Previous Article | Next Article 
Molecular and Cellular Biology, February 2001, p. 1285-1296, Vol. 21, No. 4
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.4.1285-1296.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
The CELF Family of RNA Binding Proteins Is
Implicated in Cell-Specific and Developmentally Regulated
Alternative Splicing
Andrea N.
Ladd,
Nicolas
Charlet-B., and
Thomas A.
Cooper*
Department of Pathology, Baylor College of
Medicine, Houston, Texas 77030
Received 13 September 2000/Returned for modification 20 October
2000/Accepted 9 November 2000
 |
ABSTRACT |
Alternative splicing of cardiac troponin T (cTNT) exon 5 undergoes
a developmentally regulated switch such that exon inclusion predominates in embryonic, but not adult, striated muscle. We previously described four muscle-specific splicing enhancers (MSEs) within introns flanking exon 5 in chicken cTNT that are both necessary and sufficient for exon inclusion in embryonic muscle. We also demonstrated that CUG-binding protein (CUG-BP) binds a conserved CUG
motif within a human cTNT MSE and positively regulates MSE-dependent exon inclusion. Here we report that CUG-BP is one of a novel family of
developmentally regulated RNA binding proteins that includes embryonically lethal abnormal vision-type RNA binding protein 3 (ETR-3). This family, which we call CELF proteins for CUG-BP- and
ETR-3-like factors, specifically bound MSE-containing RNAs in vitro and
activated MSE-dependent exon inclusion of cTNT minigenes in vivo. The
expression of two CELF proteins is highly restricted to brain. CUG-BP,
ETR-3, and CELF4 are more broadly expressed, and expression is
developmentally regulated in striated muscle and brain. Changes in the
level of expression and isoforms of ETR-3 in two different
developmental systems correlated with regulated changes in cTNT
splicing. A switch from cTNT exon skipping to inclusion tightly
correlated with induction of ETR-3 protein expression during
differentiation of C2C12 myoblasts. During heart development, the
switch in cTNT splicing correlated with a transition in ETR-3 protein
isoforms. We propose that ETR-3 is a major regulator of cTNT
alternative splicing and that the CELF family plays an important regulatory role in cell-specific alternative splicing during normal development and disease.
 |
INTRODUCTION |
The generation of multiple,
functionally distinct protein isoforms from a single gene via
alternative splicing is a common means of regulating gene expression.
It has been estimated that more than one-third of human genes are
alternatively spliced (21). Despite the prevalence of
alternative splicing, the mechanisms by which it is regulated are not
well understood. Cis-acting elements that mediate
alternative splicing specific to different cell types have been
identified in a few experimental systems (1, 3, 18, 19, 50,
66), and progress in identifying trans-acting factors
involved in tissue-specific regulation, particularly neuron-specific splicing, has been made. KH-type splicing regulatory protein is enriched in neurons and has been isolated as a component of a complex
that activates inclusion of the c-src neuronal N1 exon (43). The KH-type RNA binding protein Nova-1 is expressed
exclusively in neurons of the central nervous system (4)
and activates inclusion of exons in the glycine receptor and
GABAA receptor pre-mRNAs (27). Brain
polypyrimidine tract binding protein (brPTB), a protein related to the
more ubiquitous PTB but enriched in brain, binds to the same sequence
recognized by PTB and antagonizes the effects of Nova-1
(48).
In addition to the use of tissue-restricted factors, cell-specific
alternative splicing may also be regulated by altering the abundance or
activities of constitutive pre-mRNA splicing factors such as the SR
protein family and hnRNP proteins (6, 31, 34, 58). These
factors participate in constitutive splicing, but their expression is
not entirely ubiquitous and undergoes tissue-specific regulation
(14, 20, 30, 57, 65, 68). Regulation of alternative splice
site choices by natural variation in the expression of these proteins,
however, remains to be directly demonstrated.
For many genes, alternative splicing is also modulated in a
developmental-stage-specific manner. Alternative splicing is
determinative for cell fate decisions during development in
Drosophila melanogaster, such as the regulation of sexual
differentiation by the RNA binding protein Sex-lethal (reviewed in
reference 35). Changes in the constitutive splicing
machinery in nematodes also suggest a developmental role for
alternative splicing regulation (54). Factors involved in
the developmental regulation of alternative splicing in vertebrates, however, have not yet been reported.
