Previous Article | Next Article 
Molecular and Cellular Biology, February 2001, p. 840-853, Vol. 21, No. 3
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.3.840-853.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
The NH2-Terminal Coiled-Coil Domain and Tyrosine 177 Play Important Roles in Induction of a Myeloproliferative Disease
in Mice by Bcr-Abl
Xiaowu
Zhang,1,2
Ramesh
Subrahmanyam,1,3
Ray
Wong,1,3
Alec W.
Gross,1,3 and
Ruibao
Ren1,3,*
Rosenstiel Basic Medical Sciences Research
Center,1 Department of
Biochemistry,2 and Department of
Biology,3 Brandeis University, Waltham,
Massachusetts 02454-9110
Received 17 July 2000/Returned for modification 1 September
2000/Accepted 13 November 2000
 |
ABSTRACT |
Bcr-Abl, a fusion protein generated by t(9;22)(q34;q11)
translocation, plays a critical role in the pathogenesis of chronic myelogenous leukemia (CML). It has been shown that Bcr-Abl contains multiple functional domains and motifs and can disrupt regulation of
many signaling pathways and cellular functions. However, the role of
specific domains and motifs of Bcr-Abl or of specific signaling
pathways in the complex in vivo pathogenesis of CML is not
completely known. We have previously shown that expression of Bcr-Abl
in bone marrow cells by retroviral transduction efficiently induces a
myeloproliferative disorder (MPD) in mice resembling human CML. We have
also shown that the Abl kinase activity within Bcr-Abl is essential for
Bcr-Abl leukemogenesis, yet activation of the Abl kinase without Bcr
sequences is not sufficient to induce MPD in mice. In this study we
investigated the role of Bcr sequences within Bcr-Abl in inducing MPD
using this murine model for CML. We found that the
NH2-terminal coiled-coil (CC) domain was both essential and
sufficient, even though not efficient, to activate Abl to induce an MPD
in mice. Interestingly, deletion of the Src homology 3 domain
complemented the deficiencies of the CC-deleted Bcr-Abl in inducing MPD
in mice. We further demonstrated that the Grb2 binding site at
Y177 played an important role in efficient induction of MPD. These
studies directly demonstrated the important roles of Bcr sequences in
induction of MPD by Bcr-Abl.
 |
INTRODUCTION |
The bcr-abl oncogene,
produced from the t(9;22)(q34;q11) chromosomal translocation known as
the Philadelphia chromosome (Ph), is associated with 95% of the cases
of chronic myelogenous leukemia (CML) and also with 20% of the adult
and 5% of the pediatric cases of acute lymphoblastic leukemia (ALL)
(23, 33). Depending on the nature of the translocation and
exactly how the bcr and abl sequences become
spliced into a final bcr-abl mRNA, various Bcr-Abl fusion
proteins, including p185, p210, and p230, can be generated that show a
preferential association with different types of leukemia
(33). Clinical and laboratory studies indicate that
Bcr-Abl plays an essential role in initiation of the chronic phase of
CML and also plays a critical role in the maintenance and progression
of the disease (10, 20, 50).
Bcr-Abl contains multiple functional domains and motifs. Abl-derived
sequences in Bcr-Abl contain Src homology 3 (SH3), SH2, and tyrosine
kinase domains in their N-terminal half, as well as a DNA binding
domain, an actin binding domain, nuclear localization signals, and SH3
binding sites in their C-terminal region (41). The Bcr
region (in the major p210 form) contains a coiled-coil (CC)
oligomerization domain, a serine/threonine kinase domain, a Pleckstrin
homology (PH) domain, a Dbl guanine-nucleotide exchange factor homology
domain, and binding sites for the Abl SH2 domain and Grb2, Grb10, and
14-3-3 proteins (2, 25, 41, 49). The multiple domains of
Bcr-Abl work cooperatively to activate intracellular signaling pathways
commonly used in hematopoietic growth factor receptor signaling. These
signaling pathways involve Ras, Raf, phosphatidylinositol 3 (PI3)
kinase, Akt, JUN NH2-terminal kinase (JNK), signal
transducer and activator of transcription (STAT), Rac, Myc, and Bcl-2
or Bcl-xL (43). Bcr-Abl also disrupts the
adhesion pathway in CML cells (46).
Despite the advances in biochemical studies of Bcr-Abl, until recently
there has not been a good experimental system that would allow the
direct determination of the effect of specific domains and motifs of
Bcr-Abl or of specific signaling pathways on the complex in vivo
pathogenesis of the CML disease phenotype. Recently we and others have
shown that expression of Bcr-Abl in mouse bone marrow cells by
retroviral transduction efficiently induces a myeloproliferative
disorder (MPD) resembling the chronic phase of human CML (24, 37,
50). This murine model for CML provides an effective in vivo
experimental system to study the roles and relative importance of
domains of Bcr-Abl and of signaling events affected by Bcr-Abl in
leukemogenesis. It has been shown previously that the protein tyrosine
kinase activity of Bcr-Abl is essential for its leukemogenic potential
in vivo (50). However, c-Abl activated by an SH3 deletion
did not induce MPD, although an SH3-deleted Bcr-Abl still induced a
fatal MPD (14). These results indicate that activation of
the Abl kinase alone is not sufficient for induction of MPD and that
Bcr sequences in Bcr-Abl play an important role in inducing MPD.
Among Bcr domains and motifs, it has been shown that the
NH2-terminal CC domain plays an essential role in Bcr-Abl
transformation (30). Deletion of the CC domain completely
abolishes the transforming ability of Bcr-Abl in fibroblast cell lines,
hematopoietic cell lines, and fresh bone marrow cells, although the CC
domain-deleted Bcr-Abl retains detectable kinase activity, is
autophosphorylated, and can activate Ras in cells (28, 30, 35,
44). The importance of the CC domain is also strengthened by the
discovery of Tel-Abl (36). The Tel-Abl protein is a fusion
of c-Abl and Tel, a member of the Ets family of transcription factors.
A common property found between Bcr and Tel, two otherwise seemingly
unrelated proteins, is that both can form oligomers. The
helix-loop-helix domain of Tel, like the CC domain of Bcr, mediates the
oligomerization of Tel-Abl and is required for Abl kinase activation,
enhanced association with actin fibers, and transforming ability
(13). These findings suggest the possibility that the only
role in leukemogenesis of the Bcr and Tel portions of Bcr-Abl and
Tel-Abl is to contribute an oligomerization domain to activate Abl.
However, fusion of the Bcr CC domain alone was not sufficient to
activate Abl to transform fibroblast cells (32). It has
been shown that the adapter protein Grb2 binding site Y177, one of the
motifs of Bcr-Abl that are important for the activation of Ras, is also
important for Bcr-Abl function (39, 40). Mutation of Y177
diminishes Bcr-Abl-induced Ras activation and transformation in
fibroblast cells (1, 39). However, the Grb2 binding site
is not required to induce growth-factor independence in
growth-factor-dependent hematopoietic cell lines and to transform bone
marrow cells in vitro (5, 12). These results indicate that
the importance of Y177 for in vitro transformation is dependent on the
type of cells used, so the role of specific Bcr domains and motifs in leukemogenesis remains unclear.
In this study, we examined the role of the CC domain and Y177 of
Bcr-Abl in the murine CML model. We found that Bcr-Abl without the
NH2-terminal CC domain failed to induce MPD in mice but
still induced a T-cell leukemia and/or lymphoma with a greatly extended latency. Deletion of the Abl SH3 domain can restore the ability of the
CC domain-deleted Bcr-Abl to induce MPD. We also demonstrated that the
NH2-terminal CC domain alone is sufficient, yet not
efficient, to activate Abl to induce MPD and that Y177 is required for
efficient induction of MPD.
 |
MATERIALS AND METHODS |
DNA constructs.
The p210 form of Bcr-Abl expression
construct MSCV-bcr-abl/p210-IRES-gfp used in this study was described
previously (50). To make
CC (Fig.
1A), the 5'
EcoRI-XhoI fragment (fragment A) of
bcr-abl was subcloned into the EcoRI and
XhoI sites of pBluescript II SK. The fragment between the
SpeI site in the multiple cloning site of the vector and
first MscI site in fragment A, cleaved by partial
MscI digestion, was replaced by the SpeI and
MscI linker: NT6 (5' CTAGTTTGCTGG3') and NT7
(5'CCAGCAAA3'). The fragment of SpeI and
XhoI was excised out from pBluescript II SK and used with a
SnaBI-XbaI adapter containing Kozak consensus
sequences NT4 (5'GTAACCATGGCCT3') and NT5
(5'CTAGAGGCCATGGTTAC3') to replace the corresponding
SnaBI-XhoI fragment of pBabe-bcr-abl. The
SnaBI-EcoRI fragment containing the
CC DNA was
then cloned into the HpaI and EcoRI sites of
MSCV-IRES-gfp vector (Fig. 1). In the resulting
CC, the first 61 amino acids of Bcr-Abl were replaced by four amino acids
MASS. To make
CC-Abl, first two overlapping fragments were amplified by PCR from
bcr-abl with 5' primer NT10 (5'
CTCCCTTTATCCAGCCCTCAC3') and 3' primer NT155
(5'GAAGGGCTTTAAAGCCCCATCGCTGCCGGTC3') for fragment A and 5'
primer NT156 (5'GATGGGGCTTTAAAGCCCTTCAGCGGCCAGTAG3') and 3'
primer NT125 (5'CCATCAGAAGCAGTGTTGATC3') for fragment B. Then both fragments A and B were purified with the QIAquick PCR purification kit (Qiagen Inc., Chatsworth, Calif.) and mixed together as a template to generate PCR fragment C with 5' primer NT10 and 3'
primer NT125. The fragment C was digested with EcoRI and
HincII, and this EcoRI-HincII fragment
together with the 3' HincII-EcoRI fragment
containing most of the abl sequences from bcr-abl
were ligated into the EcoRI site of MSCV-IRES-gfp (Fig. 1A).
To make
CC-
SH3, the SalI-EcoRI fragment of
CC in MSCV-
CC-IRES-gfp was replaced by the corresponding
SalI-EcoRI fragment of
SH3 Bcr-Abl
(14). The MSCV-Y177F-IRES-gfp construct was generated by
swapping the first 660 bases (XhoI site) of the bcr-abl
coding sequence between wild-type (wt) bcr-abl and a Y177F
mutant (39). All sequences that were produced by PCR
amplification were verified to be correct by sequencing.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Schematic diagram of the retrovirus expression
vector and Bcr-Abl proteins used in this study. Abl-derived sequences
are shown in gray. Domains and motifs in Bcr-Abl include the following:
the NH2-terminal CC domain of Bcr (CC), the Grb2 SH2
binding site (Y177), the SH3 domain (3), the SH2 domain
(2), and the Abl tyrosine kinase domain (K). Amino acid
positions in Bcr-Abl where changes were made are indicated.
Abbreviations for restriction enzymes: H, HpaI; RI,
EcoRI. (B) Mass populations of infected 32D cells (GFP
