Previous Article | Next Article 
Molecular and Cellular Biology, February 2001, p. 1249-1259, Vol. 21, No. 4
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.4.1249-1259.2001
Gadd153 Sensitizes Cells to Endoplasmic Reticulum
Stress by Down-Regulating Bcl2 and Perturbing the Cellular Redox
State
Karen D.
McCullough,1
Jennifer L.
Martindale,1
Lars-Oliver
Klotz,1
Tak-Yee
Aw,2,
and
Nikki J.
Holbrook1,*
Cell Stress and Aging Section, Laboratory of
Biological Chemistry, National Institute on Aging, National Institutes
of Health, Baltimore, Maryland 21224-6825,1 and
Department of Molecular and Cellular Physiology, Louisiana
State University Health Sciences Center, Louisiana State University,
Shreveport, Louisiana 711302
Received 15 May 2000/Returned for modification 21 June
2000/Accepted 14 November 2000
 |
ABSTRACT |
gadd153, also known as chop, is a highly
stress-inducible gene that is robustly expressed following disruption
of homeostasis in the endoplasmic reticulum (ER) (so-called ER stress).
Although all reported types of ER stress induce expression of Gadd153, its role in the stress response has remained largely undefined. Several
studies have correlated Gadd153 expression with cell death, but a
mechanistic link between Gadd153 and apoptosis has never been
demonstrated. To address this issue we employed a cell model system in
which Gadd153 is constitutively overexpressed, as well as two cell
lines in which Gadd153 expression is conditional. In all cell lines,
overexpression of Gadd153 sensitized cells to ER stress. Investigation
of the mechanisms contributing to this effect revealed that elevated
Gadd153 expression results in the down-regulation of Bcl2 expression,
depletion of cellular glutathione, and exaggerated production of
reactive oxygen species. Restoration of Bcl2 expression in
Gadd153-overexpressing cells led to replenishment of glutathione and a
reduction in levels of reactive oxygen species, and it protected cells
from ER stress-induced cell death. We conclude that Gadd153 sensitizes
cells to ER stress through mechanisms that involve down-regulation of
Bcl2 and enhanced oxidant injury.
 |
INTRODUCTION |
Gadd153, also known as Chop, is a
leucine zipper transcription factor that is present at low levels under
normal conditions but is robustly expressed in response to stress
(5, 14, 40). gadd153 was originally identified
based on its induction following treatment of cells with growth
arresting and DNA damaging agents, though induced expression of the
gene has also been strongly tied to perturbation of homeostasis in the
endoplasmic reticulum (ER).
Proteins destined for transport to the cell membrane or to the cell
exterior are synthesized on the ER surface and are then translocated to
the ER lumen, where they are extensively modified by glycosylation and
the addition of disulfide bonds. It is in the lumen of the ER, which
provides a unique environment for protein folding, that proteins assume
their mature, tertiary conformation. Disruption of homeostasis in the
ER, which can occur, for example, as a result of nutrient deprivation
or alteration of the organelle's calcium-rich oxidizing environment,
can have devastating effects on the cell. Protein misfolding
compromises cell function because essential polypeptides never exit the
ER and are thus unable to perform their normal roles (reviewed in
references 4 and 22). Additionally, accumulation of
misfolded proteins in the ER triggers a unique signaling cascade
referred to as the unfolded protein response (UPR). In the mammalian
UPR a signal is transduced from the stressed ER to the nucleus, where
transcription of a number of genes, including gadd153 and
genes encoding ER resident proteins such as the glucose-regulated
proteins (grp genes), is activated (reviewed in references
21 and 32).
The Grp's function as chaperones that guide proteins through the
folding process, and their up-regulation in response to ER stress
increases the cell's capacity to cope with the accumulation of
immature, misfolded proteins in the ER. Indeed, if Grp78 induction is
prevented, cell survival diminishes greatly following treatment with
agents that stress the ER (24, 25). Following induction of
the UPR, the kinetics of Gadd153 induction parallel exactly those seen
for Grp78 (40). However, the effect of up-regulating Gadd153 in response to protein misfolding is much less intuitive than
the effect of up-regulating expression of ER chaperones, and few
studies have expressly addressed what function Gadd153 has in the ER
stress response.
Several groups have reported that induction of Gadd153 correlates with
the onset of apoptosis (12, 15). More recently it was
reported that cell killing in response to toxins that perturb the ER
was delayed in embryonic fibroblasts derived from mice lacking the
gadd153 gene (45). These studies suggest that
Gadd153 may be involved in the regulation of apoptosis, but to date no study has addressed the mechanistic relationship between expression of
Gadd153 and cell death. Despite this, the assumption is commonly made
in the literature that while UPR induction of Grp78 provides a survival
signal, induction of Gadd153 serves as a death signal. Clearly, there
is great need for more definitive evidence of the involvement of
Gadd153 in apoptosis.
In the present study we sought to define in greater detail what role,
if any, Gadd153 plays in the regulation of cell death. To accomplish
this task we employed one cell line that constitutively overexpresses
Gadd153 and several others that conditionally overexpress the protein.
We report that while Gadd153 expression alone does not trigger cell
death, it does sensitize cells to killing by agents that stress the ER.
Importantly, overexpression of Gadd153 does not sensitize cells
nonspecifically to all types of stress, since
-irradiation, which
induces cell death through a Gadd153-independent mechanism
(29), kills cells irrespective of their Gadd153 status. Furthermore, we demonstrate that elevated Gadd153 expression
down-regulates expression of the antiapoptotic protein Bcl2 and
drastically depletes cells of glutathione, the primary intracellular
scavenger of reactive oxygen species (ROS). Replenishment of Bcl2
returns cellular redox status to normal and protects cells from ER
stress-induced death. Thus, elevated Gadd153 expression is tied to
dramatic disruption of redox homeostasis, which readies cells for apoptosis.
 |
MATERIALS AND METHODS |
Cell culture, treatments, and generation of cell lines.
HeLa, Rat1, Rat-Myc, and gadd153
/
MEF
(45) cell lines were grown in Dulbecco's modified
essential medium (Life Technologies, Gaithersburg, Md.), supplemented
with 10% fetal bovine serum (Hyclone, Logan, Utah), 100 U of
penicillin per ml and 100 µg of streptomycin (Life Technologies) per
ml, and were maintained in a humidified atmosphere containing 5%
CO2. Rat1-Myc-Gadd153 (A94) cells were maintained as
described above in medium containing 300 µg of hygromycin B (Sigma,
St. Louis, Mo.) per ml (6).
Tunicamycin and thapsigargin were purchased from Sigma. Cells were
-irradiated using a Gammacell 40 Exactor low-dose irradiator (Nordion International Inc., Ontario, Canada) with a 137Cs
source at a specific dose rate of 1.22 Gy/min.
For the stable introduction of
bcl2 into A94 cells,
pSFFV-bcl2 (
44) was cotransfected along with
the puromycin-resistance
pPur plasmid (Clontech
Laboratories, Inc., Palo Alto, Calif.)
into A94 cells by standard
calcium phosphate transfection methods.
Stable transformants were
selected in 1 µg of puromycin per ml.
Single colonies were expanded
and screened by Western blot analysis
for expression of Bcl2 and
Gadd153. To generate clones that conditionally
express Gadd153, the
LacSwitch-inducible expression system (Stratagene,
La Jolla, Calif.)
was used. Both Rat1 and
gadd153
/
cells were
transfected with the
LacI repressor expression plasmid
P3'SS and the
pOPRSVI-CHOPFlag plasmid generated
by Matsumoto
et al. (
30).
gadd153
/
cells were also transfected with
P3'SS and
CMVneo to generate
the
gadd153
/
Neo cell line. Transfected cells
were placed under selection
with 600 µg of geneticin (Life
Technologies) and 300 µg of hygromycin
B (Rat1, Gadd153i) per ml or
300 µg of geneticin and 100 µg of
hygromycin B
(
gadd153
/
Gadd153i and
gadd153
/
Neo) per ml. Single colonies were
expanded and screened by Western
blot analysis for inducible expression
of Flag-tagged Gadd153
in the presence of 5 mM
isopropyl-

-
D-thiogalactopyranoside (IPTG)
for 8 to
24
h.
Survival assay.
Cell survival was determined using a
standard clonogenic assay. Cells were initially plated in six-well
cluster plates at a density of 30,000 cells/well. Following treatment,
cells were trypsinized and serially diluted. Four dilutions were
prepared from each treatment and ranged from 1:10 to 1:1,000,000.
Colonies were allowed to grow for 10 to 14 days and were then stained
with crystal violet (0.1% [wt/vol] crystal violet in 10% ethanol)
and counted. Colony-forming efficiency was calculated based on the number of colonies that grew and the number of cells plated into each
well and was expressed relative to control (untreated) cells.
Flow cytometric analysis of cell death and ROS production.
Flow cytometry was performed on a FACScan flow cytometer equipped with
an argon laser at 488 nm excitation (Becton Dickinson, San Jose,
Calif.). To assay for apoptotic cells on the basis of sub-G1 content, cells were trypsinized after treatments and
fixed in 70% ethanol. Following incubation with RNase (0.1%;
Boehringer Mannheim/Roche Diagnostic Corporation, Indianapolis, Ind.),
cells were stained with propidium iodide (PI; 50 µg/ml; Roche
Diagnostic Corporation), and fluorescence signals from the stained
cells were collected in the FL-2 detector using a 585/42 band-pass
filter. A total of 100,000 events were collected. Cell cycle profiles were analyzed using MultiCycle software (Phoenix Flow Systems, San
Diego, Calif.), and the sub-G1 peak was quantified to
estimate apoptosis in the population. To examine the production of ROS, cells were harvested in phosphate-buffered saline and incubated in the
presence of 20 µM 2'7'-dichlorodihydrofluorescein (H2DCF) diacetate (Molecular Probes, Eugene, Oreg.) in the dark at 37°C for
30 min. The shift in green fluorescence as measured in the FL-1
detector with a 530/30 band-pass filter is associated with ROS
production and was determined from histogram data using CellQuest software (Becton Dickinson). A total of 20,000 events was collected for
each histogram.
Western blot analysis.
Total cell lysates were prepared and
40 to 70 µg of protein was size fractionated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and then transferred to
polyvinylidene difluoride membranes by standard techniques. Blots were
probed with the following antibodies: monoclonal anti-Bcl2
(Transduction Laboratories, San Diego, Calif.), polyclonal anti-Gadd153
and anti-Grp78 (Santa Cruz Biotechnology Inc., Santa Cruz, Calif.),
horseradish peroxidase-conjugated goat anti-mouse antibody (Amersham,
Arlington Heights, Ill.), and horseradish peroxidase-conjugated goat
anti-rabbit antibody (Amersham). Bands were detected with the enhanced
chemiluminescence (ECL) system (Amersham).
CAT and
-galactosidase assays.
