Previous Article | Next Article 
Molecular and Cellular Biology, February 2001, p. 1036-1044, Vol. 21, No. 4
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.4.1036-1044.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Serum Response Factor-GATA Ternary Complex Required
for Nuclear Signaling by a G-Protein-Coupled Receptor
Steves
Morin,1,2
Pierre
Paradis,1
Anne
Aries,1 and
Mona
Nemer1,2,3,*
Laboratoire de Développment et
Différenciation Cardiaques, Institut de Recherches Cliniques de
Montréal,1 and Programme de
Biologie Moléculaire2 and
Départment de Pharmacologie,3
Université de Montréal, Montreal, Quebec, Canada
Received 11 August 2000/Returned for modification 18 September
2000/Accepted 9 November 2000
 |
ABSTRACT |
Endothelins are a family of biologically active peptides that are
critical for development and function of neural crest-derived and
cardiovascular cells. These effects are mediated by two
G-protein-coupled receptors and involve transcriptional regulation of
growth-responsive and/or tissue-specific genes. We have used the
cardiac ANF promoter, which represents the best-studied tissue-specific
endothelin target, to elucidate the nuclear pathways responsible for
the transcriptional effects of endothelins. We found that
cardiac-specific response to endothelin 1 (ET-1) requires the
combined action of the serum response factor (SRF) and the
tissue-restricted GATA proteins which bind over their adjacent
sites, within a 30-bp ET-1 response element. We show that SRF and GATA
proteins form a novel ternary complex reminiscent of the
well-characterized SRF-ternary complex factor interaction required for
transcriptional induction of c-fos in response to growth
factors. In transient cotransfections, GATA factors and SRF
synergistically activate atrial natriuretic factor and other
ET-1-inducible promoters that contain both GATA and SRF binding
sites. Thus, GATA factors may represent a new class of tissue-specific
SRF accessory factors that account for muscle- and other cell-specific
SRF actions.
 |
INTRODUCTION |
Endothelins are a family of closely
related peptide hormones (ET-1, -2, and -3) with essential functions
for mammalian organogenesis and postnatal homeostasis (5, 39,
60). The founding member of the family, ET-1, was first
identified as a potent endothelium-released vasoconstrictor
(61). However, it is now well established that endothelins
are synthesized in several tissues, where they act locally to promote
cell growth and/or differentiation via two G-protein-coupled
transmembrane domain receptors, ETA and ETB (1, 51). For example, ET-3-ETB interaction
appears to be essential for development of melanocytes and myenteric
ganglion neurons, since targeted or natural mutations of the
ETB or ET-3 gene produce pigment abnormalities and
aganglionic megacolon in mice and rats (6, 20, 29) and are
associated with Hirschprung disease in humans (19, 47). On
the other hand, ET-1-ETA interaction is evidently required
for development of the heart and of specific neural crest-derived
structures, and disruption of the ET-1 or ETA gene results
in craniofacial and cardiovascular abnormalities that are incompatible
with postnatal life (14, 33). Analysis of a number of
markers suggests that, at least in the case of craniofacial
development, ET-1-ETA signaling is required for normal cell proliferation and proper differentiation (15).
In addition to its essential role in embryonic development, ET-1 plays
important functions in postnatal cardiovascular homeostasis, including
regulation of cardiac and smooth muscle growth and contractility. In
fact, the ET-1 pathway is dysregulated in several cardiovascular diseases, such as hypertension and heart failure, and ETA
receptor antagonists prevent development of cardiac hypertrophy and
increase survival in animal models of congestive heart failure
(49, 50), confirming the potential relevance of targeting
the ET-1/ETA pathway in human diseases (64).
The profound cellular effects elicited by ET-1 activation of
ETA involve transcriptional modulation of growth-responsive
and tissue-specific genes. For example, in cardiac and smooth muscle cells, where ET-1 has growth-promoting effects, several immediate-early genes like egr-1, c-jun, and c-fos are
transiently induced in response to ET-1 treatment (24, 45,
52). Moreover, in cardiomyocytes, ET-1 modulates transcription
of various cardiac-specific genes, including atrial natriuretic factor
(ANF), the major heart secretory product (54, 55). The
intracellular signaling cascades that are activated by
ET1-ETA interaction have been extensively analyzed (7, 13, 25, 30, 43) and suggest that ETA
stimulation can activate multiple signaling cascades via coupling to
different G-proteins; for example, ETA coupling to Gq
activates Ras-dependent pathways leading to stimulation of
mitogen-activated protein kinases (MAPKs), whereas ETA
coupling to Gi inhibits adenylate cyclase. Which of these cascades
links ETA activation to the profound cellular and genetic
changes induced by ET-1 remains undefined.
In order to elucidate the nuclear pathways that mediate cell-specific
transcriptional responses to ET-1, we have used the cardiac ANF
promoter, which at present is the best-studied tissue-specific ET-1
target. We present evidence showing that ET-1 responsiveness of the
promoter requires the combined action of serum response factor (SRF)
and tissue-specific GATA protein, which form a ternary complex over a
30-bp cis element harboring juxtaposed SRF and GATA binding
sites. Formation of this complex requires both GATA and SRF binding
sites and is mediated by physical interaction between the C-terminal
zinc finger of GATA-4 and the DNA-binding domain of SRF. In
transient-transfection assays, GATA factors and SRF synergistically
activate several ET-1-inducible cardiac promoters. Thus, GATA proteins
may represent a new class of tissue-specific SRF accessory
factors that cooperate with SRF to mediate cell-specific nuclear
signaling by extracellular stimuli.
 |
MATERIALS AND METHODS |
Cell cultures and transfections.
Neonatal cardiomyocytes
were prepared from 4-day-old Sprague-Dawley rats and plated at a
density of 125,000 cells/9.5-cm2 culture dish in six-well
plates as previously described (11). For the ET-1 response
element mapping assay, cardiomyocytes were transfected by calcium
phosphate precipitation with 1.5 µg of wild-type or mutant
ANF-luciferase reporter plasmids per 9.5-cm2 culture dish.
From 16 to 20 h later, cardiomyocytes were washed twice with
Dulbecco's modified Eagle's medium (DMEM; Canadian Life Technologies
Inc.) and serum-free hormone-free medium was added (4).
SFHF was supplemented with ET-1 or vehicle for 6 to 48 h. HeLa
cells were plated at a density of 100,000 cells/9.5-cm2
dish in six-well plates (Falcon) in DMEM supplemented with 10% fetal
bovine serum (qualified grade; Canadian Life Technologies Inc.).
Transfections were carried out as in cardiomyocytes. For cotransfections, a total of 4 µg of expression vectors was used, generally 1 µg of SRF and 3 µg of GATA-4. The amount of DNA was kept constant by using the empty expression vector. Cardiomyocytes were
harvested on the fifth day after plating, HeLa cells were harvested at
36 h posttransfection, and luciferase activity was assayed as
previously described with a Berthold LB 953 luminometer (11).
Plasmids.
The mutations and deletions of the ANF promoter
and the various GATA constructs have been described previously
(3, 11, 18, 22, 42). For in vitro translation, GATA-4
constructs were subcloned into the pRSET plasmid as previously
described (17). The luciferase reporter driven by the
chicken
394
SkA has been described previously (44);
the mouse
360c-fos and the rat
613
MHC luciferase constructs were
kindly provided by T. Hoang (48) and P. M. Buttrick
(10), respectively. The human SRF eukaryotic expression
vectors used were either cytomegalovirus (CMV) (12) or
simian virus 40 (SV40) driven (44). Human SRF was
bacterially produced as a maltose-binding basic protein (MBP) fusion
protein by subcloning a 1.6-kb XbaI-BamHI cDNA
fragment from pCGN-SRF into the MBP coding region of the pMALC-2 vector (New England Biolabs). DNA fragments corresponding to the SRF DNA-binding domain including the MADS-box (amino acids 130 to 280) and
the SRF MADS-box pm1, which contains point mutations at Arg143, Lys145,
and Ile146, that abolish DNA binding were also subcloned into the
pMALC-2 and pcDNA-3 vectors. All constructs were confirmed by sequencing.
Recombinant protein production.
SRF was bacterially produced
as previously described (18). GATA-4 and SRF constructs
were produced in vitro with or without [35S]methionine
using the TNT coupled in vitro transcription-translation system
(Promega Corp., Madison, Wis.).
Protein-protein binding assays.
