INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Two mammalian proteins with molecular masses of 78 and 94 kDa identified in the mid-1970s were named glucose-regulated proteins (GRP78 and GRP94, respectively) due to the marked increases in their levels on depletion of glucose from media for cell culture (24). Subsequent studies indicated that this phenomenon is part of the cellular response to the accumulation of unfolded proteins in the endoplasmic reticulum (ER) (8, 18). Not only glucose deprivation but also various physiological and environmental stress conditions (ER stress) cause unfolding or misfolding of proteins in the ER, where newly synthesized secretory and transmembrane proteins fold and assemble. As only correctly folded molecules are allowed to move along the secretory pathway, eukaryotic cells must deal with protein misfolding in the ER promptly and appropriately to avoid malfunction and/or mislocalization of proteins that are synthesized on membrane-bound ribosomes and translocated into the ER. A typical cellular strategy to cope with unfolded proteins in the ER is induction of molecular chaperones and folding enzymes localized in the lumen of the ER, such as BiP/GRP78 and GRP94, resulting in augmentation of the folding capacity of the ER. This homeostatic response is achieved by a transcriptional induction process coupled with signaling from the ER to the nucleus, now known as the unfolded protein response (UPR).

The transcriptional apparatus responsible for the mammalian UPR was poorly understood until the cis-acting ER stress response element (ERSE), necessary and sufficient for the induction, was identified as a sequence of 19 nucleotides, the consensus of which is CCAAT-N₉-CCACG (20, 26). Based on our recent results (5, 27) and the previous finding reported by Li et al. (13) that the CCAAT part of the ERSE is constitutively occupied at least in the GRP78 promoter, we proposed that the ER stress response factor (ERSF), a transcription factor responsible for the mammalian UPR, is a heterologous protein complex composed of a constitutive component that binds to CCAAT and an inducible component that binds to CCACG. The constitutive component of ERSF is almost unambiguously NF-Y (CBF), a general transcription factor involved in transcription of numerous genes (16), as essentially all cellular binding activity to the CCAAT sequence in ERSE present in nuclear extracts was supershifted by anti-NF-Y antiserum on electrophoretic mobility shift assays (EMSAs) (20, 27). We recently identified the basic leucine zipper (bZIP)-type transcription factor ATF6 as an inducible component of ERSF based on its DNA-binding specificity and tightly regulated mechanism of activation (5, 27).

It was previously reported (28) that mammalian cells express another bZIP protein closely related to ATF6, which is encoded by the cyclic AMP response element binding protein-related protein (CREB-RP) gene (17) (also called the G13 gene [9]). Our recent study revealed that this gene product also functions as an inducible component of ERSF, and we thus proposed calling the ATF6 gene product ATF6 and the CREB-RP (G13) gene product ATF6 (K. Haze, T. Okada, H. Yoshida, H. Yanagi, T. Yura, M. Negishi, and K. Mori, submitted for publication). Both ATF6 and ATF6 are constitutively synthesized as type II transmembrane glycoproteins embedded in the ER and subjected to proteolytic processing in response to ER stress, allowing translocation into the nucleus of N-terminal fragments liberated from the ER membrane. The N-terminal regions of ATF6 and ATF6 contain all the hallmarks required for an active transcription factor, i.e., DNA binding, dimerization, and activation domains, and bind to the CCACG part of ERSE when the CCAAT part is bound to NF-Y. Thus, the soluble forms of ATF6 and ATF6 produced in ER-stressed cells (designated p50ATF6 and p60ATF6, respectively) activate transcription of mammalian UPR target genes in collaboration with NF-Y.

The CCACG part of ERSE appears to be a half-site of an E box (CANNTG)-like palindromic sequence, to which transcription factors containing a basic region as a DNA-binding domain are known to bind (6, 15).