Subconfluent cells growing
in 100-mm tissue culture dishes were transiently transfected using
Superfect transfection reagent (Qiagen, Valencia, Calif.) according to
the manufacturer's specifications. Rat1, Rat-Myc, and A94 cells were
transfected with 30 µg of plasmid containing the bcl2
promoter P1 linked to the chloramphenicol acetyltransferase
(cat) reporter gene, or a control vector that contained the
cat gene but lacked the bcl2 promoter, along with 3 µg of a
-galactosidase expression plasmid. The same transfection method was used to introduce bcl2 promoter-reporter
constructs and
-galactosidase expression plasmids into HeLa cells,
along with 0.1 to 1.0 µg of either a CMV-gadd153 expression plasmid (14) or an empty vector control (CMVneo). Cells
were harvested in a buffer containing 100 mM potassium phosphate
buffer, and CAT assays were performed as previously described using
14C-labeled chloramphenicol (20). Percentages
of chloramphenicol acetylation were obtained over the linear range of
the assay (3 to 70% conversion) and were quantified using a
PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.). Conversion
values were normalized to
-galactosidase activity, which was
measured using the Galactolight Plus kit (Tropix, Bedford, Mass.).
Site-directed mutagenesis.
The QuikChange site-directed
mutagenesis kit (Stratagene) was used to mutate the CMV-gadd153
expression vector. The primer used to mutate two of the leucine
residues in the leucine zipper region of gadd153
(L134A/L141A) was
5'-AGTGGCACAGGCAGCTGAAGAGAATGAACGGGCCAAG CAGGAAATC (the mutated nucleotides are underlined). The
oligonucleotide used to mutate two serine residues within the
activation domain of GADD153 (S79A/S82A) was
5'-AGCACCTCCCAGGCCCCTCACGCTCCAGATTCCAGT. The PCR conditions used were those recommended by the
manufacturer: 95°C for 30 s followed by 17 cycles of 95°C for
30 s, 55°C for 1 min, and 68°C for 10 min. The resulting
clones were sequenced to verify the mutations.
RT-PCR and Northern blot analysis.
To analyze RNA expression
by reverse transcription-PCR (RT-PCR), 1 µg of total RNA from each
sample was treated with DNase I and then 10% of this treated sample
was used for RT-PCR with SuperScript One-Step RT-PCR with Platinum Taq
System (Life Technologies). The primers for the gene-specific RT-PCR
analysis were as follows: bcl2 primer 1, CTGGCATCTTCTCCTTCCAGC; bcl2 primer 2, ACCTA-CCCAGCCTCCGTTATC; gapdh primer 1, ACATCAAGAAGGTGGTGAAGCAGG; and gapdh primer 2, CTCTTGCTCTCAGATCCTTGCTGG. The conditions for the RT-PCR were
1 cycle of 50°C for 30 min, 94°C for 2 min, and then 35 cycles
(bcl2) or 25 cycles (gapdh) of 94°C for 30 s, 55°C for 1 min, and 70°C for 1 min. Equal aliquots of the PCR
products were electrophoresed through a 2% agarose gel in 1× TAE buffer.
To analyze RNA expression by Northern blot analysis, total RNA was
harvested using STAT-60 (Tel-Test B, Friendswood, Tex.)
according to
the manufacturer's recommendations. Ten micrograms
of total RNA was
run on an agarose-formaldehyde gel and transferred
to a GeneScreen Plus
membrane (NEN Life Science Products). The
grp78 cDNA, a
generous gift from Amy S. Lee, was labeled by the
random primer method
and used as a probe. A 24-base oligonucleotide
(3'-ACGGTATCTGATCGTCTTCGAACC-5') complementary to 18S rRNA
was
also used as a probe to verify RNA integrity and loading
differences.
Quantification of GSH and GSSG.
Cell glutathione (GSH) and
the oxidized form of GSH (GSSG) were determined either using
high-performance liquid chromatography (HPLC) or colorimetric assays.
For HPLC determinations the method of Reed et al. (33) was
employed. Briefly, cells were treated with ice-cold 5% trichloroacetic
acid (TCA) followed by centrifugation to remove TCA-insoluble proteins.
The acid supernatant was derivatized with 6 mM iodoacetic acid and 1%
2, 4-dinitrofluorobenzene to yield the S-carboxymethyl and 2, 4-dinitrophenyl derivatives of GSH and GSSG. Separation of GSH and GSSG
derivatives was achieved on a 15- by 4.6-mm 10-µm C18
reversed-phase ion-exchange column. Colorimetric assessments of GSH and
GSSG were done according to the method described by Anderson
(2) with minor modifications due to adaptations of the
assay to microtiterplate dimensions.
 |
RESULTS |
Enforced expression of Gadd153 sensitizes cells to ER stress.
To better define Gadd153 function in the stress response, we
investigated the responsiveness of A94 cells, which constitutively overexpress Gadd153, to several ER stress-inducing agents. A94 cells
were derived from Rat1-Myc fibroblasts. A Rat1 cell line in which
Gadd153 is constitutively overexpressed could not be established,
presumably due to the growth-arresting properties of Gadd153. However,
constitutive expression of the gene was achieved in Rat1-Myc cells,
which overexpress c-Myc. A more detailed description of these cell
lines can be found elsewhere (6). To examine the influence
of Gadd153 on survival of cells exposed to ER stress, clonogenic assays
were carried out with Rat1, Rat1-Myc, and A94 cells following their
treatment with tunicamycin and thapsigargin, two classic ER stress
agents. As seen in Fig. 1, constitutive expression of Gadd153 greatly reduced long-term survival following ER
stress. Interestingly, c-Myc expression alone increased the sensitivity
of Rat1 cells to thapsigargin and tunicamycin by two- and fivefold,
respectively. However, with both agents overexpression of Gadd153 led
to a further 10-fold reduction in survival compared to Rat1-Myc cells.
To determine the specificity of these findings, we compared survival of
Rat1, Rat1-Myc, and A94 cells following exposure to
-irradiation,
one of the few DNA-damaging treatments that does not induce Gadd153
expression (29). Importantly, elevated Gadd153 expression
did not significantly alter the sensitivity of cells to
-irradiation
(Fig. 1). To confirm our findings that Gadd153-overexpressing cells
have a heightened sensitivity to ER stress agents and to further
investigate the mechanism involved, we examined cytotoxicity in a
short-term assay using flow cytometric analysis for the detection of
apoptotic cells. As shown in Fig. 2 for
thapsigargin, apoptosis as measured by the appearance of a
sub-G1 peak using flow cytometry was negligible in Rat1 and Rat1-Myc cells following 24-h treatment but was significantly elevated
in A94 cells. Interestingly, despite the fact that clonogenic survival
following
-irradiation did not differ between the Rat1 and Rat1-Myc
cells, flow cytometric analysis revealed a significant increase in
apoptosis in Rat1-Myc cells compared to that in Rat1 cells. This is
consistent with previous findings by others (6). Gadd153
expression, however, did not enhance but actually reduced the level of
-irradiation-induced apoptosis.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Constitutive expression of Gadd153 sensitizes cells to
ER stress as demonstrated in colony formation assays. Rat1, Rat-Myc,
and A94 (Rat1-Myc-Gadd153) cell lines were treated with the indicated
doses of thapsigargin or tunicamycin for 24 h or were exposed to
ionizing radiation and allowed to recover for 24 h. Following
treatments, cells were split into 100-mm tissue culture plates and
colonies were counted 8 to 12 days later. Data are reported as percent
survival relative to control (untreated) cells and are an average of at
least three independent experiments. Error bars represent standard
errors of the means.
|
|

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Constitutive expression of Gadd153 sensitizes cells to
ER stress-induced apoptosis. Cell lines were treated with thapsigargin
(1 µM, 24 h) or -irradiation (5.0 rad, 48 h recovery).
Following staining with PI, DNA content was measured using flow
cytometry. (A) Histograms from a representative experiment. Arrows
denote the appearance of a sub-G1 peak, which is indicative
of apoptosis. (B) The sub-G1 content of each cell
population was quantified. Data shown are the means ± standard
errors of at least three independent experiments.
|
|
A complication of the A94 model system is that Gadd153 is overexpressed
against a background of elevated c-Myc, and we clearly
see an effect of
c-Myc expression on survival following treatment
with agents that
perturb the ER (Fig.
1). We have confirmed this
observation in another
rat fibroblast cell line, Rat1a (
19).
While Rat1a cells
were found to be relatively resistant to tunicamycin
and thapsigargin,
Rat1a-Myc, which constitutively overexpresses
c-Myc, showed much more
sensitivity to these agents (data not
shown). These data are intriguing
and demonstrate for the first
time that expression of c-Myc sensitizes
cells to ER stress. Further
experiments are being carried out to
address the involvement of
c-Myc in ER stress signaling pathways.
However, for the purpose
of defining the role of Gadd153 in the ER
stress response, it
was essential that we examine the effects of
Gadd153 independent
of c-Myc overexpression to determine if Gadd153
expression alone
sensitizes cells to ER stress. We therefore developed
two cell
lines in which overexpression of Gadd153 is conditional. A
Gadd153
expression vector, where the
gadd153 gene is under
the control
of the Lac repressor, was introduced into Rat1 fibroblasts
and
MEFs derived from mice in which both
gadd153/
chop gene alleles
have been disrupted
(
45). The cell lines with inducible Gadd153
are referred
to as Rat1-Gadd153i and
gadd153
/
Gadd153i.
That inclusion of IPTG in the culture medium results
in accumulation of
Gadd153 in both cell lines is demonstrated
in Fig.
3A. Induction of Gadd153 alone did not
induce cell death
in either the MEF or Rat1 cell lines, even after 96 h
or more
of Gadd153 expression. However, cells pretreated for 8 to
16 h
with IPTG were sensitized to killing by the ER stress agents
thapsigargin
and tunicamycin, as measured by flow cytometry (Fig.
3B
and C).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 3.
Inducible expression of Gadd153 sensitizes cells to ER
stress-induced death. (A) gadd153, under control of an
IPTG-inducible promoter, was introduced into Rat1 fibroblasts and MEFs
derived from gadd153/chop / mice.
Accumulation of Gadd153 is evident in Western blots following
introduction of 5 mM IPTG to the culture medium. (B and C)
Rat1-Gadd153i (B) and gadd153 / Gadd153i (C)
cells were treated with thapsigargin (1 µM, 24 h) or tunicamycin (1 µg/ml, 24 h) in the presence or absence of 5 mM IPTG, and
apoptosis was quantified using flow cytometry. Data are averages of at
least three independent experiments. Error bars represent standard
errors of the means.
|
|
Down-regulation of Bcl2 contributes to Gadd153-mediated
sensitization of cells to ER stress.
We next sought to determine
how Gadd153 sensitizes cells to ER stress, and we first compared Bcl2
expression in parental and Gadd153-overexpressing cell lines. As shown
in Fig. 4A, c-Myc expression did not
alter Bcl2 expression relative to the parental Rat1 cells. However, in
the Gadd153-expressing A94 cells, the level of Bcl2 protein was
dramatically reduced, as was the bcl2 RNA level as
determined by RT-PCR. Grp78 levels were also assessed and found to be
equivalent in the Rat1, Rat1-Myc, and A94 cell lines (Fig. 4A),
indicating that ER stress was not basally elevated as a consequence of
Gadd153 overexpression. When challenged with a stressful treatment, all
three cell lines showed Grp78 expression induced to similar levels
(data not shown). Similar results were obtained with
gadd153
/
Gadd153i cells; concomitant with
IPTG induction of Gadd153, Bcl2 protein levels declined (Fig. 4B).