Many proteins essential for striated muscle development exist in
multiple isoforms generated by alternative splicing, including myogenic
transcription factors, metabolic enzymes, and components of the
myofibril. Skeletal-muscle-specific splicing patterns are induced
during differentiation and can be induced in fibroblasts by expression
of MyoD and myogenin (26, 50, 52). Alternative splicing of
exon 5 of the cardiac troponin T (cTNT) gene undergoes a
developmentally regulated switch such that mRNAs in embryonic striated
muscle include the exon, but mRNAs in the adult do not (11). The developmental regulation of cTNT splicing is
conserved in chickens, mice, rats, and humans (11, 28, 39,
60). The two cTNT isoforms generated by alternative splicing of
exon 5 confer different levels of calcium sensitivity to the
myofilament, thereby affecting the contractile properties of maturing
muscle (16, 40).
Previously, we identified four cis-acting elements within
the introns flanking exon 5 in the chicken cTNT that are both necessary and sufficient to promote exon inclusion specifically in embryonic striated muscle (10, 46, 50). These muscle-specific
splicing enhancers (MSEs) were defined in cTNT minigenes by deletions
or substitutions that prevented the activation of exon 5 inclusion in
embryonic skeletal muscle cultures but that had little effect on the
low level of exon inclusion observed in nonmuscle cultures (10,
46, 50). One of these MSEs, MSE2, is conserved in sequence and
position in chicken and human cTNT (46). MSE2 is necessary and sufficient to promote muscle-specific cTNT exon 5 inclusion in
embryonic skeletal muscle cultures when present in multiple copies
(10). A conserved CUG motif found within MSE2 is found adjacent to alternative exons in several genes that undergo regulated splicing in striated muscle and is required for enhancer activity, suggesting that these elements play a common role in muscle-specific splicing (10, 46).
CUG-binding protein (CUG-BP) is a highly conserved protein that was
purified based on its sequence-specific binding to RNA containing CUG
repeats (59). CUG-BP is proposed to play a role in the
pathogenesis of the trinucleotide expansion disease, myotonic dystrophy
(DM1), in which nuclear accumulation of transcripts of the myotonin
protein kinase (DMPK) gene containing expanded CUG repeats is proposed
to create an RNA gain-of-function mutation. We have shown that CUG-BP
binds to the conserved CUG motif within cTNT MSE2 and positively
regulates MSE-dependent inclusion of exon 5 (46).
Embryonically lethal abnormal vision (ELAV)-type RNA binding protein 3 (ETR-3) (25), which has high sequence similarity to
CUG-BP, has also recently been reported to bind to RNAs containing CUG
triplet repeats (36), suggesting that it may also regulate
the alternative splicing of MSE-containing transcripts.
Here we report the identification of a novel family of splicing
regulators that includes CUG-BP and ETR-3, which we call CELF proteins
for CUG-BP- and ETR-3-like factors. Individual CELF family members are
preferentially expressed in different cell types, and at least two CELF
genes express multiple isoforms via alternative splicing. We
demonstrate that CELF proteins bind to MSE-containing RNAs and activate
MSE-dependent exon inclusion in fibroblasts when coexpressed with cTNT
minigenes. Expression of these proteins is developmentally regulated.
ETR-3 protein expression in particular correlates with changes in cTNT
alternative splicing during heart development in both chickens and mice
and during myogenic differentiation of the mouse C2C12 myoblast cell
line. We propose that ETR-3 is a major regulator of cTNT alternative
splicing. Our results strongly support the hypothesis that the CELF
family plays a critical role in the regulation of cell-specific
alternative splicing during normal development and disease.
 |
MATERIALS AND METHODS |
Identification and analysis of CELF sequences.
ETR3, CELF3,
CELF4, and CELF5 were identified in searches of expressed sequence tag
(EST) and high-throughput genomic sequence databases using a CUG-BP
sequence query. ETR-3 was first identified in a screen of genes
expressed in human fetal heart (25). Alternatively spliced
forms of ETR-3 were recently found in a screen of genes induced during
apoptosis in a neuroblastoma cell line and were called NAPOR-1, -2, and
-3 (7); they were also found by a screen of a liver cDNA
library using a CUG-BP probe (36). A truncated version of
CELF3 called CAGH4 is also found in the database (38). A
potential sixth family member was identified in cosmids from chromosome
15 (accession no. AC009690 and AC009524), but corresponding ESTs could
not be found.
