Previous Article | Next Article 
Molecular and Cellular Biology, February 2001, p. 952-965, Vol. 21, No. 3
Division of Neuroscience, Children's
Hospital and Department of Neurobiology, Harvard Medical School,
Boston, Massachusetts 02115,1 and
Friedrich Miescher Institute, CH-4058, Basel,
Switzerland2
Received 14 June 2000/Returned for modification 31 July
2000/Accepted 19 October 2000
Serum- and glucocorticoid-inducible kinases (SGKs) form a novel
family of serine/threonine kinases that are activated in response to a
variety of extracellular stimuli. SGKs are related to Akt (also called
PKB), a serine/threonine kinase that plays a crucial role in
promoting cell survival. Like Akt, SGKs are activated by the
phosphoinositide-3 kinase (PI3K) and translocate to the nucleus upon
growth factor stimulation. However the physiological substrates and
cellular functions of SGKs remained to be identified. We hypothesized
that SGKs regulate cellular functions in concert with Akt by
phosphorylating common targets within the nucleus. The
best-characterized nuclear substrates of Akt are transcription factors
of the Forkhead family. Akt phosphorylates Forkhead transcription factors such as FKHRL1, leading to FKHRL1's exit from the nucleus and
the consequent shutoff of FKHRL1 target genes. We show here that SGK1,
like Akt, promotes cell survival and that it does so in part by
phosphorylating and inactivating FKHRL1. However, SGK and Akt display
differences with respect to the efficacy with which they phosphorylate
the three regulatory sites on FKHRL1. While both kinases can
phosphorylate Thr-32, SGK displays a marked preference for Ser-315
whereas Akt favors Ser-253. These findings suggest that SGK and Akt may
coordinately regulate the function of FKHRL1 by phosphorylating this
transcription factor at distinct sites. The efficient phosphorylation
of these three sites on FKHRL1 by SGK and Akt appears to be critical to
the ability of growth factors to suppress FKHRL1-dependent
transcription, thereby preventing FKHRL1 from inducing cell cycle
arrest and apoptosis. These findings indicate that SGK acts in concert
with Akt to propagate the effects of PI3K activation within the nucleus
and to mediate the biological outputs of PI3K signaling, including cell
survival and cell cycle progression.
Serum- and
glucocorticoid-induced kinases (SGKs) belong to a new family of
serine/threonine kinases that are regulated at both the transcriptional
and posttranslational levels by external stimuli. The mRNA encoding
SGK1, the best-studied member of the SGK family, is rapidly induced in
response to a variety of stimuli, including growth factors (51,
52), steroid and peptide hormones (3, 51, 52),
cytokines (15, 50), changes in cell volume (49), and brain injury (24).
The SGK gene is conserved from yeast to human, and the SGK protein is
expressed in a variety of tissues and cell lines in mammals (10,
51, 52). Although it has been proposed that SGK may play a role
in cell cycle progression (8) or sodium homeostasis
control (4, 12), the cellular functions of SGK are largely
uncharacterized, and to date no in vivo SGK substrates have been identified.
Within the protein kinase superfamily, SGK is closely related to Akt
(also called PKB), another serine/threonine kinase that is activated in
response to growth and survival factors and plays a critical
role in promoting cell survival (16, 20). Several recent
reports have shown that growth and survival factors also trigger SGK
activation (28, 41). The activation of SGK is dependent
upon phosphoinositide 3-kinase (PI3K) activity and requires the
phosphorylation of two regulatory sites, Thr-256 and Ser-422, that lie
in the activation loop and the C-terminal domain of SGK, respectively
(28, 41). The protein kinase PDK1, which had previously
been identified as a PI3K-dependent serine/threonine kinase that
phosphorylates and activates Akt, is also likely to be
responsible for the phosphorylation of SGK at Thr-256 (28, 41). The kinase that phosphorylates Ser-422 has yet to be identified.
Upon activation by growth factors, endogenous SGK translocates rapidly
into the nucleus, where it may encounter nuclear substrates (8). SGK and Akt are likely to phosphorylate related
substrates, as they share a similar consensus phosphorylation site
(RXRXXS/T) (1, 28, 41).
Despite their similarity, SGK and Akt display unique features. First,
unlike Akt, whose expression appears not to be regulated by
extracellular stimuli, SGK protein expression is induced upon treatment
of cells with extracellular stimuli, including growth factors. Second,
in contrast to Akt, SGK does not have a pleckstrin homology
domain and appears not to be recruited to the plasma membrane prior to its activation. Third, the consensus sequence that is
phosphorylated by SGK is not identical to the site phosphorylated by
Akt. For example, SGK is more effective than Akt at phosphorylating a
consensus peptide substrate in which the serine phosphoacceptor site is
replaced with a threonine. Moreover, SGK, in contrast to Akt, is
capable of phosphorylating peptide substrates that do not have a bulky
hydrophobic amino acid immediately C terminal to the phosphoacceptor
site (28). These differences between SGK and Akt suggested
that these two kinases might have complementary rather than redundant functions.
The observation that SGK translocates to the nucleus following its
activation by PI3K led us to hypothesize that SGK may act in concert
with Akt to phosphorylate critical targets within the nucleus. The
best-characterized nuclear substrates of Akt are transcription
factors of the Forkhead family: FKHR, FKHRL1, and AFX (for a
review, see reference 30). According to the new
nomenclature for Forkhead transcription factors, these three proteins
have been assigned to the FOXO (named for "Forkhead box, group O") subfamily of Forkhead transcription factors (26).
When Akt is inactive, FOXO family members are dephosphorylated and
localized in the nucleus, where they activate transcription. Upon
growth factor stimulation, Akt is activated and FOXOs are phosphorylated at three key regulatory phosphorylation sites (Thr-32, Ser-253, and Ser-315 for FKHRL1). The phosphorylation of FOXOs promotes
their exit from the nucleus, resulting in inhibition of FOXO-dependent
transcription (6, 7, 23, 31, 38, 43, 45, 46). Akt has been
reported to phosphorylate the second regulatory site of FOXOs (Ser-253
for FKHRL1) with greater affinity than the first and third sites
(37, 43). However, it is not clear whether protein kinases
in addition to Akt phosphorylate the first and third FOXO regulatory
sites with high affinity or what the respective contribution of each
site to the control of FOXO-dependent gene expression and FOXO
biological functions is.
We report here that the protein kinase SGK mediates the biological
effects of PI3K in parallel with Akt. Activated SGK is capable of
promoting cell survival in part by phosphorylating and inactivating the
Forkhead transcription factor FKHRL1 (also called FOXO3a). SGK,
like Akt, phosphorylates FKHRL1, thereby leading to FKHLR1
translocation from the nucleus to the cytoplasm and to the inhibition
of FKHRL1-dependent transcription. However, SGK and Akt, when expressed
at physiological levels, display differences with respect to the
efficacy with which they phosphorylate the regulatory sites on
FKHRL1: Thr-32 is phosphorylated by both protein kinases, but SGK
prefers Ser-315 whereas Akt favors Ser-253. The efficient
phosphorylation of all three regulatory sites of FKHRL1 appears to be
required for the ability of growth factors to completely repress
FKHRL1-dependent transcription, thereby preventing this transcription
factor from inducing apoptosis and/or cell cycle arrest. As mediators
of PI3K signaling within the nucleus, SGK and Akt are likely to be
important regulators of a variety of PI3K-dependent cellular responses,
including cell proliferation and survival.
Material.
Insulin-like growth factor I (IGF-I) and insulin
were purchased, respectively, from R&D Systems and Roche Biochemicals.
LY 294002 (LY) was obtained from Calbiochem. The antihemagglutinin (anti-HA) antibody (12CA5) was purchased from Roche
Biochemicals, and the anti-M2 antibody was purchased from Sigma. The
antibody against cleaved poly(ADP-ribose) polymerase (PARP) was
purchased from Cell Signaling Technology. Purified SGK was obtained
from Upstate Biotechnology.
Constructs.
The constructs encoding wild-type (WT) SGK and
mutants with mutations of the phosphorylation sites were described
previously (41). The constructs encoding WT Akt, the
constitutively active (CA) mutant (myristylated Akt lacking the
pleckstrin homology domain), and the kinase dead mutant (Akt
with a K197M mutation) have been described previously
(17). The constructs encoding glutathione
S-transferase (GST)-FKHRL1, HA-FKHRL1, M2-FKHRL1, and
the Forkhead responsive element (FHRE)-driven luciferase reporter were
described previously (7). The constructs encoding the catalytic subunit of PKA (35), WT RSK2 (53),
and the active forms of protein kinase C (PKC) Antibodies.
The anti-FKHRL1, anti-phospho-T32, and
anti-phospho-S253 antibodies were described previously
(7). For the anti-phospho-S315 antibody, a phosphopeptide
with the sequence CFRSRTNpSNATVS was synthesized (Tufts
Synthesis Facility, Tufts Medical School, Boston, Mass.) and coupled to
keyhole limpet hemocyanin (KLH) (Pierce). The KLH-coupled peptide was
injected into New Zealand White rabbits (Covance Research Products,
Denver, Pa.). Sera obtained from immunized rabbits were purified
by passage over a protein A-Sepharose column (Pharmacia),
followed by elution of the bound phosphoantibodies with 100 mM glycine
(pH 2.5). The eluate was then passed over an agarose-iodoacetyl column
to which was coupled the nonphosphorylated form of the peptide antigen.
The flowthrough from the column contained the antiphosphopeptide
antibodies used for the analysis of FKHRL1 phosphorylation.
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.3.952-965.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Protein Kinase SGK Mediates Survival Signals by
Phosphorylating the Forkhead Transcription Factor FKHRL1
(FOXO3a)
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
and 
(14,
47) have been described previously.
Cell culture. Cells of the human embryonic kidney cell line 293 (HEK 293), the derivative HEK 293T, and the Chinese hamster lung fibroblast cell line CCL39 (American Type Culture Collection) were cultured in Dulbecco's modified Eagle medium (DMEM) (Gibco) supplemented with 10% fetal calf serum (FCS) (Gibco) and antibiotics (50 U of penicillin and 50 µg of streptomycin/ml) at 37°C in an atmosphere of 95% air-5% CO2. Cerebellar granule cells were obtained from P6 Long Evans rats and cultured in BME (Sigma) supplemented with 25 mM KCl, 10% heat-inactivated calf serum (HyClone), and antibiotics as previously described (21).
In vitro kinase assay.
HEK 293 cells were seeded at
106 cells per 10-cm dish and were transfected the
following day by a modified calcium phosphate method with 2 µg of
plasmid DNA. The transfection mixture was removed after 16 h of
incubation and cells were serum starved for 24 h before
stimulation for 15 min with 100 nM insulin. Cells were placed on ice
and extracted with lysis buffer containing 50 mM Tris-HCl (pH 7.5), 1%
Nonidet P-40 (vol/vol), 120 mM NaCl, 25 mM NaF, 40 mM
-glycerophosphate, 0.1 mM sodium orthopervanadate, 1 mM
phenylmethylsulfonyl fluoride, 1 mM benzamidine, and 2 µM microcystin-LR. Lysates were centrifuged for 15 min at 12,000 × g, and the HA-conjugated SGK protein was immunoprecipitated from 400 µg of cell extracts with the anti-HA epitope 12CA5
monoclonal antibody coupled to protein A-Sepharose (Pharmacia Biotech).