We therefore examined in this study whether ATF6 and ATF6 bind to ERSE as monomers or as dimers. Interestingly, CCAAT and CCACG parts are separated by a spacer of 9 bp in all ERSE-like sequences found in the promoter regions of various ER stress-inducible genes (26), and we showed that this spacing is critical for both ATF6-binding and transcription-inducing activities of ERSE (27). These results prompted us to examine whether ATF6 and ATF6 physically interact with NF-Y. We further investigated whether ER stress indeed induces formation of ERSF that contains both NF-Y and endogenous p50ATF6 or p60ATF6.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Cell culture and transfection. HeLa cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and antibiotics (100 U of penicillin and 100 µg of streptomycin per ml). Cells were maintained at 37°C in a humidified 5% CO₂-95% air atmosphere. Transfection was carried out by the standard calcium phosphate method (21) as described in our previous report (26).

Construction of plasmids. Recombinant DNA techniques were performed according to standard procedures (21). Expression plasmids were constructed on the basis of mammalian expression vectors pcDNA3.1(+) (Invitrogen, Carlsbad, Calif.), pBIND (Promega, Madison, Wis.), and pACT (Promega). Various subregions of ATF6 and ATF6 were amplified by PCR and inserted into appropriate restriction enzyme sites of appropriate vectors after their sequences had been confirmed. In the case of N-terminal deletion mutants, the consensus sequence for efficient initiation of translation (10) was introduced at the N terminus together with an initiation codon.

Two-hybrid assays in mammalian cells. pBIND-based bait plasmid and pACT-based prey plasmid were transfected into HeLa cells cultured in 96-well plates together with reporter plasmid pG5luc containing five Gal4p binding sites in a minimal promoter upstream of the firefly luciferase gene (Promega). pBIND carried the Renilla luciferase gene to normalize transfection efficiency. Luciferase activities were determined as described (27), and relative luciferase activity was defined as the ratio of firefly luciferase activity to Renilla luciferase activity.

Pull-down assays. Recombinant NF-Y trimer composed of T7-tagged NF-YA, T7-tagged NF-YB, and histidine-tagged NF-YC was prepared as described previously (1, 27). Various subregions of ATF6 and ATF6 cloned in pcDNA3.1(+) were translated in vitro using the TNT T7 quick coupled transcription-translation system (Promega) in the presence or absence of [³⁵S]methionine using EXPRE³⁵S³⁵S protein labeling mix (DuPont, Wilmington, Del.) according to the manufacturer's instructions.

EMSAs. Synthetic double-stranded oligonucleotides containing GRP78-ERSE1 and its flanking nucleotides (AGGGCCTTCACCAATCGGCGGCCTCCACGACGGGGCT; nucleotides matching the ERSE consensus are underlined) were radiolabeled using the Klenow fragment of DNA polymerase I and [-³²P]dCTP (222 TBq/mmol; DuPont) and purified by centrifugation through ProbeQuant G50 microcolumns (Amersham Pharmacia Biotech). ³²P-labeled oligonucleotide probes (0.1 pmol, ~9,000 cpm) were incubated with various mutant forms of ATF6(~800 fmol) or ATF6 (~400 fmol) translated in vitro in the presence of recombinant NF-Y trimer (10 fmol) in binding buffer E (20 mM HEPES [pH 7.9], 100 mM KCl, 10% glycerol, 1 mM MgCl₂, 1 mM 2-mercaptoethanol, 0.1% Tween 20, 20 ng of poly[dI-dC]:poly[dI-dC] per µl) at 4°C for 1 h. Electrophoresis was carried out essentially as described previously (27).

Immunoblotting analysis. Immunoblotting was carried out according to the standard procedure (21) as described previously (5) using an enhanced chemiluminescence Western blotting detection system kit (Amersham Pharmacia Biotech). Rabbit anti-NF-YA antibody and mouse anti-KDEL monoclonal antibody (clone 10C3) were obtained from Rockland (Gilbertsville, Pa.) and StressGen Biotechnologies (Victoria, British Columbia, Canada), respectively. Anti-ATF6 and anti-ATF6 antibodies were prepared as described previously (5, 27).