positive) were starved of IL-3 for 24 h. Equal amounts of cell lysates
of the different 32D cell populations, as indicated, were separated on
an SDS-6 to 15% polyacrylamide gradient gel and analyzed by
immunoblotting with Ab3. (C) The same lysates as in panel B were
analyzed with antiphosphotyrosine. The molecular mass standards are
shown in kilodaltons in B and C. (D) The same lysates as in panel B
were analyzed with anti-phospho-STAT5, anti-phospho-Akt, or
anti-Dynamin antibodies as indicated. The filters were stripped and
reblotted with anti-STAT5, anti-Akt, or anti-Actin antibodies,
respectively. (E) Coimmunoprecipitation of Grb2 with Bcr-Abl proteins.
Different bcr-abl constructs or vector, as indicated, were
transfected into BOSC23 cells and anti-Abl IP was carried out 48 h
later. Immunoprecipitates were immunoblotted with Ab3 (top panel) and
an anti-Grb2 antibody (middle panel). Whole lysates were also blotted
with the anti-Grb2 antibody (lower panel).
|
|
Cell culture and retrovirus preparation.
The NIH 3T3 mouse
fibroblasts and BOSC23 cells were maintained as previously described
(14, 50). The 32D clone 3 (32D) cells were maintained in
interleukin-3 (IL-3)-containing medium (Dulbecco modified Eagle medium
[DMEM] containing 10% fetal bovine serum [FBS], 100 U of
penicillin/ml, 100 µg of streptomycin/ml, and 10% WEHI
3B-conditioned medium [WEHI-CM] as the source of IL-3).
Helper-free retroviruses were generated by transiently transfecting
retroviral constructs (Fig. 1A) into BOSC23 cells as described
previously (38) and were wrapped in aluminum foil and
stored at 4°C for up to 4 days without significant change in virus
titers. BOSC23-conditioned medium was made just like making retrovirus
except that there was no DNA in the transfection mix. Infection and
virus titering was performed as previously described (14).
All viruses were normalized to equivalent titers with
BOSC23-conditioned medium just before infection of bone marrow cells or
other cell lines.
In vitro transformation assay.
NIH 3T3 cells, plated at a
density of 1.5 × 105 per 60-mm plate 24 h prior to
infection, were infected for 4 h with 2 ml of infection mix (50%
viral supernatant, 10% donor calf serum, 100 U of penicillin/ml, 100 µg of streptomycin/ml, and 8 µg of Polybrene/ml in DMEM). Two days
later, 105, 104, or 103 cells from
each plate were plated into six-well plates in 0.3% Bacto agar (Becton
Dickinson, Sparks, Md.), 20% FBS, 200 U of penicillin/ml, and 200 µg
of streptomycin/ml in DMEM. Wells were refed 2 weeks later. Colonies
were counted under a microscope 5 weeks after plating. For bone marrow
colony assays, the retroviral transduced bone marrow cells (see "Bone
marrow transduction and transplantation and pathological diagnosis"
below) were washed twice in excess phosphate-buffered saline (PBS)
(GIBCO BRL, Grand Island, N.Y.) and were plated into six-well plates at
105 cells per well (0.3% Bacto agar, 20% FBS, 200 U of
penicillin/ml, 200 µg of streptomycin/ml, 50 µM
-mercaptoethanol
in DMEM). For infection of 32D cells, 0.5 × 106
cells/ml were incubated in DMEM containing 10% FBS, 10% WEHI-CM, 4 µg of Polybrene/ml, 50% retroviral supernatant, 100 U of
penicillin/ml, and 100 µg of streptomycin/ml for 24 h. After 24 h, the cells were washed with PBS once and maintained in IL-3 medium.
The green fluorescent protein (GFP)-positive 32D cells were sorted out
the next day, expanded in IL-3-containing medium for a week, and
resorted to a purity greater than 99.8% for all transduced 32D cells.
These twice-sorted GFP+ 32D cells were maintained in IL-3
medium until further use without change in the percentage of
GFP-positive cells in all samples.
32D cell proliferation and survival analysis.
The
twice-sorted 32D cells freshly grown in IL-3 medium were washed three
times in PBS, and viable cells were determined by fluorescence-activated cell sorter (FACS) analysis with propidium iodide staining. Equal numbers of viable cells from different samples
were resuspended in medium with or without IL-3. The percentage of
viable cells in culture was determined by FACS analysis, and the total
number of cells was counted on a Coulter Counter (Model Z1; Coulter
Particle Characterization, Hialeah, Fla.) each day for 4 days. The cell
concentration of the culture was maintained below 2 × 106 cells/ml during the whole experiment by diluting the
culture in fresh medium. The total number of viable cells at each time point was calculated by multiplying the percentage of viable cells with
the total number of cells and the dilution factor when it applied.
Bone marrow transduction and transplantation and pathological
diagnosis.
Bone marrow cell infection and transplantation and
pathological diagnosis were performed as previously described
(50). Total blood cells and white blood cells (WBCs) were
counted on a Coulter Counter (see above).
Flow cytometry and Southern blotting.
Flow cytometry
analyses, cell sorting, genomic DNA preparation, and Southern blot
analyses were performed as described previously (50).
Immunokinase assay.
Expression constructs were transfected
into BOSC23 cells as described in "Cell culture and retrovirus
preparation" above. Two days later, the cells were lysed in lysis
buffer (50 mM
N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid [HEPES] [pH 7.4], 150 mM NaCl, 10% glycerol, 1% Triton
X-100, 1 mM EGTA, 1.5 mM MgCl2, 1 mM dithiothreitol
[DTT], 10 mM NaF, 1 mM sodium orthovanadate, 1 mM freshly made
phenylmenthylsulfonyl fluoride, 1× complete protease inhibitor
cocktail [Boehringer Mannheim, Indianapolis, Ind.]). Cell lysates
were quantified with the Coomassie protein assay reagent (PIERCE,
Rockford, Ill.), adjusted to equal concentration with the above lysis
buffer. One milligram of total proteins (in 500 µl) was
immunoprecipitated with the anti-Abl antibody (Ab3) at 4°C for 2 h, followed by the addition of 50 µl of UltraLink immobilized protein
G beads (PIERCE) that had been washed three times with the lysis
buffer. After 30 min of incubation at 4°C, the immunoprecipitates
were collected by centrifugation, washed three times in lysis buffer
and twice in kinase buffer (10 mM MgCl2, 1 mM DTT, 50 mM
HEPES), and were aliquoted equally into two Eppendorf tubes: one for
immunoblotting (to determine how much of each Abl protein was used in
kinase reactions) and one for the in vitro kinase assay. The kinase
assay was performed in a total volume of 30 µl containing 1×
kinase buffer, 1 µg of glutathione S-transferase
(GST)-Crk1-225 as a substrate, 0.5 mM ATP, and 5 µCi of
[32P]ATP for 30 min at room temperature, mixing the
reaction by tapping the bottom of the tube every 10 min. Then 30 µl
of 2× sodium dodecyl sulfate (SDS) sample buffer was added to stop the
reaction, and the mixture was heated for 10 min at 100°C. The
UltraLink beads were brought down by centrifugation, and an equal
amount of supernatant was separated on an 6 to 15% SDS-polyacrylamide
gradient gel and was exposed to X-ray film. The phosphorylation of the
substrate was measured using a PhosphorImager and was normalized by the amount of Abl protein in each reaction.
Cell lysates and immunoblotting.
The twice-sorted 32D cells
(described above) freshly grown in IL-3 medium were washed twice in
excess PBS and starved in DMEM containing 10% FBS for 24 h. The
live cells were counted by exclusion of trypan blue dye (GIBCO BRL),
washed once, and resuspended in PBS at a concentration of 2 × 107 live cells/ml; then an equal volume of 2× SDS sample
buffer was added, samples were heated at 100°C for 5 min, and the
debris was cleared by centrifugation. Immunoblotting was performed as previously described (14). Antibodies used in this study,
except anti-Grb2 and anti-STAT5 (both purchased from
Pharmingen/Transduction Laboratories, San Diego, Calif.), were the same
as previously described (14).
IP.
Immunoprecipation (IP) was performed as previously
described (42) with modifications. BOSC23 cells were
transfected with different constructs (Fig. 1A). Two days later, cells
from three 60-mm plates were collected; washed in ice-cold PBS; lysed
in 500 µl of lysis buffer containing 1% Nonidet P-40 (NP-40), 20 mM
Tris (pH 8.0), 50 mM NaCl, and 10 mM EDTA as well as 1 mM
phenylmethylsulfonyl fluoride, 10 µg of aprotinin/ml, 10 mM NaF, 2 mM
sodium orthovanadate, and 2× complete protease inhibitor cocktail
(from a 50× stock); and incubated on ice for 25 min. Thereafter
insoluble material was removed by centrifugation at 15,000 × g for 15 min. BOSC23 cell lysates (150 µl each) were
diluted by the addition of 450 µl of incubation buffer (same as lysis
buffer except that it does not contain NP-40). Ab3 was added to each
sample, which were then incubated at 4°C on a rotating plate. After
3 h of incubation, 60 µl of UltraLink immobilized protein G
beads was added to each sample. Following an additional 2 h of
incubation at 4°C on a rotating plate, the beads were collected and
washed three times with freshly made ice-cold IP wash buffer (same as
lysis buffer except that the concentration of NP-40 was 0.1 instead of
1%) and were subsequently boiled with 50 µl of 2× SDS sample buffer before loading on SDS-polyacrylamide gels.
 |
RESULTS |
CC domain is necessary for Bcr-Abl to induce MPD in mice.
To
examine the role of the NH2-terminal CC domain of Bcr-Abl
in the induction of MPD in vivo, we made a
CC mutant of Bcr-Abl in
which the first 61 amino acid residues of Bcr-Abl containing the CC
domain (30) were deleted (Fig. 1A). We first characterized the
CC mutant of Bcr-Abl, as well as other Bcr-Abl mutants shown in
Fig. 1A, in a 32D clone 3 murine immature myeloid cell line. The 32D
cells were infected with retrovirus containing an enhanced GFP gene
(gfp) (Vector) or with retroviruses containing wt
bcr-abl plus gfp or bcr-abl mutants
plus gfp as shown in Fig. 1A. To avoid biased selection of
certain cell clones that might occur during the outgrowth of
factor-independent 32D populations due to the different oncogenic
potential of Bcr-Abl and its mutants, we maintained the 32D cells in
the presence of 10% WEHI-CM as a source of IL-3 during and after
retrovirus infection. Then, mass populations of infected 32D cells (GFP
positive) were isolated by FACS sorting (see Materials and Methods) and
were used to characterize the expression of Bcr-Abl proteins, tyrosine
phosphorylation patterns of intracellular proteins, and activation of
the signaling proteins STAT5 and Akt 24 h after IL-3 withdrawal.
The growth rate and viability of these cell populations were also
examined in the presence or absence of 10% WEHI-CM.
As shown in Fig.
1B,