The immune complexes were washed once with lysis buffer containing 0.5 M NaCl, then with lysis buffer, and finally with kinase assay buffer
(50 mM Tris-HCl [pH 7.5], 0.1% [vol/vol] 2-mercaptoethanol). In
vitro kinase assays were performed for 60 min at 30°C in 50 µl of
reaction mixture containing 30 µl of immunoprecipitate in kinase
buffer, 5 µg of WT GST-FKHRL1 as a substrate, 10 mM
MgCl2, 1 µM protein kinase A inhibitor peptide
(Bachem), and 100 µM [
-32P]ATP (Amersham;
1,000 to 2,000 cpm/pmol). All reactions were stopped by adding Laemmli
sample buffer. HEK 293 cell extracts and immunoprecipitates were
resolved by sodium dodecyl sulfate-12% polyacrylamide gel
electrophoresis (SDS-12% PAGE) and transferred to Immobilon P
membranes (Millipore). The filters were blocked for 30 min in 1×
phosphate-buffered saline (PBS) containing 5% skim milk, 0.5% Triton
X-100, and 0.5% Tween 20, followed by a 2-h incubation with the
anti-FKHRL1 antibody or the various anti-phospho-FKHRL1 antibodies diluted in the same blocking solution. The secondary antibody was alkaline phosphatase-conjugated anti-rabbit immunoglobulin G (IgG; Sigma) diluted 2,500-fold in the blocking buffer. The detection
of proteins was carried out by using the alkaline phosphatase color
development reagents from Bio-Rad.
Immunoblotting.
CCL39 fibroblasts were seeded in six-well
plastic dishes at a density of 5 × 105/well. They were transfected by the calcium
phosphate technique with 5 µg of the WT HA-FKHRL1 construct and 5 µg of the relevant constructs. Twenty-four hours after transfection,
cells were incubated in serum-free DMEM for 20 h and treated with
10 µM LY for 1 h. Extracts were obtained by lysing the cells in
lysis buffer (50 mM Tris-HCl [pH 8], 100 mM NaCl, 2 mM EGTA, 10 mM
NaF, 40 mM -glycerophosphate, 0.5% Triton X-100, 2 mM
dithiothreitol, aprotinin, 1 mM phenylmethylsulfonyl fluoride).
Proteins were resolved by SDS-PAGE (8 to 6%; 29:1, acrylamide/bisacrylamide ratio) and transferred to polyvinylidene difluoride or nitrocellulose membranes. The membranes were
incubated with anti-HA, anti-FKHRL1, anti-phospho-Thr-32,
anti-phospho-Ser-253, or anti-phospho-Ser-315 antibodies for 2 h
at room temperature. The primary antibody was visualized using
horseradish peroxidase-conjugated anti-mouse or anti-rabbit IgG
secondary antibodies and enhanced chemiluminescence.
Immunolocalization. CCL39 cells were plated onto glass coverslips at a density of 102/well in 12-well dishes. The cells were transfected by the calcium phosphate technique with 1 µg of M2-FKHRL1 and 3 µg of the relevant constructs. The day after transfection, cells were rendered quiescent by incubation in serum-free medium for 16 h and then treated with 20 µM LY for 1 h. The cells were then fixed for 15 min in 4% formaldehyde-2% sucrose at room temperature and permeabilized with 0.1% Triton X-100 for 10 min. Coverslips were washed with PBS, and nonspecific antibody binding sites were blocked by incubation with PBS containing 3% bovine serum albumin (BSA). The coverslips were then incubated with primary antibody diluted in PBS-BSA (anti-M2, 1/2,000) for 2 h and washed five times with PBS. Cells were then incubated for 1 h with a secondary antibody (goat anti-mouse IgG Cy3 conjugated: 1/500) diluted in PBS-BSA. After extensive washes in PBS, coverslips were mounted in Aquamount and examined under epifluorescent illumination. For quantification, 50 to 100 cells per coverslip were counted.
Luciferase assay.
CCL39 cells were seeded in 24-well plates
at a density of 1.5 × 105/well and were
cotransfected with 0.25 µg of empty vector (pECE) or WT HA-FKHRL1 or
with 0.5 µg of the luciferase reporter gene, 0.75 µg of the EF-LacZ
construct, 1 µg of carrier DNA (pBluescript), 0.25 to 0.5 µg of the
SGK construct, and 0.05 to 0.01 µg of the Akt construct in order to
achieve similar levels of expression between these two kinases. Two
days after transfection, cells were lysed in 100 µl of lysis buffer
and the luciferase activity of 1/5 of the samples was assayed according
to the Promega protocol. -Galactosidase activity was assayed as
previously described (34).
RT-PCR analysis. The expression of endogenous SGK was determined by reverse transcription (RT) of total RNA followed by PCR analysis. Total RNA was extracted using RNAzol (Telstat). Two micrograms of total RNA was reverse transcribed by extension of random hexamer primers using Superscript II reverse transcriptase (Life Technology) according to the manufacturer's protocol. PCR of the cDNA was performed using AdvanTaq (Life Technology) with the following pairs of primers: human SGK1-1 (hSGK1-1) (forward; GGAGCCTGAGCTTATGAATGCCAAC) and hSGK1-2 (reverse; TGCCACAGAAGGTGGATGTTGTGC); hSGK1-3 (forward; CCTTGTGGATATGCTGTGTGAACCG) and hSGK1-4 (reverse; TGGGGCATTGGTCCATAAAAACC). The PCR program used was as follows: 1 min at 95°C; 32 cycles of 30 s at 95°C, 1 min at 68°C, and 1 min at 72°C; and a 5-min extension at 72°C.
A PCR was also performed on total RNA that had not been reverse transcribed to control for the absence of genomic DNA in the RNA preparation (see Fig. 4A). The products of the PCRs were resolved on a 2% agarose gel.BrdU incorporation.
CCL39 fibroblasts were seeded onto glass
coverslips in 12-well plates at a density of 65,000/well and were
transfected with 4 µg of the construct of interest. At 8 h after
transfection, cells were starved for 24 h in DMEM and then
stimulated with 20% FCS in the presence of bromodeoxyuridine (BrdU)
for 24 h. Cells were fixed in 100% methanol for 15 min at
20°C. Coverslips were incubated with 2 N HCl for 10 min at 37°C
and washed extensively with PBS. Nonspecific antibody binding sites
were blocked by incubation with PBS containing 8% BSA and 10% FCS.
Coverslips were then incubated with primary antibodies (anti-FKHRL1,
1/2,000; antibromodeoxyuridine [anti-BrdU], 1/500) for 2 h and
washed five times with PBS. Cells were then incubated for 1 h with
a secondary antibody (goat anti-rabbit IgG, Cy3 conjugated, 1/500; goat
anti-rat IgG, biotinylated, 1/300), followed by a 30-min incubation
with Cy2-conjugated streptavidin (1/200). Coverslips were mounted in
Aquamount and examined under epifluorescent illumination. For
quantification, 50 to 100 cells per coverslip were counted.
Apoptosis assay. Cerebellar granule neurons were seeded onto glass coverslips in 24-well plates at a density of 106 cells/well and at 5 or 6 days in vitro were cotransfected with 2 µg of the construct of interest and 0.5 µg of the plasmid encoding green fluorescent protein (GFP) under the control of the cytomegalovirus promoter, as described elsewhere (21). At 16 h after transfection, the medium was changed for BME containing IGF-I (50 ng/ml) for 24 h and then incubated in BME alone for an additional 8 h or not incubated. The transfected neurons were then fixed in 4% paraformaldehyde-2% sucrose. Nuclei were stained with Hoechst 33258 (2.5 mg/ml). Apoptotic nuclei of GFP-positive neurons were counted in a blinded manner.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
SGK phosphorylates the Forkhead transcription factor FKHRL1 and displays a preference for Thr-32 and Ser-315 in vitro. Within the protein kinase superfamily, the serine/threonine kinase SGK stands out as a good candidate for the phosphorylation of FOXO family members since (i) SGK is activated by growth and survival factors in a PI3K-dependent manner (28, 41), (ii) following growth factor stimulation, SGK translocates into the nucleus, where it might phosphorylate transcription factors (8), and (iii) the sequence of peptides that are selectively phosphorylated by SGK is compatible with the amino acid regions that surround the three known phosphorylation sites of FKHRL1 (28, 41).
To determine if SGK can phosphorylate FKHRL1, a WT SGK, a kinase-inactive (KN) form of SGK (K127Q), or a CA form of SGK (S422D) (41) was expressed in HEK 293 cells and activated by exposure of the cells to insulin or IGF-I. In vitro kinase assays of immunoprecipitated SGK were then performed using bacterially purified FKHRL1 as a substrate. We found that in response to insulin or IGF-I, WT SGK, but not a KN mutant of SGK, phosphorylated FKHRL1 in vitro (Fig. 1A, left panel). The CA form of SGK efficiently phosphorylated FKHRL1 in vitro, in the absence or presence of IGF-I (Fig. 1A, right panel).
|
SGK phosphorylates the Forkhead transcription factor FKHRL1 and
displays a preference for Ser-315 within cells.
We next determined
whether SGK also induces the phosphorylation of FKHRL1 within cells and
whether the difference in the efficacy with which SGK and Akt
phosphorylate FKHRL1 regulatory sites is also observed in vivo. To this
end, we cotransfected fibroblasts or HEK 293T cells with constructs
expressing CA SGK or Akt together with FKHRL1 and performed
immunoblotting with phosphoantibodies to FKHRL1. Overexpression of CA
versions of Akt or SGK within cells led to the phosphorylation of all
three regulatory sites of FKHRL1 (data not shown). However, when the
amount of the expression plasmids transfected into cells was reduced so
that the levels of expressed SGK and Akt were lower and closer to the
endogenous levels, we found that SGK was clearly more potent than Akt
at inducing the phosphorylation of FKHRL1 at Ser-315 (Fig.
2A). In contrast, Akt was more efficient
than SGK at phosphorylating FKHRL1 at Ser-253. Thr-32, although
preferred in vitro by SGK, appeared to be phosphorylated by both Akt
and SGK within cells. These findings corroborate the specificity of SGK
and Akt for FKHRL1 observed in vitro. These results also indicate that
although when overexpressed, Akt and SGK can phosphorylate all three
phosphorylation sites of FKHRL1, when expressed at lower, potentially
more physiological levels, these two kinases display a marked
preference for particular regulatory sites of FKHRL1.
|
Other PI3K-activated protein kinases do not play a significant role in phosphorylating FKHRL1. We have shown that SGK and Akt, two protein kinases activated by growth and survival factors in a PI3K-dependent manner, are capable of phosphorylating FKHRL1 in vitro and in vivo. However, an increasing number of protein kinases have recently been reported to be regulated by PI3K, including protein kinase A (13), p70S6 kinase (2, 42), p90RSK (25, 44), and the conventional and atypical isoforms of PKC (22, 32). Most of these serine/threonine kinases are structurally related to Akt and known to phosphorylate a consensus sequence with an arginine three amino acids N-terminal to the phosphoacceptor site, which corresponds to the amino acid sequence that surrounds the three FKHRL1 phosphorylation sites.