In vitro binding studies
were performed as previously described with minor modifications
(17). In brief, 2 to 6 µl of 35S-labeled
GATA proteins was incubated with 300 ng of immobilized SRF fusion
proteins in 500 µl of binding buffer (150 mM NaCl, 50 mM Tris-Cl [pH
7.5], 0.3% Nonidet P-40, 1 mM dithiothreitol [DTT], 0.5 mM
phenylmethylsulfonyl fluoride [PMSF], 0.25% bovine serum albumin
[BSA]) for 2 h at 4°C with agitation and then centrifuged for
2 min at 15,000 rpm at room temperature (RT). Beads were washed three
times by vortexing in 500 µl of binding buffer at RT and three times
by vortexing in 500 µl of binding buffer without BSA. The protein
complexes were released after boiling in Laemmli buffer and resolved by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
Labeled proteins were visualized and quantified using a PhosphorImager
screen and a STORM system (Molecular Dynamics).
Immunoprecipitations and immunoblots.
Coimmunoprecipitations
of Flag-GATA-4 and hemagglutinin (HA)-SRF were carried out using
nuclear extracts of 293T cells overexpressing the relevant proteins.
Nuclear extracts were prepared as previously described
(42). Coimmunoprecipitation reactions were carried out on
50 µg of nuclear extracts using 1 µl of 12CA5 antibody in 500 µl
of binding buffer without BSA, and bound immunocomplexes were washed
and subjected to SDS-PAGE as described previously (17).
Proteins were transferred on Hybond polyvinylidene difluoride membrane
and subjected to immunoblotting. Anti-Flag M5 (Sigma) and 12CA5 anti-HA
monoclonal antibodies were used at a dilution of 1:8,000, revealed with
an anti-mouse immunoglobulin-horseradish peroxidase conjugate (Sigma)
at a dilution of 1:50,000, and visualized using ECL Plus (Amersham
Pharmacia Biotechnology).
EMSAs.
For electrophoretic mobility shift assays (EMSAs),
nuclear extracts were prepared from cardiomyocytes or HeLa cells
overexpressing various recombinant proteins as previously described
(22) with minor modifications. From 5 × 106 to 10 × 106 cells were washed with
ice-cold phosphate-buffered saline (PBS) containing 1 mM sodium
orthovanadate and scraped in 1 ml of ice-cold PBS containing 1 mM EDTA.
The cells were resuspended in 400 µl of buffer A (20 mM HEPES [pH
7.9], 20 mM NaF, 1 mM sodium pyrophosphate, 1 mM sodium orthovanadate,
1 mM EDTA, 1 mM EGTA, 0.25 mM sodium molybdate, 2 mM 10 µg DTT, 0.5 mM PMSF, 100 nM okadaic acid, plus 10 µg of leupeptin, 10 µg of
aprotinin, and 10 µg of pepstatin per ml) and swell on ice for 15 min. Then 25 µl of 10% NP-40 was added, and microtubes were vortexed
vigorously. The nuclei were then collected by centrifugation at 15,000 rpm at 4°C for 2 min. The pellets were resuspended in 5 volumes of
buffer C (buffer A supplemented with 20% glycerol and 0.4 M NaCl) and
shaken vigorously at 4°C for 1 h. The nuclear extracts were
cleared by centrifugation at 15,000 rpm for 15 min at 4°C, and the
protein concentration was assayed by the Bradford method. Binding
reactions were performed according to Charron et al. (11),
except that the reaction mixtures contained 1 or 10 µg of nuclear
extracts from cardiomyocytes or 7.5 µg of nuclear extracts from HeLa
cells overexpressing GATA-4 or SRF or recombinant SRF (rSRF) as
specified in the figures. Reactions were loaded on a 4% polyacrylamide
gel and run at 200 V at RT or 4°C in 0.25× Tris-borate-EDTA. Probes
used were, from 5' to 3' (only the coding strand is shown), rat ANF
proximal GATA-SRE-like (GATCCACTGATAACTTTAAAAGGGCATCTTCA), rat ANF
proximal mutated-GATA-SRE-like (GATCCACTCCTAACTTTAAAAGGGCATCTTCA), rat ANF
proximal GATA-mutated-SRE-like (GATCCACTGATAACGGGAAAAGGGCATCTTCA),
and c-fos SRE
(ACAGGATGTCCATATTAGGACATCTGCG). The GATA
(WGATAR) and the SRE (CCW6GG) consensus motifs are
underlined, and the mutations are shown in boldface. W and R denote,
respectively, A or T and A or G.
 |
RESULTS |
To study the nuclear signaling of ETA, we used primary
cardiomyocyte cultures in which we monitored the response of the ANF promoter to ET-1 stimulation. In these cells, ETA is the
predominant endothelin receptor isoform, and it has been previously
shown to mediate all ET-1 responses in cardiomyocytes, including
changes in gene expression and cell shape which mimic those observed
during in vivo cardiac hypertrophy (25, 55).
Consistent with previous reports (54), a luciferase
reporter driven by a 695-bp ANF fragment is induced threefold following a 6-h treatment with ET-1 (10
9 M), with maximal response
reaching sixfold after 48 h of treatment (Fig.
1). Deletion analysis revealed that a
30-bp proximal promoter region (
109 to
137 bp) containing a GATA
binding site (11) juxtaposed to an A/T-rich sequence with
strong homology to the binding site for SRF(s) is essential for
transcriptional activation by ET-1 (Fig. 1A). Mutation of the SRE-like
motif (SRE-like mut) or the GATA motif (GATAp mut) markedly inhibits
the ET-1 responsiveness of the bp
695 promoter (by 50 to 75%),
whereas mutation of the distal (bp
300) GATA binding site (GATAd mut)
leads to a consistent, though small, enhancement of ET-1 responsiveness
(Fig. 1A). These results suggest that the interaction of endogenous
cardiac GATA proteins and SRF over their cognate binding sites within
the proximal ANF promoter is essential for nuclear signaling by ET-1.
Consistent with this, coexpression in cardiomyocytes of the
695ANF-luciferase reporter with a dominant negative form of SRF
(SRFpm1) (46) or with a truncated GATA-4 protein that
retains the DNA-binding region but removes all transcriptional
activation domains (GATA-4 DBD) abrogates ET-1 responsiveness (Fig.
1B).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Mapping ET-1 response elements on the ANF promoter.
ANF-luciferase reporter constructs were transfected in cardiomyocytes,
which were then treated with ET-1 (1 nM) or vehicle for 48 h (A)
or 6 h (B) as described in Materials and Methods. Promoter
activity is expressed as the ratio of the luciferase activity recorded
in the presence of ET-1 to the activity in the absence of ET-1 (fold
change). The data shown represent the mean ± standard deviation
of at least three different experiments, each carried out in duplicate.
(A) All reporter constructs were driven by the wild type 695 rat ANF
promoter (WT) or mutants thereof containing either internal deletions
( 137/ 57 and  137/ 109) or point mutations in the proximal
SRE-like sequence (SRE-like mut), the proximal GATA site (bp 120,
GATAp mut), or the distal GATA element at bp 280 (GATAd mut). All
mutants are described in Materials and Methods. (B) The wild-type
ANF-luciferase construct was cotransfected in cardiomyocytes with
wild-type or mutant GATA-4 or SRF expression vectors and stimulated or
not with ET-1. Note that a dominant negative SRF form, SRFpm1, which no
longer binds DNA but retains the ability to interact with GATA-4 (Fig.
3), and a dominant negative GATA-4 mutant, GATA-4 DBD, which contains
the DNA-binding region (residues 200 to 332) but not the activation
domains, abrogate ET-1 induction.
|
|
Given that both SRF and GATA proteins interact with evolutionarily
conserved juxtaposed binding sites (Fig.
2A), we tested the possibility that they
may form a DNA-binding ternary complex analogous to the well-studied
ternary complex factor (TCF)-SRF ternary complex (16, 21, 28, 36,
53). Incubation of a 32-bp ANF probe containing the GATA-SRE
region with cardiac extracts from cardiomyocytes treated or not with
ET-1 revealed, in addition to the expected GATA and SRF complexes, the
presence of a slower-migrating DNA-binding complex (marked by asterisks in Fig. 2B). This complex is not observed over a 30-bp c-fos
SRE probe (Fig. 2B) but is efficiently inhibited by unlabeled SRE or
GATA oligonucleotides and is displaced by incubation with an anti-SRF
antibody (Fig. 2B and data not shown). Moreover, this SRF-containing
complex is clearly observed in cells overexpressing SRF and GATA-4 or
-6 and is dependent on the presence of both GATA and SRE elements (Fig.
2C). The SRF-GATA complex is abrogated in the presence of excess
unlabeled oligonucleotides containing either GATA binding sites or
well-characterized SREs from the c-fos or
-skeletal actin
promoter (Fig. 2D); the complex is also eliminated in the presence of
SRF or GATA-4 (or -6) antibodies (Fig. 2C, right panel, and 2D).
