl, V. A., and W. E. Knox.
1977.
Metabolism of arginine in lactating rat mammary gland.
Biochem. J.
166:105-113[Medline].
|
| 15.
|
Morris, J. G., and Q. R. Rogers.
1978.
Ammonia intoxication in the near-adult cat as a result of a dietary deficiency of arginine.
Science
199:431-432[Abstract/Free Full Text].
|
| 16.
|
Morris, J. G.,
Q. R. Rogers,
D. L. Winterrowd, and E. M. Kamikawa.
1979.
The utilization of ornithine and citrulline by the growing kitten.
J. Nutr.
109:724-729.
|
| 17.
|
Morris, S. M., Jr.
2000.
Regulation of arginine availability and its impact on NO synthesis, p. 187-197.
In
L. J. Ignarro (ed.), Nitric oxide: biology and pathobiology. Academic Press, San Diego, Calif.
|
| 18.
|
Morris, S. M., Jr.,
D. Bhamidipati, and D. Kepka-Lenhart.
1997.
Human type II arginase: sequence analysis and tissue-specific expression.
Gene
193:157-161[CrossRef][Medline].
|
| 19.
|
Nuzum, C. T., and P. J. Snodgrass.
1976.
Multiple assays of the five urea cycle enzymes in human liver homogenates, p. 325-349.
In
S. Grisolia, R. Baguena, and F. Mayor (ed.), The urea cycle. John Wiley & Sons, New York, N.Y.
|
| 20.
|
Shi, O.,
D. Kepka-Lenhart,
S. M. J. Morris, and W. E. O'Brien.
1998.
Structure of the murine arginase II gene.
Mamm. Genome
9:822-824[CrossRef][Medline].
|
| 21.
|
Soriano, P.,
C. Montgomery,
R. Geske, and A. Bradley.
1991.
Targeted disruption of the c-src proto-oncogene leads to osteopetrosis in mice.
Cell
64:693-702[CrossRef][Medline].
|
| 22.
|
Vockley, J. G.,
C. P. Jenkinson,
H. Shukla,
R. M. Kern,
W. W. Grody, and S. D. Cederbaum.
1996.
Cloning and characterization of the human type II arginase gene.
Genomics
38:118-123[CrossRef][Medline].
|
| 23.
|
Wakabayashi, Y.,
E. Yamada,
T. Yoshida, and H. Takahashi.
1994.
Arginine becomes an essential amino acid after massive resection of rat small intestine.
J. Biol. Chem.
269:32667-32671[Abstract/Free Full Text].
|
| 24.
|
Wu, G., and S. M. Morris, Jr.
1998.
Arginine metabolism: nitric oxide and beyond.
Biochem. J.
336(Pt. 1):1-17.
|
| 25.
|
Yip, M. C., and W. E. Knox.
1972.
Function of arginase in lactating mammary gland.
Biochem. J.
127:893-899[Medline].
|
Molecular and Cellular Biology, February 2001, p. 811-813, Vol. 21, No. 3
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.3.811-813.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Belik, J., Shehnaz, D., Pan, J., Grasemann, H.
(2008). Developmental changes in arginase expression and activity in the lung. Am. J. Physiol. Lung Cell. Mol. Physiol.
294: L498-L504
[Abstract]
[Full Text]
-
Deignan, J. L., Livesay, J. C., Shantz, L. M., Pegg, A. E., O'Brien, W. E., Iyer, R. K., Cederbaum, S. D., Grody, W. W.
(2007). Polyamine homeostasis in arginase knockout mice. Am. J. Physiol. Cell Physiol.
293: C1296-C1301
[Abstract]
[Full Text]
-
Chaturvedi, R., Asim, M., Lewis, N. D., Algood, H. M. S., Cover, T. L., Kim, P. Y., Wilson, K. T.
(2007). L-Arginine Availability Regulates Inducible Nitric Oxide Synthase-Dependent Host Defense against Helicobacter pylori. Infect. Immun.
75: 4305-4315
[Abstract]
[Full Text]
-
Marathe, C., Bradley, M. N., Hong, C., Lopez, F., de Galarreta, C. M. R., Tontonoz, P., Castrillo, A.
(2006). The Arginase II Gene Is an Anti-inflammatory Target of Liver X Receptor in Macrophages. J. Biol. Chem.
281: 32197-32206
[Abstract]
[Full Text]
-
Morris, S. M Jr
(2006). Arginine: beyond protein. Am. J. Clin. Nutr.
83: 508S-512S
[Abstract]
[Full Text]
-
White, A. R., Ryoo, S., Li, D., Champion, H. C., Steppan, J., Wang, D., Nyhan, D., Shoukas, A. A., Hare, J. M., Berkowitz, D. E.
(2006). Knockdown of Arginase I Restores NO Signaling in the Vasculature of Old Rats. Hypertension
47: 245-251
[Abstract]
[Full Text]
-
Scaglia, F., Brunetti-Pierri, N., Kleppe, S., Marini, J., Carter, S., Garlick, P., Jahoor, F., O'Brien, W., Lee, B.
(2004). Clinical Consequences of Urea Cycle Enzyme Deficiencies and Potential Links to Arginine and Nitric Oxide Metabolism. J. Nutr.
134: 2775S-2782S
[Abstract]
[Full Text]
-
King, N. E., Rothenberg, M. E., Zimmermann, N.
(2004). Arginine in Asthma and Lung Inflammation. J. Nutr.
134: 2830S-2836S
[Abstract]
[Full Text]
-
Gobert, A. P., Cheng, Y., Akhtar, M., Mersey, B. D., Blumberg, D. R., Cross, R. K., Chaturvedi, R., Drachenberg, C. B., Boucher, J.-L., Hacker, A., Casero, R. A. Jr, Wilson, K. T.
(2004). Protective Role of Arginase in a Mouse Model of Colitis. J. Immunol.
173: 2109-2117
[Abstract]
[Full Text]
-
Endo, M., Oyadomari, S., Terasaki, Y., Takeya, M., Suga, M., Mori, M., Gotoh, T.
(2003). Induction of arginase I and II in bleomycin-induced fibrosis of mouse lung. Am. J. Physiol. Lung Cell. Mol. Physiol.
285: L313-L321
[Abstract]
[Full Text]
-
Janech, M. G., Chen, R., Klein, J., Nowak, M. W., McFee, W., Paul, R. V., Fitzgibbon, W. R., Ploth, D. W.
(2002). Molecular and functional characterization of a urea transporter from the kidney of a short-finned pilot whale. Am. J. Physiol. Regul. Integr. Comp. Physiol.
282: R1490-R1500
[Abstract]
[Full Text]