We therefore determined if these other PI3K-activated protein kinases were capable of inducing FKHRL1 phosphorylation. In contrast to our findings with SGK and Akt, immunoblot experiments using anti-FKHRL1 phosphospecific antibodies showed that overexpression of CA forms of the atypical PKC or did not lead to an
enhancement of FKHRL1 phosphorylation (Fig.
3). Likewise, expression of PKA or
p90RSK only weakly induced the phosphorylation of FKHRL1 at Thr-32,
Ser-253 (Fig. 3), and Ser-315 (data not shown).
|
Endogenous SGK participates in FKHRL1 phosphorylation in response
to growth factor signaling.
To determine if SGK activity is
required for FKHRL1 phosphorylation in response to growth factors, we
interfered with the activity of endogenous SGK in cells by expressing
dominant-negative SGK alleles. To this end, we first verified that
endogenous SGK was expressed in HEK 293T cells. Since available
antibodies do not recognize the endogenous SGK protein in these cells,
we performed RT-PCR analysis of mRNA extracted from HEK 293T cells with
pairs of primers that are specific for the SGK1 isoform. We found that the SGK1 mRNA is transcribed in HEK 293T cells, indicating that SGK1
protein is likely expressed in these cells (Fig.
4A). Consistent with the previous finding
that SGK expression is induced by serum and glucocorticoids
(8), we found that the levels of SGK mRNA expression were
slightly up-regulated in HEK 293T cells that were exposed to serum and
dexamethasone for 1 h (Fig. 4A).
|
4 M dexamethasone (D) to induce SGK1 mRNA.
RT-PCRs were performed on total RNA using two different pairs of
primers that are specific for the human SGK1 isoform (hSGK1-1-hSGK1-2
and hSGK1-3-hSGK1-4). (B) HEK 293T cells were transfected with an
empty vector (CTL) or constructs encoding the KN Akt (K197M) mutant
(Akt k.n.) or the KN SGK (T256A/S422A) mutant (SGK k.n.). Cells were
incubated in the presence of 10% FCS, and extracts were resolved
by SDS-PAGE. Phosphorylation of endogenous FKHRL1 was detected by
immunoblot analysis with antibodies directed against phospho-T32,
phospho-S253, or phospho-S315 FKHRL1. Mobility shift of
endogenous FKHRL1 was assessed by immunoblot analysis with the antibody
directed against total FKHRL1. *, phosphorylated form of FKHRL1.
SGK activity is important for promoting FKHRL1 relocalization to
the cytoplasm upon growth factor stimulation.
To determine if SGK,
by phosphorylating FKHRL1, promotes the sequestration of FKHRL1 within
the cytoplasm, we first coexpressed WT SGK, the CA SGK mutant (S422D),
or the KN SGK mutant (T256A/S422A) together with FKHRL1 and examined
the effect on the subcellular localization of FKHRL1. In the absence of
growth factors, FKHRL1 was found to be predominantly in the nucleus
(Fig. 5A). However, when
FKHRL1 was coexpressed with the CA S422D mutant of
SGK, a significant fraction of FKHRL1 was present in the cytoplasm
(Fig. 5A). This suggests that SGK phosphorylation of FKHRL1
leads to the translocation of FKHRL1 from the nucleus to the
cytoplasm.
|
SGK suppresses FKHRL1 transcriptional activity.
Since SGK
phosphorylation of FKHRL1 promotes the exit of FKHRL1 from the nucleus,
we expected that SGK phosphorylation of FKHRL1 might lead to a
reduction in FKHRL1-dependent transcription. We tested whether SGK
inhibits FKHRL1-dependent transcription by performing luciferase assays
using a FHRE-driven luciferase reporter construct. We found that WT SGK
and the CA mutants of SGK effectively blocked FKHRL1-dependent
transcription (Fig. 6A, left panel). In
contrast to the expression of SGK or Akt, the expression of PKA,
p90RSK, PKC , or PKC , which does not lead to FKHRL1 efficient
phosphorylation (Fig. 3), did not have a significant effect on
FKHRL1-dependent transcription (Fig. 6A, right panel).
|
FKHRL1 induces cell cycle arrest and apoptosis when mutated at SGK
or Akt phosphorylation sites.
A recently described transcriptional
target of FKHRL1 is the cell cycle inhibitor gene p27KIP1, and indeed,
FKHRL1 and the other FOXOs have been shown to induce cell cycle arrest
when present in the nucleus (36). Since the
phosphorylation of each regulatory site of FKHRL1 contributes to the
exclusion of FKHRL1 from the nucleus and the repression of
FKHRL1-dependent transcription, we asked if the efficient
phosphorylation of the different regulatory sites of FKHRL1 by Akt and
SGK was required to block FKHRL1-dependent cell cycle arrest. To this
end, we transfected the various FKHRL1 phosphorylation site mutants
into fibroblasts and measured reentry into the S phase of the cell
cycle by BrdU incorporation after growth factor stimulation (Fig.
7A). We found that FKHRL1 single and
double phosphorylation site mutants were more efficient at blocking
cell cycle reentry than WT FKHRL1. The mutant of FKHRL1 in which all
three phosphorylation sites were replaced by an alanine was the most
effective at blocking cell cycle reentry. These results indicate that
the phosphorylation of the three regulatory sites of FKHRL1 is
important to prevent FKHRL1 from inducing cell cycle arrest.
|
SGK plays a role in the promotion of growth factor-induced cell survival. Our observation that SGK suppresses FKHRL1-dependent transcription and that the phosphorylation of FKHRL1 at all three regulatory sites is important for the prevention of FKHRL1-induced cell cycle arrest and apoptosis suggested that SGK may regulate these two biological functions. Indeed, a role for SGK in cell cycle progression had been suggested in a recent study (8).
To determine whether SGK plays a critical role in regulating cell survival, we first employed primary cultures of cerebellar granule neurons, a population of neurons that is dependent both on PI3K and on the repression of FKHRL1-dependent transcription for cell survival (7, 21). As shown in Fig. 2B, these neurons express an endogenous form of SGK as well as an endogenous form of FKHRL1 that is phosphorylated in response to survival factors. After transfecting cerebellar granule cells with various forms of SGK and counting the number of apoptotic and surviving cells among the transfected cells, we then asked whether SGK could promote the survival of neurons. The expression of a CA form of SGK, as with Akt, leads to a significant reduction of apoptotic neurons whether the cerebellar neurons are grown in the presence or absence of survival factors (with a P value of <0.01 according to analysis of variance) (Fig. 8A). In contrast, the expression of KN SGK (T256A/S422A) in cerebellar neurons led to a small increase in the number of cells undergoing apoptosis (Fig. 8A), which is consistent with ability of this SGK mutant to act in a dominant-interfering manner to prevent endogenous SGK from phosphorylating FKHRL1 and relocalizing it to the cytoplasm.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
In this report we describe experiments demonstrating that the PI3K-regulated kinase SGK1 phosphorylates the FOXO transcription factor FKHRL1, thereby inducing the exit of FKHRL1 from the nucleus and the repression of FKHRL1-dependent transcription. Our experiments identify FKHRL1 as a physiological substrate of SGK and suggest a biological role for this protein kinase in the regulation of cell survival and cell cycle progression. Our findings suggest that SGK functions as a critical link between growth factor activation of the PI3K and the regulation of gene expression events that are critical for biological responses such as cell survival and cell cycle reentry.
SGK and Akt may cooperate in promoting a variety of biological responses by phosphorylating common substrates at overlapping but different regulatory sites. SGK and Akt differ with respect to the efficacy with which they phosphorylate specific sites on FKHRL1, since SGK preferentially phosphorylates Ser-315 whereas Akt favors Ser-253. The coordinated phosphorylation of FKHRL1 at three sites by SGK and Akt could involve the sequential phosphorylation of the different sites of FKHRL1. In a recent study of the FKHRL1 family member FKHR, the site equivalent to FKHRL1 Ser-253 was suggested to act as a "gatekeeper," since the phosphorylation of Ser-253 was found to be required to release a negative constraint on the FKHR molecule so that FKHR could then be phosphorylated at additional sites (37). Nakae and colleagues suggested that while Akt is responsible for phosphorylating FKHR at Ser-253, other unidentified protein kinases that are distinct from Akt may phosphorylate the two other sites on FKHR (37). Given the findings in the present study, it is tempting to speculate that Akt may first phosphorylate FKHRL1 at Ser-253 and that this phosphorylation event may induce a conformational change in FKHRL1 that allows SGK to phosphorylate FKHRL1 at Ser-315. Alternatively, the phosphorylation of FKHRL1 at Ser-253 by Akt may allow the binding to FKHRL1 of 14-3-3 proteins, which then act as cofactors that promote the phosphorylation of FKHRL1 by SGK. A role for 14-3-3 proteins as cofactors that promote sequential protein phosphorylation was recently demonstrated for another Akt target, the Bcl-2 family member BAD (18).
The efficient phosphorylation of the three regulatory sites of FKHRL1 appears to be required to ensure the effective translocation of FKHRL1 from the nucleus to the cytoplasm and the effective repression of FKHRL1-dependent transcription. The phosphorylation of FKHRL1 at each of the regulatory sites may involve different mechanisms that cooperate to promote the efficient exclusion of FKHRL1 from the nucleus. FKHRL1 Ser-315, which is the phosphorylation site favored by SGK, is located close to the nuclear export signal (NES) of FOXOs (6). One possibility is that SGK phosphorylation of Ser-315 unmasks the NES of FKHRL1, thereby rendering the NES accessible to the nuclear export machinery. Thus, SGK phosphorylation of Ser-315 may play a primary role in exporting nuclear FKHRL1 to the cytoplasm upon activation of the PI3K-SGK signaling pathway. The phosphorylation of the other two sites on FKHRL1, Thr-32 and Ser-253, is catalyzed more effectively by Akt and is required for FKHRL1 binding to 14-3-3 proteins (7). When bound to FKHRL1, 14-3-3 proteins may participate in the nuclear export of FKHRL1, since the 14-3-3 proteins have been shown to contain a NES and to be involved in the coexport of their binding partners (33). 14-3-3 protein binding to FKHRL1 may also ensure the retention of FKHRL1 in the cytoplasm. As FKHRL1 Ser-253 is located within the nuclear localization signal of FKHRL1, Akt phosphorylation of Ser-253 may also inhibit the function of the nuclear localization signal of FKHRL1, thereby preventing the reentry of cytoplasmic FKHRL1 into the nucleus.