N-terminally deleted GATA-4 protein (G4
) retains the ability to form
a ternary complex with SRF that migrates faster than the ternary
complex formed with wild-type GATA-4 (Fig. 2D, middle panel). In
contrast, both SRF binding and ternary complex formation are severely
reduced when a DNA-binding-defective mutant of GATA-4 (G4m) is
coexpressed with SRF instead of native GATA-4, suggesting that DNA
binding stabilizes SRF-GATA-4 interaction and that the ability of
GATA-4 to interact with SRF is dissociable from its DNA-binding
capacity. Similarly, a DNA-binding-defective SRF mutant (SRFpm1) fails
to form a detectable ternary complex with GATA-4 (Fig. 2D, right
panel), consistent with the requirement of both GATA and SRE elements
for complex formation (Fig. 2C); this mutant decreases GATA-4 binding,
suggesting that it retains the ability to physically contact GATA-4
(Fig. 2D, right panel). Next, we tested the effect of increased levels
of GATA-4 and/or SRF on ternary complex formation. As shown in Fig. 2E,
increased levels of SRF, GATA-4, or both enhance the formation of the
ternary complex, suggesting that this may represent a possible
mechanism of ET-1 regulation. Together, these data demonstrate that
GATA proteins and SRF interact physically to form a DNA-binding ternary complex over a cardiac promoter through cooperative binding.



View larger version (219K):
[in this window]
[in a new window]
|
FIG. 2.
SRF and GATA factors form a ternary complex over a DNA
element containing juxtaposed GATA and SRE motifs. (A) Schematic
representation of the ANF promoter, focusing on the proximal ET-1
response element. Note the evolutionary conservation of the
GATA/SRE-like element. (B to E) EMSAs were performed on
c-fos-SRE (SRE), ANF-GATA (GATA), or ANF-GATA-SRE-like
probes using nuclear extracts prepared from cardiomyocytes treated with
ET-1 (100 nM) or vehicle for 6 h (B) or from HeLa cells
overexpressing SRF, GATA-4 or -6, or both (C and D). Gels were exposed
to a phosphorimager screen and developed in the STORM (Molecular
Dynamics). GATA and SRF complexes are denoted by open and solid
arrowheads, respectively, and the GATA-SRF complex is indicated by an
asterisk. All probes and antibodies used are described in Materials and
Methods. (B) ET-1 treatment (6 h) enhances GATA and SRF binding on the
GATA and SRE probes and formation of the ternary complex. (C) The
GATA-SRF ternary complex is present in HeLa cell extracts
overexpressing SRF and GATA-4 or GATA-6 (left and right panels)
and requires intact GATA and SRF binding sites. Please note the faint
ternary complex band seen when only GATA factors are overexpressed,
reflecting interaction of exogenous GATA proteins with endogenous HeLa
cell SRF. (D) Both wild-type GATA-4 (G4) and an N-terminally truncated
form (G4 , residues 200 to 440) form a ternary complex that is
abrogated by unlabeled c-fos-SRE (SRE 1), SKA-SRE (SRE2),
or GATA probes and is eliminated in presence of either GATA-4 or SRF
antibodies (Ab). Please note the different mobilities of the G4- and
G4 -containing ternary complexes (left panels) and the reduced
ability of a DNA-binding-defective GATA-4 mutant (G4m) to form a stable
ternary complex while eliminating SRF-SRE binding. The right panel
illustrates the inability of a DNA-binding-defective SRF mutant,
SRFpm1, to form a ternary complex, although this mutant inhibits GATA-4
binding to its site. (E) Effects of increased amounts of GATA-4 and/or
SRF on ternary complex formation. Binding was carried out using 4, 8, or 16 µg of extracts expressing GATA-4 and SRF (left panel) or using
2 µg of extracts overexpressing GATA-4 in presence of 2 or 4 µg of
control (Ctl) or SRF-expressing extracts (middle panel) or using 2 µg
of SRF-expressing extracts in the presence of 2 or 4 µg of extracts
from control or GATA-4-expressing cells (right panel).
|
|
Physical interaction between GATA-4 and SRF was further analyzed using
in vivo coimmunoprecipitations (Fig. 3A)
and in vitro pull-down assays (Fig. 3B), which confirmed the ability of
the two proteins to interact directly even in the absence of DNA. Structure-function studies revealed that the minimal DNA-binding domain
of GATA-4, composed of the second zinc finger and the basic regions
(amino acids 244 to 332), is necessary and sufficient for physical
interaction with SRF; however, DNA binding is not essential for
interaction with SRF, as revealed by the ability of G4m (which harbors
a point mutation in the zinc finger) to interact, albeit with decreased
efficiency, with SRF (Fig. 3C). Similarly, the core SRF DNA-binding
domain (SRF[130-280]) is sufficient for GATA interaction. However,
SRF's ability to bind DNA is not required for GATA interaction, as
evidenced by the ability of SRF[130-280]pm1, which harbors mutations
in the basic region that abolish DNA binding, to efficiently associate
with GATA-4 (Fig. 3D). It is noteworthy that this structure-function
analysis carried out in the absence of DNA is in general agreement with
the data obtained in the presence of the GATA-SRF DNA fragment in gel
shift experiments (Fig. 2D). Indeed, formation of the SRF-GATA ternary complex required only the DNA-binding domain of GATA-4 (200 to 332),
and while DNA-binding-defective mutants of GATA-4 (G4m) and SRF
(SRFpm1) did not produce ternary complexes, they nevertheless abrogated
SRF and GATA binding, respectively; this is consistent with their
ability to physically interact with each other in the absence of DNA
binding.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 3.
SRF can interact physically with cardiac GATA factors in
the absence of DNA. (A) SRF interacts in vivo with GATA-4. Nuclear
extracts from 293T cells transfected with empty vectors (Ctl),
Flag-GATA-4 (G4), and/or HA-SRF (SRF) were immunoprecipitated using an
anti-HA antibody, separated by SDS-10% PAGE, transferred to
polyvinylidene difluoride membranes, and subjected to immunoblotting
using an anti-Flag antibody (top panel). The lower two panels are
Western blots carried out on the same nuclear extracts using either HA
(to reveal tagged SRF proteins) or Flag (to reveal tagged GATA-4
proteins) antibodies. (B and C) Luciferase (Luc), GATA-4 (G4), or
GATA-6 (G6) and a series of deletion mutants of GATA-4 were translated
and labeled as described in Materials and Methods. LacZ and SRF in
fusion with MBP were produced in bacteria. (B) SRF directly interacts
with both cardiac factors GATA-4 and -6. (C) In vitro mapping of the
GATA-4 domain required for interaction with SRF to the second zinc
finger and the basic region (244 to 332). (D) The SRF DNA-binding
domain is sufficient for interaction with GATA-4. SRF (130-280)pm1 is
a DNA-binding-deficient mutant containing three point mutations in the
basic region. Protein complexes were separated by electrophoresis,
exposed on a phosphorimager screen, and developed in the STORM.
|
|
Next, we tested the transcriptional properties of a GATA-4-SRF-DNA
complex. In cotransfection assays, both GATA-4 and SRF significantly
activate the ANF promoter (up to 20-fold), and when they are added
together, a synergistic 80-fold promoter activation is achieved (Fig.
4A). This synergy is dependent on the
presence of both SRE and GATA elements, suggesting that, although the
two proteins can physically associate in solution, DNA binding is indeed required for stable interaction and/or for formation of the
transcriptionally competent complex. Other cardiac GATA factors, GATA-5
and -6, can also synergize with SRF over the ANF promoter; however, no
synergy could be observed under the same conditions with GATA-1, -2, or
-3 (Fig. 4B). Synergy is dependent on the DNA-binding domains and the
DNA-binding ability of both SRF and GATA-4, as evidenced by the
inability of SRFpm1 and G4m (which no longer bind their respective
sites) to functionally cooperate (Fig. 4C and D); this finding is
consistent with the requirement for intact SRE and GATA elements to
observe cooperative SRF-GATA transactivation (Fig. 4A). However,
although sufficient for physical interaction, neither the GATA-4 nor
SRF DNA-binding domain is sufficient for transcriptional synergy, which
requires the activation domains of both proteins (Fig. 4C and D).
Finally, we tested whether the promoters of other genes that are
transcriptionally activated by ET-1 in cardiomyocytes share the ability
to respond synergistically to SRF and GATA-4. In addition to the
c-fos promoter, two cardiac promoters,
-skeletal actin
and
-myosin heavy chain, are activated by ET-1 (24, 59;
unpublished data). All three promoters contain adjacent GATA and SRE
elements, and all three are synergistically activated by SRF and
GATA-4. In contrast, the B-type natriuretic peptide (BNP) promoter
which is modestly induced by ET-1 (35) harbors GATA but no
SRF binding sites and is unable to support GATA-SRF synergy (Fig.