Pull-down assays for ERSF. Nuclear extracts were prepared as described previously (2) from HeLa cells untreated or treated with 300 nM thapsigargin for 4 h. Synthetic double-stranded oligonucleotides containing wild-type or mutant GRP78-ERSE1 (see Fig. 8A for their sequences) were biotinylated and immobilized on UltraLink resin (Pierce, Rockford, Ill.) by streptavidin-biotin interaction. ERSE-coupled resin was rotated with nuclear extracts in binding buffer B (20 mM HEPES [pH 7.9], 100 mM KCl, 10% glycerol, 1 mM MgCl₂, 1 mM 2-mercaptoethanol, 0.1% Tween 20, and 0.1% bovine serum albumin) at 4°C for 1 h, washed with binding buffer B six times, and then suspended in SDS sample buffer, followed by boiling for 5 min. After brief centrifugation, supernatants were subjected to SDS-12% PAGE and analyzed by immunoblotting using anti-ATF6 or anti-ATF6 antibodies.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

ATF6 and ATF6 bind to ERSE as a homo- or heterodimer. As both p50ATF6 and p60ATF6, soluble and active forms of ATF6 and ATF6, respectively, are bZIP-type transcription factors localized in the nucleus, we performed two-hybrid assays to determine whether ATF6 and ATF6 can dimerize through their leucine zippers. HeLa cells were transfected with pBIND-based bait plasmid and pACT-based prey plasmid together with reporter plasmid pG5luc, and then reporter luciferase activities constitutively expressed in transfected cells were determined. pBIND carried the DNA-binding domain of yeast transcriptional activator Gal4p (GAL4BD), whereas pACT carried the activation domain of VP16 (VP16AD). ATF6(1-373) and ATF6(1-392), representing p50ATF6 and p60ATF6, respectively, were fused to VP16AD to generate VP16AD-ATF6(1-373) and VP16AD-ATF6(1-392), respectively, whereas GAL4BD was fused to ATF6(171-373), which lacked the activation domain present in the N-terminal region (see schematic structures depicted in Fig. 1).

View larger version (35K): [in this window] [in a new window]   FIG. 1.   Schematic structures of full-length and mutant forms of ATF6(A) and ATF6 (B). Numbers indicate amino acid positions from the N terminus. The locations of the activation domain (AD), basic leucine zipper region (bZIP), and transmembrane domain (TMD) are marked.

View larger version (24K): [in this window] [in a new window]   FIG. 2.   Formation of homodimers of ATF6(A) or heterodimers between ATF6 and ATF6 (B) detected by two-hybrid assays. Mammalian expression plasmids pBIND and pACT carried the DNA-binding domain of yeast transcriptional activator Gal4p (GAL4BD) and the activation domain of VP16 (VP16AD), respectively. ATF6(171-373) was fused with GAL4BD in pBIND to generate GAL4BD-ATF6(171-373), which was used as bait, whereas ATF6(1-373), ATF6(1-291), ATF6(1-392), and ATF6(1-310) were fused with VP16AD in pACT and used as prey (see schematic structures depicted in Fig. 1). HeLa cells were transiently transfected with a combination of bait plasmid (100 ng) and prey plasmid (100 ng), as indicated, together with the reporter plasmid pG5luc (100 ng), containing five GAL4BD binding sites upstream of the firefly luciferase gene. Twenty-four hours after transfection, relative luciferase activity constitutively expressed in transfected cells was determined, and averages from four independent experiments are presented with standard deviations (bars).

View larger version (51K): [in this window] [in a new window]   FIG. 3.   Formation of homo- and heterodimers between ATF6 and ATF6 detected by EMSA. Various subregions of ATF6 and ATF6 were translated in vitro individually or together with other subregions, as indicated, and then incubated with 32P-labeled oligonucleotide probe GRP78-ERSE1 in the presence or absence of NF-Y trimer. DNA-protein complexes formed were analyzed by EMSA. The positions of complexes I and II are indicated. The arrow marks the positions of complex II composed of NF-Y and heterodimer of ATF6 and/or ATF6 bound to 32P-labeled GRP78-ERSE1.