The regulation of FKHRL1 subcellular localization by phosphorylation is reminiscent of the regulation of the yeast transcription factor Pho4 (27, 29, 40). Pho4 is phosphorylated at several regulatory sites by different kinases and the multiple phosphorylation events cooperate to promote the nuclear export of Pho4 and to prevent the nuclear import of Pho4, thus resulting in the exclusion of this transcription factor from the nucleus (29). The sequential phosphorylation of transcription factors, such as Pho4 or FKHRL1, at several sites that have overlapping but distinct roles in regulating nuclear export may therefore provide a general and efficient mechanism that ensures the effective translocation of these transcription factors from the nucleus to the cytoplasm.
The primary consequence of FKHRL1 phosphorylation at its regulatory sites appears to be the translocation of FKHRL1 from the nucleus to the cytoplasm and the inhibition of FKHRL1-dependent transcription. However, a question that remains to be answered is that of whether there are kinase-dependent mechanisms in addition to the regulation of the subcellular localization of FKHRL1 that contribute to the control of FKHRL1 function. Given that Ser-315, the amino acid residue that is preferentially phosphorylated by SGK, is located within the transactivation domain of FKHRL1, it is possible that the phosphorylation of Ser-315 may also regulate the transactivation function of FKHLR1. In addition, phosphorylation of FKHRL1 at different phosphorylation sites may facilitate FKHRL1 binding to distinct protein partners that have yet to be identified but could prove to be important for FKHRL1 function.
It is not yet clear why there are two families of PI3K-regulated kinases that phosphorylate FKHRL1. One possibility is that when expressed at physiological levels, SGK and Akt display a strict preference for one FKHRL1 site over the others, so that SGK exclusively phosphorylates FKHRL1 at Ser-315 while Akt selectively phosphorylates FKHRL1 at Ser-253. This is consistent with the observation that when expressed at low levels, SGK selectively phosphorylated Ser-315 while Akt was more effective at phosphorylating Ser-253. Another possibility is suggested by the observation that Akt and SGK are differentially expressed in cells in response to environmental stimuli. Whereas Akt is activated within seconds upon growth factor addition and may be involved in the phosphorylation of FKHRL1 at early times after growth factor stimulation, SGK protein is present only at very low levels in cells in the absence of growth factor stimulation (8). The expression of SGK is induced within hours of exposure of the cells to growth factors (8). Thus, active SGK could phosphorylate FKHRL1 at later times after growth factor stimulation and may prolong the effects of growth factor stimulation on gene expression.
The overexpression of KN mutants of SGK or Akt in cells reduces the phosphorylation of FKHRL1 and inhibits FKHRL1 cytoplasmic relocalization in response to growth factors, suggesting that endogenous SGK and Akt may both be required for the phosphorylation of FKHRL1 and for FKHRL1 cytoplasmic retention. In addition, overexpression of KN mutants of SGK or Akt in cells promotes apoptosis, raising the possibility that endogenous SGK and Akt may both play an important role in mediating PI3K-dependent cell survival. However, a potential limitation to the use of the dominant-interfering SGK and Akt mutants to selectively inhibit their endogenous counterparts is that SGK and Akt are both activated by the same upstream kinase, PDK1 (28, 41). Thus, the expression of high levels of dominant-interfering mutants of SGK may lead to inhibition of PDK1 and consequently may prevent the activation of both SGK and Akt (48). Conversely, it is possible that the overexpression of dominant-negative mutants of Akt may interfere with endogenous SGK function. Therefore, many of the data that had been generated in the past few years using dominant-negative mutants of Akt to block endogenous Akt function may have to be reexamined, as the results obtained may reflect the inhibition of both endogenous Akt and SGK. The identification of chemical inhibitors that specifically block SGK or Akt will be particularly useful for resolving this issue.
In our present study, we have defined a new function for SGK in mediating survival in response to survival factors. It will be important to determine whether the survival function of SGK can be generalized to cells that have been challenged with a range of apoptotic stimuli, such as DNA damage, matrix detachment, or cell cycle discordance. The transcription factor FKHRL1 is also likely just one of a number of SGK substrates that mediate the survival function of SGK. Other previously characterized targets of Akt that had been implicated in the regulation of cell survival, such as BAD and caspase 9 (9, 17, 19), may also be found to be phosphorylated and regulated by SGK.
The physiological roles of SGK are not likely to be restricted to the promotion of cell survival. Previous studies have indicated that SGK is present in the nucleus during the S phase of the cell cycle, suggesting that SGK plays an active role in cell cycle progression (8). Importantly, FOXO transcription factors have recently been shown to promote cell cycle arrest by inducing the expression of the cell cycle inhibitor p27KIP1 (36). Consistent with a role for SGK phosphorylation of FKHRL1 in cell cycle progression, we find that mutating any one of the three phosphorylation sites of FKHRL1 generates a form of FKHRL1 that promotes cell cycle arrest. These results suggest that SGK and Akt may together promote cell cycle progression by phosphorylating and inactivating FOXOs, thereby decreasing p27KIP1 levels.
Given the importance of SGK and Akt for cell survival and proliferation, mutations in these kinases are likely to have an impact on cancer development in vertebrates. CA versions of Akt and PI3K are transduced by oncogenic retroviruses and can trigger cell transformation (5, 11). It will be interesting to determine whether the CA versions of SGK will also be found to be tumorigenic. The ability of CA forms of Akt and SGK to induce cell transformation may be a consequence of the inappropriate suppression of FOXO-dependent transcription, due to SGK and/or Akt phosphorylation of FOXO transcription factors. One attractive model is that when cells are exposed to deleterious conditions that inhibit PI3K signaling, FOXOs will translocate to the nucleus and induce the expression of cell death or cell cycle arrest genes. CA SGK and Akt may shut off the expression of these cell death and arrest genes by excluding FOXOs from the nucleus, thereby triggering abnormal proliferation and survival and ultimately cell transformation.
Members of the PI3K pathway are conserved throughout evolution. In particular, SGK homologues are present in yeast, nematodes, flies, and mammals. In the nematode Caenorhabditis elegans, the PI3K-Akt pathway plays an important role in the regulation of insulin metabolism and organismal aging by suppressing the activity of a Forkhead transcription factor termed Daf16 (39). Since in addition to Akt, there exists an SGK counterpart in the nematode, it will be interesting to determine whether the nematode SGK contributes to the suppression of Daf16 function and participates in the control of insulin metabolism and organismal aging.
In summary, the protein kinase SGK appears to integrate the effects of different extracellular stimuli and to regulate a variety of biological functions by phosphorylating key substrates including the FOXO transcription factor FKHRL1. The identification of the array of biological functions and substrates of SGK will be of critical importance in understanding how the PI3K signaling pathway orchestrates cellular responses to various extracellular cues.
| |
ACKNOWLEDGMENTS |
|---|
We thank G. Firestone, A. Toker, and F. Uberall for kindly providing reagents. We thank S. R. Datta, M. Z. Lin, K. F. Tolias, and J. Zieg for critical reading of the manuscript. We also thank S. R. Datta for stimulating discussion.
This research was supported by an NIH grant (CA43855), a Mental Retardation Research Center grant (HD 18655), and a grant from Daiichi Pharmaceuticals to M.E.G. A.B. is supported by a Human Frontier Long Term Fellowship.
| |
ADDENDUM IN PROOF |
|---|
While this ipaper was in review, Sonyang and colleagues (Curr. Biol. 10:1233-1236, 2000) demonstrated that SGK-3 (also known as CISK) can both promote cell survival and directly phosphorylate and inactivate the proapoptotic proteins FKHR and BAD.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Division of Neuroscience, Children's Hospital and Department of Neurobiology, Harvard Medical School, Boston, MA 02115. Phone: (617) 355-8344. Fax: (617) 738-1542. E-mail: greenberg{at}a1.tch.harvard.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Alessi, D. R., F. B. Caudwell, M. Andjelkovic, B. A. Hemmings, and P. Cohen. 1996. Molecular basis for the substrate specificity of protein kinase B; comparison with MAPKAP kinase-1 and p70 S6 kinase. FEBS Lett. 399:333-338[CrossRef][Medline]. |
| 2. | Alessi, D. R., M. T. Kozlowski, Q. P. Weng, N. Morrice, and J. Avruch. 1998. 3-Phosphoinositide-dependent protein kinase 1 (PDK1) phosphorylates and activates the p70 S6 kinase in vivo and in vitro. Curr. Biol. 8:69-81[CrossRef][Medline]. |
| 3. |
Alliston, T. N.,
A. C. Maiyar,
P. Buse,
G. L. Firestone, and J. S. Richards.
1997.
Follicle stimulating hormone-regulated expression of serum/glucocorticoid-inducible kinase in rat ovarian granulosa cells: a functional role for the Sp1 family in promoter activity.
Mol. Endocrinol.
11:1934-1949 |
| 4. |
Alvarez de la Rosa, D.,
P. Zhang,
A. Naray-Fejes-Toth,
G. Fejes-Toth, and C. M. Canessa.
1999.
The serum and glucocorticoid kinase sgk increases the abundance of epithelial sodium channels in the plasma membrane of Xenopus oocytes.
J. Biol. Chem.
274:37834-37839 |
| 5. |
Bellacosa, A.,
J. R. Testa,
S. P. Staal, and P. N. Tsichlis.
1991.
A retroviral oncogene, akt, encoding a serine threonine kinase containing a SH2-like region.
Science
254:274-277 |
| 6. |
Biggs, W. H. I.,
J. Meisenhelder,
T. Hunter,
W. K. Cavenee, and K. C. Arden.
1999.
Protein kinase B/Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1.
Proc. Natl. Acad. Sci. USA
96:7421-7426 |
| 7. | Brunet, A., A. Bonni, M. J. Zigmond, M. Z. Lin, P. Juo, L. S. Hu, M. J. Anderson, K. C. Arden, J. Blenis, and M. E. Greenberg. 1999. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96:857-868[CrossRef][Medline]. |
| 8. |
Buse, P.,
S. H. Tran,
E. Luther,
P. T. Phu,
G. W. Aponte, and G. L. Firestone.
1999.
Cell cycle and hormonal control of nuclear-cytoplasmic localization of the serum- and glucocorticoid-inducible protein kinase, Sgk, in mammary tumor cells. A novel convergence point of anti-proliferative and proliferative cell signaling pathways.
J. Biol. Chem.
274:7253-7263 |
| 9. |
Cardone, H. M.,
N. Roy,
H. R. Stennicke,
G. S. Salvesen,
T. F. Franke,
E. Stanbridge,
S. Frisch, and J. C. Reed.
1998.
Regulation of cell death protease caspase-9 by phosphorylation.
Science
282:1318-1321 |
| 10. | Casamayor, A., P. D. Torrance, T. Kobayashi, J. Thorner, and D. R. Alessi. 1999. Functional counterparts of mammalian protein kinases PDK1 and SGK in budding yeast. Curr. Biol. 9:186-197[CrossRef][Medline]. |
| 11. |
Chang, H. W.,
M. Aoki,
D. Fruman,
K. R. Auger,
A. Bellacosa,
P. N. Tsichlis,
L. C. Cantley,
T. M. Roberts, and P. K. Vogt.
1997.