CC protein was expressed at a level similar to
that of wt Bcr-Abl. However, consistent with the previous
report
(
30), the kinase activity of

CC was drastically reduced
compared to that of wt Bcr-Abl. The autophosphorylation of

CC
in 32D
cells was reduced 10-fold (calculated as the ratio of the
amount of
phosphorylated wt Bcr-Abl to phosphorylated

CC, denominated
by the
corresponding expression levels of wt Bcr-Abl and CC-Abl)
compared to
that of wt Bcr-Abl (Fig.
1C). Tyrosine phosphorylation
of certain
cellular proteins, such as p120 and p62 (likely to
be Bcr-Abl
substrates c-Cbl and p62dok, respectively), in

CC-expressing
32D
cells was also decreased compared to 32D cells expressing
wt Bcr-Abl
(Fig.
1C). An in vitro immunoprecipitation-kinase assay,
using
GST-Crk
1-225 as a substrate, also revealed that deletion
of the CC domain decreased the kinase activity of Bcr-Abl by 2.5-fold
(Table
1). The smaller reduction in
kinase activity of

CC in
vitro may be due to the insensitivity of
the in vitro kinase assay
in distinguishing various forms of Abl, as
previously shown (
29).
As reported previously (
3), we found that wt Bcr-Abl
activated STAT5 in 32D cells in the absence of IL-3 (Fig.
1D, lane
2).
However, the level of tyrosine-phosphorylated STAT5 in

CC-expressing
cells was significantly decreased compared to that in
Bcr-Abl-expressing
32D cells (Fig.
1D, pSTAT5, lane 5 versus lane 2),
indicating
that

CC has a reduced ability to activate STAT5. The
level of
activated Akt (pAkt) was also decreased slightly in

CC-expressing
cells compared to that in Bcr-Abl-expressing
32D cells (Fig.
1D,
pAkt, lane 5 versus lane
2).
It has been shown that Grb2 can bind Bcr-Abl through its phosphorylated
Y177 (
39,
40). Since

CC retains some ability
to
activate the Abl kinase and contains Y177, we examined whether

CC
can bind to Grb2 by coimmunoprecipitation using BOSC23 cells
transiently expressing Bcr-Abl variants. As shown in Fig.
1E,
Grb2 was
brought down from cells transfected with Bcr-Abl by the
anti-Abl
anti-body Ab3 (lane 1). A small fraction of Grb2 had
a slower migration
rate (Fig.
1E, lane 1 and bottom panel). This
may reflect that some
Grb2 was phosphorylated by Bcr-Abl. Indeed,
it has been found that
Bcr-Abl can phosphorylate Grb2 in vitro,
which caused a slower
migration of Grb2 (Subrahmanyam and Ren,
unpublished data). A trace
amount of Grb2 was also brought down
from control cells containing
vector alone (Fig.
1E, lane 2),
kinase-deficient Bcr-Abl (lane 3), and
the Y177F mutant of Bcr-Abl
(lane 7). This weak binding may reflect the
Grb2-Abl interaction
through the Grb2 SH3 domains and the SH3 binding
sites in the
carboxyl-terminal region of Abl (
42).
Interestingly, Grb2 binds
to

CC (Fig.
1E, lane 5) as strongly as it
binds to wt Bcr-Abl,
indicating that Y177 can still be phosphorylated
in

CC. However,
consistent with

CC's weak kinase activity, much
less slow-migrating
Grb2 was present in

CC cells (Fig.
1E, lane
5).
In vitro transformation assays showed that deletion of the CC domain
abolished Bcr-Abl's transforming ability in the NIH 3T3
fibroblast
cells (Table
1). This result is consistent with the
previous report
(
30). However, in contrast to the previous results
(
28,
30,
44),

CC retained some ability to confer
growth-factor
independence in 32D cells (Fig.
2). Although the growth rate of

CC-expressing cells was greatly reduced (Fig.
2A),

CC had an
ability to maintain the viability of 32D cells upon IL-3 withdrawal
similar to that of wt Bcr-Abl (Fig.
2B). We also found that

CC
could
confer IL-3 independence in BaF3 cells (data not shown).
The difference
in the ability of CC domain-deleted Bcr-Abl in
conferring growth-factor
independence to hematopoietic cell lines
found in this study versus the
earlier reports (
28,
30) could
be due to different cell
lines being used in different laboratories.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
Effects of Bcr-Abl mutants versus those of wt Bcr-Abl on
proliferation and survival of 32D cells. Various sorted GFP-positive
32D cell populations (as indicated) cultured in the presence of 10%
WEHI-CM as a source of IL-3 were washed three times in PBS and
resuspended in medium with or without 10% WEHI-CM. The total number of
cells was counted on a Coulter Counter, the percentage of viable cells
was determined by propidium iodide staining and FACS analysis, and the
total number of live cells was calculated. Shown are the growth rate
(A) (y axis is in log scale) and viability (B) of the 32D
cells in the presence (lower panel) or absence (upper panel) of 10%
WEHI-CM.
|
|
We next examined the leukemogenicity of

CC in mice compared to wt
Bcr-Abl using the conditions of the mouse CML model (
50).
As shown before (
50), mice receiving
bcr-abl-infected bone marrow
cells (Bcr-Abl mice) rapidly
developed a fatal MPD (Fig.
3 and
see
Fig.
5). Interestingly, mice receiving

CC-infected bone marrow
cells
(

CC mice) also developed a fatal disease. However, the
disease in

CC mice was drastically different from the wt Bcr-Abl-induced
disease. First, the disease in

CC mice developed after a much
longer
latency period (the median latency was 115 days, compared
to a median
latency of 20 days for wt Bcr-Abl-induced disease)
(Fig.
3 and Table
2). Second, while all diseased Bcr-Abl
mice
had very high peripheral WBC counts (usually >200,000 cells per
µl) (Fig.
4A), a high WBC count (>100,000 cells per µl) was
detected
in only 35% (8 of 23 in three independent experiments) of

CC
mice during the whole course of the experiment (Fig.
4B). Finally,
the most important
difference was that the types of cells involved
in wt Bcr-Abl and

CC
diseases were different. In diseased wt
Bcr-Abl mice, a large number of
myeloid (Mac-1
+) cells accumulate in peripheral blood,
spleen, liver, and bone
marrow (Fig.
5B and data not shown). In
contrast, all

CC mice
developed T-cell leukemia and/or lymphoma,
manifesting thymic
lymphoma, lymphadenopathy, and pleural effusion
(Fig.
5C and data
not shown). Some

CC
mice had a large number of GFP
+ T lymphoblastic cells in
peripheral blood while others had many
fewer tumor cells in their
peripheral blood. In all cases examined,
the T lymphoid tumor cell
phenotype was either Thy 1.2
+ CD4
+
CD8
+ or Thy 1.2
+ CD4
to+
CD8
+ and stained negative for Mac-1, CD19, and Ter119 (an
erythroid
cell-surface marker) (data not shown). GFP

myeloid cells were also elevated in most of these mice, suggesting
that

CC-induced T-cell tumor induces a reactive myeloproliferation
(Fig.
5C). Western blot analysis demonstrated that

CC and Bcr-Abl
were
expressed at a similar level in tumor cells from

CC mice
and Bcr-Abl
mice, respectively (data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
Survival of mice receiving bone marrow cells transduced
with retroviruses carrying bcr-abl or bcr-abl
mutants, as indicated. The curves were generated by Kaplan-Meier
survival analysis using data collected from one representative
experiment for each retrovirus. The number of mice in each group is
indicated. Asterisks indicate the CC- SH3 mice that died with
T-cell leukemia or lymphoma or anemia after a period of MPD.
|
|

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 4.
Comparison of WBC counts among mice receiving bone
marrow cells transduced with retroviruses carrying bcr-abl
or bcr-abl mutants. WBC counts of wt Bcr-Abl mice (A), CC
mice (B), CC- SH3 mice (C), and CC-Abl mice (D) were plotted
versus the time (days) post-BMT. Note that some graphs use different
scales for the y axis.
|
|