5). Together, these data demonstrate that DNA-bound SRF can cooperate with members of the GATA family to form a
transcriptionally active ternary complex that regulates expression of
some tissue-specific and growth-responsive genes.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
Synergistic activation of the cardiac ANF promoter by
GATA-4 and SRF. (A) HeLa cells were transfected with the 695ANF-luc
(WT) or ANF-luc vector containing point mutations in the GATA or SRE
elements as described for Fig. 1 in the presence of GATA-4 (G4) or
CMV-driven SRF expression vectors or both, or in presence of the
backbone vector (Ctl). Please note that the 5' deletion at bp 371
removes a consensus distal SRE that is not required for ET-1 response
or GATA-SRF synergy, while the 135/ 57 bp internal deletion removes
the proximal GATA SRE but retains the distal GATA (bp-300) and SRE
(bp-400) sites. (B) Other GATA factors were tested for their ability to
synergize with SRF over the ANF promoter. Only the cardiac GATA
proteins GATA-4, -5, and -6 (G4, G5, and G6) show synergy with SRF. (C)
Mapping of GATA-4 (G4) and SRF functional domains required for
transcriptional synergy. HeLa cells were cotransfected with the
695ANF-luciferase reporter and various GATA-4 mutants in the presence
or absence of the CMV-driven SRF expression vector (C) or with
expression vectors for different SRF mutants in the presence or absence
of wild-type GATA-4 expression vector (D). Please note that in panel D,
SRF proteins were produced using SV40-driven expression vectors. All
plasmids used are described in Materials and Methods; the data shown
are the means ± standard deviation of at least three different
experiments, each carried out in duplicate.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
Functional cooperation between GATA-4 and SRF is not
restricted to the ANF promoter. HeLa cells were cotransfected with the
luciferase reporter under the control of the promoter of the rat ANF
( 695ANF), the chicken -skeletal actin ( 394 SKA), the rat
-myosin heavy chain ( 613 MHC), the mouse c-fos
( 360c-fos), or rat BNP ( 2.2BNP) genes. Note that except for the BNP
promoter, which contains no recognizable SRE motif, all other promoters
contain one or more SRE (depicted by a rectangle) and GATA (depicted by
an ellipse) sites; on each of these promoters, at least one SRE is in
close proximity to a GATA site. High-affinity binding sites are shown
as black areas, and weak affinity sites (based on published reports or
on the present work) are hatched. Only promoters containing both GATA
and SRE sites are synergistically activated by transient overexpression
of GATA-4 and SRE. Transfections were carried out in HeLa cells as
described for Fig. 4. All reporter constructs are described in
Materials and Methods. The data are from one representative experiment
carried out in duplicate. Similar results were obtained on at least two
other occasions.
|
|
 |
DISCUSSION |
We have used the ANF promoter to elucidate the
transcription pathways that link activation of the G-protein-coupled
endothelin ETA receptor to cell-specific changes in gene
expression and, consequently, cell fate. We found that
transcriptional regulation of several ET-1-responsive cardiac
genes involves combinatorial interaction between the
tissue-specific GATA family of transcription factors and SRF
through formation of a novel DNA-bound ternary complex reminiscent of
the well-studied TCF-SRF ternary complex, identified over the
c-fos promoter and involving SRF and the growth factor-regulated, ubiquitous TCFs. The results obtained identify for
the first time an endothelin response element that could account for
cell-specific endothelin
and possibly other growth and differentiation factor
actions. Moreover, given the coexpression of SRF and members of
the GATA family in various endothelin target tissues such as ovaries
and vascular smooth muscles (discussed below), the transcription pathway described herein may represent a paradigm for elucidating cell-specific nuclear signaling by ETA and possibly other
G-protein-coupled receptors.
ET-1 is a potent growth promoter of vascular and cardiac myocytes and a
survival-differentiation factor for neural crest cells; although these
effects clearly involve transcriptional regulation of specific genes,
the identities of these target genes are only starting to be unraveled
(15). Moreover, while numerous Ras-dependent intracellular
signaling cascades are transiently activated by ET-1-ETA
association, the pathway linking ETA stimulation to nuclear events has remained undefined. In fact, few promoters have been reported to be regulated by ET-1, and their precise ET response elements were not mapped; they include cardiac
- and
-myosin heavy chain (59), ANF (54), BNP
(35), and c-Fos (24). Interestingly, it was
shown that ET-1 enhanced the activity of a c-fos SRE-driven
reporter and that this required an intact SRE; however, mutations that
abolished formation of the TCF-SRF ternary complex, the presumed
mediator of growth factor signaling, did not affect ET-1
responsiveness, indicating that ET-1 action is SRF dependent but TCF
independent (24). In agreement with this, our results
suggest that a GATA-SRF, not a TCF-SRF, ternary complex likely mediates
ET-1 regulation of cardiac promoters which contain SREs but no adjacent
TCF sites. This does not exclude the possibility that other elements
and factors may also contribute to ET-1 response in a cell- and
promoter-dependent manner. Indeed, as discussed in the introduction,
several intracellular pathways known to activate various transcription
factors are induced by ET-1; they include, among others, p38 MAPK,
which phosphorylates and activates MEF2 proteins (23, 62),
and ATF6 (57), an SRF-interacting protein (63). Whether ATF6 and MEF2 are part of a larger ET-1
response complex on the ANF promoter would be worth investigating. At
present, several lines of evidence suggest that the presence of GATA
and SRF factors is essential for the ET-1 responsiveness of ANF: (i) dominant negative GATA or SRF forms abrogate ET-1 response (Fig. 1) and
(ii) cotransfection of the ANF promoter with an ETA
expression vector renders the ANF promoter responsive to ET-1 only in
cells containing both GATA and SRF proteins, likely through formation of the GATA-SRF ternary complex (J. Wang and M. Nemer, unpublished data).
The mechanism(s) by which the GATA-SRF ternary complex mediates ET-1
response is presently undefined. Binding of both GATA and SRF is
induced by ET-1, and this may in turn enhance ternary complex
formation. Additionally, ET-1 induces GATA-4 phosphorylation (F. Charron and M. Nemer, unpublished data); whether postranslational modifications of GATA-4 modulate ternary complex formation or activity
is presently being investigated. Preliminary evidence indicates that
the GATA-4-SRF synergy can be further enhanced by some MAPK forms. The
identification for the first time of an ET regulatory element and
effector transcription complexes will pave the way for elucidation of
the signaling cascades and molecules more proximal to transcription in
which specificity may lie.
In addition to its growth-promoting effects on cardiac myocytes, ET-1
is a well-known mitogen for smooth muscle cells, including vascular and
mesangial cells (39), which express high levels of GATA-6
and SRF (9, 56). Moreover, SRF binding sites are required
for cardiac and smooth muscle-specific expression of several genes,
such as ANF,
-myosin heavy chain,
-skeletal actin, SM22, and
-smooth muscle actin (3, 32, 34). In the case of the
ANF promoter, two SRF binding sites have been characterized; the
high-affinity site, centered around bp
400, was shown to be essential
for ANF promoter activity in postnatal ventricles (3); in
addition to SRF, the element binds a cardiac-enriched nuclear protein
whose identity remains to be elucidated (3). The proximal
ANF SRE discussed in this paper is a low-affinity binding site for SRF
that was shown to contribute to ANF promoter activation in response to
1-adrenergic stimulation (27), although in
our own hands this site has no effect on
1-adrenergic
activation of the promoter. The mechanism by which SRF acts to regulate
smooth and cardiac muscle-specific genes has remained enigmatic ever since it was noted that the CArG box, present on actin promoters and
required for their muscle-specific expression, was identical to the
serum response element mapped on the c-fos promoter
(38, 41) and that both elements interacted equally well
with SRF (8). Based on the present data, it is tempting to
speculate on the role of GATA proteins as tissue-specific cofactors for SRF. The present work also suggests that a GATA-SRF ternary complex likely contributes to promoter architecture, allowing proteins bound to
distal enhancer elements to interact with those present on the proximal
promoter and with the basal transcription machinery. Indeed, molecular
modeling based on the crystal structure of SRF and the nuclear magnetic
resonance structure of GATA-1 bound to their respective sites (data not
shown) reveal that binding of the SRF-GATA complex to the proximal ANF
promoter induces a DNA bend that may bring distal enhancers into closer
interactions with downstream elements. This may in turn explain the
modest contribution of the proximal SRE to
1-adrenergic
responsiveness, given that the ANF
1-adrenergic response
elements are present on both sides of the GATA SRE (at bp
80 and
450) (2).
SRF, initially isolated as the nuclear protein that mediates
transcriptional response of c-fos and other immediate-early
genes to growth factors, has been one of the most extensively
characterized transcription factors (reviewed in reference
58). It is now well established that many SRF-dependent
responses to growth factor stimulation are mediated by an
SRF-containing ternary complex in which the TCF is the target of
several MAPK cascades (21, 36, 53). At least three
different but related TCFs have been identified; functional as well as
structural analyses of the TCF-SRF-DNA ternary complex suggest that
TCFs act as growth-regulated SRF cofactors (37, 40).