ATF6 and ATF6 directly interact with NF-Y trimer through binding to NF-YC subunit. To gain insight into possible interactions of ATF6 and ATF6 with NF-Y, we performed two-hybrid assays, as shown in Fig. 4. As NF-Y is a heterotrimer composed of NF-YA, NF-YB, and NF-YC, each subunit was fused to GAL4BD to generate GAL4BD-NF-YA, GAL4BD-NF-YB, and GAL4BD-NF-YC, respectively. In addition, GAL4BD-NF-YA was expressed together with full-length NF-YB and NF-YC to allow heterotrimer formation in transfected cells. Subregions of ATF6 and ATF6 fused with VP16AD were used as prey.

View larger version (23K): [in this window] [in a new window]   FIG. 4.   Interaction between NF-Y and ATF6(A) or ATF6 (B) detected by two-hybrid assays. Full-length NF-YA was fused with GAL4BD in pBIND to express GAL4BD-NF-YA fusion protein, whereas unfused full-length NF-YB or NF-YC was expressed from a pcDNA3.1(+)-based plasmid. Various subregions of ATF6 and ATF6 were fused with VP16AD in pACT to express various VP16AD fusion proteins, as indicated. HeLa cells were transiently transfected with a combination of bait plasmid (total, 100 ng) and prey plasmid (100 ng) together with reporter plasmid pG5luc (100 ng). Relative luciferase activity was determined and is presented as in Fig. 2.

View larger version (39K): [in this window] [in a new window]   FIG. 5.   Interaction between NF-Y and ATF6 or ATF6 detected by pull-down assays. (A) Pull-down assays using immobilized NF-Y trimer. In vitro-translated and [35S]methionine-labeled luciferase, ATF6(1-373), or ATF6(1-392) was mixed with resin to which recombinant NF-Y trimer had been immobilized (lanes +) or control resin (lanes ). After washing, bound materials were eluted, subjected to SDS-12% PAGE, and visualized by exposure to X-ray film. Aliquots (10%) of input materials were run on the same gel for comparison (lanes input). (B) Pull-down assays using immobilized NF-Y subunit. In vitro-translated and [35S]methionine-labeled ATF6(1-373) or ATF6(1-392) was mixed with resin to which NF-Y trimer (lanes 12 and 18) or one of the three subunits of NF-Y (NF-YA, NF-YB, and NF-YC, lanes 13 to 15 and lanes 19 to 21) had been immobilized, or control resin (lanes 11 and 17). Bound materials and 10% aliquots of input materials were analyzed as in panel A.

bZIP regions of ATF6 and ATF6 are sufficient for interaction with NF-Y. As ATF6 and ATF6 bind to ERSE as dimers, we determined whether dimerization is required for interaction with NF-Y trimer. As shown in Fig. 6A and B, we found that deletion of the leucine zipper made ATF6 and ATF6 unable to interact with NF-Y trimer; neither ATF6(1-331) (lanes 4 to 6) nor ATF6(1-350) (lanes 13 to 15) could be retained in NF-Y trimer-immobilized resin. Consistent with these results, deletion of the leucine zipper from ATF6 and ATF6 abolished their association with NF-Y trimer as detected by two-hybrid assays (Fig. 4, lines 6 and 12, respectively). We then examined the effects of deleting the leucine zipper regions on the ERSE-binding activities of ATF6 and ATF6 using EMSA. As shown in Fig. 3, in vitro-translated ATF6(1-373) and ATF6(1-392) bound to ERSE only in the presence of NF-Y trimer, resulting in formation of complex II (Fig. 7A, lanes 2 and 7, respectively). In marked contrast, ATF6(1-331) and ATF6(1-350) containing the DNA-binding basic region but lacking the leucine zipper failed to form complex II even in the presence of NF-Y trimer (lanes 3 and 8, respectively). ATF6 and ATF6 lacking the leucine zipper were inactive in activating transcription of UPR target genes (Fig. 7B); overexpression of ATF6(1-373) and ATF6(1-392) led to a constitutively enhanced level of GRP78 protein (lanes 12 and 15, respectively), as reported previously (5, 27; Haze et al., submitted), but overexpression of ATF6(1-331) and ATF6(1-350) failed to do so (lanes 13 and 16, respectively). It should be noted that not only ATF6(1-373) and ATF6(1-392) but also ATF6(1-331) and ATF6(1-350) accumulated in the nuclei of transfected cells (Haze et al., submitted). Thus, leucine zipper region-mediated dimerization of ATF6 and ATF6 appeared not to be critical for nuclear localization but to be indispensable for their interaction with NF-Y, binding to ERSE, and transcriptional activator activity.