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 5.
Immunophenotypes of peripheral blood WBCs from a vector
control mouse (A), Bcr-Abl mouse (B), CC mouse (C), CC- SH3
mouse (D) and CC-Abl mouse (E). WBC counts and the time (days post-BMT)
when the data were collected are shown for each mouse.
|
|
It has previously been shown that expression of Bcr-Abl in freshly
isolated bone marrow cells from 5-FU-treated mice (5-FU
BM) could
promote the formation of colonies of myeloid origin
in soft agar
without any exogenous cytokines (
14,
15). Using
this
assay, we found that deletion of the CC domain virtually
abolished the
ability of Bcr-Abl to induce colony formation (Table
1). The above in
vivo (summarized in Table
2) and in vitro experiments
clearly
demonstrated that the CC oligomerization domain of Bcr-Abl
is essential
for induction of
myeloproliferation.
Deletion of the Abl SH3 domain rescues the ability of
CC to
induce MPD in mice.
The NH2-terminal CC domain of
Bcr-Abl has been shown to play an important role in activation of the
Abl kinase (30, 31). To examine whether the inability of
CC to induce CML-like disease is due to a lesser activation of the
Abl kinase, we introduced a deletion mutation of the Abl SH3 domain in
CC. Mutations of the SH3 domain in c-Abl have been shown to activate
the Abl kinase activity and its oncogenic potential (11,
21). It has been shown previously that SH3-deleted c-Abl is not
capable of inducing MPD in mice, but a naturally occurring Bcr-Abl
variant, Bcr-Abl/b3a3, in which a large portion of the SH3 domain is
deleted, induces the same MPD as the major form of Bcr-Abl (b3a2)
(14). We therefore constructed a
CC mutant of
Bcr-Abl/b3a3, termed
CC-
SH3 (Fig. 1A), and examined the
leukemogenicity of this mutant.
As shown in Fig.
1C, deletion of the Abl SH3 domain increased the
tyrosine kinase activity of

CC for both autophosphorylation
(by
about sevenfold) and tyrosine phosphorylation of intracellular
proteins
in 32D cells. Interestingly, the in vitro kinase assay
was unable to
reveal the increase of the Abl kinase activity in

CC-

SH3 compared
to

CC (Table
1). These results are consistent
with the effect of SH3
deletion in c-Abl, where elevated kinase
activity of SH3-deleted c-Abl
can be detected in cells but not
in vitro (
29). In
addition, deletion of the Abl SH3 domain also
restored

CC's ability
to activate STAT5, although the pAkt level
in

CC-

SH3-expressing
32D cells remained slightly lower than
that in wt Bcr-Abl-expressing
32D cells (Fig.
1D). A coimmunoprecipitation
experiment showed that

CC-

SH3 could bind Grb2 strongly (Fig.
1E, lane 6). Consistent
with the increased kinase activity of

CC-

SH3, more slow-migrating
Grb2 was present in

CC-

SH3 cells
than in

CC cells (Fig.
1E,
lane 6 versus lane
5).
In vitro transformation assays showed that

CC-

SH3 was incapable
of transforming NIH 3T3 cells (Table
1). It was reported
that a similar

CC-

SH3,

1-40-

SH3, can transform Rat1 cells
(
28). This difference could be due to the different
fibroblast
cell lines used. However, deletion of the SH3 domain in

CC did
increase the ability of

CC to confer growth-factor
independence
in 32D cells (Fig.
2A) and partially restored the ability
of

CC
to stimulate growth of primary 5-FU BM in vitro (Table
1).
When

CC-

SH3 was introduced into bone marrow cells under the
conditions of the mouse CML model, it also induced a fatal disease
(Fig.
3). However, in contrast to

CC mice, all

CC-

SH3 mice
developed an MPD (Fig.
5D) and had high WBC counts (Fig.
4C),
demonstrating that deletion of the SH3 domain rescues the ability
of

CC to induce MPD in mice. However, the rescue was not complete
compared to wt Bcr-Abl. First, although all

CC-

SH3 mice developed
MPD, only 71% (15 of a total 21 in two independent experiments)
died
during this MPD stage (Fig.
3 and Table
2). The

CC-

SH3
mice that
died with MPD displayed hepatomegaly, splenomegaly,
and pulmonary
hemorrhages, the same general features seen in wt
Bcr-Abl mice. Three
of the

CC-

SH3 mice that survived a period
of myeloproliferative
syndrome developed T-cell tumors (thymic
lymphoma and pleural
effusion), two died of anemia, and one died
before diagnosis could be
made. Second,

CC-

SH3 induced diseases
with a longer latency; the
median latency of the

CC-

SH3 disease
was 48 days, and the average
disease latency in

CC-

SH3 mice
was similar to that of

CC mice
(
P = 0.575). Even though

CC-

SH3
mice that died of
MPD (Fig.
3) had a significantly shorter latency
than observed for

CC mice (
P = 0.0002), the latency was still
significantly longer than that of Bcr-Abl mice (
P < 0.0001). These
results suggest that the CC domain may have other
functions than
just to overcome the inhibitory function of the SH3
domain and/or
that the Abl SH3 domain may have a positive role in MPD
induction,
which overlaps with Bcr sequences. Nevertheless, the results
presented
here indicate that the main function of the CC domain of
Bcr-Abl
required in induction of MPD can be largely rescued by deletion
of the Abl SH3
domain.
CC domain of Bcr-Abl is sufficient to activate Abl for inducing an
MPD in mice.
After showing that the NH2-terminal CC
domain of Bcr-Abl is essential for induction of MPD in mice, we
examined whether the CC domain alone is sufficient to activate Abl to
induce MPD. The NH2-terminal CC domain of Bcr is predicted
by sequence analysis to consist of amino acids from 28 to 68 in the
NH2 terminus of Bcr-Abl, which was confirmed by the finding
that the first 71 amino acids of Bcr can form oligomers in vitro
(30). It was also shown that fusion of the first 63 amino
acids of Bcr to c-Abl was sufficient to activate the Abl kinase
activity, actin association, and transformation of hematopoietic cell
lines (30). However, the SEG program, a computer software
that predicts globular domains based on amino acid composition
(48), indicated that the first 77 amino acid residues of
Bcr may form a globular structure. It is possible that the first 63 amino acid residues of Bcr are enough to form a functional CC domain,
but the extra 14 amino acid residues may help its folding within Bcr.
We therefore fused a DNA fragment encoding the first 77 amino acid
residues of Bcr directly to c-abl starting at its second
exon to generate cc-abl (Fig. 1A).
Consistent with previous reports (
30), fusion of the CC
domain activated the Abl kinase (Fig.
1C and Table
1). The reduction
of
autophosphorylation of CC-Abl (by about three- fold compared
to wt
Bcr-Abl) in 32D cells may be, at least in part, due to loss
of tyrosine
phosphorylation sites in the Bcr region (
25,
26,
39,
40,
49). In addition, CC-Abl-expressing 32D cells had
an amount of
phospho-STAT5 similar to that of wt Bcr-Abl-expressing
cells, although
the pAkt level was slightly lower in CC-Abl-expressing
32D cells than
in wt Bcr-Abl-expressing 32D cells. Consistent
with the lack of the
Grb2 SH2 binding site Y177, CC-Abl had a
greatly reduced ability to
bind Grb2 (Fig.
1E, lane
4).
Fusion of Bcr's NH
2-terminal CC domain alone did not
activate c-Abl's oncogenic potential in NIH 3T3 cells (Table
1), as
shown previously in Rat1 cells (
30). However, fusion of
the
NH
2-terminal CC domain of Bcr to c-Abl did confer IL-3
independence
in 32D cells (Fig.
2) and induced colony formation of 5-FU
BM,
with less efficiency than wt Bcr-Abl (Table
1).
When CC-Abl was introduced into mice by bone marrow transduction and
transplantation, it induced an MPD (displaying high WBC
counts with
granulocyte predominance and hepatosplenomegaly) (Fig.
4D and
5E and
data not shown) in the majority of recipient mice
(Table
2), and some
of the CC-Abl mice died of the MPD (Fig.
4D). Southern blot
analysis showed multiple proviral integrations
with distinct
intensity in peripheral blood WBCs from most CC-Abl
mice,
indicating that CC-Abl induced a polyclonal MPD (see Fig.
7A). All
these peripheral blood samples were collected during
the MPD phase
(with the WBC count between 150,000 and 240,000/µl)
between days 66 and 73 post-bone marrow transplantation (BMT).
These results indicate
that the MPD induced by CC-Abl, just like
that induced by Bcr-Abl, is
polyclonal and that CC-Abl itself,
like Bcr-Abl, is sufficient to
induce an MPD. However, CC-Abl
was not efficient in inducing the fatal
MPD compared to wt Bcr-Abl.
First, CC-Abl mice survived much longer
than Bcr-Abl mice (
P <
0.0001) (Fig.
3). Second, only
76% (29 of 38 in three independent
experiments) of CC-Abl mice
developed MPD, and among these 29
CC-Abl mice, only 10 died during the
MPD phase. Third, CC-Abl
did not induce pulmonary hemorrhages, which
may explain why CC-Abl
mice with MPD lived much longer than wt Bcr-Abl
mice (all of which
had pulmonary hemorrhages and died rapidly).
Finally, there were
significantly more B and T lymphoid cells (both
GFP
+ and GFP

) in the peripheral blood of the
majority of CC-Abl mice throughout
the whole course of disease
development, including MPD phase,
than seen in wt Bcr-Abl mice with MPD
(Fig.
5B and E). These results
suggest that CC-Abl has the ability to
promote the proliferation
of both myeloid and lymphoid
cells.
To further illustrate the course of disease development in those CC-Abl
mice that survived the MPD phase, we performed FACS
analyses of
peripheral blood WBCs from several CC-Abl mice at
different time points
during disease development and show the
data from one representative
mouse, BMT17.15, in Fig.
6. When
mouse
BMT17.15 first developed a high WBC count, the majority
of peripheral
WBCs were myeloid cells (Fig.
6B). The MPD syndrome
was sustained for
more than a month in this mouse (Fig.
6A, B,
and C). Then the WBC
counts decreased and remained low for 4 months
(Fig.
6A). Later, when
the WBC counts increased again (Fig.
6A),
there were many fewer
GFP
+ myeloid cells but more GFP
+ T lymphoid
cells (Fig.
6D). As the WBC counts continued to increase,
there were
progressively more GFP
+ T lymphoid cells and fewer
GFP
+ myeloid cells present in the peripheral blood of this
mouse (Fig.
6D and E). When mouse BMT17.15 died, pathological
examination
revealed that it had developed thymic lymphoma,
splenomegaly,
and pleural effusion (the majority of cells in the
pleural effusion
were T lymphoblastic cells [data not shown]).
Some CC-Abl mice
that survived an MPD phase did not develop high WBC
counts at
later time points after BMT and died of T-cell lymphoma
(BMT17.17
is an example [Fig.
4D]). Those CC-Abl mice who failed to
develop
MPD also developed a T-cell malignancy. In summary, among 38 CC-Abl
mice, 10 developed and died of MPD, 9 developed and died
primarily
of T-cell malignancy, and 19 developed an MPD in an early
phase
and later died of either T-cell malignancy (9 of 19 mice) or
mixed
MPD and T-cell tumors (10 of 19 mice) (Table
2).