Treatment with IPTG did not, however, result in increased ER stress,
since Grp78 levels remained constant (Fig. 4B). This was further
demonstrated with gadd153
/
Neo cells, which
lack Gadd153 completely. Treatment of
gadd153
/
Neo cells with IPTG had no effect
on the expression of Grp78 or Bcl2, indicating that the down-regulation
of bcl2 observed in gadd153
/
Gadd153i cells was the result of induced Gadd153 expression and not a
nonspecific effect of IPTG on the cells. Down-regulation of
bcl2 mRNA expression by Gadd153 was also demonstrated using RT-PCR (Fig. 4C). Inclusion of IPTG in the culture medium of
gadd153
/
Gadd153i cells resulted in
down-regulation of bcl2 mRNA but had no effect on expression
of bcl2 in gadd153
/
Neo cells.
Furthermore, these gadd153
/
cell lines had
similar levels of basal and thapsigargin-induced grp78 RNA
expression, regardless of the presence of IPTG or IPTG-induced Gadd153
expression (Fig. 4D).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 4.
Gadd153 down-regulates Bcl2. (A) Western blot
demonstrating that Bcl2 protein levels are diminished in cells
constitutively overexpressing Gadd153, while Grp78 expression is
unaffected by constitutively elevated Gadd153 levels. The RT-PCR shows
that the bcl2 mRNA level is also decreased basally in A94
cells. The gapdh RT-PCR was performed as a control for RNA
integrity and loading. (B) Western blot demonstrating down-regulation
of Bcl2 in gadd153 / Gadd153i cells but not
in gadd153 / Neo cells. Concomitant with
induction of Gadd153 expression by inclusion of 5 mM IPTG in the
culture medium, Bcl2 expression decreases, while expression of Grp78
remains constant. In contrast, IPTG had no effect on Bcl2 protein
levels in the vector control cells. There was no Gadd153 expression in
the gadd153 / Neo cells, so no blot is shown
for this protein. (C) RT-PCR demonstrating that inclusion of IPTG in
the culture medium of gadd153 / Neo cells has
no effect on bcl2 mRNA levels. In contrast, IPTG-mediated
induction of Gadd153 in gadd153 / , Gadd153i
cells results in diminished abundance of bcl2 mRNA. (D)
Northern blot analysis showing that 5 mM IPTG pretreatment for 18 h, which induces Gadd153 expression in
gadd153 / Gadd153i cells, does not influence
the induction of grp78 RNA levels in response to ER stress
incurred by 1 µM thapsigargin (TG) for 6 h.
|
|
To determine how Gadd153 acts to down-regulate Bcl2, we examined the
effects of Gadd153 expression on
bcl2 promoter activity
using a CAT reporter system. A construct containing the P1 promoter
region of
bcl2 linked to the
cat coding region
(
44) was transfected
into Rat1, Rat1-Myc, and A94 cells.
bcl2 promoter activity was
similar in Rat1 and Rat1-Myc
cells. However, the activity of the
bcl2 promoter was
significantly repressed in Gadd153-overexpressing
A94 cells (Fig.
5A). To verify that the decreased
bcl2 promoter
expression indeed was related to Gadd153
expression, we performed
transient-transfection experiments in which
HeLa cells were cotransfected
with the
bcl2-
cat
reporter plasmid along with increasing concentrations
of a
gadd153 expression vector. As shown in Fig.
5B, Gadd153
expression
inhibited
bcl2 promoter activity in a
dose-dependent manner. Similar
cotransfection experiments performed
with the
bcl2 promoter-reporter
construct and an empty
vector control (
CMVneo) demonstrated no
effect of the
control vector on the
bcl2 promoter (data not shown).
These
data suggest that Gadd153 down-regulates Bcl2 expression
by inhibiting
bcl2 transcription. We next tested repression of
the
bcl2 promoter by several Gadd153 mutants. When mutations
were
made in the leucine zipper region of the protein (L134A/L141A),
Gadd153 was no longer able to repress the
bcl2 promoter
(Fig.
5C). In contrast, Gadd153 harboring two mutations in the
protein's
transactivation domain (S79A/S82A) repressed the
bcl2 promoter
as well as wild-type Gadd153 did (Fig.
5C).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 5.
(A) Plasmid constructs containing the bcl2
promoter region P1 linked to the cat reporter gene were
transfected into Rat1, Rat1-Myc, and A94 cell lines. Acetylation of
14C-chloramphenicol, which reflects activity of the
bcl2 promoter, was quantified. Data are expressed as fold
induction of the promoter activity relative to that of the vector
control, which harbored the cat gene but lacked the
bcl2 promoter. (B) bcl2-cat promoter-reporter
plasmids were introduced into HeLa cells along with increasing
concentrations of a gadd153 expression vector, and
bcl2 promoter activity was determined. Data are reported as
fold induction relative to the activity of the bcl2 promoter
in HeLa cells transfected with a vector lacking the gadd153
gene (CMVneo). (C) bcl2-cat promoter-reporter
plasmids were introduced in HeLa cells along with 1 µg of expression
vector for CMVneo, wild-type Gadd153, Gadd153 harboring
mutations in the leucine zipper domain (L134A/L141A), or Gadd153
harboring mutations in the transactivation domain (S79A/S82A).
bcl2 promoter activity was determined 48 h later. Data
are expressed relative to the activity of the bcl2
promoter-transfected empty CMVneo vector. All data are
averages of at least three independent experiments and bars represent
standard errors of the means.
|
|
To determine whether down-regulation of Bcl2 contributes to
sensitization to ER stress in Gadd153-overexpressing cells, expression
of Bcl2 in A94 cells was restored by stable introduction of a
bcl2 expression plasmid, and the sensitivity of the
resulting
cell line, A94B1, to ER stress-induced apoptosis was examined
using flow cytometry. Cell death was negligible in A94B1 cells
treated
with thapsigargin and tunicamycin (Fig.
6), clearly demonstrating
a protective
effect of Bcl2 in Gadd153-overexpressing cells.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 6.
Restoration of Bcl2 expression in A94 cells protects
against ER stress-induced death. A94 cells transfected with
bcl2 expression constructs show greatly enhanced Bcl2 levels
(Western blot, insert). Following treatment with either thapsigargin (1 µM, 24 h) or tunicamycin (1 µg/ml, 24 h), cells were
harvested, stained with PI, and analyzed using flow cytometry. The
sub-G1 content of each cell population was quantified. Data
are averages of at least three independent experiments and error bars
represent standard errors of the means.
|
|
Intracellular GSH content is decreased in cells expressing
Gadd153.
Reduced Bcl2 expression has been linked to lowered levels
of cellular GSH, the tripeptide thiol that is an essential component of
cellular defenses against oxidative stress and reactive electrophiles. In addition, we have previously implicated Gadd153 in the cellular response to oxidative stress (19). We therefore reasoned
that Gadd153 might perturb cellular redox states through a
Bcl2-dependent mechanism. Using HPLC and colorimetric assays, GSH and
GSSG levels were quantified in the Gadd153-overexpressing cell line,
A94. Compared to GSH levels in Rat1 and Rat1-Myc, GSH levels were
dramatically reduced in A94 cells, while GSSG levels remained unchanged
(Fig. 7A). The ratio of GSH to GSSG,
which gives an indication of the overall redox status of the cell, was
five- and eightfold less in A94 cells relative to that in the Rat1 and
Rat1-Myc lines, respectively (Fig. 7B). These data indicate that A94
cells are unable to maintain the normal reducing environment found in
Rat1 and Rat1-Myc cells. Furthermore, restoration of Bcl2 expression in
A94 cells, which protects against ER stress-induced death (Fig. 5),
returned GSH levels in the Gadd153-overexpressing cells to normal (Fig.
7A) and increased the GSH/GSSG ratio above that seen in parental cells
(Fig. 7B). Differences between GSH/GSSG ratios in A94B1 cells and Rat1
parental cells probably reflect the abundance of Bcl2 in A94B1 cells,
which exceeds the endogenous levels observed in either the Rat1 or
Rat1-Myc lines.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7.
GSH is depleted from Gadd153-overexpressing cells in a
Bcl2-dependent manner. (A) HPLC was used to measure cellular GSH and
GSSG levels. (B) The ratio of GSH to GSSG, which gives an estimate of
the overall redox state of the cell, is reported. All data are reported
as averages of three or more independent experiments and bars represent
standard errors of the means.
|
|
The observations described above suggest that Gadd153-overexpressing
cells have a greater oxidant burden than those that do
not express
Gadd153 constitutively. To determine more directly
if this is so,
production of reactive oxygen species (ROS) was
measured in Rat1,
Rat1-Myc, and A94 cells. Cells were loaded with
the cell-permeable
fluorescent dye, H
2DCF diacetate. Upon entry
into cells,
the dye is oxidized by ROS generating a fluorescent
product.
Fluorescence, measured by flow cytometry, gives an estimate
of
intracellular ROS production. Using this approach we found
that oxidant
production was low in untreated Rat1 and Rat1-Myc
cells. In sharp
contrast, ROS production was significantly elevated
in untreated A94
cells (Fig.
8), consistent with the
reduced GSH
levels in the Gadd153-overexpressing cells. Furthermore,
ROS production
in A94B1 cells was low and comparable to that observed
in Rat1
and Rat1-Myc cells. ROS production increased somewhat in Rat1
and Rat1-Myc cells following thapsigargin and tunicamycin treatment
but
was greatest in A94 cells treated with thapsigargin and tunicamycin
(Fig.
8). Consistent with their elevated GSH levels, oxidant production
following ER stress was not observed in A94B1 cells, which overexpress
Bcl2 and are resistant to ER stress (Fig.
8).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 8.
Gadd153 increases cellular ROS production. Control
(untreated) cells and cells treated with thapsigargin (1 µM, 24 h) or tunicamycin (1 µg/ml, 24 h) were incubated with
H2DCF diacetate, which freely crosses cell membranes and is
cleaved intracellularly to form the less membrane-permeative
H2DCF. In the presence of ROS this dye is oxidized,
producing a fluorescent product, DCF. Flow cytometry was used to
analyze fluorescence in each cell population. ROS production, indicated
as a rightward shift in peak fluorescence, was maximal in A94 cells,
regardless of treatment. This experiment was repeated three times, and
representative histograms are shown.
|
|
The finding that Gadd153 expression contributes to oxidant production
was confirmed in
gadd153
/
MEFs that
conditionally express Gadd153. As measured by flow
cytometry, ROS
production increased substantially in
gadd153
/
Gadd153i cells when Gadd153
expression was induced with IPTG
(Fig.
9A). Furthermore, while thapsigargin and
tunicamycin both
induced ROS production in
gadd153
/
Gadd153i cells, the oxidant burden
was exaggerated in
gadd153
/
Gadd153i cells
in which Gadd153 expression was restored (Fig.
9B and C). In contrast,
although inclusion of IPTG in the culture
medium of
gadd153
/
Neo cells did cause some increase
in ROS (presumably a nonspecific
effect), it was not nearly as great as
that seen in the Gadd153-expressing
cells (Fig.
9D, E, and F).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 9.
Conditional expression of Gadd153 increases oxidative
stress. ROS production was examined in
gadd153 / Gadd153i cells, which conditionally
express Gadd153 (A, B, and C), and in
gadd153 / Neo cells, which are vector control
cells (D, E, and F), using H2DCF dye and flow cytometry. (A
and D) Cells were treated with IPTG (dark gray peak) or with a vehicle
control (black peak). Significant ROS production was observed in
response to Gadd153 induction (A) but not in IPTG-treated control cells
(D). (B and E) Following pretreatment with IPTG or vehicle control,
cells were exposed to tunicamycin (TN; 1 µg/ml, 12 h). The black
peak represents fluorescence in untreated control cells ( IPTG, TN).