Transformation of chicken cells by the gene encoding the catalytic subunit of PI 3-kinase.
Science
276:1848-1850 |
| 12. |
Chen, S. Y.,
A. Bhargava,
L. Mastroberardino,
O. C. Meijer,
J. Wang,
P. Buse,
G. L. Firestone,
F. Verrey, and D. Pearce.
1999.
Epithelial sodium channel regulated by aldosterone-induced protein sgk.
Proc. Natl. Acad. Sci. USA
96:2514-2519 |
| 13. |
Cheng, X.,
Y. Ma,
M. Moore,
B. A. Hemmings, and S. S. Taylor.
1998.
Phosphorylation and activation of cAMP-dependent protein kinase by phosphoinositide-dependent protein kinase.
Proc. Natl. Acad. Sci. USA
95:9849-9854 |
| 14. | Chou, M. M., W. Hou, J. Johnson, L. K. Graham, M. H. Lee, C. S. Chen, A. C. Newton, B. S. Schaffhausen, and A. Toker. 1998. Regulation of protein kinase C zeta by PI 3-kinase and PDK-1. Curr. Biol. 8:1069-1077[CrossRef][Medline]. |
| 15. | Cowling, R. T., and H. C. Birnboim. 2000. Expression of serum- and glucocorticoid-regulated kinase (sgk) mRNA is up-regulated by GM-CSF and other proinflammatory mediators in human granulocytes. J. Leukoc. Biol. 67:240-248[Abstract]. |
| 16. |
Datta, S. R.,
A. Brunet, and M. E. Greenberg.
1999.
Cellular survival: a play in three Akts.
Genes Dev.
13:2905-2927 |
| 17. | Datta, S. R., H. Dudek, X. Tao, S. Masters, H. Fu, Y. Gotoh, and M. E. Greenberg. 1997. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 91:231-241[CrossRef][Medline]. |
| 18. | Datta, S. R., A. Katsov, L. Hu, A. Petros, S. W. Fesik, M. B. Yaffe, and M. E. Greenberg. 2000. 14-3-3 proteins and survival kinases cooperate to inactivate BAD by BH3 domain phosphorylation. Mol. Cell 6:41-51[CrossRef][Medline]. |
| 19. |
del Peso, L.,
M. Gonzalez-Garcia,
C. Page,
R. Herrera, and G. Nunez.
1997.
Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt.
Science
278:687-689 |
| 20. | Downward, J. 1998. Mechanisms and consequences of activation of protein kinase B/Akt. Curr. Opin. Cell Biol. 10:262-267[CrossRef][Medline]. |
| 21. |
Dudek, H.,
S. R. Datta,
T. F. Franke,
M. Birnbaum,
R. Yao,
G. M. Cooper,
R. A. Segal,
D. R. Kaplan, and M. E. Greenberg.
1997.
Regulation of neuronal survival by the serine-threonine protein kinase Akt.
Science
275:661-665 |
| 22. | Dutil, E. M., A. Toker, and A. C. Newton. 1998. Regulation of conventional protein kinase C isozymes by phosphoinositide-dependent kinase 1 (PDK1). Curr. Biol. 8:1366-1375[CrossRef][Medline]. |
| 23. |
Guo, S.,
G. Rena,
S. Cichy,
X. He,
P. Cohen, and T. Unterman.
1999.
Phosphorylation of serine 256 by protein kinase B disrupts transactivation by FKHR and mediates effects of insulin on IGF binding protein-1 promoter activity through a conserved insulin response sequence.
J. Biol. Chem.
274:17184-17192 |
| 24. | Imaizumi, K., M. Tsuda, A. Wanaka, M. Tohyama, and T. Takagi. 1994. Differential expression of sgk mRNA, a member of the Ser/Thr protein kinase gene family, in rat brain after CNS injury. Brain Res. Mol. Brain Res. 26:189-196[Medline]. |
| 25. |
Jensen, C. J.,
M. B. Buch,
T. O. Krag,
B. A. Hemmings,
S. Gammeltoft, and M. Frodin.
1999.
90-kDa ribosomal S6 kinase is phosphorylated and activated by 3-phosphoinositide-dependent protein kinase-1.
J. Biol. Chem.
274:27168-27176 |
| 26. |
Kaestner, K. H.,
W. Knochel, and D. E. Martinez.
2000.
Unified nomenclature for the winged helix/forkhead transcription factors.
Genes Dev.
14:142-146 |
| 27. |
Kaffman, A.,
N. M. Rank, and E. K. O'Shea.
1998.
Phosphorylation regulates association of the transcription factor Pho4 with its import receptor Pse1/Kap121.
Genes Dev.
12:2673-2683 |
| 28. | Kobayashi, T., and P. Cohen. 1999. Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem. J. 339:319-328. |
| 29. |
Komeili, A., and E. K. O'Shea.
1999.
Roles of phosphorylation sites in regulating activity of the transcription factor Pho4.
Science
284:977-980 |
| 30. | Kops, G. J., and B. M. Burgering. 1999. Forkhead transcription factors: new insights into protein kinase B (c-akt) signaling. J. Mol. Med. 77:656-665[CrossRef][Medline]. |
| 31. | Kops, G. J., N. D. de Ruiter, A. M. De Vries-Smits, D. R. Powell, J. L. Bos, and B. M. Burgering. 1999. Direct control of the Forkhead transcription factor AFX by protein kinase B. Nature 398:630-634[CrossRef][Medline]. |
| 32. |
Le Good, J. A.,
W. H. Ziegler,
D. B. Parekh,
D. R. Alessi,
P. Cohen, and P. J. Parker.
1998.
Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1.
Science
281:2042-2045 |
| 33. | Lopez-Girona, A., B. Furnari, O. Mondesert, and P. Russell. 1999. Nuclear localization of Cdc25 is regulated by DNA damage and a 14-3-3 protein. Nature 397:172-175[CrossRef][Medline]. |
| 34. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 35. |
Maurer, R. A.
1989.
Both isoforms of the cAMP-dependent protein kinase catalytic subunit can activate transcription of the prolactin gene.
J. Biol. Chem.
264:6870-6873 |
| 36. | Medema, R. H., G. J. Kops, J. L. Bos, and B. M. Burgering. 2000. AFX-like Forkhead transcription factors mediate cell-cycle regulation by Ras and PKB through p27kip1. Nature 404:782-787[CrossRef][Medline]. |
| 37. | Nakae, J., V. Barr, and D. Accili. 2000. Differential regulation of gene expression by insulin and IGF-1 receptors correlates with phosphorylation of a single amino acid residue in the forkhead transcription factor FKHR. EMBO J. 19:989-996[CrossRef][Medline]. |
| 38. |
Nakae, J.,
B. C. Park, and D. Accili.
1999.
Insulin stimulates phosphorylation of the forkhead transcription factor FKHR on serine 253 through a wortmannin-sensitive pathway.
J. Biol. Chem.
274:15982-15985 |
| 39. | Ogg, S., S. Paradis, S. Gottlieb, G. I. Patterson, L. Lee, H. A. Tissenbaum, and G. Ruvkun. 1997. The Forkhead transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 389:994-999[CrossRef][Medline]. |
| 40. | O'Neill, E. M., A. Kaffman, E. R. Jolly, and E. K. O'Shea. 1996. Regulation of PHO4 nuclear localization by the PHO80-PHO85 cyclin-CDK complex. Science 271:209-212[Abstract]. |
| 41. | Park, J., M. L. Leong, P. Buse, A. C. Maiyar, G. L. Firestone, and B. A. Hemmings. 1999. Serum and glucocorticoid-inducible kinase (SGK) is a target of the PI 3-kinase-stimulated signaling pathway. EMBO J. 18:3024-3033[CrossRef][Medline]. |
| 42. |
Pullen, N.,
P. B. Dennis,
M. Andjelkovic,
A. Dufner,
S. C. Kozma,
B. A. Hemmings, and G. Thomas.
1998.
Phosphorylation and activation of p70s6k by PDK1.
Science
279:707-710 |
| 43. |
Rena, G.,
S. Guo,
S. Cichy,
T. G. Unterman, and P. Cohen.
1999.
Phosphorylation of the transcription factor forkhead family member FKHR by protein kinase B.
J. Biol. Chem.
274:17179-17183 |
| 44. | Richards, S. A., J. Fu, A. Romanelli, A. Shimamura, and J. Blenis. 1999. Ribosomal S6 kinase 1 (RSK1) activation requires signals dependent on and independent of the MAP kinase ERK. Curr. Biol. 9:810-820[CrossRef][Medline]. |
| 45. |
Takaishi, H.,
H. Konishi,
H. Matsuzaki,
Y. Ono,
Y. Shirai,
N. Saito,
T. Kitamura,
W. Ogawa,
M. Kasuga,
U. Kikkawa, and Y. Nishizuka.
1999.
Regulation of nuclear translocation of forkhead transcription factor AFX by protein kinase B.
Proc. Natl. Acad. Sci. USA
96:11836-11841 |
| 46. |
Tang, E. D.,
G. Nunez,
F. G. Barr, and K.-L. Guan.
1999.
Negative regulation of the Forkhead transcription factor FKHR by Akt.
J. Biol. Chem.
274:16741-16746 |
| 47. |
Uberall, F.,
K. Hellbert,
S. Kampfer,
K. Maly,
A. Villunger,
M. Spitaler,
J. Mwanjewe,
G. Baier-Bitterlich,
G. Baier, and H. H. Grunicke.
1999.
Evidence that atypical protein kinase C-lambda and atypical protein kinase C-zeta participate in Ras-mediated reorganization of the F-actin cytoskeleton.
J. Cell Biol.
144:413-425 |
| 48. | Vanhaesebroeck, B., and D. R. Alessi. 2000. The PI3K-PDK1 connection: more than just a road to PKB. Biochem. J. 346:561-576. |
| 49. |
Waldegger, S.,
P. Barth,
G. Raber, and F. Lang.
1997.
Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume.
Proc. Natl. Acad. Sci. USA
94:4440-4445 |
| 50. | Waldegger, S., K. Klingel, P. Barth, M. Sauter, M. L. Rfer, R. Kandolf, and F. Lang. 1999. h-sgk serine-threonine protein kinase gene as transcriptional target of transforming growth factor beta in human intestine. Gastroenterology 116:1081-1088[CrossRef][Medline]. |
| 51. |
Webster, K. M.,
L. Goya, and G. L. Firestone.
1993.
Immediate-early transcriptional regulation and rapid mRNA turnover of a putative serine/threonine protein kinase.
J. Biol. Chem.
268:11482-11485 |
| 52. |
Webster, K. M.,
L. Goya,
Y. Ge,
A. C. Maiyar, and G. L. Firestone.
1993.
Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum.
Mol. Cell. Biol.