Unexpectedly, while mutations that abolish TCF binding rendered the
c-fos promoter unresponsive to some growth factors, they did
not abolish serum regulation or endothelin stimulation (26,
31). This led to the speculation that an unidentified SRF
cofactor that would interact with the DNA-binding SRF domain and form a
ternary complex with SRF and DNA must exist. Our results suggest that
GATA factors may fulfill these criteria. Indeed, GATA-4 and -6 interact
with the DNA-binding domain of SRF and form a stable ternary complex,
as evidenced by gel shift analysis and supported by molecular modeling
(Fig. 2 and 3 and data not shown). Remarkably, we found that the
well-studied c-fos SRE contains two inverted GATA motifs
flanking the SRF binding sequences (see c-fos SRE sequence
in Materials and Methods) which bound recombinant GATA factors, albeit
with lower affinity than the ANF GATA sites (our unpublished work).
Moreover, the c-fos promoter as well as a c-fos
SRE heterologous promoter were synergistically activated by SRF and
GATA factors in many cell types (Fig. 5 and data not shown). Whether a
GATA-SRF ternary complex can substitute for the TCF-SRF complex over
the c-fos promoter and mediate cell-specific serum or
growth-differentiation responses in GATA-expressing cells deserves to
be investigated.
Finally, we have recently shown that GATA factors can interact with
other MADS-box-containing proteins, namely, the MEF2 factors (42). Although the ability to associate with MADS-box
transcription factor through similar domains may be a general feature
of GATA proteins, it is noteworthy that functional cooperativity
between GATA and MEF2, on the one hand, and GATA and SRF, on the other hand, involves distinct mechanisms. In the case of MEF2,
transcriptional synergy occurs via GATA-dependent recruitment of MEF2
to target promoters and does not require the DNA-binding ability of
MEF2 (42). In contrast, transcriptional cooperativity
between GATA and SRF requires both GATA and SRF DNA-binding abilities
and sites. While the molecular basis for these differences is not clear
at present, the ability of GATA and MADS factors to interact via different mechanisms underscores the potential relevance to various cellular processes of a functional interaction between the two evolutionarily conserved transcription factor families.
 |
ACKNOWLEDGMENTS |
We are grateful to Brian Wilkes for molecular modeling studies,
to Lynda Robitaille for technical assistance, to Lise Laroche for
secretarial help, and to members of the Nemer lab for helpful discussions.
This work was supported by grants from the Medical Research Council of
Canada (MT-13056 and MOP-36382) and in part by a grant from the
Société de recherches sur le cancer inc. S.M. was the recipient of an MRC studentship, and M.N. is a senior Scientist of the MRC.
The first two authors contributed equally to this work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut de
recherches cliniques de Montréal, Laboratoire de
développement et différenciation cardiaques, 110 des Pins
Ouest, Montréal, Quebec, Canada H2W 1R7. Phone: (514) 987-5680. Fax: (514) 987-5575. E-mail: nemerm{at}ircm.qc.ca.
 |
REFERENCES |
| 1.
|
Arai, H.,
S. Hori,
I. Aramori,
H. Ohkubo, and S. Nakanishi.
1990.
Cloning and expression of a cDNA encoding an endothelin receptor.
Nature
348:730-732[CrossRef][Medline].
|
| 2.
|
Ardati, A., and M. Nemer.
1993.
A nuclear pathway for a1-adrenergic receptor signaling in cardiac cells.
EMBO J.
12:5131-5139[Medline].
|
| 3.
|
Argentin, S.,
A. Ardati,
S. Tremblay,
I. Lihrmann,
L. Robitaille,
J. Drouin, and M. Nemer.
1994.
Developmental stage-specific regulation of atrial natriuretic factor gene transcription in cardiac cells.
Mol. Cell. Biol.
14:777-790[Abstract/Free Full Text].
|
| 4.
|
Argentin, S.,
Y.-L. Sun,
I. Lihrmann,
T. J. Schmidt,
J. Drouin, and M. Nemer.
1991.
Distal cis-acting promoter sequences mediate glucocorticoid stimulation of cardiac atrial natriuretic factor gene transcription.
J. Biol. Chem.
266:23315-23322[Abstract/Free Full Text].
|
| 5.
|
Battistini, B.,
P. Chailler,
P. D'Orleans-Juste,
N. Briere, and P. Sirois.
1993.
Growth regulatory properties of endothelins.
Peptides
14:385-399[CrossRef][Medline].
|
| 6.
|
Baynash, A. G.,
K. Hosoda,
A. Giaid,
J. A. Richardson,
N. Emoto,
R. E. Hammer, and M. Yanagisawa.
1994.
Interaction of endothelin-3 with endothelin-B receptor is essential for development of epidermal melanocytes and enteric neurons.
Cell
79:1277-1285[CrossRef][Medline].
|
| 7.
|
Bogoyevitch, M. A.,
P. E. Glennon,
M. B. Andersson,
A. Clerk,
A. Lazou,
C. J. Marshall,
P. J. Parker, and P. H. Sugden.
1994.
Endothelin-1 and fibroblast growth factors stimulate the mitogen- activated protein kinase signaling cascade in cardiac myocytes: the potential role of the cascade in the integration of two signaling pathways leading to myocyte hypertrophy.
J. Biol. Chem.
269:1110-1119[Abstract/Free Full Text].
|
| 8.
|
Boxer, L. M.,
R. Prywes,
R. G. Roeder, and L. Kedes.
1989.
The sarcomeric actin CArG-binding factor is indistinguishable from the c-Fos serum response factor.
Mol. Cell. Biol.
9:515-522[Abstract/Free Full Text].
|
| 9.
|
Browning, C. L.,
D. E. Culberson,
I. V. Aragon,
R. A. Fillmore,
J. D. Croissant,
R. J. Schwartz, and W. E. Zimmer.
1998.
The developmentally regulated expression of serum response factor plays a key role in the control of smooth muscle-specific genes.
Dev. Biol.
194:18-37[CrossRef][Medline].
|
| 10.
|
Buttrick, P. M.,
M. L. Kaplan,
R. N. Kitsis, and L. A. Leinwand.
1993.
Distinct behavior of cardiac myosin heavy chain gene constructs in vivo: discordance with in vitro results.
Circ. Res.
72:1211-1217[Abstract/Free Full Text].
|
| 11.
|
Charron, F.,
P. Paradis,
O. Bronchain,
G. Nemer, and M. Nemer.
1999.
Cooperative interaction between GATA-4 and GATA-6 regulates myocardial gene expression.
Mol. Cell. Biol.
19:4355-4365[Abstract/Free Full Text].
|
| 12.
|
Chen, C. Y., and R. J. Schwartz.
1996.
Recruitment of the tinman homolog Nkx-2.5 by serum response factor activates cardiac -actin gene transcription.
Mol. Biol. Cell
16:6372-6384.
|
| 13.
|
Choukroun, G.,
R. Hajjar,
J. M. Kyriakis,
J. V. Bonventre,
A. Rosenzweig, and T. Force.
1998.
Role of the stress-activated protein kinases in endothelin-induced cardiomyocyte hypertrophy.
J. Clin. Investig.
102:1311-1320[Medline].
|
| 14.
|
Clouthier, D. E.,
K. Hosoda,
J. A. Richardson,
S. C. Williams,
H. Yanagisawa,
T. Kuwaki,
M. Kumada,
R. E. Hammer, and M. Yanagisawa.
1998.
Cranial and cardiac neural crest defects in endothelin-A receptor-deficient mice.
Development
125:813-824[Abstract].
|
| 15.
|
Clouthier, D. E.,
S. C. Williams,
H. Yanagisawa,
M. Wieduwilt,
J. A. Richardson, and M. Yanagisawa.
2000.
Signaling pathways crucial for craniofacial development revealed by endothelin-A receptor-deficient mice.
Dev. Biol.
217:10-24[CrossRef][Medline].
|
| 16.
|
Dalton, S., and R. Treisman.
1992.
Characterization of SAP-1, a protein recruited by serum response factor to the c-fos serum response element.
Cell
68:597-612[CrossRef][Medline].
|
| 17.
|
Durocher, D.,
F. Charron,
R. Warren,
R. J. Schwartz, and M. Nemer.
1997.
The cardiac transcription factors Nkx2-5 and GATA-4 are mutual cofactors.
EMBO J.
16:5687-5696[CrossRef][Medline].
|
| 18.
|
Durocher, D.,
C. Y. Chen,
A. Ardati,
R. J. Schwartz, and M. Nemer.
1996.