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 6.
The course of disease development in a representative
CC-Abl mouse that developed a CML-like syndrome during the early phase
of disease and a T-cell leukemia and lymphoma in the later phase of
disease. Peripheral blood WBCs of mouse BMT17.15 (a CC-Abl mouse that
was also shown in Fig. 4D) were counted and were analyzed for the
presence of myeloid (Mac-1+) cells and B
(CD19+) and T (Thy 1.2+) lymphoid cells by FACS
analysis at different days post-BMT. The WBC counts versus the time
plot (A) for mouse BMT17.15 are taken from Fig. 4D. WBC counts and FACS
profiles are shown for day 43 (B), day 71 (C), day 195 (D), and day 215 (E), as indicated.
|
|
The fact that some CC-Abl mice developed T-cell malignancies after a
very long MPD phase suggests that CC-Abl may have been
targeted into
hematopoietic stem cells and induced an MPD that
subsequently
transformed to T-cell malignancy. Alternatively,
the MPD and T-cell
malignancy induced by CC-Abl could have different
cell origins and
therefore represent different transforming events.
To distinguish
between these possibilities, we examined the proviral
integration
pattern in cells isolated during the MPD phase versus
the T-cell
leukemia and/or lymphoma phase (Fig.
7B and C). Mouse
BMT20.19
developed predominantly an MPD at an early stage, and
the MPD was
sustained throughout the whole experiment (see WBC
counts and
percentages of GFP-positive myeloid cells at days 68,
165, and 214 post-BMT in the legend of Fig.
7). When
this mouse
was sacrificed at day 214 post-BMT due to a moribund
condition,
we found that it also had thymic lymphoma. Southern blot
analysis
showed that peripheral blood cells isolated in the MPD phase
shared
a common proviral integration site (approximately 4.5 kb) with
cells isolated from the thymic lymphoma and sorted T cells from
the
spleen at the terminal stage of the disease (Fig.
7B1), indicating
that
the T-cell tumor was derived from a clone that also contributed
to the
MPD during the early phase. A second restriction enzyme
digestion and
Southern blot analysis (Fig.
7B2) confirmed this
conclusion. It is
notable that not all clones in the MPD phase
developed a T-cell tumor
and that predominant MPD clones differed
at different time points of
the disease development (Fig.
7B1).
The latter phenomenon may reflect
that progenitor cells at different
developmental stages were targeted
by CC-Abl. Analysis of a mouse
with mixed MPD and T-cell leukemia
(mouse BMT17.19) also showed
that sorted myeloid cells shared common
proviral integration sites
with sorted T lymphoid cells (Fig.
7C1).