View larger version (50K): [in this window] [in a new window]   FIG. 6.   Identification of the regions in ATF6(A and C) and ATF6 (B and D) important for interaction with NF-Y. Interactions of NF-Y trimer with various subregions of ATF6 and ATF6 translated in vitro and labeled with [35S]methionine were determined by pull-down assays as described for Fig. 5A.

View larger version (36K): [in this window] [in a new window]   FIG. 7.   Effects of deleting leucine zipper regions on the activities of ATF6 and ATF6. (A) Effects on ERSE-binding activity. Various C-terminal deletion mutants of ATF6 and ATF6 translated in vitro were incubated with 32P-labeled oligonucleotide probe GRP78-ERSE1 in the presence of NF-Y trimer. Rabbit reticulocyte lysate that had been incubated with vector alone was used as a control. DNA-protein complexes formed were analyzed by EMSA. The positions of complexes I and II are indicated. (B) Effects on transcriptional activity. HeLa cells were transiently transfected with 10 µg of pcDNA3.1(+) alone (vector) or one of the pcDNA3.1(+)-based plasmids to express various C-terminal deletion mutants of ATF6 or ATF6, as indicated. Forty-eight hours after transfection, cells were lysed with phosphate-buffered saline containing 1% SDS and boiled for 5 min. Samples (6 µg of protein) were subjected to SDS-10% PAGE and analyzed by immunoblotting with anti-KDEL antibody, which recognizes GRP78.

ERSF including NF-Y trimer and ATF6 and/or ATF6 is formed in response to ER stress. Previously, we failed to demonstrate ER stress-induced formation of complex II (ERSF composed of NF-Y trimer and p50ATF6 or p60ATF6 bound to ERSE) by means of EMSA because of the low levels of p50ATF6 and p60ATF6 produced in ER-stressed cells (27). We therefore examined whether ERSF formation could be detected by pull-down assays. To ensure that the system used was reliable, we attempted to reconstitute complex II in vitro as shown in Fig. 8. Double-stranded oligonucleotides encoding GRP78-ERSE1 (referred to here as ERSE-CC) were immobilized on resin using biotin-avidin interaction. To confirm binding specificity, two critical regions of ERSE were mutated separately or simultaneously to generate ERSE-CM, ERSE-MC, and ERSE-MM (see Fig. 8A for their sequences), and mutant ERSEs were similarly immobilized on resin.

View larger version (41K): [in this window] [in a new window]   FIG. 8.   In vitro reconstitution of ERSF consisting of NF-Y and ATF6 or ATF6. (A) Nucleotide sequences of oligonucleotides immobilized on resin. A 37-bp sequence containing GRP78-ERSE1 and its flanking nucleotides is referred to as ERSE-CC. Two critical regions of ERSE (shaded) were mutated separately or simultaneously (indicated by lowercase letters) to generate ERSE-CM, ERSE-MC, and ERSE-MM. Each of the synthetic double-stranded oligonucleotides was immobilized on resin. Principles of assays to analyze formation of ERSF are shown schematically on the right. (B and C) Binding of ATF6(B) and ATF6 (C) in the presence of NF-Y to resin carrying ERSE-CC. Various subregions of ATF6 and ATF6 labeled with [35S]methionine during in vitro translation were mixed with recombinant NF-Y trimer and applied to resin to which one of the four oligonucleotides (ERSE-CC,-CM,-MC, or -MM) had been immobilized. After washing, bound materials were eluted and subjected to SDS-12% PAGE together with 10% aliquots of input material. Eluted NF-Y was detected by immunoblotting using anti-NF-YA antibody, whereas eluted ATF6 and ATF6 were visualized by exposure to X-ray film.