The dark gray peak corresponds to tunicamycin-treated cells lacking
Gadd153 ( IPTG, +TN), while the light gray peak corresponds to ROS
production in IPTG-pretreated cells exposed to tunicamycin (+IPTG,
+TN). Tunicamycin treatment increased ROS production in both cell
lines, but ROS production was maximal in Gadd153-expressing cells
treated with tunicamycin. (C and F) Following pretreatment with IPTG or
vehicle control, cells were exposed to thapsigargin (TG; 1 µM,
12 h). The black peak represents fluorescence in untreated cells
( IPTG, TG). The dark gray peak corresponds to thapsigargin-treated
cells that were not pretreated with IPTG ( IPTG, +TG), while the light
gray peak corresponds to cells receiving IPTG followed by thapsigargin
(+IPTG, +TG). Maximal ROS production was again detected in
Gadd153-expressing cells treated with thapsigargin. All experiments
were repeated three times and representative histograms are shown.
|
|
That disruption of redox equilibrium contributes to ER stress-induced
cell death was confirmed in experiments using buthionine
sulfoximine
(BSO), an inhibitor of GSH neosynthesis. Pretreatment
of Rat1 and
Rat1-Myc cells with BSO depleted the cells of GSH
(data not shown) and
greatly sensitized them to tunicamycin and
thapsigargin (Fig.
10). Interestingly, A94 cells were not
protected
from ER stress by pretreatment with
N-acetylcysteine (NAC), which
supplies cells with cysteine,
a necessary precursor in the synthesis
of GSH (data not shown).
However, such NAC pretreatment also failed
to increase significantly
the GSH levels in the A94 cells (data
not shown).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 10.
GSH depletion sensitizes cells to ER stress. Rat1 and
Rat1-Myc cells were pretreated with BSO (100 µM, 24 h) followed
by treatment with thapsigargin (TG; 1 µM, 24 h). Cell death was
quantified using flow cytometry. Data represent averages from at least
three independent experiments. Error bars denote standard errors of the
means.
|
|
 |
DISCUSSION |
In this study we examined the influence of Gadd153 expression on
cell survival following ER stress. Using a cell line that constitutively overexpresses Gadd153 and two additional cell lines that
conditionally overexpress the protein, we have demonstrated that
elevated Gadd153 expression sensitizes cells to agents that perturb ER
function. Concomitant with Gadd153 expression, production of the Bcl2
protein is repressed. Furthermore, expression of Gadd153 results in
severe depletion of intracellular thiols. As such a redox imbalance
would predict, ROS production was markedly increased in association
with overexpression of Gadd153. Restoration of Bcl2 in
Gadd153-overexpressing cells returns redox homeostasis to the cells and
protects them from ER stress-induced death.
In Gadd153-overexpressing cells, Bcl2 protein levels are dramatically
reduced relative to parental cells, and we have provided evidence that
this is due to reduced transcription of the bcl2 gene. While
it has been suggested that Gadd153 can directly regulate gene
transcription (37), there is no evidence of a
Gadd153-responsive site in the bcl2 promoter. An alternative
explanation is that Gadd153 exerts its effects on the bcl2
promoter indirectly by negatively regulating another transcription
factor. Gadd153 has long been recognized as an inhibitor of gene
transcription, primarily through its dimerization with and negative
regulation of other leucine zipper transcription factors of the C/EBP
(13, 34) and CREB (36, 43) families.
Furthermore, there is precedence for repression of the bcl2
promoter through the action of transcription factor complexes
(24). Our finding that mutation of the leucine zipper
domain of Gadd153 abolishes its effects on the bcl2 promoter suggests that the ability of Gadd153 to influence bcl2
expression requires complex formation with other proteins.
An important finding of this study is that elevated Gadd153 expression
results in thiol depletion. Direct measurement of cellular GSH levels
indicated that GSH pools were severely depleted in Gadd153-overexpressing cells. We confirmed this finding by measuring ROS production and again found that Gadd153 expression, even in the
absence of stress, perturbed redox equilibrium (Fig. 9A). GSH has a
number of vital functions in the cell. In addition to its role in
detoxifying electrophiles and scavenging free radicals, GSH maintains
protein integrity by preventing oxidation of thiol groups and by
reducing disulfide bonds induced by oxidative stress (reviewed in
references 3 and 27). Thiol depletion has
been shown to sensitize cells to death caused by a variety of stimuli, and in some cell types it is sufficient to induce apoptosis (8, 35, 41). It is clear from these studies and others (9, 16,
17, 38) that in many cell types control of GSH homeostasis is
closely associated with regulation of apoptosis. An interesting question raised by this study is how Gadd153 expression and Bcl2 repression lead to redox imbalance. Bcl2 is known to influence GSH
levels, but how this occurs remains controversial (39). Our glutathione measurements reveal that the total level of glutathione (GSH plus GSSG) is dramatically lower in Gadd153-overexpressing cells
because GSH pools are depleted, while GSSG levels remain essentially
unchanged. There are several possible explanations for these findings.
First, GSH could be rapidly exported from the Gadd153-overexpressing
cells. This does not appear to be the case, as measurement of thiols in
the medium of parental cells and those that overexpress Gadd153
indicated that both had extruded equally low levels of GSH (data not
shown). Another possible explanation is that Gadd153 interferes with
GSH neosynthesis. Synthesis of GSH is a two-step process that is
dependent on the sequential actions of
-glutamyl cysteine
synthetase, which is rate limiting, and glutathione synthetase.
Regulation of these enzymes, particularly of
-glutamyl cysteine
synthetase, is complex and occurs transcriptionally (31,
42), posttranscriptionally (26), and
posttranslationally (10, 28). Whether Gadd153 can
influence GSH neosynthesis is currently under investigation.
While our data demonstrate that elevated Gadd153 levels sensitize cells
to ER stress, we also found that overexpression of c-Myc increases
susceptibility of cells to ER stress-induced death. We have confirmed
these findings with another rat fibroblast cell line, Rat1a-Myc, which
constitutively expresses c-Myc and displays enhanced sensitivity to
thapsigargin and tunicamycin compared to its parental line, Rat1a (data
not shown). While the mechanism whereby c-Myc sensitizes cells to ER
stress remains to be determined, it appears to be distinct from that of
Gadd153. For example, expression of c-Myc does not downregulate Bcl2,
while Bcl2 expression is markedly depressed in all cells that express
Gadd153, regardless of c-Myc expression. Furthermore, unlike our
observations in Gadd153-overexpressing cells, GSH levels were not
reduced in Rat1-Myc cells but were actually higher compared to those in
the parental Rat1 cell line.
In summary, we have established an important mechanistic link between
Gadd153 expression and cell survival following ER stress. By decreasing
Bcl2 levels, primarily through transcriptional mechanisms, and by
depleting cells of essential thiols, Gadd153 poises cells for death.
Further studies investigating how Gadd153 represses the bcl2
promoter and perturbs cellular redox status should enhance our
understanding of the role of Gadd153 in the stress response.
 |
ACKNOWLEDGMENTS |
We thank Robert Wersto, Joe Chrest, and Christa Morris for their
assistance with the flow cytometry experiments described in the
manuscript. We also thank David Ron for generously providing us with
the gadd153/chop knockout cells, as well as M. Matsumoto and S. Akira for their gift of the pORSVI-CHOPFlag and P3'SS
vectors used to generate the cell lines that conditionally express Gadd153.
Lars-O. Klotz is a recipient of a postdoctoral fellowship from the
Deutsche Forschungsgemeinschaft (DFG), Bonn, Germany (KL 1245/1-1).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Biological Chemistry, 5600 Nathan Shock Dr., Baltimore, MD 21224. Phone: (410) 558-8446. Fax: (410) 558-8386. E-mail:
nikki-holbrook{at}nih.gov.
Present address: Institut fur Physiologische Chemie I,
Heinrich-Heine-Universitat Dusseldorf, D-40225 Dusseldorf, Germany.
 |
REFERENCES |
| 1.
|
Alarcon, R. M.,
B. A. Rupnow,
T. G. Graeber,
S. J. Knox, and A. J. Giaccia.
1996.
Modulation of c-Myc activity and apoptosis in vivo.
Cancer Res.
56:4315-4319[Abstract/Free Full Text].
|
| 2.
|
Anderson, M. E.
1985.
Determination of glutathione and glutathione disulfide in biological samples.
Methods Enzymol.
113:548-555[Medline].
|
| 3.
|
Anderson, M. E., and J. L. Luo.
1998.
Glutathione therapy: from prodrugs to genes.
Semin. Liver Dis.
18:415-424[Medline].
|
| 4.
|
Aridor, M., and W. E. Balch.
1999.
Integration of endoplasmic reticulum signaling in health and disease.
Nat. Med.
5:745-751[CrossRef][Medline].
|
| 5.
|
Carlson, S. G.,
T. W. Fawcett,
J. D. Bartlett,
M. Bernier, and N. J. Holbrook.
1993.
Regulation of the C/EBP-related gene gadd153 by glucose deprivation.
Mol. Cell. Biol.
13:4736-4744[Abstract/Free Full Text].
|
| 6.
|
Chen, C.,
A. Nussenzweig,
M. Guo,
D. Kim,
G. C. Li, and C. C. Ling.
1996.
Down-regulation of gadd153 by c-myc in rat fibroblasts and its effect on cell growth and radiation-induced apoptosis.
Oncogene
13:1659-1665[Medline].
|
| 7.
|
Cherney, B. W.,
K. Bhatia, and G. Tosato.
1994.
A role for deregulated c-Myc expression in apoptosis of Epstein-Barr virus-immortalized B cells.
Proc. Natl. Acad. Sci. USA
91:12967-12971[Abstract/Free Full Text].
|
| 8.
|
Chiba, T.,
S. Takahashi,
N. Sato,
S. Ishii, and K. Kikuchi.
1996.
Fas-mediated apoptosis is modulated by intracellular glutathione in human T cells.
Eur. J. Immunol.
5:1164-1169.
|
| 9.
|
Cotgreave, I. A., and R. G. Gerdes.
1998.
Recent trends in glutathione biochemistry glutathione-protein interactions: a molecular link between oxidative stress and cell proliferation?
Biochem. Biophys. Res. Commun.
242:1-9[CrossRef][Medline].
|
| 10.
|
Estrela, J. M.,
F. Gil,
J. M. Vila, and J. Vina.
1988.
Alpha-adrenergic modulation of glutathione metabolism in isolated rat hepatocytes.
Am. J. Physiol.
255:E801-E805[Abstract/Free Full Text].
|
| 11.
|
Evan, G. I.,
A. H. Wyllie,
C. S. Gilbert,
T. D. Littlewood,
H. Land,
M. Brooks,
C. M. Waters,
L. Z. Penn, and D. C. Hancock.
1992.
Induction of apoptosis in fibroblasts by c-myc protein.
Cell
69:119-128[CrossRef][Medline].
|
| 12.
|
Eymin, B.,
L. Dubrez,
M. Allouche, and E. Solary.
1997.
Increased gadd153 messenger RNA level is associated with apoptosis in human leukemic cells treated with etoposide.
Cancer Res.
57:686-695[Abstract/Free Full Text].
|
| 13.
|
Fawcett, T. W.,
H. B. Eastman,
J. L. Martindale, and N. J. Holbrook.
1996.