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 7.
Proviral integrations in cells isolated from CC-Abl
mice. Genomic DNA was isolated from peripheral blood WBCs of five
CC-Abl mice during an MPD phase (with WBC count between 150,000 and
240,000/µl) between days 66 and 73 post-BMT (A) and from indicated
tissues of CC-Abl mice BMT20.19 (B) and BMT17.19 (C). The DNA was then
digested with EcoRI (A, B1, and C1) or Bg1II (B2)
and subjected to Southern blot analysis using a 32P-labeled
IRES-gfp fragment as a probe. The filter in panel C1 was stripped and
reprobed with a fragment from the 3' end of bcr-abl cDNA to
detect the full-length cc-abl cDNA (4.5 kb) (C2). The
peripheral blood of mouse BMT20.19 (B) had a WBC count of 259,000/µl
and contained 74.9% GFP+MAC-1+, 2.5%
GFP+CD19+, and 1.1% GFP+Thy
1.2+ cells (M74.9B2.5T1.1) at day 68; a WBC count of
139,000/µl and M44.6B5.3T8.5 at day 165; and a WBC count of
115,000/µl and M45.4B4.5T2.9 at day 214 post-BMT. The sorted spleen T
cells (B) had a 98.6% purity. The peripheral blood of mouse BMT17.19
(C) had a WBC count of 156,000/µl and contained M15.1B0.8T32.6 when
it was sacrificed at day 128 post-BMT. The sorted spleen myeloid and T
cells from this mouse had 88.8 and 94.5% purity, respectively. Th.L.,
thymic lymphoma; Sp.M., sorted spleen Mac-1+ cells; Sp.T.,
sorted spleen Thy 1.2+ cells; Pl. eff., pleural effusion.
Molecular size markers are shown on the right.
|
|
Interestingly, two CC-Abl mice (BMT20.17 and BMT20.19) also developed
solid myeloid tumors that contained a large number of
myeloid blast
cells (data not shown). Although it is possible
that these myeloblast
tumors represent myeloid blast transformation
of MPD, this is hard to
study due to its rare
occurrence.
Grb2-binding site Y177 of Bcr-Abl is required for efficient
induction of MPD in mice.
The inefficiency of CC-Abl in inducing
MPD suggests that Bcr sequences besides the CC domain play an important
role in efficient induction of the disease. One of the important motifs
in the Bcr region besides the CC oligomerization domain is the Grb2 SH2
binding site, which contains the phosphorylated tyrosine 177. To
examine the role of Y177 in the induction of MPD in mice, we introduced the Y177F mutant of Bcr-Abl (Fig. 1) into mice using the conditions of
the mouse CML model. We found that Y177F induced a fatal disease in
most recipient mice with a significantly longer latency than wt Bcr-Abl
(Fig. 8A). Among the 15 Y177F mice in
which the disease was examined, 12 developed an MPD at an early stage,
characterized by high WBC count (ranging from 84,000 to 360,000 cells/µl) with granulocyte predominance (Fig. 8B and data not shown).
None of these mice died in the MPD phase. Seven of these 12 mice then developed a fatal T-cell malignancy at a later stage (Fig. 8C). One of
these 12 mice died of anemia, possibly due to failure of long-term bone
marrow reconstitution (Fig. 8A), and the 4 others died before diagnosis
could be made. Among the three mice that did not develop an early MPD,
two developed a fatal T-cell malignancy and one died of anemia (Fig.
8A). The T-cell tumors in all Y177F mice examined contained
CD4
to+ CD8+ cells (Fig. 8D), as was seen in
CC-Abl mice (data not shown). However, the locations of Y177F-induced
T-cell tumors were different from those of CC-Abl-induced T-cell
tumors. While CC-Abl mice with T-cell malignancies manifested T-cell
leukemia, thymic lymphoma, pleural effusion, and occasional lymphomas
in the neck of mice, Y177F mice developed massive abdominal lymphomas
in all mice. Pleural effusion was also found in six of nine mice
examined, while thymic lymphoma was detected in only one of these nine
mice. Despite this difference in the T-cell malignancies induced by CC-Abl versus the Y177F mutant of Bcr-Abl, the results described above
indicate that the Grb2-binding site Y177 is important for Bcr-Abl to
efficiently induce MPD.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 8.
(A) Survival of mice receiving bone marrow cells
transduced by Y177F- and wt bcr-abl-containing
retroviruses. The curves were generated by Kaplan-Meier survival
analysis using data collected from one representative experiment. The
two Y177F mice that died of anemia are marked with . One of these
two mice had MPD at an earlier phase. (B) FACS profiles of the
peripheral blood WBCs of a representative vector control mouse and
diseased wt Bcr-Abl and Y177F mice. Also shown are the time (days
post-BMT) and the peripheral blood WBC counts at the time of analysis.
(C) FACS profiles of the abdominal tumor and spleen from a
representative Y177F mouse with mixed MPD and T-cell malignancy. (D)
FACS analysis characterizing the phenotype of the T-cell tumor from the
same mouse as in panel C. The CD4 versus CD8 analysis was done on gated
GFP-positive cells.
|
|
 |
DISCUSSION |
It has been shown previously that the Abl kinase activity is
essential for Bcr-Abl leukemogenesis, yet activation of the Abl kinase
without Bcr sequences is not sufficient to induce MPD in mice
(14, 50). In this study, we found that the
NH2-terminal CC domain of Bcr is both essential and
sufficient, albeit not fully efficient, for Bcr to activate Abl to
induce MPD in our murine model for CML. We also found that the Grb2 SH2
binding site at Y177 played an important role for Bcr-Abl to induce
efficiently the MPD, although the ability of Bcr-Abl to bind Grb2
directly was neither essential (since CC-Abl lacked the ability to bind Grb2 yet it induced an MPD in mice) nor sufficient (since
CC retained the ability to bind Grb2 yet it failed to induce MPD in mice)
for Bcr to enable Abl to induce MPD.
The fusion of Bcr sequences to c-Abl generates an active protein
tyrosine kinase in a manner similar to the activation of receptor
tyrosine kinases (RTKs). RTKs are activated through ligand-induced dimerization, and the subsequent transautophosphorylation of receptor cytoplasmic tails creates binding sites for downstream signaling molecules. The fusion of Bcr sequences to c-Abl results in a
constitutive oligomerization of the fusion protein and activation of
the Abl kinase (30). Bcr also contains other functional
motifs that link Bcr-Abl to downstream signaling molecules. Bcr
sequences, therefore, change the activation, localization, and
signaling properties of c-Abl. Consistent with this scenario, the
NH2-terminal CC oligomerization domain of Bcr was shown
here to be both necessary and sufficient, although not fully efficient
by itself, to activate c-Abl to induce MPD. Also consistent with this
notion, the tyrosine phosphorylation site Y177, which is known to bind
Grb2, was shown here to play an important role in the efficient
induction of MPD by Bcr-Abl.
The fact that activation of the Abl kinase by deletion of the Abl SH3
domain could rescue the ability of
CC to induce MPD is consistent
with the notion that a main function of the CC domain of Bcr is to
activate the Abl kinase activity. However, oligomerization through the
NH2-terminal CC domain of Bcr appears not to be the sole
mechanism for Bcr to activate the Abl kinase. In this study we found
that
CC was still capable of inducing a T-cell malignancy in mice,
albeit with a long disease latency. We also found for the first time
that
CC had the same antiapoptotic activity as wt Bcr-Abl in 32D
cells, although it had a much lower proliferation-stimulating capacity
than wt Bcr-Abl in 32D cells (Fig. 2). It is possible that
CC
maintains survival of hematopoietic cells in mice and that further
neoplastic transformation may be due to the acquisition of additional
genetic abnormalities. The development of T-cell- specific malignancy
after a long latency may be a bias in the murine model, since it is a
common end result of expression of several oncogenes or their mutants,
which are not associated with T-cell malignancies in humans (4,
14, 19, 45). The oncogenic activity of
CC correlates with the
fact that it retains some kinase activity (for both autophosphorylation
and phosphorylation of intracellular proteins [Fig. 1B]), retains the
ability to bind Grb2 (Fig. 1E), and retains some ability to activate
STAT5 (Fig. 1C) and Ras in cells (28, 30, 35, 44). These
results indicate that the rest of the Bcr sequences have some ability
to activate the Abl kinase. Further identifying motif(s) in the Bcr
region that are responsible for activation of the Abl kinase and
further elucidating the mechanisms by which such motif(s) activate Abl will be important for understanding the regulation of the Abl kinase
and for intervening in Bcr-Abl leukemogenesis.
The fact that both CC-Abl and
CC-
SH3 can induce MPD suggests that
one of the key functions of the NH2-terminal CC domain is
to activate the Abl kinase. However, it has been shown previously that
c-Abl activated by SH3 deletion is not sufficient to induce MPD
(14). Together these data suggest that the fusion of the NH2-terminal CC domain of Bcr to c-Abl has a function(s) in
addition to activating the Abl kinase, and this additional function of the CC domain has an effect similar to that of fusing Bcr amino acids
64 to 927 to an activated c-Abl (
CC-
SH3). The CC domain of
Bcr-Abl has been shown not only to play an important role in activation
of the Abl kinase domain but also to enhance the association of Bcr-Abl
with actin filaments (30, 31). The CC domain may also
enhance functions of other domains of Abl, such as increasing the
binding of Bcr-Abl to ligands of the Abl SH2 domain, SH3 domain, and
other motifs in Abl, and it may also mediate interactions between
Bcr-Abl and c-Bcr or other CC domain-containing proteins. The fusion of
the CC domain or CC domain-deleted Bcr sequences to c-Abl also leads to
the removal of the myristoylation site of c-Abl. Myristoylation may
affect the cellular localization of the Abl oncoproteins, which, in
turn, may affect signaling pathways important for induction of MPD.
Further studies will be conducted to address these possibilities.
In this study we found that
CC-
SH3 was incapable of transforming
NIH 3T3 cells (Table 1). The different effect of the deletion of the
SH3 domain on c-Abl and
CC is probably due to the absence of the
myristoylation site in
CC-
SH3, since the myristoylation site was
shown to be required for the SH3-deleted c-Abl to transform fibroblast