View larger version (39K): [in this window] [in a new window]   FIG. 9.   Formation of ERSF in nuclear extract of ER-stressed cells. (A) Effects of thapsigargin treatment on the processing of ATF6 and ATF6. HeLa cells were untreated (Tg) or treated with 300 nM thapsigargin for 4 h (+Tg). The cells were lysed directly in 50 µl of 1× Laemmli's SDS sample buffer and boiled for 5 min. Aliquots (5 µl) of the samples were subjected to SDS-PAGE and analyzed by immunoblotting with anti-ATF6 or anti-ATF6 antibody. Nuclear extracts were also prepared as described in Materials and Methods and analyzed similarly by immunoblotting. The positions of p90ATF6, p50ATF6, p110ATF6, and p60ATF6 are indicated by arrowheads. The positions of prestained SDS-PAGE molecular size standards (Bio-Rad, Hercules, Calif.) are also shown (in kilodaltons). (B) ER stress-induced formation of ERSF. Nuclear extract of HeLa cells prepared as in panel A was mixed with resin to which one of the four oligonucleotides (ERSE-CC,-CM,-MC, or -MM) had been immobilized, as indicated. After washing, bound materials were eluted and subjected to SDS-12% PAGE together with 10% aliquots of input materials. Eluted ATF6 and ATF6 were detected by immunoblotting using anti-ATF6 and anti-ATF6 antibodies, respectively.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Identification of the cis-acting ERSE responsible for the mammalian UPR as 19 nucleotides of CCAAT-N₉-CCACG not only provided the opportunity to search for transcription factors specific to the mammalian UPR but also delineated the nature of the expected binding protein(s) (20, 26). The expected proteins should bind to the CCACG part of ERSE, because the general transcription factor NF-Y binds to the CCAAT part. The characteristics of the expected proteins should explain why the binding site is always located 9 bp downstream of the NF-Y-binding site; altering the spacing from 9 bp to 8 or 10 bp inactivated ERSE regardless of whether the ERSE was present in the natural XBP-1 promoter (27) or transplanted upstream of the heterologous simian virus 40 promoter (26). Furthermore, the transcriptional activity of the expected proteins should be specifically regulated, because the UPR is activated only in response to the accumulation of unfolded proteins in the ER. The bZIP proteins ATF6 and ATF6 were promising candidate transcription factors because they bind to CCACG in ERSE in an NF-Y-dependent manner and their transcriptional activities are tightly regulated by ER stress-induced proteolysis (5, 27; Haze et al., submitted). In this study, we determined why the CCAAT and CCACG parts of ERSE must be separated by a spacer of 9 bp. Homo- or heterodimers of ATF6 and ATF6 physically interact with NF-Y trimer through direct association with the NF-YC-subunit, as depicted in Fig. 10. Thus, ATF6 and ATF6 recognize and bind to both NF-Y and ERSE simultaneously to activate transcription, and this bipartite interaction requires optimal spacing. Interestingly, the bZIP regions of ATF6 and ATF6 alone were sufficient for association with the NF-Y trimer (Fig. 6) and binding to ERSE (Fig. 3), consistent with our unpublished observation that ATF6(271-373) and ATF6 (294-392), both lacking the activation domain, exhibited strong dominant negative effects on the UPR.

View larger version (63K): [in this window] [in a new window]   FIG. 10.   Model for mammalian UPR. Under normal growth conditions, the general transcription factor NF-Y constitutively occupies the CCAAT part of ERSE. On the other hand, both ATF6 and ATF6 are sequestered from the CCACG part of ERSE due to their anchoring in the ER membrane. Upon accumulation of unfolded proteins in the ER, both ATF6 and ATF6 are cleaved, allowing entrance of the resulting N-terminal fragments into the nucleus, where homo- and/or heterodimers of ATF6 and ATF6 bind to both NF-YC and CCACG. ER stress-induced formation of the transcription factor complex ERSF composed of NF-Y and ATF6/ culminates in induced transcription of UPR target genes.