13:2031-2040 |
| 53. | Xing, J., D. D. Ginty, and M. E. Greenberg. 1996. Coupling of the RAS-MAPK pathway to gene activation by RSK2, a growth factor-regulated CREB kinase. Science 273:959-963[Abstract]. |
Molecular and Cellular Biology, February 2001, p. 952-965, Vol. 21, No. 3
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.3.952-965.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Li, Y., Wang, W.-J., Cao, H., Lu, J., Wu, C., Hu, F.-Y., Guo, J., Zhao, L., Yang, F., Zhang, Y.-X., Li, W., Zheng, G.-Y., Cui, H., Chen, X., Zhu, Z., He, H., Dong, B., Mo, X., Zeng, Y., Tian, X.-L.
(2009). Genetic association of FOXO1A and FOXO3A with longevity trait in Han Chinese populations. Hum Mol Genet
18: 4897-4904
[Abstract] [Full Text] -
Proud, C. G.
(2009). Dynamic Balancing: DEPTOR Tips the Scales. J Mol Cell Biol
1: 61-63
[Abstract] [Full Text] -
Matheny, R. W. Jr., Adamo, M. L.
(2009). Current Perspectives on Akt Akt-ivation and Akt-ions. Exp. Biol. Med.
234: 1264-1270
[Abstract] [Full Text] -
Jag, U. R., Zavadil, J., Stanley, F. M.
(2009). Insulin Acts through FOXO3a to Activate Transcription of Plasminogen Activator Inhibitor Type 1. Mol. Endocrinol.
23: 1587-1602
[Abstract] [Full Text] -
Storz, P., Doppler, H., Copland, J. A., Simpson, K. J., Toker, A.
(2009). FOXO3a Promotes Tumor Cell Invasion through the Induction of Matrix Metalloproteinases. Mol. Cell. Biol.
29: 4906-4917
[Abstract] [Full Text] -
Mauro, T. M., McCormick, J. A., Wang, J., Boini, K. M., Ray, L., Monks, B., Birnbaum, M. J., Lang, F., Pearce, D.
(2009). Akt2 and SGK3 are both determinants of postnatal hair follicle development. FASEB J.
23: 3193-3202
[Abstract] [Full Text] -
Tan, C. S. H., Bodenmiller, B., Pasculescu, A., Jovanovic, M., Hengartner, M. O., Jorgensen, C., Bader, G. D., Aebersold, R., Pawson, T., Linding, R.
(2009). Comparative Analysis Reveals Conserved Protein Phosphorylation Networks Implicated in Multiple Diseases. Sci Signal
2: ra39-ra39
[Abstract] [Full Text] -
Lau, C. J., Koty, Z., Nalbantoglu, J.
(2009). Differential Response of Glioma Cells to FOXO1-Directed Therapy. Cancer Res.
69: 5433-5440
[Abstract] [Full Text] -
Mojsilovic-Petrovic, J., Nedelsky, N., Boccitto, M., Mano, I., Georgiades, S. N., Zhou, W., Liu, Y., Neve, R. L., Taylor, J. P., Driscoll, M., Clardy, J., Merry, D., Kalb, R. G.
(2009). FOXO3a Is Broadly Neuroprotective In Vitro and In Vivo against Insults Implicated in Motor Neuron Diseases. J. Neurosci.
29: 8236-8247
[Abstract] [Full Text] -
Husain, M., Meggs, L. G., Vashistha, H., Simoes, S., Griffiths, K. O., Kumar, D., Mikulak, J., Mathieson, P. W., Saleem, M. A., Del Valle, L., Pina-Oviedo, S., Wang, J. Y., Seshan, S. V., Malhotra, A., Reiss, K., Singhal, P. C.
(2009). Inhibition of p66ShcA Longevity Gene Rescues Podocytes from HIV-1-induced Oxidative Stress and Apoptosis. J. Biol. Chem.
284: 16648-16658
[Abstract] [Full Text] -
Ito, K., Akazawa, H., Tamagawa, M., Furukawa, K., Ogawa, W., Yasuda, N., Kudo, Y., Liao, C.-h., Yamamoto, R., Sato, T., Molkentin, J. D., Kasuga, M., Noda, T., Nakaya, H., Komuro, I.
(2009). PDK1 coordinates survival pathways and {beta}-adrenergic response in the heart. Proc. Natl. Acad. Sci. USA
106: 8689-8694
[Abstract] [Full Text] -
Xu, J., Liao, L., Qin, J., Xu, J., Liu, D., Songyang, Z.
(2009). Identification of Flightless-I as a Substrate of the Cytokine-independent Survival Kinase CISK. J. Biol. Chem.
284: 14377-14385
[Abstract] [Full Text] -
Fu, W., Ma, Q., Chen, L., Li, P., Zhang, M., Ramamoorthy, S., Nawaz, Z., Shimojima, T., Wang, H., Yang, Y., Shen, Z., Zhang, Y., Zhang, X., Nicosia, S. V., Zhang, Y., Pledger, J. W., Chen, J., Bai, W.
(2009). MDM2 Acts Downstream of p53 as an E3 Ligase to Promote FOXO Ubiquitination and Degradation. J. Biol. Chem.
284: 13987-14000
[Abstract] [Full Text] -
Melhem, A., Yamada, S. D., Fleming, G. F., Delgado, B., Brickley, D. R., Wu, W., Kocherginsky, M., Conzen, S. D.
(2009). Administration of Glucocorticoids to Ovarian Cancer Patients Is Associated with Expression of the Anti-apoptotic Genes SGK1 and MKP1/DUSP1 in Ovarian Tissues. Clin. Cancer Res.
15: 3196-3204
[Abstract] [Full Text] -
Shin, D.-J., Osborne, T. F.
(2009). FGF15/FGFR4 Integrates Growth Factor Signaling with Hepatic Bile Acid Metabolism and Insulin Action. J. Biol. Chem.
284: 11110-11120
[Abstract] [Full Text] -
Soukas, A. A., Kane, E. A., Carr, C. E., Melo, J. A., Ruvkun, G.
(2009). Rictor/TORC2 regulates fat metabolism, feeding, growth, and life span in Caenorhabditis elegans. Genes Dev.
23: 496-511
[Abstract] [Full Text] -
Tai, D. J. C., Su, C.-C., Ma, Y.-L., Lee, E. H. Y.
(2009). SGK1 Phosphorylation of I{kappa}B Kinase {alpha} and p300 Up-regulates NF-{kappa}B Activity and Increases N-Methyl-D-aspartate Receptor NR2A and NR2B Expression. J. Biol. Chem.
284: 4073-4089
[Abstract] [Full Text] -
Kim, J., Wende, A. R., Sena, S., Theobald, H. A., Soto, J., Sloan, C., Wayment, B. E., Litwin, S. E., Holzenberger, M., LeRoith, D., Abel, E. D.
(2008). Insulin-Like Growth Factor I Receptor Signaling Is Required for Exercise-Induced Cardiac Hypertrophy. Mol. Endocrinol.
22: 2531-2543
[Abstract] [Full Text] -
Wang, J., Knight, Z. A., Fiedler, D., Williams, O., Shokat, K. M., Pearce, D.
(2008). Activity of the p110-{alpha} subunit of phosphatidylinositol-3-kinase is required for activation of epithelial sodium transport. Am. J. Physiol. Renal Physiol.
295: F843-F850
[Abstract] [Full Text] -
Dehner, M., Hadjihannas, M., Weiske, J., Huber, O., Behrens, J.
(2008). Wnt Signaling Inhibits Forkhead Box O3a-induced Transcription and Apoptosis through Up-regulation of Serum- and Glucocorticoid-inducible Kinase 1. J. Biol. Chem.
283: 19201-19210
[Abstract] [Full Text] -
Morishita, D., Katayama, R., Sekimizu, K., Tsuruo, T., Fujita, N.
(2008). Pim Kinases Promote Cell Cycle Progression by Phosphorylating and Down-regulating p27Kip1 at the Transcriptional and Posttranscriptional Levels. Cancer Res.
68: 5076-5085
[Abstract] [Full Text] -
Chahdi, A., Sorokin, A.
(2008). Endothelin-1 Couples {beta}Pix to p66Shc: Role of {beta}Pix in Cell Proliferation through FOXO3a Phosphorylation and p27kip1 Down-Regulation Independently of Akt. Mol. Biol. Cell
19: 2609-2619
[Abstract] [Full Text] -
Pew, T., Zou, M., Brickley, D. R., Conzen, S. D.
(2008). Glucocorticoid (GC)-Mediated Down-Regulation of Urokinase Plasminogen Activator Expression via the Serum and GC Regulated Kinase-1/Forkhead Box O3a Pathway. Endocrinology
149: 2637-2645
[Abstract] [Full Text] -
Yan, L., Lavin, V. A., Moser, L. R., Cui, Q., Kanies, C., Yang, E.
(2008). PP2A Regulates the Pro-apoptotic Activity of FOXO1. J. Biol. Chem.
283: 7411-7420
[Abstract] [Full Text] -
Arteaga, M. F., Coric, T., Straub, C., Canessa, C. M.
(2008). A brain-specific SGK1 splice isoform regulates expression of ASIC1 in neurons. Proc. Natl. Acad. Sci. USA
105: 4459-4464
[Abstract] [Full Text] -
Yang, K.-J., Shin, S., Piao, L., Shin, E., Li, Y., Park, K. A., Byun, H. S., Won, M., Hong, J., Kweon, G. R., Hur, G. M., Seok, J. H., Chun, T., Brazil, D. P., Hemmings, B. A., Park, J.
(2008). Regulation of 3-Phosphoinositide-dependent Protein Kinase-1 (PDK1) by Src Involves Tyrosine Phosphorylation of PDK1 and Src Homology 2 Domain Binding. J. Biol. Chem.
283: 1480-1491
[Abstract] [Full Text] -
Papanicolaou, K. N., Izumiya, Y., Walsh, K.
(2008). Forkhead Transcription Factors and Cardiovascular Biology. Circ. Res.
102: 16-31
[Abstract] [Full Text] -
Lara-Pezzi, E., Winn, N., Paul, A., McCullagh, K., Slominsky, E., Santini, M. P., Mourkioti, F., Sarathchandra, P., Fukushima, S., Suzuki, K., Rosenthal, N.
(2007). A naturally occurring calcineurin variant inhibits FoxO activity and enhances skeletal muscle regeneration. JCB
179: 1205-1218
[Abstract] [Full Text] -
Krol, J., Francis, R. E., Albergaria, A., Sunters, A., Polychronis, A., Coombes, R. C., Lam, E. W.-F.
(2007). The transcription factor FOXO3a is a crucial cellular target of gefitinib (Iressa) in breast cancer cells. Molecular Cancer Therapeutics
6: 3169-3179
[Abstract] [Full Text] -
Greer, E. L., Oskoui, P. R., Banko, M. R., Maniar, J. M., Gygi, M. P., Gygi, S. P., Brunet, A.
(2007). The Energy Sensor AMP-activated Protein Kinase Directly Regulates the Mammalian FOXO3 Transcription Factor. J. Biol. Chem.
282: 30107-30119
[Abstract] [Full Text] -
Failor, K. L., Desyatnikov, Y., Finger, L. A., Firestone, G. L.