The open reading frames for all five CELF proteins were cloned into the
pcDNA3.1HisC vector (Invitrogen) in frame with the N-terminal Xpress
epitope tag using 5' primers containing the initiation codon and 3'
primers containing the termination codon. CUG-BP primers were
GTTAGTGGATCCATGAACGGCACCCTGGACCA and
GGCCGAAGCTTTCAGTAGGGCTTGCTGT. ETR-3 primers were
CGGTGAGATCTATGAACGGAGCTTTGGA and
CGGTCAAGCTTTCAGTAAGGTTTGCTGTCGT. CELF3 primers were
GTTAGAGGATCCATGAAGGAGCCGGATGCCATCA and
AATTACCTCGAGTCAGTAGGGCCGGTTGGCATCCTTA. CELF4 primers were
GTTAGAGGATCCATGAAGGACCACGATGCCATC and
AATTACCTCGAGTCAGTACGGGCGATTGGCGTCTTTG. CELF5 primers were
CATCATCGGATCCATGGCCCGCCTGACGGAGAG and
CATCATCTCTAGATCACGGGTCTTTGGGCCGCT. For all CELF proteins
except CELF4, the expressed open reading frames begin at the codon for
the first methionine shown in Fig. 1. The open reading frame for CELF4
in the expression vector starts at the codon for the methionine at
position 48, as this was the first known methionine at the time of
cloning; additional ESTs that contain the putative upstream translation
presented in Fig. 1 have subsequently been entered in the database. The
templates for PCR included a CUG-BP cDNA clone provided by L. Timchenko (Baylor College of Medicine, Houston, Tex.) and an ETR-3 cDNA provided
by C. C. Liew (University of Toronto, Toronto, Ontario, Canada).
The 5' ends of CELF3 and CELF4 were not available in the EST database
and were cloned by rapid amplification of cDNA ends (RACE) using the
Marathon RACE kit (Clontech Laboratories, Inc.) on adult brain cDNA
(Clontech). The 5' RACE products provided the sequence of initiation
codons, which were then used to amplify full-length CELF3 and CELF4
from commercial cDNA from adult brain (Clontech). The 5' end of CELF5
mRNA (including the putative initiation codon) was found in cosmid
R31341, and the 3' end of CELF5 mRNA (including the termination codon
and 3' untranslated region [UTR]) was found in in several ESTs. CELF5
was amplified using cDNA generated from human total brain RNA
(Clontech) in a 20-µl reaction mixture containing 2.5 µg of RNA, 50 ng of oligo (dT)12-18 primer (Life Technologies), First
Strand buffer (Life Technologies), 0.01 M dithiothreitol [DTT], 0.5 mM deoxynucleoside triphosphate (dNTP) mixture, and 100 U of avian
myeloblastosis virus reverse transcriptase (Life Technologies). The RNA
and primers were heated to 65°C for 10 min and chilled on ice, and
then the remaining reagents were added and the reaction mixture was
incubated at 42°C for 1 h and at 70°C for 15 min and stored at
20°C. All PCRs were performed in a 50-µl reaction volume
containing Taq Plus Precise buffer (Stratagene, La Jolla,
Calif.), 0.25 mM dNTP mixture, 2.5 µl of dimethyl sulfoxide, 200 ng
of each of the 5' and 3' primers, and 2.5 U of Taq Plus
Precise enzyme (Stratagene) on an MJ Research PTC-100 using 30 cycles
of 95°C for 1 min, 55°C for 1 min, and 72°C for 2 min, followed
by 1 cycle at 72°C for 10 min. PCR products were isolated from 1%
agarose gels using the QIAquick gel extraction kit (Qiagen) and cloned
directly into pcDNA3.1HisC. Sequences were confirmed by overlapping
reads of both strands.
Sequence profile analyses were performed using PROSITE
(24) and PSORTII (44). Nuclear localization
predictions were made using both Reinhardt's NCNN and the k
-NN nearest-neighbor prediction algorithms. The simple modular
architecture research tool (SMART) (56) was used to
identify proteins with a domain structure similar to that of the CELF
proteins. Alignments and phylogenetic analyses were performed using
DNASTAR software, which utilizes the Clustal V method
(23).