The ANF promoter is a downstream target for Nkx-2.5 in the myocardium.
Mol. Cell. Biol.
16:4648-4655[Abstract].
|
| 19.
|
Edery, P.,
T. Attie,
J. Amiel,
A. Pelet,
C. Eng,
R. M. Hofstra,
H. Martelli,
C. Bidaud,
A. Munnich, and S. Lyonnet.
1996.
Mutation of the endothelin-3 gene in the Waardenburg-Hirschsprung disease (Shah-Waardenburg syndrome).
Nat. Genet.
12:442-444[CrossRef][Medline].
|
| 20.
|
Gariepy, C. E.,
D. T. Cass, and M. Yanagisawa.
1996.
Null mutation of endothelin receptor type B gene in spotting lethal rats causes aganglionic megacolon and white coat color.
Proc. Natl. Acad. Sci. USA
93:867-872[Abstract/Free Full Text].
|
| 21.
|
Gille, H.,
T. Strahl, and P. E. Shaw.
1995.
Activation of ternary complex factor Elk-1 by stress-activated protein kinases.
Curr. Biol.
5:1191-1200[CrossRef][Medline].
|
| 22.
|
Grépin, C.,
L. Dagnino,
L. Robitaille,
L. Haberstroh,
T. Antakly, and M. Nemer.
1994.
A hormone-encoding gene identifies a pathway for cardiac but not skeletal muscle gene transcription.
Mol. Cell. Biol.
14:3115-3129[Abstract/Free Full Text].
|
| 23.
|
Han, J.,
Y. Jiang,
Z. Li,
V. V. Kravchenko, and R. J. Ulevitch.
1997.
Activation of the transcription factor MEF2C by the MAP kinase p38 in inflammation.
Nature
386:296-299[CrossRef][Medline].
|
| 24.
|
Herman, W. H., and M. S. Simonson.
1995.
Nuclear signaling by endothelin-1. A Ras pathway for activation of the c-fos serum response element.
J. Biol. Chem.
270:11654-11661[Abstract/Free Full Text].
|
| 25.
|
Hilal-Dandan, R.,
M. T. Ramirez,
S. Villegas,
A. Gonzalez,
Y. Endo-Mochizuki,
J. H. Brown, and L. L. Brunton.
1997.
Endothelin ETA receptor regulates signaling and ANF gene expression via multiple G protein-linked pathways.
Am. J. Physiol.
272:H130-H137[Abstract/Free Full Text].
|
| 26.
|
Hill, C. S., and R. Treisman.
1995.
Differential activation of c-fos promoter elements by serum, lysophosphatidic acid, G proteins and polypeptide growth factors.
EMBO J.
14:5037-5047[Medline].
|
| 27.
|
Hines, W. A.,
J. Thorburn, and A. Thorburn.
1999.
A low-affinity serum response element allows other transcription factors to activate inducible gene expression in cardiac myocytes.
Mol. Cell. Biol.
19:1841-1852[Abstract/Free Full Text].
|
| 28.
|
Hipskind, R. A.,
D. Buscher,
A. Nordheim, and M. Baccarini.
1994.
Ras/MAP kinase-dependent and -independent signaling pathways target distinct ternary complex factors.
Genes Dev.
8:1803-1816[Abstract/Free Full Text].
|
| 29.
|
Hosoda, K.,
R. E. Hammer,
J. A. Richardson,
A. G. Baynash,
J. C. Cheung,
A. Giaid, and M. Yanagisawa.
1994.
Targeted and natural (piebald-lethal) mutations of endothelin-B receptor gene produce megacolon associated with spotted coat color in mice.
Cell
79:1267-1276[CrossRef][Medline].
|
| 30.
|
James, A. F.,
L. H. Xie,
Y. Fujitani,
S. Hayashi, and M. Horie.
1994.
Inhibition of the cardiac protein kinase A-dependent chloride conductance by endothelin-1.
Nature
370:297-300[CrossRef][Medline].
|
| 31.
|
Johansen, F. E., and R. Prywes.
1994.
Two pathways for serum regulation of the c-Fos serum response element require specific sequence elements and a minimal domain of serum response factor.
Mol. Cell. Biol.
14:5920-5928[Abstract/Free Full Text].
|
| 32.
|
Kim, S.,
H. S. Ip,
M. M. Lu,
C. Clendenin, and M. S. Parmacek.
1997.
A serum response factor-dependent transcriptional regulatory program identifies distinct smooth muscle cell sublineages.
Mol. Cell. Biol.
17:2266-2278[Abstract].
|
| 33.
|
Kurihara, Y.,
H. Kurihara,
H. Oda,
K. Maemura,
R. Nagai,
T. Ishikawa, and Y. Yazaki.
1995.
Aortic arch malformations and ventricular septal defect in mice deficient in endothelin-1.
J. Clin. Investig.
96:293-300.
|
| 34.
|
Li, L.,
Z. Liu,
B. Mercer,
P. Overbeek, and E. N. Olson.
1997.
Evidence for serum response factor-mediated regulatory networks governing SM22alpha transcription in smooth, skeletal, and cardiac muscle cells.
Dev. Biol.
187:311-321[CrossRef][Medline].
|
| 35.
|
Liang, F.,
S. Lu, and D. G. Gardner.
2000.
Endothelin-dependent and -independent components of strain-activated brain natriuretic peptide gene transcription require extracellular signal regulated kinase and p38 mitogen-activated protein kinase.
Hypertension
35:188-192[Abstract/Free Full Text].
|
| 36.
|
Marais, R.,
J. Wynne, and R. Treisman.
1993.
The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain.
Cell
73:381-393[CrossRef][Medline].
|
| 37.
|
Matsubara, H.,
M. Kanasaki,
S. Murasawa,
Y. Tsukaguchi,
Y. Nio, and M. Inada.
1994.
Differential gene expression and regulation of angiotensin II receptor subtypes in rat cardiac fibroblasts and cardiomyocytes in culture.
J. Clin. Investig.
93:1592-1601.
|
| 38.
|
Miwa, T., and L. Kedes.
1987.
Duplicated CArG box domains have positive and mutually dependent regulatory roles in expression of the human alpha-cardiac actin genes.
Mol. Cell. Biol.
7:2803-2813[Abstract/Free Full Text].
|
| 39.
|
Miyauchi, T., and T. Masaki.
1999.
Pathophysiology of endothelin in the cardiovascular system.
Annu. Rev. Physiol.
61:391-415[CrossRef][Medline].
|
| 40.
|
Mo, Y.,
B. Vaessen,
K. Johnston, and R. Marmorstein.
1998.
Structures of SAP-1 bound to DNA targets from the E74 and c-fos promoters: insights into DNA sequence discrimination by Ets proteins.
Mol. Cell
2:201-212[CrossRef][Medline].
|
| 41.
|
Mohun, T.,
N. Garrett, and R. Treisman.
1987.
Xenopus cytoskeletal actin and human c-fos gene promoters share a conserved protein-binding site.
EMBO J.
6:667-673[Medline].
|
| 42.
|
Morin, S.,
F. Charron,
L. Robitaille, and M. Nemer.
2000.
GATA-dependent recruitment of MEF2 proteins to target promoters.
EMBO J.
19:2046-2055[CrossRef][Medline].
|
| 43.
|
Ono, K.,
G. Tsujimoto,
A. Sakamoto,
K. Eto,
T. Masaki,
Y. Ozaki, and M. Satake.
1994.
Endothelin-A receptor mediates cardiac inhibition by regulating calcium and potassium currents.
Nature
370:301-304[CrossRef][Medline].
|
| 44.
|
Paradis, P.,
W. R. MacLellan,
N. S. Belaguli,
R. J. Schwartz, and M. D. Schneider.
1996.
Serum response factor mediates AP-1-dependent induction of the skeletal alpha-actin promoter in ventricular myocytes.
J. Biol. Chem.
271:10827-10833[Abstract/Free Full Text].
|
| 45.
|
Pribnow, D.,
L. L. Muldoon,
M. Fajardo,
L. Theodor,
L. Y. Chen, and B. E. Magun.
1992.
Endothelin induces transcription of fos/jun family genes: a prominent role for calcium ion.
Mol. Endocrinol.
6:1003-1012[Abstract/Free Full Text].
|
| 46.
|
Prywes, R., and H. Zhu.
1992.
In vitro squelching of activated transcription by serum response factor: evidence for a common coactivator used by multiple transcriptional activators.
Nucleic Acids Res.
20:513-520[Abstract/Free Full Text].
|
| 47.
|
Puffenberger, E. G.,
K. Hosoda,
S. S. Washington,
K. Nakao,
D deWit,
M. Yanagisawa, and A. Chakravart.
1994.
A missense mutation of the endothelin-B receptor gene in multigenic Hirschsprung's disease.