(2007). Glucocorticoid-Induced Degradation of Glycogen Synthase Kinase-3 Protein Is Triggered by Serum- and Glucocorticoid-Induced Protein Kinase and Akt Signaling and Controls {beta}-Catenin Dynamics and Tight Junction Formation in Mammary Epithelial Tumor Cells. Mol. Endocrinol.
21: 2403-2415
[Abstract] [Full Text] -
Takano, M., Lu, Z., Goto, T., Fusi, L., Higham, J., Francis, J., Withey, A., Hardt, J., Cloke, B., Stavropoulou, A. V., Ishihara, O., Lam, E. W.-F., Unterman, T. G., Brosens, J. J., Kim, J. J.
(2007). Transcriptional Cross Talk between the Forkhead Transcription Factor Forkhead Box O1A and the Progesterone Receptor Coordinates Cell Cycle Regulation and Differentiation in Human Endometrial Stromal Cells. Mol. Endocrinol.
21: 2334-2349
[Abstract] [Full Text] -
Feroze-Zaidi, F., Fusi, L., Takano, M., Higham, J., Salker, M. S., Goto, T., Edassery, S., Klingel, K., Boini, K. M., Palmada, M., Kamps, R., Groothuis, P. G., Lam, E. W.-F., Smith, S. K., Lang, F., Sharkey, A. M., Brosens, J. J.
(2007). Role and Regulation of the Serum- and Glucocorticoid-Regulated Kinase 1 in Fertile and Infertile Human Endometrium. Endocrinology
148: 5020-5029
[Abstract] [Full Text] -
Barreyro, F. J., Kobayashi, S., Bronk, S. F., Werneburg, N. W., Malhi, H., Gores, G. J.
(2007). Transcriptional Regulation of Bim by FoxO3A Mediates Hepatocyte Lipoapoptosis. J. Biol. Chem.
282: 27141-27154
[Abstract] [Full Text] -
Huang, H., Tindall, D. J.
(2007). Dynamic FoxO transcription factors. J. Cell Sci.
120: 2479-2487
[Abstract] [Full Text] -
Rudd, M. D, Gonzalez-Robayna, I., Hernandez-Gonzalez, I., Weigel, N. L, Bingman, W. E III, Richards, J. S
(2007). Constitutively active FOXO1a and a DNA-binding domain mutant exhibit distinct co-regulatory functions to enhance progesterone receptor A activity. J Mol Endocrinol
38: 673-690
[Abstract] [Full Text] -
Pao, A. C., McCormick, J. A., Li, H., Siu, J., Govaerts, C., Bhalla, V., Soundararajan, R., Pearce, D.
(2007). NH2 terminus of serum and glucocorticoid-regulated kinase 1 binds to phosphoinositides and is essential for isoform-specific physiological functions. Am. J. Physiol. Renal Physiol.
292: F1741-F1750
[Abstract] [Full Text] -
Glauser, D. A, Schlegel, W.
(2007). The emerging role of FOXO transcription factors in pancreatic {beta} cells. J Endocrinol
193: 195-207
[Abstract] [Full Text] -
Cordas, E., Naray-Fejes-Toth, A., Fejes-Toth, G.
(2007). Subcellular location of serum- and glucocorticoid-induced kinase-1 in renal and mammary epithelial cells. Am. J. Physiol. Cell Physiol.
292: C1971-C1981
[Abstract] [Full Text] -
Littlewood, T. D., Bennett, M. R.
(2007). Foxing Smooth Muscle Cells: FOXO3a-CYR61 Connection. Circ. Res.
100: 302-304
[Full Text] -
Chen, Y.-J., Hsiao, P.-W., Lee, M.-T., Mason, J I., Ke, F.-C., Hwang, J.-J.
(2007). Interplay of PI3K and cAMP/PKA signaling, and rapamycin-hypersensitivity in TGF{beta}1 enhancement of FSH-stimulated steroidogenesis in rat ovarian granulosa cells. J Endocrinol
192: 405-419
[Abstract] [Full Text] -
Uddin, S., Hussain, A. R., Siraj, A. K., Manogaran, P. S., Al-Jomah, N. A., Moorji, A., Atizado, V., Al-Dayel, F., Belgaumi, A., El-Solh, H., Ezzat, A., Bavi, P., Al-Kuraya, K. S.
(2006). Role of phosphatidylinositol 3'-kinase/AKT pathway in diffuse large B-cell lymphoma survival. Blood
108: 4178-4186
[Abstract] [Full Text] -
Lang, F., Bohmer, C., Palmada, M., Seebohm, G., Strutz-Seebohm, N., Vallon, V.
(2006). (Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms.. Physiol. Rev.
86: 1151-1178
[Abstract] [Full Text] -
Wu, W., Zou, M., Brickley, D. R., Pew, T., Conzen, S. D.
(2006). Glucocorticoid Receptor Activation Signals through Forkhead Transcription Factor 3a in Breast Cancer Cells. Mol. Endocrinol.
20: 2304-2314
[Abstract] [Full Text] -
Bhalla, V., Soundararajan, R., Pao, A. C., Li, H., Pearce, D.
(2006). Disinhibitory pathways for control of sodium transport: regulation of ENaC by SGK1 and GILZ. Am. J. Physiol. Renal Physiol.
291: F714-F721
[Abstract] [Full Text] -
Gomis, R. R., Alarcon, C., He, W., Wang, Q., Seoane, J., Lash, A., Massague, J.
(2006). A FoxO-Smad synexpression group in human keratinocytes. Proc. Natl. Acad. Sci. USA
103: 12747-12752
[Abstract] [Full Text] -
Kristof, A. S., Fielhaber, J., Triantafillopoulos, A., Nemoto, S., Moss, J.
(2006). Phosphatidylinositol 3-Kinase-dependent Suppression of the Human Inducible Nitric-oxide Synthase Promoter Is Mediated by FKHRL1. J. Biol. Chem.
281: 23958-23968
[Abstract] [Full Text] -
Baumeister, R., Schaffitzel, E., Hertweck, M.
(2006). Endocrine signaling in Caenorhabditis elegans controls stress response and longevity.. J Endocrinol
190: 191-202
[Abstract] [Full Text] -
You, H., Pellegrini, M., Tsuchihara, K., Yamamoto, K., Hacker, G., Erlacher, M., Villunger, A., Mak, T. W.
(2006). FOXO3a-dependent regulation of Puma in response to cytokine/growth factor withdrawal. JEM
203: 1657-1663
[Abstract] [Full Text] -
Zhang, W., Patil, S., Chauhan, B., Guo, S., Powell, D. R., Le, J., Klotsas, A., Matika, R., Xiao, X., Franks, R., Heidenreich, K. A., Sajan, M. P., Farese, R. V., Stolz, D. B., Tso, P., Koo, S.-H., Montminy, M., Unterman, T. G.
(2006). FoxO1 Regulates Multiple Metabolic Pathways in the Liver: EFFECTS ON GLUCONEOGENIC, GLYCOLYTIC, AND LIPOGENIC GENE EXPRESSION. J. Biol. Chem.
281: 10105-10117
[Abstract] [Full Text] -
Sariyer, I. K., Akan, I., Palermo, V., Gordon, J., Khalili, K., Safak, M.
(2006). Phosphorylation Mutants of JC Virus Agnoprotein Are Unable To Sustain the Viral Infection Cycle.. J. Virol.
80: 3893-3903
[Abstract] [Full Text] -
Hazlehurst, L. A., Argilagos, R. F., Emmons, M., Boulware, D., Beam, C. A., Sullivan, D. M., Dalton, W. S.
(2006). Cell Adhesion to Fibronectin (CAM-DR) Influences Acquired Mitoxantrone Resistance in U937 Cells. Cancer Res.
66: 2338-2345
[Abstract] [Full Text] -
Xia, W., Bisi, J., Strum, J., Liu, L., Carrick, K., Graham, K. M., Treece, A. L., Hardwicke, M. A., Dush, M., Liao, Q., Westlund, R. E., Zhao, S., Bacus, S., Spector, N. L.
(2006). Regulation of Survivin by ErbB2 Signaling: Therapeutic Implications for ErbB2-Overexpressing Breast Cancers. Cancer Res.
66: 1640-1647
[Abstract] [Full Text] -
Palmada, M., Boehmer, C., Akel, A., Rajamanickam, J., Jeyaraj, S., Keller, K., Lang, F.
(2006). SGK1 Kinase Upregulates GLUT1 Activity and Plasma Membrane Expression. Diabetes
55: 421-427
[Abstract] [Full Text] -
Levine, A. J., Feng, Z., Mak, T. W., You, H., Jin, S.
(2006). Coordination and communication between the p53 and IGF-1-AKT-TOR signal transduction pathways. Genes Dev.
20: 267-275
[Abstract] [Full Text] -
Alvarez de la Rosa, D., Gimenez, I., Forbush, B., Canessa, C. M.
(2006). SGK1 activates Na+-K+-ATPase in amphibian renal epithelial cells. Am. J. Physiol. Cell Physiol.
290: C492-C498
[Abstract] [Full Text] -
Zhao, W., Kitidis, C., Fleming, M. D., Lodish, H. F., Ghaffari, S.
(2006). Erythropoietin stimulates phosphorylation and activation of GATA-1 via the PI3-kinase/AKT signaling pathway. Blood
107: 907-915
[Abstract] [Full Text] -
Yamamoto, M., Clark, J. D., Pastor, J. V., Gurnani, P., Nandi, A., Kurosu, H., Miyoshi, M., Ogawa, Y., Castrillon, D. H., Rosenblatt, K. P., Kuro-o, M.
(2005). Regulation of Oxidative Stress by the Anti-aging Hormone Klotho. J. Biol. Chem.
280: 38029-38034
[Abstract] [Full Text] -
Gaudet, S., Janes, K. A., Albeck, J. G., Pace, E. A., Lauffenburger, D. A., Sorger, P. K.
(2005). A Compendium of Signals and Responses Triggered by Prodeath and Prosurvival Cytokines. Mol. Cell. Proteomics
4: 1569-1590
[Abstract] [Full Text] -
Wang, D., Sun, H., Lang, F., Yun, C. C.
(2005). Activation of NHE3 by dexamethasone requires phosphorylation of NHE3 at Ser663 by SGK1. Am. J. Physiol. Cell Physiol.
289: C802-C810
[Abstract] [Full Text] -
Meng, F., Yamagiwa, Y., Taffetani, S., Han, J., Patel, T.
(2005). IL-6 activates serum and glucocorticoid kinase via p38{alpha} mitogen-activated protein kinase pathway. Am. J. Physiol. Cell Physiol.
289: C971-C981
[Abstract] [Full Text] -
Perrot, V., Rechler, M. M.
(2005). The Coactivator p300 Directly Acetylates the Forkhead Transcription Factor Foxo1 and Stimulates Foxo1-Induced Transcription. Mol. Endocrinol.
19: 2283-2298
[Abstract] [Full Text] -
Abid, Md. R., Yano, K., Guo, S., Patel, V. I., Shrikhande, G., Spokes, K. C., Ferran, C., Aird, W. C.