Western blots.
Antipeptide antibodies against ETR-3 (against
a 17-amino-acid peptide [QTSATSTNANPLSTGC] conjugated to
keyhole limpet hemocyanin) were generated in rabbits by Cocalico
Biologicals. Antipeptide antibodies against CELF4 (against a
15-amino-acid peptide [CIHPYPAQSPTAADP] conjugated to
keyhole limpet hemocyanin) were generated in rabbits by Anaspec, Inc.
The 3B1 mouse monoclonal antibody against CUG-BP was provided by M. Swanson (University of Florida, Gainsville). Tissues were dissected
from embryonic-day-14, newborn, 4-day-old, and pregnant or 0- to
4-day-postpartum adult female Swiss Webster mice (Taconic Farms, Inc.)
and from embryonic-day-8 to -20 and adult White Leghorn chickens (Texas
A&M University) and homogenized directly in protein loading buffer
(0.64 M Tris-HCl [pH 6.8], 10% glycerol, 2% sodium dodecyl sulfate
[SDS], 5%
-mercaptoethanol). C2C12 murine myoblast cells were
maintained at a density of 20 to 60% confluency in 100-mm-diameter
tissue culture dishes in 10 ml of growth medium (low-glucose Dulbecco
modified Eagle medium [DMEM] supplemented with 20% fetal bovine
serum and 0.5% chick embryo extract) and cultured at 37°C in 5%
CO2. To induce differentiation, growth medium was replaced
with differentiation medium (low-glucose DMEM supplemented with 5%
horse serum) when cells had reached 60% confluency. To collect total
protein samples from C2C12 cultures, cells were rinsed with
phosphate-buffered saline and then scraped directly into protein
loading buffer and sonicated. Protein concentrations were determined
using a noninterfering protein assay (Geno Technology, Inc.). Total
protein samples were resolved on 10% denaturing polyacrylamide gels,
with 50 to 60 µg loaded per lane, and transferred to Immobilon-P membranes (Millipore). Membranes were incubated for 1 h in
blocking solution (5% milk in phosphate-buffered saline plus 0.05%
Tween-20 [PBT]) at room temperature with shaking. The primary
antibody was added, the mixture was incubated for 1 h, and then
the membrane was washed twice for 20 min with PBT and blocked again for
1 h. Goat anti-rabbit or goat anti-mouse horseradish
peroxidase-conjugated secondary antibody (Jackson ImmunoResearch
Laboratories, Inc.) was added, and the mixture was incubated for 1 h; then the membrane was washed three times for 20 min with PBT, and
bands were visualized with SuperSignal chemiluminescent substrate
(Pierce) on Kodak film (Eastman Kodak).
UV cross-linking.
The open reading frames for CUG-BP, ETR-3,
and CELF4 were cloned downstream of glutathione
S-transferase (GST) in the pGEX-2T GST fusion expression
plasmid (Novagen). BL21(DE3)pLysS competent bacteria (Stratagene) were
transformed and tested for the presence of the plasmid. One colony was
grown overnight at 37°C in Terrific broth (53) plus 80 µg of Timentin/ml, diluted 1:10, and grown for an additional 2 h. IPTG (0.1 mM) was added, and cells were grown for 3 h and
pelleted. The cell pellet was resuspended in 0.2 culture volumes of
phosphate-buffered saline and sonicated on ice six times for 10 s
each. Triton X-100 was added to a final concentration of 1%, and the
total lysate was spun for 10 min at 12,000 × g.
Recombinant GST fusion proteins were purified from the supernatant
according to the GST-Bind buffer kit (Novagen) and quantitated using a
protein assay kit (Bio-Rad), and the quantity and purity were checked
on SDS-polyacrylamide gel electrophoresis gels by Coomassie staining
(53).