Cell
79:1257-1266[CrossRef][Medline].
|
| 48.
|
Rajotte, D.,
H. B. Sadowski,
A. Haman,
K. Gopalbhai,
S. Meloche,
L. Liu,
G. Krystal, and T. Hoang.
1996.
Contribution of both STAT and SRF/TCF to c-fos promoter activation by granulocyte-macrophage colony-stimulating factor.
Blood
88:2906-2916[Abstract/Free Full Text].
|
| 49.
|
Sakai, S.,
T. Miyauchi,
M. Kobayashi,
I. Yamaguchi,
K. Goto, and Y. Sugishita.
1996.
Inhibition of myocardial endothelin pathway improves long-term survival in heart failure.
Nature
384:353-355[CrossRef][Medline].
|
| 50.
|
Sakai, S.,
T. Miyauchi,
T. Sakurai,
Y. Kasuya,
M. Ihara,
I. Yamaguchi,
K. Goto, and Y. Sugishita.
1996.
Endogenous endothelin-1 participates in the maintenance of cardiac function in rats with congestive heart failure. Marked increase in endothelin-1 production in the failing heart.
Circulation
93:1214-1222[Abstract/Free Full Text].
|
| 51.
|
Sakurai, T.,
M. Yanagisawa,
Y. Takuwa,
H. Miyazaki,
S. Kimura,
K. Goto, and T. Masaki.
1990.
Cloning of a cDNA encoding a non-isopeptide-selective subtype of the endothelin receptor.
Nature
348:732-735[CrossRef][Medline].
|
| 52.
|
Shamim, A.,
T. Pelzer,
C. Grohe, and L. Neyses.
1999.
Induction of Egr-1 mRNA and protein by endothelin 1, angiotensin II and norepinephrine in neonatal cardiac myocytes.
Mol. Cell. Biochem.
195:11-17[CrossRef][Medline].
|
| 53.
|
Shaw, P. E.,
H. Schroter, and A. Nordheim.
1989.
The ability of a ternary complex to form over the serum response element correlates with serum inducibility of the human c-fos promoter.
Cell
56:563-572[CrossRef][Medline].
|
| 54.
|
Shubeita, H. E.,
P. M. McDonough,
A. N. Harris,
K. U. Knowlton,
C. C. Glembotski,
J. H. Brown, and K. R. Chien.
1990.
Endothelin induction of inositol phospholipid hydrolysis, sarcomere assembly, and cardiac gene expression in ventricular myocytes: a paracrine mechanism for myocardial cell hypertrophy.
J. Biol. Chem.
265:20555-20562[Abstract/Free Full Text].
|
| 55.
|
Sugden, P. H., and M. A. Bogoyevitch.
1996.
Endothelin-1-dependent signaling pathways in the myocardium.
Trends Cardiovasc. Med.
6:87-94.
|
| 56.
|
Suzuki, E.,
T. Evans,
J. Lowry,
L. Truong,
D. W. Bell,
J. R. Testa, and K. Walsh.
1996.
The human GATA-6 gene: structure, chromosomal location, and regulation of expression by tissue-specific and mitogen-responsive signals.
Genomics
38:283-290[CrossRef][Medline].
|
| 57.
|
Thuerauf, D. J.,
N. D. Arnold,
D. Zechner,
D. S. Hanford,
K. M. DeMartin,
P. M. McDonough,
R. Prywes, and C. C. Glembotski.
1998.
p38 mitogen-activated protein kinase mediates the transcriptional induction of the atrial natriuretic factor gene through a serum response element: a potential role for the transcription factor ATF6.
J. Biol. Chem.
273:20636-20643[Abstract/Free Full Text].
|
| 58.
|
Treisman, R.
1995.
Journey to the surface of the cell: Fos regulation and the SRE.
EMBO J.
14:4905-4913[Medline].
|
| 59.
|
Wang, D. L.,
J. J. Chen,
N. L. Shin,
Y. C. Kao,
K. H. Hsu,
W. Y. Huang, and C. C. Liew.
1992.
Endothelin stimulates cardiac alpha- and beta- myosin heavy chain gene expression.
Biochem. Biophys. Res. Commun.
183:1260-1265[CrossRef][Medline].
|
| 60.
|
Yanagisawa, M.
1994.
The endothelin system: a new target for therapeutic intervention.
Circulation
89:1320-1322[Free Full Text].
|
| 61.
|
Yanagisawa, M.,
H. Kurihara,
S. Kimura,
Y. Tomobe,
M. Kobayashi,
Y. Mitsui,
Y. Yazaki,
K. Goto, and T. Masaki.
1988.
A novel potent vasoconstrictor peptide produced by vascular endothelial cells.
Nature
332:411-415[CrossRef][Medline].
|
| 62.
|
Zhao, M.,
L. New,
V. V. Kravchenko,
Y. Kato,
H. Gram,
F. di Padova,
E. N. Olson,
R. J. Ulevitch, and J. Han.
1999.
Regulation of the MEF2 family of transcription factors by p38.
Mol. Cell. Biol.
19:21-30[Abstract/Free Full Text].
|
| 63.
|
Zhu, C.,
F. E. Johansen, and R. Prywes.
1997.
Interaction of ATF6 and serum response factor.
Mol. Cell. Biol.
17:4957-4966[Abstract].
|
| 64.
|
Zolk, O.,
J. Quattek,
G. Sitzler,
T. Schrader,
G. Nickenig,
P. Schnabel,
K. Shimada,
M. Takahashi, and M. Bohm.
1999.
Expression of endothelin-1, endothelin-converting enzyme, and endothelin receptors in chronic heart failure.
Circulation
99:2118-2123[Abstract/Free Full Text].
|
Molecular and Cellular Biology, February 2001, p. 1036-1044, Vol. 21, No. 4
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.4.1036-1044.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhu, L., Harutyunyan, K. G., Peng, J. L., Wang, J., Schwartz, R. J., Belmont, J. W.
(2007). Identification of a novel role of ZIC3 in regulating cardiac development. Hum Mol Genet
16: 1649-1660
[Abstract]
[Full Text]
-
Gardner, D. G., Chen, S., Glenn, D. J., Grigsby, C. L.
(2007). Molecular Biology of the Natriuretic Peptide System: Implications for Physiology and Hypertension. Hypertension
49: 419-426
[Full Text]
-
Kim, M.-S., Merlo, X., Wilson, C., Lough, J.
(2006). Co-activation of Atrial Natriuretic Factor Promoter by Tip60 and Serum Response Factor. J. Biol. Chem.
281: 15082-15089
[Abstract]
[Full Text]
-
Xing, W., Zhang, T.-C., Cao, D., Wang, Z., Antos, C. L., Li, S., Wang, Y., Olson, E. N., Wang, D.-Z.
(2006). Myocardin Induces Cardiomyocyte Hypertrophy. Circ. Res.
98: 1089-1097
[Abstract]
[Full Text]
-
Wang, J., Paradis, P., Aries, A., Komati, H., Lefebvre, C., Wang, H., Nemer, M.
(2005). Convergence of Protein Kinase C and JAK-STAT Signaling on Transcription Factor GATA-4. Mol. Cell. Biol.
25: 9829-9844
[Abstract]
[Full Text]
-
Parlakian, A., Charvet, C., Escoubet, B., Mericskay, M., Molkentin, J. D., Gary-Bobo, G., De Windt, L. J., Ludosky, M.-A., Paulin, D., Daegelen, D., Tuil, D., Li, Z.
(2005). Temporally Controlled Onset of Dilated Cardiomyopathy Through Disruption of the SRF Gene in Adult Heart. Circulation
112: 2930-2939
[Abstract]
[Full Text]
-
Debrus, S., Rahbani, L., Marttila, M., Delorme, B., Paradis, P., Nemer, M.
(2005). The Zinc Finger-Only Protein Zfp260 Is a Novel Cardiac Regulator and a Nuclear Effector of {alpha}1-Adrenergic Signaling. Mol. Cell. Biol.
25: 8669-8682
[Abstract]
[Full Text]
-
Morin, S., Pozzulo, G., Robitaille, L., Cross, J., Nemer, M.
(2005). MEF2-dependent Recruitment of the HAND1 Transcription Factor Results in Synergistic Activation of Target Promoters. J. Biol. Chem.
280: 32272-32278
[Abstract]
[Full Text]
-
Houweling, A. C., van Borren, M. M., Moorman, A. F.M., Christoffels, V. M.
(2005). Expression and regulation of the atrial natriuretic factor encoding gene Nppa during development and disease. Cardiovasc Res
67: 583-593
[Abstract]
[Full Text]
-
Streb, J. W., Miano, J. M.
(2005). AKAP12{alpha}, an Atypical Serum Response Factor-dependent Target Gene. J. Biol. Chem.