cells (7). The wt Bcr-Abl, which also lacks the myristoylation site yet has the ability to transform our NIH 3T3 cell
line, may have an ability to associate with the plasma membrane in
cells. Such ability may be somehow disrupted in
CC-
SH3.
The Y177F mutation in Bcr-Abl has been shown to block transformation of
fibroblast cells by Bcr-Abl but not to affect the ability of Bcr-Abl to
induce factor independence in hematopoietic cell lines and to transform
primary bone marrow cells (5, 12, 39). These previous
results indicate that the role of Y177 in Bcr-Abl transformation is
cellular context dependent. In this study we found that Y177 in Bcr-Abl
is required for efficient induction of MPD in mice, even under the
condition of overexpression of the mutant. This experiment further
demonstrates the importance of using an in vivo experimental system to
study the roles and relative importance of domains and motifs of
Bcr-Abl and of signaling events affected by Bcr-Abl in leukemogenesis.
One of the consequences of the Grb2-Bcr-Abl interaction appears to be
the phosphorylation of Grb2. We found that a fraction of Grb2 in BOSC23
cells overexpressing Bcr-Abl and
CC-
SH3 migrated more slowly
(Fig. 1E), suggesting that Grb2 was phosphorylated. Consistent with
this notion we have found that Bcr-Abl could phosphorylate Grb2 in
vitro (Subrahmanyam and Ren, unpublished data). Since very little
slow-migrating Grb2 was present in BOSC23 cells overexpressing CC-Abl
and the Y177F mutant, which contain an activated Abl kinase yet fail to
bind Grb2 (Fig. 1E and data not shown), the phosphorylation of Grb2 was
likely Bcr-Abl-binding dependent. Indeed, we found that the
phosphorylation of Grb2 by the Y177F mutant was reduced compared to
that by wt Bcr-Abl in vitro (Subrahmanyam and Ren, unpublished data).
Similar to our finding, it has been shown that Grb2 was tyrosine
phosphorylated in 293 cells overexpressing both platelet-derived growth
factor receptor (PDGFR) and Grb2 (27). Tyrosine
phosphorylation of Grb2 may regulate its function. Further studies are
needed to examine whether Grb2 can be tyrosine phosphorylated under
physiological conditions.
Although both CC-Abl and the Y177F Bcr-Abl mutant had a reduced ability
to induce MPD and both induced T-cell malignancies with extended
disease latency, the anatomical distribution of Y177F Bcr-Abl mutant-
and CC-Abl-induced T-cell tumors was drastically different. While
CC-Abl tumor cells spread mostly into peripheral blood, thymus, and to
a much lesser extent, lymph nodes, Y177F Bcr-Abl mutant tumor cells had
a strong preference to locate in abdominal mesenteric lymph nodes. This
result suggests that signaling by Bcr sequences other than the CC
domain and Y177 governs the types and/or homing of the malignant T
lymphoid cells. Further determination of the effect of specific domains
and motifs of Bcr-Abl and specific signaling pathways on the complex
disease phenotypes in vivo using the murine CML model will help in the design of additional rational therapeutic interventions for CML. Insights gained from in vivo experiments will also contribute to
understanding mechanisms of leukemogenesis in general and may also shed
light on the molecular mechanisms of normal hematopoiesis.
 |
ACKNOWLEDGMENTS |
We thank Ben Hentel and Jonathan Schatz for their help in flow
cytometry analyses.
This work was supported by National Cancer Institute grant CA68008 (to
R.R.) and by ACS grant RPG-97-131-01-LBC (to R.R.). R.R. is a recipient
of The Leukemia and Lymphoma Society Scholar Award.
 |
ADDENDUM |
It was reported, after submission of our results, that Y177 was
required for the induction of MPD in mice by Bcr-Abl (34). Similar to our results, Y177F was shown to induce a massive abdominal T-cell malignancy. However, in that report only a few Y177F mice had
moderately increased neutrophils in peripheral blood, bone marrow, and
spleen, and some Y177F mice developed B-lymphoid leukemia (34). The differences between our results and those
reported (34) may be due to different retroviral titers
and/or different retroviral transduction methods used. Bcr-Abl has been
shown to induce a variety of hematological neoplasms, including acute
B-lymphocytic leukemia; pre-B-cell lymphoma; T-cell leukemia and/or
lymphoma; macrophage, erythroid, and mast cell tumors; myelomonocytic
leukemia; and myeloproliferative disease (6, 8, 9, 16-18, 20, 22, 24, 37, 47, 50). The nature of the hematological neoplasms
induced by Bcr-Abl has been shown to be influenced by the genetic
background of mouse strains, by treatment of bone marrow cells (5-FU
treated versus non-5-FU treated), as well as by infection conditions or
the promoters used in transgenic animals (8, 9, 16-18, 20, 24,
47), which may ultimately affect what cells Bcr-Abl expression
is targeted into and, therefore, what disease Bcr-Abl induces.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Rosenstiel Basic
Medical Sciences Research Center, MS 029, Brandeis University, 415 South Street, Waltham, MA 02454-9110. Phone: (781) 736-2486. Fax: (781)
736-2405. E-mail: ren{at}hydra.rose.brandeis.edu.
 |
REFERENCES |
| 1.
|
Afar, D. E.,
A. Goga,
J. McLaughlin,
O. N. Witte, and C. L. Sawyers.
1994.
Differential complementation of Bcr-Abl point mutants with c-Myc.
Science
264:424-426[Abstract/Free Full Text].
|
| 2.
|
Bai, R. Y.,
T. Jahn,
S. Schrem,
G. Munzert,
K. M. Weidner,
J. Y. Wang, and J. Duyster.
1998.
The SH2-containing adapter protein GRB10 interacts with BCR-ABL.
Oncogene
17:941-948[CrossRef][Medline].
|
| 3.
|
Carlesso, N.,
D. A. Frank, and J. D. Griffin.
1996.
Tyrosyl phosphorylation and DNA binding activity of signal transducers and activators of transcription (STAT) proteins in hematopoietic cell lines transformed by Bcr/Abl.
J. Exp. Med.
183:811-820[Abstract/Free Full Text].
|
| 4.
|
Carron, C.,
F. Cormier,
A. Janin,
V. Lacronique,
M. Giovannini,
M. T. Daniel,
O. Bernard, and J. Ghysdael.
2000.
TEL-JAK2 transgenic mice develop T-cell leukemia.
Blood
95:3891-3899[Abstract/Free Full Text].
|
| 5.
|
Cortez, D.,
L. Kadlec, and A. M. Pendergast.
1995.
Structural and signaling requirements for BCR-ABL-mediated transformation and inhibition of apoptosis.
Mol. Cell. Biol.
15:5531-5541[Abstract].
|
| 6.
|
Daley, G. Q.,
R. A. Van Etten, and D. Baltimore.
1990.
Induction of chronic myelogenous leukemia in mice by the P210bcr/abl gene of the Philadelphia chromosome.
Science
247:824-830[Abstract/Free Full Text].
|
| 7.
|
Daley, G. Q.,
R. A. Van Etten,
P. K. Jackson,
A. Bernards, and D. Baltimore.
1992.
Nonmyristoylated Abl proteins transform a factor-dependent hematopoietic cell line.
Mol. Cell. Biol.
12:1864-1871[Abstract/Free Full Text].
|
| 8.
|
Elefanty, A. G., and S. Cory.
1992.
Hematologic disease induced in BALB/c mice by a bcr-abl retrovirus is influenced by the infection conditions.
Mol. Cell. Biol.
12:1755-1763[Abstract/Free Full Text].
|
| 9.
|
Elefanty, A. G.,
I. K. Hariharan, and S. Cory.
1990.
bcr-abl, the hallmark of chronic myeloid leukaemia in man, induces multiple haemopoietic neoplasms in mice.
EMBO J.
9:1069-1078[Medline].
|
| 10.
|
Faderl, S.,
M. Talpaz,
Z. Estrov,
S. O'Brien,
R. Kurzrock, and H. M. Kantarjian.
1999.
The biology of chronic myeloid leukemia.
N. Engl. J. Med.
341:164-172[Free Full Text].
|
| 11.
|
Franz, W. M.,
P. Berger, and J. Y. Wang.
1989.
Deletion of an N-terminal regulatory domain of the c-abl tyrosine kinase activates its oncogenic potential.
EMBO J.
8:137-147[Medline].
|
| 12.
|
Goga, A.,
J. McLaughlin,
D. E. Afar,
D. C. Saffran, and O. N. Witte.
1995.
Alternative signals to RAS for hematopoietic transformation by the BCR-ABL oncogene.
Cell
82:981-988[CrossRef][Medline].
|
| 13.
|
Golub, T. R.,
A. Goga,
G. F. Barker,
D. E. Afar,
J. McLaughlin,
S. K. Bohlander,
J. D. Rowley,
O. N. Witte, and D. G. Gilliland.
1996.
Oligomerization of the ABL tyrosine kinase by the Ets protein TEL in human leukemia.
Mol. Cell. Biol.
16:4107-4116[Abstract].
|
| 14.
|
Gross, A. W.,
X. Zhang, and R. Ren.
1999.
Bcr-Abl with an SH3 deletion retains the ability to induce a myeloproliferative disease in mice, yet c-Abl activated by an SH3 deletion induces only lymphoid malignancy.
Mol. Cell. Biol.
19:6918-6928[Abstract/Free Full Text].
|
| 15.
|
Hao, S. X., and R. Ren.
2000.
Expression of interferon consensus sequence binding protein (ICSBP) is downregulated in Bcr-Abl-induced murine chronic myelogenous leukemia-like disease, and forced coexpression of ICSBP inhibits Bcr-Abl-induced myeloproliferative disorder.
Mol. Cell. Biol.
20:1149-1161[Abstract/Free Full Text].
|
| 16.
|
Heisterkamp, N.,
G. Jenster,
J. ten Hoeve,
D. Zovich,
P. K. Pattengale, and J. Groffen.
1990.
Acute leukemia in bcr/abl transgenic mice.
Nature
344:251-253[CrossRef][Medline].
|
| 17.
|
Honda, H.,
T. Fujii,
M. Takatoku,
H. Mano,
O. N. Witte,
Y. Yazaki, and H. Hirai.
1995.
Expression of p210bcr-abl by metallothionein promoter induced T-cell leukemia in transgenic mice.
Blood
85:2853-2861[Abstract/Free Full Text].
|
| 18.
|
Honda, H.,
H. Oda,
T. Suzuki,
T. Takahashi,
O. N. Witte,
K. Ozawa,
T. Ishikawa,
Y. Yazaki, and H. Hirai.
1998.
Development of acute lymphoblastic leukemia and myeloproliferative disorder in transgenic mice expressing p210bcr/abl: a novel transgenic model for human Ph1-positive leukemias.
Blood
91:2067-2075[Abstract/Free Full Text].
|
| 19.
|
Honda, H.,
T. Ushijima,
K. Wakazono,
H. Oda,
Y. Tanaka,
S. Aizawa,
T. Ishikawa,
Y. Yazaki, and H. Hirai.
2000.
Acquired loss of p53 induces blastic transformation in p210(bcr/abl)-expressing hematopoietic cells: a transgenic study for blast crisis of human CML.
Blood
95:1144-1150[Abstract/Free Full Text].
|
| 20.
|
Huettner, C. S.,
P. Zhang,
R. A. Van Etten, and D. G. Tenen.
2000.
Reversibility of acute B-cell leukaemia induced by BCR-ABL1.
Nat. Genet.
24:57-60[CrossRef][Medline].
|
| 21.
|
Jackson, P., and D. Baltimore.
1989.
N-terminal mutations activate the leukemogenic potential of the myristoylated form of c-abl.
EMBO J.
8:449-456[Medline].
|
| 22.
|
Kelliher, M. A.,
J. McLaughlin,
O. N. Witte, and N. Rosenberg.
1990.
Induction of a chronic myelogenous leukemia-like syndrome in mice with v-abl and BCR/ABL.
Proc. Natl. Acad. Sci. USA
87:6649-6653[Abstract/Free Full Text]. (Erratum, 87:9072.)
|
| 23.
|
Kurzrock, R.,
J. U. Gutterman, and M. Talpaz.
1988.