The templates for in vitro RNA synthesis were derived from the
MSE-containing and MSE-lacking minigenes used for transfection (see
below). The MSE-containing substrate contains 30 nucleotides of the
pBluescript vector (Stratagene) downstream of the T3 promoter, 93 nucleotides of cTNT intron 4 including MSE1, a 63-nucleotide artificial
exon derived from skeletal troponin I
(GGTTCACAACCATCTACGCATTCGAAGAGGCATTGGATCCGAACCAAGCAAGATGTCTGACAG), and 142 nucleotides of cTNT intron 5 including MSE2 to -4. The plasmid was linearized using SpeI (Roche Molecular
Biochemicals). The substrate containing MSEs 2 to 4 was obtained by
removing a SexAI-BamHI (Roche Molecular
Biochemicals) fragment situated between the T3 promoter and the exon
which encompassed MSE1. For the substrates containing the full-length
intron and MSEs 2 to 4, the plasmids were linearized using
SpeI (Roche Molecular Biochemicals); the MSE1 substrate was
obtained by linearizing the MSE1 to 4 template with BstBI
(Roche Molecular Biochemicals), which cuts within the exon. The
linearized plasmids were transcribed with T3 RNA polymerase (Life
Technologies). In vitro synthesis of uniformly labeled RNA was
performed as described previously (9).
UV cross-linking was performed using 1 pmol of substrate (0.4 × 106 to 1.0 × 106 cpm) labeled with
[
-32P]GTP and [
-32P]UTP and 500 ng of
recombinant GST fusion proteins. Proteins and RNA were incubated at
30°C for 10 min with a mixture containing 30 µg of HeLa nuclear
extract (13), 2 mM magnesium acetate, 2 mM ATP, 16 mM
HEPES (pH 7.9) 65 mM potassium glutamate, 0.16 mM EDTA, 0.4 mM DTT, and
16% glycerol. In some experiments, 1 µg of tRNA (Ambion), 1 µg of
bovine serum albumin, and 0.1 µg of heparin were substituted for HeLa
nuclear extract without affecting the results. Incubation with bulk RNA
and protein is necessary to decrease the nonspecific binding of the
recombinant proteins. Reaction mixtures were placed on an aluminum
block prechilled in ice water and irradiated 4 cm from a Philips G15T8
germicidal lamp for 8 min. Samples were digested with 0.5 µg of each
RNase A and RNase T1 (Sigma) at 37°C for 20 min. An equal volume of protein loading buffer was added, and samples were denatured at 90°C
and run on a SDS-12% polyacrylamide gel. Sizes were determined using
prestained markers (Bio-Rad).
Cotransfection experiments.
R35C was derived from RTB33.51
(50) by filling in a BstBI site located 86 nucleotides upstream of the insertion site for the cTNT genomic
fragment in the skeletal troponin I minigene. M2/M2TB has been
described previously (10). RTBPSRAX was derived from
RTBPSR (50) by removing all of the cTNT intron sequence (68 nucleotides between Asp718 and XbaI sites).
QT35 quail fibroblast cells were plated at a density of 1.8 × 106 cells/60-mm-diameter tissue culture dish in 3 to 5 ml
of growth medium (F10 medium supplemented with 5% fetal bovine serum,
1% chick serum, 10% tryptose phosphate, and 2 mM
L-glutamine) and cultured overnight at 37°C in 5%
CO2. The medium was then changed to transfection medium
(low-glucose DMEM supplemented with 10% fetal bovine serum and 2 mM
L-glutamine), and cells were transfected with 2 µg of
minigene DNA and 0 to 10 µg of CELF expression plasmid DNA using
FuGene 6 (Roche Molecular Biochemicals). Medium was replaced with
growth medium at 24 h, and total RNA was harvested 48 h
following transfection by the method of Chomczynski and Sacchi (8) as modified by Xie and Rothblum (63).
Total protein samples were collected from parallel plates by scraping
cells into 250 µl of protein loading buffer and sonicating. Fifty
microliters of each sample was run on a 10% denaturing polyacrylamide
gel, and Western blot analysis was performed as described above using the anti-Xpress antibody (Invitrogen) at 1:5,000. To monitor cTNT splicing during muscle differentiation, C2C12 cells were transfected with 2 µg of R35C minigene DNA using FuGene 6 (Roche Molecular Biochemicals) at 30% confluency. Growth medium was replaced with differentiation medium the next day, and RNA was harvested every 24 h.