Physical and functional association between GADD153 and CCAAT/enhancer-binding protein beta during cellular stress.
J. Biol. Chem.
271:14285-14289[Abstract/Free Full Text].
|
| 14.
|
Fornace, A. J.,
D. W. Nebert,
M. C. Hollander,
J. D. Luethy,
M. Papathanasiou,
J. Fargnoli, and N. J. Holbrook.
1989.
Mammalian genes coordinately regulated by growth arrest signals and DNA-damaging agents.
Mol. Cell. Biol.
9:4196-4203[Abstract/Free Full Text].
|
| 15.
|
Friedman, A. D.
1996.
GADD153/CHOP, a DNA damage-inducible protein, reduced CAAT/enhancer binding protein activities and increased apoptosis in 32D c13 myeloid cells.
Cancer Res.
56:3250-3256[Abstract/Free Full Text].
|
| 16.
|
Ghibelli, L.,
S. Coppola,
G. Rotilio,
E. Lafavia,
V. Maresca, and M. R. Ciriolo.
1995.
Non-oxidative loss of glutathione in apoptosis via GSH extrusion.
Biochem. Biophys. Res. Commun.
216:313-320[CrossRef][Medline].
|
| 17.
|
Ghibelli, L.,
C. Fanelli,
G. Rotilio,
E. Lafavia,
S. Coppola,
C. Colussi,
P. Civitareale, and M. R. Ciriolo.
1998.
Rescue of cells from apoptosis by inhibition of active GSH extrusion.
FASEB J.
12:479-486[Abstract/Free Full Text].
|
| 18.
|
Guyton, K. Z.,
Q. Xu, and N. J. Holbrook.
1996.
Induction of the mammalian stress response gene GADD153 by oxidative stress: role of AP-1 element.
Biochem. J.
314:547-554.
|
| 19.
|
Hoang, A. T.,
K. J. Cohen,
J. F. Barrett,
D. A. Bergstrom, and C. V. Dang.
1994.
Participation of cyclin A in Myc-induced apoptosis.
Proc. Natl. Acad. Sci. USA
91:6875-6879[Abstract/Free Full Text].
|
| 20.
|
Holbrook, N. J.,
J. D. Luethy, and J. Kin.
1987.
Transient expression of foreign genes in lymphoid cells is enhanced by phorbol ester.
Mol. Cell. Biol.
7:2610-2613[Abstract/Free Full Text].
|
| 21.
|
Kaufman, R. J.
1999.
Stress signaling from the lumen of the endoplasmic reticulum: coordination of gene transcriptional and translational controls.
Genes Dev.
13:1211-1233[Free Full Text].
|
| 22.
|
Kopito, R. R.
1997.
ER quality control: the cytoplasmic connection.
Cell
88:427-430[CrossRef][Medline].
|
| 23.
|
Li, R.,
H. Pei,
D. K. Watson, and T. S. Papas.
2000.
EAP1/Daxx interacts with ETS1 and represses transcriptional activation of ETS1 target genes.
Oncogene
19:745-753[CrossRef][Medline].
|
| 24.
|
Little, E., and A. S. Lee.
1995.
Generation of a mammalian cell line deficient in glucose-regulated protein stress induction through targeted ribozyme driven by a stress-inducible promoter.
J. Biol. Chem.
270:9526-9534[Abstract/Free Full Text].
|
| 25.
|
Liu, H.,
R. C. Bowes,
B. van de Water,
C. Sillence,
J. F. Nagelkerke, and J. L. Stevens.
1997.
Endoplasmic reticulum chaperones GRP78 and calreticulin prevent oxidative stress, Ca2+ disturbances, and cell death in renal epithelial cells.
J. Biol. Chem.
272:21751-21759[Abstract/Free Full Text].
|
| 26.
|
Liu, R. M.,
L. Gao,
J. Choi, and H. J. Forman.
1998.
Gamma-glutamylcysteine synthetase: mRNA stabilization and independent subunit transcription by 4-hydroxy-2-nonenal.
Am. J. Physiol.
275:L861-L869.
|
| 27.
|
Lu, S. C.
1999.
Regulation of hepatic glutathione synthesis: current concepts and controversies.
FASEB J.
13:1169-1183[Abstract/Free Full Text].
|
| 28.
|
Lu, S. C.,
J. Kuhlenkamp,
C. Garcia-Ruiz, and N. Kaplowitz.
1991.
Hormone-mediated down-regulation of hepatic glutathione synthesis in the rat.
J. Clin. Investig.
88:260-269.
|
| 29.
|
Luethy, J. D., and N. J. Holbrook.
1992.
Activation of the gadd153 promoter by genotoxic agents: a rapid and specific response to DNA damage.
Cancer Res.
52:5-10[Abstract/Free Full Text].
|
| 30.
|
Matsumoto, M.,
M. Minami,
K. Takeda,
Y. Sakao, and S. Akira.
1996.
Ectopic expression of CHOP (GADD153) induces apoptosis in M1 myeloblastic leukemia cells.
FEBS Lett.
395:143-147[CrossRef][Medline].
|
| 31.
|
Mulcahy, R. T.,
M. A. Wartman,
H. H. Bailey, and J. J. Gipp.
1997.
Constitutive and beta-naphthoflavone-induced expression of the human gamma-glutamylcysteine synthetase heavy subunit gene is regulated by a distal antioxidant response element/TRE sequence.
J. Biol. Chem.
272:7445-7454[Abstract/Free Full Text].
|
| 32.
|
Pahl, H. L.
1999.
Signal transduction from the endoplasmic reticulum to the cell nucleus.
Physiol. Rev.
79:683-701[Abstract/Free Full Text].
|
| 33.
|
Reed, D. J.,
J. R. Babson,
P. W. Beatty,
A. E. Brodie,
W. W. Ellis, and D. W. Potter.
1980.
High-performance liquid chromatography analysis of nanomole levels of glutathione, glutathione disulfide, and related thiols and disulfides.
Anal. Biochem.
106:55-62[CrossRef][Medline].
|
| 34.
|
Ron, D., and J. H. Habener.
1992.
CHOP, a novel developmentally regulated nuclear protein that dimerizes with transcription factors C/EBP and LAP and functions as a dominant-negative inhibitor of gene transcription.
Genes Dev.
6:439-453[Abstract/Free Full Text].
|
| 35.
|
Sato, N.,
S. Iwata,
K. Nakamura,
T. Hori,
K. Mori, and J. Yodoi.
1995.
Thiol-mediated redox regulation of apoptosis. Possible roles of cellular thiols other than glutathione in T cell apoptosis J.
Immunol.
154:3194-3203.
|
| 36.
|
Sylvester, S. L.,
C. M. J. ap Rhys,
J. D. Luethy-Martindale, and N. J. Holbrook.
1994.
Induction of GADD153, a CCAAT/enhancer-binding protein (C/EBP)-related gene, during the acute phase response in rats.
J. Biol. Chem.
269:20119-20125[Abstract/Free Full Text].
|
| 37.
|
Ubeda, M.,
X. Z. Wang,
H. Zinszner,
I. Wu,
J. F. Habener, and D. Ron.
1996.
Stress-induced binding of the transcriptional factor CHOP to a novel DNA control element.
Mol. Cell. Biol.
16:1479-1489[Abstract].
|
| 38.
|
van den Dobbelsteen, D. J.,
C. S. I. Nobel,
J. Schlegel,
I. A. Cotgreave,
S. Orrenius, and A. F. Slater.
1996.
Rapid and specific efflux of reduced glutathione during apoptosis induced by anti-Fas/APO-1 antibody.
J. Biol. Chem.
271:15420-15427[Abstract/Free Full Text].
|
| 39.
|
Voehringer, D. W.
1999.
BCL-2 and glutathione: alterations in cellular redox state that regulate apoptosis sensitivity.
Free Radic. Biol. Med.
27:945-950[CrossRef][Medline].
|
| 40.
|
Wang, X. Z.,
B. Lawson,
J. W. Brewer,
H. Zinszner,
A. Sanjay,
L. J. Mi,
R. Boorstein,
G. Kreibich,
L. M. Hendershot, and D. Ron.
1996.
Signals from the stressed endoplasmic reticulum induce C/EBP-homologous protein (CHOP/GADD153).
Mol. Cell. Biol.
16:4273-4280[Abstract].
|
| 41.
|
Watson, R. W.,
O. D. Rotstein,
A. B. Nathens,
A. P. Dackiw, and J. C. Marshall.
1996.
Thiol-mediated redox regulation of neutrophil apoptosis.
Surgery
120:150-157[CrossRef][Medline].
|
| 42.
|
Wild, A. C.,
H. R. Moinova, and R. T. Mulcahy.
1999.
Regulation of gamma-glutamylcysteine synthetase subunit gene expression by the transcription factor Nrf2.
J. Biol. Chem.
274:33627-33636[Abstract/Free Full Text].
|
| 43.
|
Wolfgang, C. D.,
B. P. C. Chen,
J. L. Martindale,
N. J. Holbrook, and T. Hai.
1997.
Gadd153/Chop10, a potential target gene of the transcriptional repressor ATF3.
Mol. Cell. Biol.
17:6700-6707[Abstract].
|
| 44.
|
Zauli, G.,
D. Gibellini,
A. Caputo,
A. Bassini,
M. Negrini,
M. Monne,
M. Mazzoni, and S. Capitani.
1995.
The human immunodeficiency virus type-1 Tat protein upregulates Bcl-2 gene expression in Jurkat T-cell lines and primary peripheral blood mononuclear cells.
Blood
86:3823-3834[Abstract/Free Full Text].
|
| 45.
|
Zinszner, H.,
M. Kuroda,
X. Wang,
N. Batchvarova,
R. T. Lightfoot,
H. Remotti,
J. L. Stevens, and D. Ron.
1998.
CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum.
Genes Dev.
12:982-995[Abstract/Free Full Text].
|
Molecular and Cellular Biology, February 2001, p. 1249-1259, Vol. 21, No. 4
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.4.1249-1259.2001
This article has been cited by other articles:
-
Chigurupati, S., Wei, Z., Belal, C., Vandermey, M., Kyriazis, G. A., Arumugam, T. V., Chan, S. L.
(2009). The Homocysteine-inducible Endoplasmic Reticulum Stress Protein Counteracts Calcium Store Depletion and Induction of CCAAT Enhancer-binding Protein Homologous Protein in a Neurotoxin Model of Parkinson Disease. J. Biol. Chem.
284: 18323-18333
[Abstract]
[Full Text]
-
Matsuura, G., Morinaga, N., Yahiro, K., Komine, R., Moss, J., Yoshida, H., Noda, M.
(2009). Novel Subtilase Cytotoxin Produced by Shiga-Toxigenic Escherichia coli Induces Apoptosis in Vero Cells via Mitochondrial Membrane Damage. Infect. Immun.
77: 2919-2924
[Abstract]
[Full Text]
-
Ishikawa, F., Akimoto, T., Yamamoto, H., Araki, Y., Yoshie, T., Mori, K., Hayashi, H., Nose, K., Shibanuma, M.
(2009). Gene Expression Profiling Identifies a Role for CHOP During Inhibition of the Mitochondrial Respiratory Chain. J Biochem
146: 123-132
[Abstract]
[Full Text]
-
Di Nardo, A., Kramvis, I., Cho, N., Sadowski, A., Meikle, L., Kwiatkowski, D. J., Sahin, M.