NF-Y is a trimer composed of three subunits, NF-YA, NF-YB, and NF-YC (16). Among these, NF-YB and NF-YC contain regions homologous to each other and similar to the histone fold motif. NF-YB and NF-YC form a stable heterodimer, and this heterodimerization allows association of the third subunit, NF-YA, resulting in the formation of a heterotrimer capable of binding to the CCAAT motif (16). NF-Y not only controls basal transcription of many genes by itself but also participates in inducible transcription by interacting with other specific transcription factors. One such example is interaction of NF-Y with regulatory factor X (RFX), involved in gamma interferon-induced transcription of the major histocompatibility complex (MHC) class II genes (14, 19). The promoters of the MHC class II genes contain the RFX binding site (X box) approximately 20 bp upstream of the NF-Y binding site (Y box), and both RFX and NF-Y can bind independently to their respective target sequences. Interestingly, the binding of RFX to the X box was enhanced severalfold when the Y box was bound to NF-Y, and the amounts of RFX-NF-Y-DNA complex, rather than those of RFX-DNA or NF-Y-DNA complex, correlated well with the promoter activity, suggesting that the RFX-NF-Y interaction is critical for transcriptional activation of the MHC class II genes. This cooperative binding and subsequent activation of the promoter required correct alignment between RFX and NF-Y because formation of the RFX-NF-Y-DNA complex as well as promoter activation were not affected by altering the spacing by one helical turn (insertion or deletion of 10 bp) but were abolished by changing the spacing by a half turn (insertion or deletion of 5 bp).

NF-Y is also involved in sterol-regulated transcription of several genes, such as those encoding farnesyl diphosphate synthase, 3-hydroxy-3-methylglutaryl coenzyme A synthase, and squalene synthase, by interacting with sterol regulatory element-binding protein (SREBP) (3, 4, 7, 22). In the promoter of the farnesyl diphosphate synthase gene, the SREBP binding site is located 20 bp downstream of the NF-Y binding site, and weak binding of SREBP to its target sequence was enhanced over 20-fold by simultaneous incubation with NF-Y (4). Insertion of 4 bp between the SREBP and NF-Y binding sites abolished the cooperative binding of SREBP and NF-Y as well as the activation of the promoter for the farnesyl diphosphate synthase gene in response to depletion of sterol (4). In the promoter of the 3-hydroxy-3-methylglutaryl coenzyme A synthase gene, the SREBP binding site is located 17 bp downstream of the NF-Y binding site, and insertion of 5 or 10 bp between the SREBP and NF-Y binding sites made the promoter insensitive to sterol depletion (3). Consistent with these observations, it was shown that spacing of 16 to 20 bp between the SREBP and NF-Y binding sites is optimal for sterol-regulated transcription (7). Thus, to our knowledge, nothing is as strict as the interaction between NF-Y and ATF6 or ATF6; insertion or deletion of 1 bp is sufficient to inactivate transcriptional activity of ERSE by abolishing binding of ATF6 or ATF6 to ERSE. These results indicated that the transcriptional activation by ATF6 or ATF6 definitely requires the presence of both a precise DNA sequence and NF-Y trimer at an optimal distance. Interestingly, SREBP was found to interact directly with NF-Y only when NF-Y is trimerized (3), whereas we showed that ATF6 and ATF6 associate with NF-Y trimer through direct binding to the NF-YC subunit. Because binding of ATF6 and ATF6 to the NF-YC subunit is much less efficient than that to the NF-Y trimer (Fig. 5), ATF6 and ATF6 translocated into the nucleus would form a functional complex with NF-Y trimer on the ERSE (see below) without being trapped by free NF-YC subunit nonproductively, as proposed for the case of SREBP-NF-Y interaction (3).