The extent of minigene exon inclusion was determined by reverse
transcription-PCR (RT-PCR) analysis. cDNA was generated as described
above. PCR was performed in a 40-µl volume containing Taq
MgCl2-free buffer (Promega), 1.75 mM MgCl2, 0.2 mM dNTPs, 200 ng of each oligonucleotide (CATTCACCACATTGGTGTGC
and AGGTGCTGCCGCCGGGCGGTGGCTG), 1.5 ng of
-32P-labeled 5' primer, and 2.5 U of Taq
(Promega) for 18 cycles of 95°C for 1 min, 55°C for 1 min, and
72°C for 1 min, followed by 1 cycle at 72°C for 5 min. The 5'
primer was labeled with
-32P by incubation with a
mixture containing kinase buffer (70 mM Tris [pH 7.5], 1 mM
MgCl2, 0.5 mM DTT), 0.7 U of polynucleotide kinase (USB
Corporation), enough oligonucleotide for 1.5 ng per PCR, and equal
molar amounts of [
-32P]ATP in a 10-µl volume at
37°C for 30 min. PCR products were resolved on 5% nondenaturing
polyacrylamide gels, and bands were quantitated using a PhosphorImager
(Molecular Dynamics). The extent of endogenous cTNT exon inclusion in
mouse heart was determined by RT-PCR analysis using primers
AGCCGAGAGCATGTCTGACGCCGAGGAGGTGGT (in exon 3) and
CAGCATCTTTGGCTTCATCAGGACCAACCT (in exon 6) and 30 cycles of
amplification. Primer extension of chicken heart RNA was performed
using a 5'-end-labeled oligo nucleotide complementary to cTNT exon 6 as
described previously (64), and the ratios of primer
extension products were quantitated by a PhosphorImager.
Nucleotide sequence accession numbers.
Accession
numbers for the sequences of CELF3, CELF4, and CELF5 are AF329264,
AF329265, and AF329266, respectively.
 |
RESULTS |
Identification of the CELF protein family.
A screen of human
EST databases was performed to identify CUG-BP paralogs based on
sequence similarity. Four proteins closely related to CUG-BP were
found, including ELAV-type RNA binding protein 3 (ETR-3) and three
novel proteins we call CELF3, CELF4, and CELF5 (Fig.
1B). A
potential sixth family member was identified in cosmid sequences from
chromosome 15 (see Materials and Methods), but no corresponding ESTs
were found and this family member was not studied further. The three
novel protein sequences presented are derived from open reading frames
amplified by PCR from human brain cDNA. All five proteins have the same
domain structure (Fig. 1A): three RNA binding domains composed of the
RNP-containing RNA recognition motif (RRM) (reviewed in reference
5) and a domain of unknown function separating RRM2 and
RRM3. We have termed the region separating RRM2 and RRM3 the divergent
domain, because sequence similarities within this domain split the CELF
family into two subgroups of closely related proteins (Fig. 1C), the first containing CUG-BP and ETR-3 (78% identical) and the second containing CELF3, CELF4, and CELF5 (CELF3 and CELF5 have 60.8 and
63.8% identity with CELF4, respectively). BLAST searches reveal that
the divergent domains are unique. No known protein-protein, protein-RNA, or protein-DNA interaction motifs, targeting signals, or
predicted secondary structure were identified within the divergent domain. Variable regions most likely due to alternative splicing were
identified in both ETR-3 and CELF4 (Fig. 1B). CELF3 contains a region
of allelic variation in which a variable number of CAG repeats encode a
stretch of glutamines of unfixed length (Fig. 1B). All of the CELF
proteins contain multiple potential protein kinase C and casein kinase
II phosphorylation sites. All are predicted to have predominantly
nuclear localization, and CELF3, CELF4, and CELF5 each possess a
consensus nuclear localization signal sequence near the C terminus.
CUG-BP is known to be distributed within both the nucleus and cytoplasm
and is detectable by Western blot analysis and gel shift assays in two
isoforms that differ in phosphorylation state and intracellular
distribution (49, 59). Among vertebrate proteins, the CELF
family is most closely related to the Hu family of RNA binding
proteins, homologs of Drosophila nuclear protein ELAV that
have been implicated in the regulation of mRNA stability and
translation (reviewed in reference 32).


View larger version (66K):
[in this window]
[in a new window]
|
FIG. 1.