(2009). Tuberous Sclerosis Complex Activity Is Required to Control Neuronal Stress Responses in an mTOR-Dependent Manner. J. Neurosci.
29: 5926-5937
[Abstract]
[Full Text]
-
Huang, W.-C., Lin, Y.-S., Chen, C.-L., Wang, C.-Y., Chiu, W.-H., Lin, C.-F.
(2009). Glycogen Synthase Kinase-3{beta} Mediates Endoplasmic Reticulum Stress-Induced Lysosomal Apoptosis in Leukemia. J. Pharmacol. Exp. Ther.
329: 524-531
[Abstract]
[Full Text]
-
Szegezdi, E., MacDonald, D. C., Ni Chonghaile, T., Gupta, S., Samali, A.
(2009). Bcl-2 family on guard at the ER. Am. J. Physiol. Cell Physiol.
296: C941-C953
[Abstract]
[Full Text]
-
Xiao, X., Bai, P., Bui Nguyen, T. M., Xiao, J., Liu, S., Yang, G., Hu, L., Chen, X., Zhang, X., Liu, J., Wang, H.
(2009). The antitumoral effect of Paris Saponin I associated with the induction of apoptosis through the mitochondrial pathway. Molecular Cancer Therapeutics
8: 1179-1188
[Abstract]
[Full Text]
-
Namba, T., Tanaka, K.-I., Ito, Y., Ishihara, T., Hoshino, T., Gotoh, T., Endo, M., Sato, K., Mizushima, T.
(2009). Positive Role of CCAAT/Enhancer-Binding Protein Homologous Protein, a Transcription Factor Involved in the Endoplasmic Reticulum Stress Response in the Development of Colitis. Am. J. Pathol.
174: 1786-1798
[Abstract]
[Full Text]
-
Xuan, B., Qian, Z., Torigoi, E., Yu, D.
(2009). Human Cytomegalovirus Protein pUL38 Induces ATF4 Expression, Inhibits Persistent JNK Phosphorylation, and Suppresses Endoplasmic Reticulum Stress-Induced Cell Death. J. Virol.
83: 3463-3474
[Abstract]
[Full Text]
-
Sanson, M., Auge, N., Vindis, C., Muller, C., Bando, Y., Thiers, J.-C., Marachet, M.-A., Zarkovic, K., Sawa, Y., Salvayre, R., Negre-Salvayre, A.
(2009). Oxidized Low-Density Lipoproteins Trigger Endoplasmic Reticulum Stress in Vascular Cells: Prevention by Oxygen-Regulated Protein 150 Expression. Circ. Res.
104: 328-336
[Abstract]
[Full Text]
-
Goosse, K, Bouckenooghe, T, Balteau, M, Reusens, B, Remacle, C
(2009). Implication of nitric oxide in the increased islet-cells vulnerability of adult progeny from protein-restricted mothers and its prevention by taurine. J Endocrinol
200: 177-187
[Abstract]
[Full Text]
-
Jiang, C. C., Mao, Z. G., Avery-Kiejda, K. A., Wade, M., Hersey, P., Zhang, X. D.
(2009). Glucose-regulated protein 78 antagonizes cisplatin and adriamycin in human melanoma cells. Carcinogenesis
30: 197-204
[Abstract]
[Full Text]
-
Kim, I., Shu, C.-W., Xu, W., Shiau, C.-W., Grant, D., Vasile, S., Cosford, N. D. P., Reed, J. C.
(2009). Chemical Biology Investigation of Cell Death Pathways Activated by Endoplasmic Reticulum Stress Reveals Cytoprotective Modulators of ASK1. J. Biol. Chem.
284: 1593-1603
[Abstract]
[Full Text]
-
Zou, C.-G., Cao, X.-Z., Zhao, Y.-S., Gao, S.-Y., Li, S.-D., Liu, X.-Y., Zhang, Y., Zhang, K.-Q.
(2009). The Molecular Mechanism of Endoplasmic Reticulum Stress-Induced Apoptosis in PC-12 Neuronal Cells: The Protective Effect of Insulin-Like Growth Factor I. Endocrinology
150: 277-285
[Abstract]
[Full Text]
-
Mungrue, I. N., Pagnon, J., Kohannim, O., Gargalovic, P. S., Lusis, A. J.
(2009). CHAC1/MGC4504 Is a Novel Proapoptotic Component of the Unfolded Protein Response, Downstream of the ATF4-ATF3-CHOP Cascade. J. Immunol.
182: 466-476
[Abstract]
[Full Text]
-
Shaw, J., Yurkova, N., Zhang, T., Gang, H., Aguilar, F., Weidman, D., Scramstad, C., Weisman, H., Kirshenbaum, L. A.
(2008). Antagonism of E2F-1 regulated Bnip3 transcription by NF-{kappa}B is essential for basal cell survival. Proc. Natl. Acad. Sci. USA
105: 20734-20739
[Abstract]
[Full Text]
-
Malhotra, J. D., Miao, H., Zhang, K., Wolfson, A., Pennathur, S., Pipe, S. W., Kaufman, R. J.
(2008). Antioxidants reduce endoplasmic reticulum stress and improve protein secretion. Proc. Natl. Acad. Sci. USA
105: 18525-18530
[Abstract]
[Full Text]
-
Rabik, C. A., Fishel, M. L., Holleran, J. L., Kasza, K., Kelley, M. R., Egorin, M. J., Dolan, M. E.
(2008). Enhancement of Cisplatin [cis-Diammine Dichloroplatinum (II)] Cytotoxicity by O6-Benzylguanine Involves Endoplasmic Reticulum Stress. J. Pharmacol. Exp. Ther.
327: 442-452
[Abstract]
[Full Text]
-
Akerfeldt, M. C., Howes, J., Chan, J. Y., Stevens, V. A., Boubenna, N., McGuire, H. M., King, C., Biden, T. J., Laybutt, D. R.
(2008). Cytokine-Induced {beta}-Cell Death Is Independent of Endoplasmic Reticulum Stress Signaling. Diabetes
57: 3034-3044
[Abstract]
[Full Text]
-
Sanz, A. B., Santamaria, B., Ruiz-Ortega, M., Egido, J., Ortiz, A.
(2008). Mechanisms of Renal Apoptosis in Health and Disease. J. Am. Soc. Nephrol.
19: 1634-1642
[Abstract]
[Full Text]
-
Jiang, C. C., Lucas, K., Avery-Kiejda, K. A., Wade, M., deBock, C. E., Thorne, R. F., Allen, J., Hersey, P., Zhang, X. D.
(2008). Up-regulation of Mcl-1 Is Critical for Survival of Human Melanoma Cells upon Endoplasmic Reticulum Stress. Cancer Res.
68: 6708-6717
[Abstract]
[Full Text]
-
Li, Y., Bevilacqua, E., Chiribau, C.-B., Majumder, M., Wang, C., Croniger, C. M., Snider, M. D., Johnson, P. F., Hatzoglou, M.
(2008). Differential Control of the CCAAT/Enhancer-binding Protein {beta} (C/EBP{beta}) Products Liver-enriched Transcriptional Activating Protein (LAP) and Liver-enriched Transcriptional Inhibitory Protein (LIP) and the Regulation of Gene Expression during the Response to Endoplasmic Reticulum Stress. J. Biol. Chem.
283: 22443-22456
[Abstract]
[Full Text]
-
Kitamura, M.
(2008). Endoplasmic reticulum stress and unfolded protein response in renal pathophysiology: Janus faces. Am. J. Physiol. Renal Physiol.
295: F323-F334
[Abstract]
[Full Text]
-
Yung, H.-w., Calabrese, S., Hynx, D., Hemmings, B. A., Cetin, I., Charnock-Jones, D. S., Burton, G. J.
(2008). Evidence of Placental Translation Inhibition and Endoplasmic Reticulum Stress in the Etiology of Human Intrauterine Growth Restriction. Am. J. Pathol.
173: 451-462
[Abstract]
[Full Text]
-
Naidoo, N., Ferber, M., Master, M., Zhu, Y., Pack, A. I.
(2008). Aging Impairs the Unfolded Protein Response to Sleep Deprivation and Leads to Proapoptotic Signaling. J. Neurosci.
28: 6539-6548
[Abstract]
[Full Text]
-
Croons, V., Martinet, W., Herman, A. G., De Meyer, G. R. Y.
(2008). Differential Effect of the Protein Synthesis Inhibitors Puromycin and Cycloheximide on Vascular Smooth Muscle Cell Viability. J. Pharmacol. Exp. Ther.
325: 824-832
[Abstract]
[Full Text]
-
Ou, L., Wu, Y., Ip, C., Meng, X., Hsu, Y.-C., Ip, M. M.
(2008). Apoptosis induced by t10,c12-conjugated linoleic acid is mediated by an atypical endoplasmic reticulum stress response. J. Lipid Res.
49: 985-994
[Abstract]
[Full Text]
-
Scheuner, D., Kaufman, R. J.
(2008). The Unfolded Protein Response: A Pathway That Links Insulin Demand with {beta}-Cell Failure and Diabetes. Endocr. Rev.
29: 317-333
[Abstract]
[Full Text]
-
Yu, Y., Niapour, M., Zhang, Y., Berger, S. A.
(2008). Mitochondrial regulation by c-Myc and hypoxia-inducible factor-1{alpha} controls sensitivity to econazole. Molecular Cancer Therapeutics
7: 483-491
[Abstract]
[Full Text]
-
Chen, L. H., Jiang, C. C., Watts, R., Thorne, R. F., Kiejda, K. A., Zhang, X. D., Hersey, P.
(2008). Inhibition of Endoplasmic Reticulum Stress-Induced Apoptosis of Melanoma Cells by the ARC Protein. Cancer Res.
68: 834-842
[Abstract]
[Full Text]
-
Eizirik, D. L., Cardozo, A. K., Cnop, M.
(2008). The Role for Endoplasmic Reticulum Stress in Diabetes Mellitus. Endocr. Rev.
29: 42-61
[Abstract]
[Full Text]
-
Cheng, W.-P., Hung, H.-F., Wang, B.-W., Shyu, K.-G.
(2008). The molecular regulation of GADD153 in apoptosis of cultured vascular smooth muscle cells by cyclic mechanical stretch. Cardiovasc Res
77: 551-559
[Abstract]
[Full Text]
-
Kieran, D., Woods, I., Villunger, A., Strasser, A., Prehn, J. H. M.
(2007). Deletion of the BH3-only protein puma protects motoneurons from ER stress-induced apoptosis and delays motoneuron loss in ALS mice. Proc. Natl. Acad. Sci. USA
104: 20606-20611
[Abstract]
[Full Text]
-
Glembotski, C. C.
(2007). Endoplasmic Reticulum Stress in the Heart. Circ. Res.
101: 975-984
[Abstract]
[Full Text]
-
Jiang, C. C., Chen, L. H., Gillespie, S., Wang, Y. F., Kiejda, K. A., Zhang, X. D., Hersey, P.
(2007). Inhibition of MEK Sensitizes Human Melanoma Cells to Endoplasmic Reticulum Stress-Induced Apoptosis. Cancer Res.
67: 9750-9761
[Abstract]
[Full Text]
-
Pyrko, P., Schonthal, A. H., Hofman, F. M., Chen, T. C., Lee, A. S.
(2007). The Unfolded Protein Response Regulator GRP78/BiP as a Novel Target for Increasing Chemosensitivity in Malignant Gliomas. Cancer Res.