280: 4125-4134
[Abstract]
[Full Text]
-
Yin, F., Herring, B. P.
(2005). GATA-6 Can Act as a Positive or Negative Regulator of Smooth Muscle-specific Gene Expression. J. Biol. Chem.
280: 4745-4752
[Abstract]
[Full Text]
-
Zhang, X., Azhar, G., Zhong, Y., Wei, J. Y.
(2004). Identification of a Novel Serum Response Factor Cofactor in Cardiac Gene Regulation. J. Biol. Chem.
279: 55626-55632
[Abstract]
[Full Text]
-
Oh, J., Wang, Z., Wang, D.-Z., Lien, C.-L., Xing, W., Olson, E. N.
(2004). Target Gene-Specific Modulation of Myocardin Activity by GATA Transcription Factors. Mol. Cell. Biol.
24: 8519-8528
[Abstract]
[Full Text]
-
Pikkarainen, S., Tokola, H., Kerkela, R., Ruskoaho, H.
(2004). GATA transcription factors in the developing and adult heart. Cardiovasc Res
63: 196-207
[Abstract]
[Full Text]
-
Parlakian, A., Tuil, D., Hamard, G., Tavernier, G., Hentzen, D., Concordet, J.-P., Paulin, D., Li, Z., Daegelen, D.
(2004). Targeted Inactivation of Serum Response Factor in the Developing Heart Results in Myocardial Defects and Embryonic Lethality. Mol. Cell. Biol.
24: 5281-5289
[Abstract]
[Full Text]
-
Minami, T., Murakami, T., Horiuchi, K., Miura, M., Noguchi, T., Miyazaki, J.-i., Hamakubo, T., Aird, W. C., Kodama, T.
(2004). Interaction between Hex and GATA Transcription Factors in Vascular Endothelial Cells Inhibits flk-1/KDR-mediated Vascular Endothelial Growth Factor Signaling. J. Biol. Chem.
279: 20626-20635
[Abstract]
[Full Text]
-
Aries, A., Paradis, P., Lefebvre, C., Schwartz, R. J., Nemer, M.
(2004). Essential role of GATA-4 in cell survival and drug-induced cardiotoxicity. Proc. Natl. Acad. Sci. USA
101: 6975-6980
[Abstract]
[Full Text]
-
Minami, T., Sugiyama, A., Wu, S.-Q., Abid, R., Kodama, T., Aird, W. C.
(2004). Thrombin and Phenotypic Modulation of the Endothelium. Arterioscler. Thromb. Vasc. Bio.
24: 41-53
[Abstract]
[Full Text]
-
Escalante, R., Moreno, N., Sastre, L.
(2003). Dictyostelium discoideum Developmentally Regulated Genes Whose Expression Is Dependent on MADS Box Transcription Factor SrfA. Eukaryot Cell
2: 1327-1335
[Abstract]
[Full Text]
-
Zhang, X., Azhar, G., Furr, M. C., Zhong, Y., Wei, J. Y.
(2003). Model of functional cardiac aging: young adult mice with mild overexpression of serum response factor. Am. J. Physiol. Regul. Integr. Comp. Physiol.
285: R552-R560
[Abstract]
[Full Text]
-
Pikkarainen, S., Tokola, H., Majalahti-Palviainen, T., Kerkela, R., Hautala, N., Bhalla, S. S., Charron, F., Nemer, M., Vuolteenaho, O., Ruskoaho, H.
(2003). GATA-4 Is a Nuclear Mediator of Mechanical Stretch-activated Hypertrophic Program. J. Biol. Chem.
278: 23807-23816
[Abstract]
[Full Text]
-
Minami, T., Abid, Md. R., Zhang, J., King, G., Kodama, T., Aird, W. C.
(2003). Thrombin Stimulation of Vascular Adhesion Molecule-1 in Endothelial Cells Is Mediated by Protein Kinase C (PKC)-delta -NF-kappa B and PKC-zeta -GATA Signaling Pathways. J. Biol. Chem.
278: 6976-6984
[Abstract]
[Full Text]
-
Pikkarainen, S., Tokola, H., Kerkela, R., Majalahti-Palviainen, T., Vuolteenaho, O., Ruskoaho, H.
(2003). Endothelin-1-specific Activation of B-type Natriuretic Peptide Gene via p38 Mitogen-activated Protein Kinase and Nuclear ETS Factors. J. Biol. Chem.
278: 3969-3975
[Abstract]
[Full Text]
-
Sepulveda, J. L., Vlahopoulos, S., Iyer, D., Belaguli, N., Schwartz, R. J.
(2002). Combinatorial Expression of GATA4, Nkx2-5, and Serum Response Factor Directs Early Cardiac Gene Activity. J. Biol. Chem.
277: 25775-25782
[Abstract]
[Full Text]
-
Dai, Y.-S., Cserjesi, P., Markham, B. E., Molkentin, J. D.
(2002). The Transcription Factors GATA4 and dHAND Physically Interact to Synergistically Activate Cardiac Gene Expression through a p300-dependent Mechanism. J. Biol. Chem.
277: 24390-24398
[Abstract]
[Full Text]
-
Arai, A., Spencer, J. A., Olson, E. N.
(2002). STARS, a Striated Muscle Activator of Rho Signaling and Serum Response Factor-dependent Transcription. J. Biol. Chem.
277: 24453-24459
[Abstract]
[Full Text]
-
Habets, P. E.M.H., Moorman, A. F.M., Clout, D. E.W., van Roon, M. A., Lingbeek, M., van Lohuizen, M., Campione, M., Christoffels, V. M.
(2002). Cooperative action of Tbx2 and Nkx2.5 inhibits ANF expression in the atrioventricular canal: implications for cardiac chamber formation. Genes Dev.
16: 1234-1246
[Abstract]
[Full Text]
-
Bruneau, B. G.
(2002). Transcriptional Regulation of Vertebrate Cardiac Morphogenesis. Circ. Res.
90: 509-519
[Abstract]
[Full Text]
-
Nishida, W., Nakamura, M., Mori, S., Takahashi, M., Ohkawa, Y., Tadokoro, S., Yoshida, K., Hiwada, K., Hayashi, K.'i., Sobue, K.
(2002). A Triad of Serum Response Factor and the GATA and NK Families Governs the Transcription of Smooth and Cardiac Muscle Genes. J. Biol. Chem.
277: 7308-7317
[Abstract]
[Full Text]
-
MOHUN, T., LATINKIC, B., TOWERS, N., KOTECHA, S.
(2002). Regulation of Cardiac Muscle Differentiation in Xenopus laevis Embryos. Cold Spring Harb Symp Quant Biol
67: 13-18
[Abstract]
-
SMALL, E.M., KRIEG, P.A.
(2002). Molecular Mechanisms of Chamber-specific Myocardial Gene Expression: Transgenic Analysis of the ANF Promoter. Cold Spring Harb Symp Quant Biol
67: 71-80
[Abstract]
-
Minami, T., Aird, W. C.
(2001). Thrombin Stimulation of the Vascular Cell Adhesion Molecule-1 Promoter in Endothelial Cells Is Mediated by Tandem Nuclear Factor-kappa B and GATA Motifs. J. Biol. Chem.
276: 47632-47641
[Abstract]
[Full Text]
-
Liang, Q., Wiese, R. J., Bueno, O. F., Dai, Y.-S., Markham, B. E., Molkentin, J. D.
(2001). The Transcription Factor GATA4 Is Activated by Extracellular Signal-Regulated Kinase 1- and 2-Mediated Phosphorylation of Serine 105 in Cardiomyocytes. Mol. Cell. Biol.
21: 7460-7469
[Abstract]
[Full Text]
-
Zhang, X., Chai, J., Azhar, G., Sheridan, P., Borras, A. M., Furr, M. C., Khrapko, K., Lawitts, J., Misra, R. P., Wei, J. Y.
(2001). Early Postnatal Cardiac Changes and Premature Death in Transgenic Mice Overexpressing a Mutant Form of Serum Response Factor. J. Biol. Chem.
276: 40033-40040
[Abstract]
[Full Text]
-
Charron, F., Tsimiklis, G., Arcand, M., Robitaille, L., Liang, Q., Molkentin, J. D., Meloche, S., Nemer, M.
(2001). Tissue-specific GATA factors are transcriptional effectors of the small GTPase RhoA. Genes Dev.
15: 2702-2719
[Abstract]
[Full Text]
-
Liang, Q., De Windt, L. J., Witt, S. A., Kimball, T. R., Markham, B. E., Molkentin, J. D.
(2001). The Transcription Factors GATA4 and GATA6 Regulate Cardiomyocyte Hypertrophy in Vitro and in Vivo. J. Biol. Chem.
276: 30245-30253
[Abstract]
[Full Text]