The CELF family members are closely related. (A) All of
the CELF proteins possess the same domain structure: three RRMs and a
divergent domain of unknown function between RRM2 and RRM3.
Nomenclature is designed to consider CUG-BP and ETR-3 as CELF1 and
CELF2, respectively. (B) Sequences of five human CELF proteins derived
from PCR-amplified cDNAs (see Materials and Methods). Blue, conserved
nonpolar amino acids; red, conserved uncharged polar residues; green,
conserved positively charged residues; gold, conserved negatively
charged residues; black, nonconserved residues. Known alternatively
spliced regions are shaded. Italic's, a region of allelic variation in
CELF3 due to a variable number of CAG repeats. (C) Phylogenetic
relationship of human CELF proteins.
|
|
CELF proteins are widely expressed in adult tissues.
To
examine the expression of CELF family members, commercial RNA dot blots
containing samples from a variety of human tissues were probed with
3'-UTR probes. CELF3 and CELF5 mRNAs were restricted to brain, whereas
CUG-BP, ETR-3, and CELF4 displayed broader patterns of expression (data
not shown). Consistent with these results, CELF3 and CELF5 ESTs were
identified only in brain-derived libraries.
To examine the distribution of the three CELF family members that are
not restricted to brain, Western blot analyses were performed on total
protein samples extracted from a variety of adult mouse tissues (Fig.
2). A mouse monoclonal antibody against CUG-BP and rabbit polyclonal antipeptide antibodies against unique epitopes in ETR-3 and CELF4 were used. Each antipeptide antibody failed
to recognize other CELF proteins that were transiently expressed in
QT35 cells or as recombinant proteins (data not shown). Every tissue
examined expressed one or more of the three CELF proteins, with
skeletal muscle, heart, and brain showing the highest levels of CELF
proteins overall. Each CELF family member was expressed in multiple
tissues with a distinct pattern of tissue distribution. The multiple
bands observed for ETR-3 and CELF4 suggest the presence of multiple
isoforms, with different cell types showing different combinations of
isoforms. At least some of these isoforms are likely to be generated by
alternative splicing (Fig. 1B and data not shown). ETR-3 and CELF4 were
particularly abundant in striated muscle and brain, where multiple
isoforms were observed for each. In skeletal muscle, the pattern of
these isoforms differed depending on the source of the tissue, perhaps
due to differences in fiber type composition.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 2.
CELF proteins are widely expressed. Western blot
analysis was performed on total protein samples extracted from adult,
pregnant or postpartum female Swiss Webster mice. Fifty micrograms of
total protein was loaded in each lane. ETR-3 and CELF4 polyclonal
antipeptide antibodies failed to recognize other CELF proteins as
transiently expressed or recombinant proteins. An abundant 30-kDa
protein was also detected in brain samples on CELF4 blots (data not
shown). The relative intensity of this band was reduced somewhat by the
addition of a protease inhibitor cocktail to the homogenization buffer,
suggesting abundant CELF4 protein expression and cleavage or
degradation in brain.
|
|
CELF family members bind to cTNT MSEs in vitro and positively
regulate MSE-dependent splicing in vivo.
We have previously shown
that CUG-BP binds to a human MSE2-like sequence flanking the human cTNT
alternative exon 5 and promotes MSE-dependent exon inclusion
(46). To determine whether CELF proteins differ in their
ability to bind MSEs, we tested the binding of CUG-BP, ETR-3, and
CELF4, the three CELF proteins expressed in striated muscle, to chicken
cTNT MSEs. Sequence-specific binding of purified recombinant GST fusion
proteins was tested by UV cross-linking using uniformly labeled RNAs
containing MSEs 1 to 4, MSE1, or MSEs 2 to 4 from the chicken cTNT
gene. All three CELF proteins bound to MSEs 1 to 4 and to MSEs 2 to 4 but not to an upstream fragment that contains MSE1 alone (Fig.
3), demonstrating that the binding of
CELF proteins is restricted to the downstream intron. This binding is
not due to the GST portion of the fusion proteins, as CELF fusion
proteins made with other epitope tags demonstrate the same
sequence-specific binding (data not shown). In experiments performed in
the presence of HeLa nuclear extracts, a nonspecific 100-kDa RNA
binding protein demonstrated equivalent levels of binding to all
substrates, indicating that all three RNAs were intact and competent
for binding. Therefore, the CELF proteins bind to a 142-nucleotide
intronic region of the chicken cTNT gene that is sufficient for
activation of exon inclusion in striated muscle (10, 50).