67: 9809-9816
[Abstract]
[Full Text]
-
Medigeshi, G. R., Lancaster, A. M., Hirsch, A. J., Briese, T., Lipkin, W. I., DeFilippis, V., Fruh, K., Mason, P. W., Nikolich-Zugich, J., Nelson, J. A.
(2007). West Nile Virus Infection Activates the Unfolded Protein Response, Leading to CHOP Induction and Apoptosis. J. Virol.
81: 10849-10860
[Abstract]
[Full Text]
-
Niknejad, N., Morley, M., Dimitroulakos, J.
(2007). Activation of the Integrated Stress Response Regulates Lovastatin-induced Apoptosis. J. Biol. Chem.
282: 29748-29756
[Abstract]
[Full Text]
-
Xu, Q., Ohara, N., Liu, J., Nakabayashi, K., DeManno, D., Chwalisz, K., Yoshida, S., Maruo, T.
(2007). Selective progesterone receptor modulator asoprisnil induces endoplasmic reticulum stress in cultured human uterine leiomyoma cells. Am. J. Physiol. Endocrinol. Metab.
293: E1002-E1011
[Abstract]
[Full Text]
-
Davenport, E. L., Moore, H. E., Dunlop, A. S., Sharp, S. Y., Workman, P., Morgan, G. J., Davies, F. E.
(2007). Heat shock protein inhibition is associated with activation of the unfolded protein response pathway in myeloma plasma cells. Blood
110: 2641-2649
[Abstract]
[Full Text]
-
Sarkar, D., Park, E. S., Barber, G. N., Fisher, P. B.
(2007). Activation of Double-Stranded RNA Dependent Protein Kinase, A New Pathway by Which Human Polynucleotide Phosphorylase (hPNPaseold-35) Induces Apoptosis. Cancer Res.
67: 7948-7953
[Abstract]
[Full Text]
-
Endo, H., Murata, K., Mukai, M., Ishikawa, O., Inoue, M.
(2007). Activation of Insulin-like Growth Factor Signaling Induces Apoptotic Cell Death Under Prolonged Hypoxia by Enhancing Endoplasmic Reticulum Stress Response. Cancer Res.
67: 8095-8103
[Abstract]
[Full Text]
-
Guo, J., Zhu, T., Xiao, Z.-X. J., Chen, C.-Y.
(2007). Modulation of Intracellular Signaling Pathways to Induce Apoptosis in Prostate Cancer Cells. J. Biol. Chem.
282: 24364-24372
[Abstract]
[Full Text]
-
Lawrence, M. C., McGlynn, K., Naziruddin, B., Levy, M. F., Cobb, M. H.
(2007). Inaugural Article: Differential regulation of CHOP-10/GADD153 gene expression by MAPK signaling in pancreatic beta-cells. Proc. Natl. Acad. Sci. USA
104: 11518-11525
[Abstract]
[Full Text]
-
Lai, E., Teodoro, T., Volchuk, A.
(2007). Endoplasmic Reticulum Stress: Signaling the Unfolded Protein Response. Physiology
22: 193-201
[Abstract]
[Full Text]
-
Thomas, K. C., Sabnis, A. S., Johansen, M. E., Lanza, D. L., Moos, P. J., Yost, G. S., Reilly, C. A.
(2007). Transient Receptor Potential Vanilloid 1 Agonists Cause Endoplasmic Reticulum Stress and Cell Death in Human Lung Cells. J. Pharmacol. Exp. Ther.
321: 830-838
[Abstract]
[Full Text]
-
Kubisch, C. H., Logsdon, C. D.
(2007). Secretagogues differentially activate endoplasmic reticulum stress responses in pancreatic acinar cells. Am. J. Physiol. Gastrointest. Liver Physiol.
292: G1804-G1812
[Abstract]
[Full Text]
-
Pirot, P., Ortis, F., Cnop, M., Ma, Y., Hendershot, L. M., Eizirik, D. L., Cardozo, A. K.
(2007). Transcriptional Regulation of the Endoplasmic Reticulum Stress Gene Chop in Pancreatic Insulin-Producing Cells. Diabetes
56: 1069-1077
[Abstract]
[Full Text]
-
Yung, H.-w., Korolchuk, S., Tolkovsky, A. M., Charnock-Jones, D. S., Burton, G. J.
(2007). Endoplasmic reticulum stress exacerbates ischemia-reperfusion-induced apoptosis through attenuation of Akt protein synthesis in human choriocarcinoma cells. FASEB J.
21: 872-884
[Abstract]
[Full Text]
-
Meister, S., Schubert, U., Neubert, K., Herrmann, K., Burger, R., Gramatzki, M., Hahn, S., Schreiber, S., Wilhelm, S., Herrmann, M., Jack, H.-M., Voll, R. E.
(2007). Extensive Immunoglobulin Production Sensitizes Myeloma Cells for Proteasome Inhibition. Cancer Res.
67: 1783-1792
[Abstract]
[Full Text]
-
Cnop, M., Ladriere, L., Hekerman, P., Ortis, F., Cardozo, A. K., Dogusan, Z., Flamez, D., Boyce, M., Yuan, J., Eizirik, D. L.
(2007). Selective Inhibition of Eukaryotic Translation Initiation Factor 2{alpha} Dephosphorylation Potentiates Fatty Acid-induced Endoplasmic Reticulum Stress and Causes Pancreatic beta-Cell Dysfunction and Apoptosis. J. Biol. Chem.
282: 3989-3997
[Abstract]
[Full Text]
-
Sokka, A.-L., Putkonen, N., Mudo, G., Pryazhnikov, E., Reijonen, S., Khiroug, L., Belluardo, N., Lindholm, D., Korhonen, L.
(2007). Endoplasmic Reticulum Stress Inhibition Protects against Excitotoxic Neuronal Injury in the Rat Brain. J. Neurosci.
27: 901-908
[Abstract]
[Full Text]
-
Kim, S.-H., Hwang, C.-I., Juhnn, Y.-S., Lee, J.-H., Park, W.-Y., Song, Y.-S.
(2007). GADD153 mediates celecoxib-induced apoptosis in cervical cancer cells. Carcinogenesis
28: 223-231
[Abstract]
[Full Text]
-
Ge, Y., Montano, I., Rustici, G., Freebern, W. J., Haggerty, C. M., Cui, W., Ponciano-Jackson, D., Chandramouli, G. V. R., Gardner, E. R., Figg, W. D., Abu-Asab, M., Tsokos, M., Jackson, S. H., Gardner, K.
(2006). Selective leukemic-cell killing by a novel functional class of thalidomide analogs. Blood
108: 4126-4135
[Abstract]
[Full Text]
-
Shaw, J., Zhang, T., Rzeszutek, M., Yurkova, N., Baetz, D., Davie, J. R., Kirshenbaum, L. A.
(2006). Transcriptional Silencing of the Death Gene BNIP3 by Cooperative Action of NF-{kappa}B and Histone Deacetylase 1 in Ventricular Myocytes. Circ. Res.
99: 1347-1354
[Abstract]
[Full Text]
-
Lopez-Anton, N., Rudy, A., Barth, N., Schmitz, L. M., Pettit, G. R., Schulze-Osthoff, K., Dirsch, V. M., Vollmar, A. M.
(2006). The Marine Product Cephalostatin 1 Activates an Endoplasmic Reticulum Stress-specific and Apoptosome-independent Apoptotic Signaling Pathway. J. Biol. Chem.
281: 33078-33086
[Abstract]
[Full Text]
-
Marciniak, S. J., Ron, D.
(2006). Endoplasmic reticulum stress signaling in disease.. Physiol. Rev.
86: 1133-1149
[Abstract]
[Full Text]
-
Kim, S.-H., Hwang, C.-I., Park, W.-Y., Lee, J.-H., Song, Y.-S.
(2006). GADD153 mediates celecoxib-induced apoptosis in cervical cancer cells. Carcinogenesis
27: 1961-1969
[Abstract]
[Full Text]
-
Shiraishi, H., Okamoto, H., Yoshimura, A., Yoshida, H.
(2006). ER stress-induced apoptosis and caspase-12 activation occurs downstream of mitochondrial apoptosis involving Apaf-1. J. Cell Sci.
119: 3958-3966
[Abstract]
[Full Text]
-
Williams, B. L., Lipkin, W. I.
(2006). Endoplasmic reticulum stress and neurodegeneration in rats neonatally infected with borna disease virus.. J. Virol.
80: 8613-8626
[Abstract]
[Full Text]
-
Guichard, C., Pedruzzi, E., Fay, M., Marie, J.-C., Braut-Boucher, F., Daniel, F., Grodet, A., Gougerot-Pocidalo, M.-A., Chastre, E., Kotelevets, L., Lizard, G., Vandewalle, A., Driss, F., Ogier-Denis, E.
(2006). Dihydroxyphenylethanol induces apoptosis by activating serine/threonine protein phosphatase PP2A and promotes the endoplasmic reticulum stress response in human colon carcinoma cells. Carcinogenesis
27: 1812-1827
[Abstract]
[Full Text]
-
Kubisch, C. H., Sans, M. D., Arumugam, T., Ernst, S. A., Williams, J. A., Logsdon, C. D.
(2006). Early activation of endoplasmic reticulum stress is associated with arginine-induced acute pancreatitis. Am. J. Physiol. Gastrointest. Liver Physiol.
291: G238-G245
[Abstract]
[Full Text]
-
Gotoh, T., Mori, M.
(2006). Nitric Oxide and Endoplasmic Reticulum Stress. Arterioscler. Thromb. Vasc. Bio.
26: 1439-1446
[Abstract]
[Full Text]
-
Koumenis, C., Wouters, B. G.
(2006). "Translating" Tumor Hypoxia: Unfolded Protein Response (UPR)-Dependent and UPR-Independent Pathways. Mol Cancer Res
4: 423-436
[Abstract]
[Full Text]
-
Obeng, E. A., Carlson, L. M., Gutman, D. M., Harrington, W. J. Jr, Lee, K. P., Boise, L. H.
(2006). Proteasome inhibitors induce a terminal unfolded protein response in multiple myeloma cells. Blood
107: 4907-4916
[Abstract]
[Full Text]
-
Endo, M., Mori, M., Akira, S., Gotoh, T.
(2006). C/EBP Homologous Protein (CHOP) Is Crucial for the Induction of Caspase-11 and the Pathogenesis of Lipopolysaccharide-Induced Inflammatio. J. Immunol.
176: 6245-6253
[Abstract]
[Full Text]
-
Misra, U. K., Deedwania, R., Pizzo, S. V.
(2006). Activation and Cross-talk between Akt, NF-{kappa}B, and Unfolded Protein Response Signaling in 1-LN Prostate Cancer Cells Consequent to Ligation of Cell Surface-associated GRP78. J. Biol. Chem.
281: 13694-13707
[Abstract]
[Full Text]
-
Mao, W., Iwai, C., Keng, P. C., Vulapalli, R., Liang, C.-s.
(2006). Norepinephrine-induced oxidative stress causes PC-12 cell apoptosis by both endoplasmic reticulum stress and mitochondrial intrinsic pathway: inhibition of phosphatidylinositol 3-kinase survival pathway. Am. J. Physiol. Cell Physiol.
290: C1373-C1384
[Abstract]
[Full Text]
-
Li, J., Lee, B., Lee, A. S.