Wang et al. conducted binding-site selection experiments using the bZIP domain of ATF6 tagged with a polyhistidine that had been expressed and purified from bacterial cells (25). As a result, the consensus binding sequence, designated the ATF6 site, was deduced to be TGACGTGG/A, which contains a partially palindromic sequence (GACGTG), suggesting that ATF6 binds to the ATF6 site as a dimer. The ATF6 site conferred strong ER stress inducibility on the c-fos minimal promoter. A point mutation in the 3' half-site from G to T (TGACGTTG; the mutated nucleotide is underlined) blocked not only its binding activity to ATF6 but also its transcriptional response to ER stress. It is therefore possible that ATF6 activates transcription of its target genes via direct binding to the ATF6 site even in the absence of the NF-Y binding site nearby, as the authors proposed, although the ATF6 site has not yet been identified in natural promoters of ER stress-inducible genes. Interestingly, the CCACG part of ERSE is entirely complementary to the 3' half-site of the ATF6 site (TGACGTGG). We showed in this study that ATF6 and ATF6 bind to ERSE as dimers in the presence of NF-Y. Thus, the half-site of the palindromic sequence appears to be sufficient for recognition and binding when the ATF6 dimer is physically associated with NF-Y.

Li et al. recently analyzed the mechanism of activation of ATF6 by ER stress (11) using anti-ATF6 antibody raised by Zhu et al. (28). They found that the level of p90ATF6 decreased 2 h after thapsigargin treatment, consistent with our previous results (5), but they failed to detect p50ATF6, contrary to our results. This discrepancy could be due, at least in part, to the region of ATF6 used to immunize rabbits; the anti-ATF6 antibody produced by Zhu et al. was raised against ATF6(155-345), whereas our anti-ATF6 antibody was raised against ATF6(6-307). We also had difficulty in detecting p50ATF6 using their anti-ATF6 antibody (data not shown). Four hours after thapsigargin treatment, they observed the recovery of p90ATF6 together with the appearance of a new band migrating slightly faster than p90ATF6. Although the amounts of these doublet protein bands increased over time from 4 to 12 h after thapsigargin treatment, it is not yet clear whether this increase is required for the induction of GRP78 mRNA, a target of the mammalian UPR. Perhaps the most critical difference between their results and our results was that they recovered both p90ATF6 and the band migrating slightly faster than p90ATF6 in nuclear extracts of HeLa cells (11), whereas we recovered only the cleaved product, p50ATF6, in HeLa nuclear extracts, as shown in Fig. 9A. We have no explanation for this discrepancy because we could not find a difference significant enough between their methods (23) and our methods (2) for preparing nuclear extracts from HeLa cells to account for the discrepancy. Nevertheless, it is very difficult to see how a protein containing a transmembrane domain can be extracted as a soluble nuclear protein as they reported. Although they speculate that alternative splicing might be able to produce a soluble form of ATF6 without proteolysis by removing the short hydrophobic stretch acting as a transmembrane domain from p90ATF6, such specific changes at the mRNA level have not been observed in ER-stressed HeLa cells (26).

Li et al. also reported that ATF6 was coimmunoprecipitated with YY1, a ubiquitous transcription factor, but not with NF-Y from ATF6-overproducing COS cells (11). However, the physiological significance of their findings remains unclear, as they overexpressed full-length ATF6 containing the transmembrane domain that anchors ATF6 in the ER membrane, and they performed immunoprecipitation after solubilization of cell extracts with detergent (0.5% NP-40); ATF6 may have been dissociated from NF-Y under these conditions. Thus, the most important finding of this study was the ER stress-induced formation of a transcription factor complex ERSF in the nucleus including NF-Y and p50ATF6 and/or p60ATF6 that binds to ERSE and activates transcription of ER chaperone genes. Although the amounts of this complex were too low to be detected by EMSA, as we reported previously (27), the complex was detected in the nuclear extract of ER-stressed cells by pull-down assays in the present study (Fig. 9). These results, together with our previous observations (5, 27; Haze et al., submitted), unambiguously established that ER stress-induced activation of ATF6 and ATF6 through proteolytic processing plays a major role in the mammalian UPR. The next important issue to be resolved is the mechanism of regulated proteolysis that activates ATF6 and ATF6.