(2005). Forkhead Transcription Factors Inhibit Vascular Smooth Muscle Cell Proliferation and Neointimal Hyperplasia. J. Biol. Chem.
280: 29864-29873
[Abstract] [Full Text] -
David, S., Stegenga, S. L., Hu, P., Xiong, G., Kerr, E., Becker, K. B., Venkatapathy, S., Warrington, J. A., Kalb, R. G.
(2005). Expression of Serum- and Glucocorticoid-Inducible Kinase Is Regulated in an Experience-Dependent Manner and Can Cause Dendrite Growth. J. Neurosci.
25: 7048-7053
[Abstract] [Full Text] -
Arteaga, M. F., Canessa, C. M.
(2005). Functional specificity of Sgk1 and Akt1 on ENaC activity. Am. J. Physiol. Renal Physiol.
289: F90-F96
[Abstract] [Full Text] -
Cobb, J., Duboule, D.
(2005). Comparative analysis of genes downstream of the Hoxd cluster in developing digits and external genitalia. Development
132: 3055-3067
[Abstract] [Full Text] -
Uddin, S., Hussain, A. R., Al-Hussein, K. A., Manogaran, P. S., Wickrema, A., Gutierrez, M. I., Bhatia, K. G.
(2005). Inhibition of Phosphatidylinositol 3'-Kinase/AKT Signaling Promotes Apoptosis of Primary Effusion Lymphoma Cells. Clin. Cancer Res.
11: 3102-3108
[Abstract] [Full Text] -
Aoyama, T., Matsui, T., Novikov, M., Park, J., Hemmings, B., Rosenzweig, A.
(2005). Serum and Glucocorticoid-Responsive Kinase-1 Regulates Cardiomyocyte Survival and Hypertrophic Response. Circulation
111: 1652-1659
[Abstract] [Full Text] -
Scheid, M. P., Parsons, M., Woodgett, J. R.
(2005). Phosphoinositide-Dependent Phosphorylation of PDK1 Regulates Nuclear Translocation. Mol. Cell. Biol.
25: 2347-2363
[Abstract] [Full Text] -
Chae, K.-S., Martin-Caraballo, M., Anderson, M., Dryer, S. E.
(2005). Akt Activation Is Necessary for Growth Factor-Induced Trafficking of Functional KCa Channels in Developing Parasympathetic Neurons. J. Neurophysiol.
93: 1174-1182
[Abstract] [Full Text] -
Boyd, C., Naray-Fejes-Toth, A.
(2005). Gene regulation of ENaC subunits by serum- and glucocorticoid-inducible kinase-1. Am. J. Physiol. Renal Physiol.
288: F505-F512
[Abstract] [Full Text] -
Zhang, L., Cui, R., Cheng, X., Du, J.
(2005). Antiapoptotic Effect of Serum and Glucocorticoid-Inducible Protein Kinase Is Mediated by Novel Mechanism Activating I{kappa}B Kinase. Cancer Res.
65: 457-464
[Abstract] [Full Text] -
Liu, J. O.
(2005). The Yins of T Cell Activation. Sci Signal
2005: re1-re1
[Abstract] [Full Text] -
You, H., Jang, Y., You-Ten, A. I., Okada, H., Liepa, J., Wakeham, A., Zaugg, K., Mak, T. W.
(2004). p53-dependent inhibition of FKHRL1 in response to DNA damage through protein kinase SGK1. Proc. Natl. Acad. Sci. USA
101: 14057-14062
[Abstract] [Full Text] -
Nechamen, C. A., Thomas, R. M., Cohen, B. D., Acevedo, G., Poulikakos, P. I., Testa, J. R., Dias, J. A.
(2004). Human Follicle-Stimulating Hormone (FSH) Receptor Interacts with the Adaptor Protein APPL1 in HEK 293 Cells: Potential Involvement of the PI3K Pathway in FSH Signaling. Biol. Reprod.
71: 629-636
[Abstract] [Full Text] -
Wang, G.-X., McCrudden, C., Dai, Y.-P., Horowitz, B., Hume, J. R., Yamboliev, I. A.
(2004). Hypotonic activation of volume-sensitive outwardly rectifying chloride channels in cultured PASMCs is modulated by SGK. Am. J. Physiol. Heart Circ. Physiol.
287: H533-H544
[Abstract] [Full Text] -
Cunningham, M. A., Zhu, Q., Hammond, J. M.
(2004). FoxO1a Can Alter Cell Cycle Progression by Regulating the Nuclear Localization of p27kip in Granulosa Cells. Mol. Endocrinol.
18: 1756-1767
[Abstract] [Full Text] -
Gu, T.-L., Tothova, Z., Scheijen, B., Griffin, J. D., Gilliland, D. G., Sternberg, D. W.
(2004). NPM-ALK fusion kinase of anaplastic large-cell lymphoma regulates survival and proliferative signaling through modulation of FOXO3a. Blood
103: 4622-4629
[Abstract] [Full Text] -
Lee, S. W., Dai, G., Hu, Z., Wang, X., Du, J., Mitch, W. E.
(2004). Regulation of Muscle Protein Degradation: Coordinated Control of Apoptotic and Ubiquitin-Proteasome Systems by Phosphatidylinositol 3 Kinase. J. Am. Soc. Nephrol.
15: 1537-1545
[Abstract] [Full Text] -
Ray, N., Enquist, L. W.
(2004). Transcriptional Response of a Common Permissive Cell Type to Infection by Two Diverse Alphaherpesviruses. J. Virol.
78: 3489-3501
[Abstract] [Full Text] -
Wu, W., Chaudhuri, S., Brickley, D. R., Pang, D., Karrison, T., Conzen, S. D.
(2004). Microarray Analysis Reveals Glucocorticoid-Regulated Survival Genes That Are Associated With Inhibition of Apoptosis in Breast Epithelial Cells. Cancer Res.
64: 1757-1764
[Abstract] [Full Text] -
Tomlinson, C. C., Damania, B.
(2004). The K1 Protein of Kaposi's Sarcoma-Associated Herpesvirus Activates the Akt Signaling Pathway. J. Virol.
78: 1918-1927
[Abstract] [Full Text] -
Ghannam, G., Takeda, A., Camarata, T., Moore, M. A., Viale, A., Yaseen, N. R.
(2004). The Oncogene Nup98-HOXA9 Induces Gene Transcription in Myeloid Cells. J. Biol. Chem.
279: 866-875
[Abstract] [Full Text] -
Cunningham, M. A., Zhu, Q., Unterman, T. G., Hammond, J. M.
(2003). Follicle-Stimulating Hormone Promotes Nuclear Exclusion of the Forkhead Transcription Factor FoxO1a via Phosphatidylinositol 3-Kinase in Porcine Granulosa Cells. Endocrinology
144: 5585-5594
[Abstract] [Full Text] -
Crossley, L. J.
(2003). Neutrophil activation by fMLP regulates FOXO (forkhead) transcription factors by multiple pathways, one of which includes the binding of FOXO to the survival factor Mcl-1. J. Leukoc. Biol.
74: 583-592
[Abstract] [Full Text] -
Czech, M. P.
(2003). Insulin's expanding control of forkheads. Proc. Natl. Acad. Sci. USA
100: 11198-11200
[Full Text] -
Hribal, M. L., Nakae, J., Kitamura, T., Shutter, J. R., Accili, D.
(2003). Regulation of insulin-like growth factor-dependent myoblast differentiation by Foxo forkhead transcription factors. JCB
162: 535-541
[Abstract] [Full Text] -
Birkenkamp, K. U., Coffer, P. J.
(2003). FOXO Transcription Factors as Regulators of Immune Homeostasis: Molecules to Die for?. J. Immunol.
171: 1623-1629
[Full Text] -
De Bosscher, K., Vanden Berghe, W., Haegeman, G.
(2003). The Interplay between the Glucocorticoid Receptor and Nuclear Factor-{kappa}B or Activator Protein-1: Molecular Mechanisms for Gene Repression. Endocr. Rev.
24: 488-522
[Abstract] [Full Text] -
Chen, T., Yang, I., Irby, R., Shain, K. H., Wang, H. G., Quackenbush, J., Coppola, D., Cheng, J. Q., Yeatman, T. J.
(2003). Regulation of Caspase Expression and Apoptosis by Adenomatous Polyposis Coli. Cancer Res.
63: 4368-4374
[Abstract] [Full Text] -
Perrot, V., Rechler, M. M.
(2003). Characterization of Insulin Inhibition of Transactivation by a C-terminal Fragment of the Forkhead Transcription Factor Foxo1 in Rat Hepatoma Cells. J. Biol. Chem.
278: 26111-26119
[Abstract] [Full Text] -
Salnikow, K., Davidson, T., Zhang, Q., Chen, L. C., Su, W., Costa, M.
(2003). The Involvement of Hypoxia-inducible Transcription Factor-1-dependent Pathway in Nickel Carcinogenesis. Cancer Res.
63: 3524-3530
[Abstract] [Full Text] -
Wang, Z., Malone, M. H., He, H., McColl, K. S., Distelhorst, C. W.
(2003). Microarray Analysis Uncovers the Induction of the Proapoptotic BH3-only Protein Bim in Multiple Models of Glucocorticoid-induced Apoptosis. J. Biol. Chem.
278: 23861-23867
[Abstract] [Full Text] -
Poser, S., Impey, S., Xia, Z., Storm, D. R.
(2003). Brain-Derived Neurotrophic Factor Protection of Cortical Neurons from Serum Withdrawal-Induced Apoptosis Is Inhibited by cAMP. J. Neurosci.
23: 4420-4427
[Abstract] [Full Text] -
Burgering, B. M. T., Medema, R. H.
(2003). Decisions on life and death: FOXO Forkhead transcription factors are in command when PKB/Akt is off duty. J. Leukoc. Biol.
73: 689-701
[Abstract] [Full Text] -
Ghaffari, S., Jagani, Z., Kitidis, C., Lodish, H. F., Khosravi-Far, R.
(2003). Cytokines and BCR-ABL mediate suppression of TRAIL-induced apoptosis through inhibition of forkhead FOXO3a transcription factor. Proc. Natl. Acad. Sci. USA
100: 6523-6528
[Abstract] [Full Text] -
Hirota, K., Daitoku, H., Matsuzaki, H., Araya, N., Yamagata, K., Asada, S., Sugaya, T., Fukamizu, A.
(2003). Hepatocyte Nuclear Factor-4 Is a Novel Downstream Target of Insulin via FKHR as a Signal-regulated Transcriptional Inhibitor. J. Biol. Chem.
278: 13056-13060
[Abstract] [Full Text] -
Maiyar, A. C., Leong, M. L.L., Firestone, G. L.
(2003). Importin-alpha Mediates the Regulated Nuclear Targeting of Serum- and Glucocorticoid-inducible Protein Kinase (Sgk) by Recognition of a Nuclear Localization Signal in the Kinase Central Domain. Mol. Biol. Cell
14: 1221-1239
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»