(2006). Endoplasmic Reticulum Stress-induced Apoptosis: MULTIPLE PATHWAYS AND ACTIVATION OF p53-UP-REGULATED MODULATOR OF APOPTOSIS (PUMA) AND NOXA BY p53. J. Biol. Chem.
281: 7260-7270
[Abstract]
[Full Text]
-
Bergeron, A., Jorquera, R., Orejuela, D., Tanguay, R. M.
(2006). Involvement of Endoplasmic Reticulum Stress in Hereditary Tyrosinemia Type I. J. Biol. Chem.
281: 5329-5334
[Abstract]
[Full Text]
-
Sorensen, S., Ranheim, T., Bakken, K. S., Leren, T. P., Kulseth, M. A.
(2006). Retention of Mutant Low Density Lipoprotein Receptor in Endoplasmic Reticulum (ER) Leads to ER Stress. J. Biol. Chem.
281: 468-476
[Abstract]
[Full Text]
-
Bek, M. F., Bayer, M., Muller, B., Greiber, S., Lang, D., Schwab, A., August, C., Springer, E., Rohrbach, R., Huber, T. B., Benzing, T., Pavenstadt, H.
(2006). Expression and Function of C/EBP Homology Protein (GADD153) in Podocytes. Am. J. Pathol.
168: 20-32
[Abstract]
[Full Text]
-
Baetz, D., Regula, K. M., Ens, K., Shaw, J., Kothari, S., Yurkova, N., Kirshenbaum, L. A.
(2005). Nuclear Factor-{kappa}B-Mediated Cell Survival Involves Transcriptional Silencing of the Mitochondrial Death Gene BNIP3 in Ventricular Myocytes. Circulation
112: 3777-3785
[Abstract]
[Full Text]
-
Skalet, A. H., Isler, J. A., King, L. B., Harding, H. P., Ron, D., Monroe, J. G.
(2005). Rapid B Cell Receptor-induced Unfolded Protein Response in Nonsecretory B Cells Correlates with Pro- Versus Antiapoptotic Cell Fate. J. Biol. Chem.
280: 39762-39771
[Abstract]
[Full Text]
-
Feldman, D. E., Chauhan, V., Koong, A. C.
(2005). The Unfolded Protein Response: A Novel Component of the Hypoxic Stress Response in Tumors. Mol Cancer Res
3: 597-605
[Abstract]
[Full Text]
-
Wu, Y., Zhang, H., Dong, Y., Park, Y.-M., Ip, C.
(2005). Endoplasmic Reticulum Stress Signal Mediators Are Targets of Selenium Action. Cancer Res.
65: 9073-9079
[Abstract]
[Full Text]
-
Yang, L., Carlson, S. G., McBurney, D., Horton, W. E. Jr.
(2005). Multiple Signals Induce Endoplasmic Reticulum Stress in Both Primary and Immortalized Chondrocytes Resulting in Loss of Differentiation, Impaired Cell Growth, and Apoptosis. J. Biol. Chem.
280: 31156-31165
[Abstract]
[Full Text]
-
Obeng, E. A., Boise, L. H.
(2005). Caspase-12 and Caspase-4 Are Not Required for Caspase-dependent Endoplasmic Reticulum Stress-induced Apoptosis. J. Biol. Chem.
280: 29578-29587
[Abstract]
[Full Text]
-
Ueda, K., Kawano, J., Takeda, K., Yujiri, T., Tanabe, K., Anno, T., Akiyama, M., Nozaki, J., Yoshinaga, T., Koizumi, A., Shinoda, K., Oka, Y., Tanizawa, Y.
(2005). Endoplasmic reticulum stress induces Wfs1 gene expression in pancreatic {beta}-cells via transcriptional activation. Eur J Endocrinol
153: 167-176
[Abstract]
[Full Text]
-
Han, X.-J., Chae, J.-K., Lee, M.-J., You, K.-R., Lee, B.-H., Kim, D.-G.
(2005). Involvement of GADD153 and Cardiac Ankyrin Repeat Protein in Hypoxia-induced Apoptosis of H9c2 Cells. J. Biol. Chem.
280: 23122-23129
[Abstract]
[Full Text]
-
Lin, W., Harding, H. P., Ron, D., Popko, B.
(2005). Endoplasmic reticulum stress modulates the response of myelinating oligodendrocytes to the immune cytokine interferon-{gamma}. JCB
169: 603-612
[Abstract]
[Full Text]
-
Hong, J., Yokomakura, A., Nakano, Y., Ban, H. S., Ishihara, K., Ahn, J.-W., Zee, O., Ohuchi, K.
(2005). Induction of Nitric Oxide Production by the Cytostatic Macrolide Apicularen A [2,4-Heptadienamide, N-[(1E)-3-[(3S,5R,7R,9S)-3,4,5,6,7,8,9,10-octahydro-7,14 Dihydroxy-1-oxo-5,9-epoxy-1H-2-benzoxacyclododecin-3-yl]-1 propenyl]-, (2Z,4Z)-(9CI)] and Possible Role of Nitric Oxide in Apicularen A-Induced Apoptosis in RAW 264.7 Cells. J. Pharmacol. Exp. Ther.
312: 968-977
[Abstract]
[Full Text]
-
Liu, X.-m., Peyton, K. J., Ensenat, D., Wang, H., Schafer, A. I., Alam, J., Durante, W.
(2005). Endoplasmic Reticulum Stress Stimulates Heme Oxygenase-1 Gene Expression in Vascular Smooth Muscle: ROLE IN CELL SURVIVAL. J. Biol. Chem.
280: 872-877
[Abstract]
[Full Text]
-
Pedruzzi, E., Guichard, C., Ollivier, V., Driss, F., Fay, M., Prunet, C., Marie, J.-C., Pouzet, C., Samadi, M., Elbim, C., O'Dowd, Y., Bens, M., Vandewalle, A., Gougerot-Pocidalo, M.-A., Lizard, G., Ogier-Denis, E.
(2004). NAD(P)H Oxidase Nox-4 Mediates 7-Ketocholesterol-Induced Endoplasmic Reticulum Stress and Apoptosis in Human Aortic Smooth Muscle Cells. Mol. Cell. Biol.
24: 10703-10717
[Abstract]
[Full Text]
-
Marciniak, S. J., Yun, C. Y., Oyadomari, S., Novoa, I., Zhang, Y., Jungreis, R., Nagata, K., Harding, H. P., Ron, D.
(2004). CHOP induces death by promoting protein synthesis and oxidation in the stressed endoplasmic reticulum. Genes Dev.
18: 3066-3077
[Abstract]
[Full Text]
-
Fribley, A., Zeng, Q., Wang, C.-Y.
(2004). Proteasome Inhibitor PS-341 Induces Apoptosis through Induction of Endoplasmic Reticulum Stress-Reactive Oxygen Species in Head and Neck Squamous Cell Carcinoma Cells. Mol. Cell. Biol.
24: 9695-9704
[Abstract]
[Full Text]
-
Yamaguchi, H., Wang, H.-G.
(2004). CHOP Is Involved in Endoplasmic Reticulum Stress-induced Apoptosis by Enhancing DR5 Expression in Human Carcinoma Cells. J. Biol. Chem.
279: 45495-45502
[Abstract]
[Full Text]
-
Netherton, C. L., Parsley, J. C., Wileman, T.
(2004). African Swine Fever Virus Inhibits Induction of the Stress-Induced Proapoptotic Transcription Factor CHOP/GADD153. J. Virol.
78: 10825-10828
[Abstract]
[Full Text]
-
Okada, K.-i., Minamino, T., Tsukamoto, Y., Liao, Y., Tsukamoto, O., Takashima, S., Hirata, A., Fujita, M., Nagamachi, Y., Nakatani, T., Yutani, C., Ozawa, K., Ogawa, S., Tomoike, H., Hori, M., Kitakaze, M.
(2004). Prolonged Endoplasmic Reticulum Stress in Hypertrophic and Failing Heart After Aortic Constriction: Possible Contribution of Endoplasmic Reticulum Stress to Cardiac Myocyte Apoptosis. Circulation
110: 705-712
[Abstract]
[Full Text]
-
Dimcheff, D. E., Faasse, M. A., McAtee, F. J., Portis, J. L.
(2004). Endoplasmic Reticulum (ER) Stress Induced by a Neurovirulent Mouse Retrovirus Is Associated with Prolonged BiP Binding and Retention of a Viral Protein in the ER. J. Biol. Chem.
279: 33782-33790
[Abstract]
[Full Text]
-
Chen, C., Dudenhausen, E. E., Pan, Y.-X., Zhong, C., Kilberg, M. S.
(2004). Human CCAAT/Enhancer-binding Protein {beta} Gene Expression Is Activated by Endoplasmic Reticulum Stress through an Unfolded Protein Response Element Downstream of the Protein Coding Sequence. J. Biol. Chem.
279: 27948-27956
[Abstract]
[Full Text]
-
Sun, M., Rothermel, T. A., Shuman, L., Aligo, J. A., Xu, S., Lin, Y., Lamb, R. A., He, B.
(2004). Conserved Cysteine-Rich Domain of Paramyxovirus Simian Virus 5 V Protein Plays an Important Role in Blocking Apoptosis. J. Virol.
78: 5068-5078
[Abstract]
[Full Text]
-
Cullinan, S. B., Diehl, J. A.
(2004). PERK-dependent Activation of Nrf2 Contributes to Redox Homeostasis and Cell Survival following Endoplasmic Reticulum Stress. J. Biol. Chem.
279: 20108-20117
[Abstract]
[Full Text]
-
Ma, Y., Hendershot, L. M.
(2004). Herp Is Dually Regulated by Both the Endoplasmic Reticulum Stress-specific Branch of the Unfolded Protein Response and a Branch That Is Shared with Other Cellular Stress Pathways. J. Biol. Chem.
279: 13792-13799
[Abstract]
[Full Text]
-
Zhang, X., Huang, Q., Yang, Z., Li, Y., Li, C.-Y.
(2004). GW112, A Novel Antiapoptotic Protein That Promotes Tumor Growth. Cancer Res.
64: 2474-2481
[Abstract]
[Full Text]
-
JAYANTHI, S., DENG, X., NOAILLES, P.-A. H., LADENHEIM, B., CADET, J. L.
(2004). Methamphetamine induces neuronal apoptosis via cross-talks between endoplasmic reticulum and mitochondria-dependent death cascades. FASEB J.
18: 238-251
[Abstract]
[Full Text]
-
Lorz, C., Justo, P., Sanz, A., Subira, D., Egido, J., Ortiz, A.
(2004). Paracetamol-Induced Renal Tubular Injury: A Role for ER Stress. J. Am. Soc. Nephrol.
15: 380-389
[Abstract]
[Full Text]
-
Dimcheff, D. E., Askovic, S., Baker, A. H., Johnson-Fowler, C., Portis, J. L.
(2003). Endoplasmic Reticulum Stress Is a Determinant of Retrovirus-Induced Spongiform Neurodegeneration. J. Virol.
77: 12617-12629
[Abstract]
[Full Text]
-
Corazzari, M., Lovat, P. E., Oliverio, S., Pearson, A. D. J., Piacentini, M., Redfern, C. P. F.
(2003). Growth and DNA Damage-Inducible Transcription Factor 153 Mediates Apoptosis in Response to Fenretinide but Not Synergy between Fenretinide and Chemotherapeutic Drugs in Neuroblastoma. Mol. Pharmacol.
64: 1370-1378
[Abstract]
[Full Text]