The molecular genetics of Philadelphia chromosome-positive leukemias.
N. Engl. J. Med.
319:990-998[Medline].
|
| 24.
|
Li, S.,
R. L. Ilaria, Jr.,
R. P. Million,
G. Q. Daley, and R. A. Van Etten.
1999.
The P190, P210, and P230 forms of the BCR/ABL oncogene induce a similar chronic myeloid leukemia-like syndrome in mice but have different lymphoid leukemogenic activity.
J. Exp. Med.
189:1399-1412[Abstract/Free Full Text].
|
| 25.
|
Liu, J.,
M. Campbell,
J. Q. Guo,
D. Lu,
Y. M. Xian,
B. S. Andersson, and R. B. Arlinghaus.
1993.
BCR-ABL tyrosine kinase is autophosphorylated or transphosphorylates P160 BCR on tyrosine predominantly within the first BCR exon.
Oncogene
8:101-109[Medline]. (Erratum, 8:2021.)
|
| 26.
|
Liu, J.,
Y. Wu,
G. Z. Ma,
D. Lu,
L. Haataja,
N. Heisterkamp,
J. Groffen, and R. B. Arlinghaus.
1996.
Inhibition of Bcr serine kinase by tyrosine phosphorylation.
Mol. Cell. Biol.
16:998-1005[Abstract].
|
| 27.
|
Lowenstein, E. J.,
R. J. Daly,
A. G. Betzer,
W. Li,
B. Margolis,
R. Lammers,
A. Ullrich,
E. Y. Skolnick,
D. Bar-Sagi, and J. Schlessinger.
1992.
The SH2 and SH3 domains containing protein GRB2 links receptor tyrosine kinases to ras signaling.
Cell
70:431-442[CrossRef][Medline].
|
| 28.
|
Maru, Y.,
O. N. Witte, and M. Shibuya.
1996.
Deletion of the ABL SH3 domain reactivates de-oligomerized BCR-ABL for growth factor independence.
FEBS Lett.
379:244-246[CrossRef][Medline].
|
| 29.
|
Mayer, B. J., and D. Baltimore.
1994.
Mutagenic analysis of the roles of SH2 and SH3 domains in regulation of the Abl tyrosine kinase.
Mol. Cell. Biol.
14:2883-2894[Abstract/Free Full Text].
|
| 30.
|
McWhirter, J. R.,
D. L. Galasso, and J. Y. Wang.
1993.
A coiled-coil oligomerization domain of Bcr is essential for the transforming function of Bcr-Abl oncoproteins.
Mol. Cell. Biol.
13:7587-7595[Abstract/Free Full Text].
|
| 31.
|
McWhirter, J. R., and J. Y. Wang.
1991.
Activation of tyrosinase kinase and microfilament-binding functions of c-abl by bcr sequences in bcr/abl fusion proteins.
Mol. Cell. Biol.
11:1553-1565[Abstract/Free Full Text].
|
| 32.
|
McWhirter, J. R., and J. Y. Wang.
1997.
Effect of Bcr sequences on the cellular function of the Bcr-Abl oncoprotein.
Oncogene
15:1625-1634[CrossRef][Medline].
|
| 33.
|
Melo, J. V.
1997.
BCR-ABL gene variants.
Baillieres Clin. Haematol.
10:203-222[Medline].
|
| 34.
|
Million, R. P., and R. A. Van Etten.
2000.
The Grb2 binding site is required for the induction of chronic myeloid leukemia-like disease in mice by the Bcr/Abl tyrosine kinase.
Blood
96:664-670[Abstract/Free Full Text].
|
| 35.
|
Muller, A. J.,
J. C. Young,
A. M. Pendergast,
M. Pondel,
N. R. Landau,
D. R. Littman, and O. N. Witte.
1991.
BCR first exon sequences specifically activate the BCR/ABL tyrosine kinase oncogene of Philadelphia chromosome-positive human leukemias.
Mol. Cell. Biol.
11:1785-1792[Abstract/Free Full Text].
|
| 36.
|
Papadopoulos, P.,
S. A. Ridge,
C. A. Boucher,
C. Stocking, and L. M. Wiedemann.
1995.
The novel activation of ABL by fusion to an ets-related gene, TEL.
Cancer Res.
55:34-38[Abstract/Free Full Text].
|
| 37.
|
Pear, W. S.,
J. P. Miller,
L. Xu,
J. C. Pui,
B. Soffer,
R. C. Quackenbush,
A. M. Pendergast,
R. Bronson,
J. C. Aster,
M. L. Scott, and D. Baltimore.
1998.
Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/abl-transduced bone marrow.
Blood
92:3780-3792[Abstract/Free Full Text].
|
| 38.
|
Pear, W. S.,
G. P. Nolan,
M. L. Scott, and D. Baltimore.
1993.
Production of high-titer helper-free retroviruses by transient transfection.
Proc. Natl. Acad. Sci. USA
90:8392-8396[Abstract/Free Full Text].
|
| 39.
|
Pendergast, A. M.,
L. A. Quilliam,
L. D. Cripe,
C. H. Bassing,
Z. Dai,
N. Li,
A. Batzer,
K. M. Rabun,
C. J. Der,
J. Schlessinger, et al.
1993.
BCR-ABL-induced oncogenesis is mediated by direct interaction with the SH2 domain of the GRB-2 adaptor protein.
Cell
75:175-185[CrossRef][Medline].
|
| 40.
|
Puil, L.,
J. Liu,
G. Gish,
G. Mbamalu,
D. Bowtell,
P. G. Pelicci,
R. Arlinghaus, and T. Pawson.
1994.
Bcr-Abl oncoproteins bind directly to activators of the Ras signalling pathway.
EMBO J.
13:764-773[Medline].
|
| 41.
|
Raitano, A. B.,
Y. E. Whang, and C. L. Sawyers.
1997.
Signal transduction by wild-type and leukemogenic Abl proteins.
Biochim. Biophys. Acta
1333:F201-F216[Medline].
|
| 42.
|
Ren, R.,
Z. S. Ye, and D. Baltimore.
1994.
Abl protein-tyrosine kinase selects the Crk adapter as a substrate using SH3-binding sites.
Genes Dev.
8:783-795[Abstract/Free Full Text].
|
| 43.
|
Sawyers, C. L.
1999.
Chronic myeloid leukemia.
N. Engl. J. Med.
340:1330-1340[Free Full Text].
|
| 44.
|
Tauchi, T.,
S. Okabe,
K. Miyazawa, and K. Ohyashiki.
1998.
The tetramerization domain-independent Ras activation by BCR-ABL oncoprotein in hematopoietic cells.
Int. J. Oncol.
12:1269-1276[Medline].
|
| 45.
|
Tomasson, M. H.,
D. W. Sternberg,
I. R. Williams,
M. Carroll,
D. Cain,
J. C. Aster,
R. L. Ilaria, Jr.,
R. A. Etten, and D. G. Gilliland.
2000.
Fatal myeloproliferation, induced in mice by TEL/PDGFbetaR expression, depends on PDGFbetaR tyrosines 579/581.
J. Clin. Investig.
105:423-432[Medline].
|
| 46.
|
Verfaillie, C. M.,
R. Hurley,
B. I. Lundell,
C. Zhao, and R. Bhatia.
1997.
Integrin-mediated regulation of hematopoiesis: do BCR/ABL-induced defects in integrin function underlie the abnormal circulation and proliferation of CML progenitors?
Acta Haematol.
97:40-52[Medline].
|
| 47.
|
Voncken, J. W.,
V. Kaartinen,
P. K. Pattengale,
W. T. Germeraad,
J. Groffen, and N. Heisterkamp.
1995.
BCR/ABL P210 and P190 cause distinct leukemia in transgenic mice.
Blood
86:4603-4611[Abstract/Free Full Text].
|
| 48.
|
Wootton, J. C.
1994.
Non-globular domains in protein sequences: automated segmentation using complexity measures.
Comput. Chem.
18:269-285[CrossRef][Medline].
|
| 49.
|
Wu, Y.,
J. Liu, and R. B. Arlinghaus.
1998.
Requirement of two specific tyrosine residues for the catalytic activity of Bcr serine/threonine kinase.
Oncogene
16:141-146[CrossRef][Medline].
|
| 50.
|
Zhang, X., and R. Ren.
1998.
Bcr-Abl efficiently induces a myeloproliferative disease and production of excess interleukin-3 and granulocyte-macrophage colony-stimulating factor in mice: a novel model for chronic myelogenous leukemia.
Blood
92:3829-3840[Abstract/Free Full Text].
|
Molecular and Cellular Biology, February 2001, p. 840-853, Vol. 21, No. 3
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.3.840-853.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Quintas-Cardama, A., Cortes, J.
(2009). Molecular biology of bcr-abl1-positive chronic myeloid leukemia. Blood
113: 1619-1630
[Abstract]
[Full Text]
-
Wu, J., Meng, F., Lu, H., Kong, L., Bornmann, W., Peng, Z., Talpaz, M., Donato, N. J.
(2008). Lyn regulates BCR-ABL and Gab2 tyrosine phosphorylation and c-Cbl protein stability in imatinib-resistant chronic myelogenous leukemia cells. Blood
111: 3821-3829
[Abstract]
[Full Text]
-
Chu, S., Li, L., Singh, H., Bhatia, R.
(2007). BCR-Tyrosine 177 Plays an Essential Role in Ras and Akt Activation and in Human Hematopoietic Progenitor Transformation in Chronic Myelogenous Leukemia. Cancer Res.
67: 7045-7053
[Abstract]
[Full Text]
-
Chen, J., Yu, W.-M., Daino, H., Broxmeyer, H. E., Druker, B. J., Qu, C.-K.
(2007). SHP-2 phosphatase is required for hematopoietic cell transformation by Bcr-Abl. Blood
109: 778-785
[Abstract]
[Full Text]
-
Quintas-Cardama, A., Cortes, J. E.
(2006). Chronic Myeloid Leukemia: Diagnosis and Treatment. Mayo Clin Proc.
81: 973-988
[Abstract]
[Full Text]
-
Baisamy, L., Jurisch, N., Diviani, D.
(2005). Leucine Zipper-mediated Homo-oligomerization Regulates the Rho-GEF Activity of AKAP-Lbc. J. Biol. Chem.
280: 15405-15412
[Abstract]
[Full Text]
-
Kharas, M. G., Fruman, D. A.
(2005). ABL Oncogenes and Phosphoinositide 3-Kinase: Mechanism of Activation and Downstream Effectors. Cancer Res.
65: 2047-2053
[Abstract]
[Full Text]
-
Million, R. P., Harakawa, N., Roumiantsev, S., Varticovski, L., Van Etten, R. A.
(2004). A Direct Binding Site for Grb2 Contributes to Transformation and Leukemogenesis by the Tel-Abl (ETV6-Abl) Tyrosine Kinase. Mol. Cell. Biol.
24: 4685-4695
[Abstract]
[Full Text]
-
Beissert, T., Puccetti, E., Bianchini, A., Guller, S., Boehrer, S., Hoelzer, D., Ottmann, O. G., Nervi, C., Ruthardt, M.
(2003). Targeting of the N-terminal coiled coil oligomerization interface of BCR interferes with the transformation potential of BCR-ABL and increases sensitivity to STI571. Blood
102: 2985-2993
[Abstract]
[Full Text]
-
Wertheim, J. A., Perera, S. A., Hammer, D. A., Ren, R., Boettiger, D., Pear, W. S.
(2003). Localization of BCR-ABL to F-actin regulates cell adhesion but does not attenuate CML development. Blood
102: 2220-2228
[Abstract]
[Full Text]
-
Eisenhaure, T. M., Francis, S. A., Willison, L. D., Coughlin, S. R., Lerner, D. J.
(2003). The Rho Guanine Nucleotide Exchange Factor Lsc Homo-oligomerizes and Is Negatively Regulated through Domains in Its Carboxyl Terminus That Are Absent in Novel Splenic Isoforms. J. Biol. Chem.
278: 30975-30984
[Abstract]
[Full Text]
-
Ho, J. M.-Y., Nguyen, M. H.-H., Dierov, J. K., Badger, K. M., Beattie, B. K., Tartaro, P., Haq, R., Zanke, B. W., Carroll, M. P., Barber, D. L.
(2002). TEL-JAK2 constitutively activates the extracellular signal-regulated kinase (ERK), stress-activated protein/Jun kinase (SAPK/JNK), and p38 signaling pathways. Blood
100: 1438-1448
[Abstract]
[Full Text]
-
Million, R. P., Aster, J., Gilliland, D. G., Van Etten, R. A.
(2002). The Tel-Abl (ETV6-Abl) tyrosine kinase, product of complex (9;12) translocations in human leukemia, induces distinct myeloproliferative disease in mice. Blood
99: 4568-4577
[Abstract]
[Full Text]
-
Wertheim, J. A., Forsythe, K., Druker, B. J., Hammer, D., Boettiger, D., Pear, W. S.
(2002). BCR-ABL-induced adhesion defects are tyrosine kinase-independent. Blood
99: 4122-4130
[Abstract]
[Full Text]
-
He, Y., Wertheim, J. A., Xu, L., Miller, J. P., Karnell, F. G., Choi, J. K., Ren, R., Pear, W. S.
(2002). The coiled-coil domain and Tyr177 of bcr are required to induce a murine chronic myelogenous leukemia-like disease by bcr/abl. Blood
99: 2957-2968
[Abstract]
[Full Text]
-
Wolff, N. C., Ilaria, R. L. Jr
(2001). Establishment of a murine model for therapy-treated chronic myelogenous leukemia using the tyrosine kinase inhibitor STI571. Blood
98: 2808-2816
[Abstract]
[Full Text]