Analysis using scanning mutations has identified multiple CELF protein
binding sites within this region (unpublished data).

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 3.
CELF proteins bind specifically to a downstream
MSE-containing region. UV cross-linking experiments were performed
using purified recombinant GST-CELF fusion proteins and uniformly
32P-labeled RNA (G and U) containing partial or full-length
segments of the cTNT-regulated region. Proteins and RNA were
preincubated in HeLa nuclear extract to increase the specificity of
binding. Similar results were obtained when tRNA, bovine serum albumin,
and heparin were used instead of HeLa nuclear extract (not shown). Each
lane contains equal molar amounts of RNA. An approximately 100-kDa
protein that bound nonspecifically to all three RNA substrates in HeLa
cell nuclear extracts is also shown.
|
|
To determine whether different CELF family members can activate
MSE-dependent exon inclusion, expression vectors for all five CELF
proteins were cotransfected with the R35C minigene that contains a
heterologous alternative exon flanked by MSEs 1 to 4 into QT35 quail
fibroblast cells (Fig. 4A). This exon is
appropriately regulated in embryonic skeletal muscle cultures and is
predominantly skipped in QT35 cells, as in other nonmuscle cells
(10, 50). Western blots probed with antibodies against the
N-terminal epitope tag demonstrated that all of the expression vectors
express proteins of the expected sizes at comparable levels and that
increasing amounts of expression plasmid resulted in increasing amounts
of expressed proteins (data not shown). Cotransfection with each of the
five CELF proteins enhanced the level of exon inclusion in a
dose-responsive manner (Fig. 4B). To determine whether enhanced exon
inclusion by CELF proteins is MSE dependent, 300 ng of each CELF
expression plasmid was cotransfected with a minigene containing the
same alternative exon flanked by human
-globin intron 1 sequences which lack MSEs (Fig. 4C). The extent of exon inclusion in the presence
of 300 ng of CUG-BP, CELF5, CELF4, or CELF3 expression plasmid did not
differ from the level observed for the minigene alone (Fig. 4D). Exon
inclusion was elevated by the addition of 300 ng of ETR-3 expression
plasmid but remained well below levels observed with the MSE-containing
minigene. Therefore, the CELF family members promote the MSE-dependent
exon in vivo on RNA substrates to which they bind in a
sequence-specific manner in vitro.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 4.
CELF proteins promote MSE-dependent exon inclusion. (A)
The MSE-containing R35C minigene contains an alternative exon flanked
upstream by the last 99 nucleotides of cTNT intron 4, which includes
MSE1, and downstream by the first 142 nucleotides of cTNT intron 5, which includes MSEs 2 to 4. This intron-exon-intron cassette is
inserted between exons 2 and 4 of the constitutively spliced chicken
skeletal troponin I gene. RSV, Rous sarcoma virus. (B) Quail QT35
fibroblasts were cotransfected with 2 µg of R35C and 0 ( ), 10, 30, 100, or 300 ng of CUG-BP, ETR-3, CELF5, CELF4, or CELF3 expression
plasmid. Increasing concentrations of expression vector showed
increasing amounts of protein expression (data not shown). RNA was
harvested after 48 h, and RT-PCR analysis was performed to
determine the extent of exon inclusion. (C) The MSE-lacking substrate
RTBPSRAX contains the same alternative exon as R35C flanked upstream by
the last 78 nucleotides of human -globin intron 1 and downstream by
the first 96 nucleotides of the same intron. (D) QT35 cells were
cotransfected with 2 µg of RTBPSRAX alone ( ) and with 300 ng of
CELF5, CELF4, CELF3, ETR-3, or CUG-BP expression plasmid. Asterisk,
cryptic splice observed in some PCRs in which the exon is included but
the 30-nucleotide exon upstream of the alternative exon is skipped. The
appearance of this cryptic splice is inconsistent and represents at
most 15% of spliced mRNAs. It is unknown why this cryptic splice is
enhanced most efficiently by ETR-3, but enhancement does not appear to
be MSE dependent as it is observed for both MSE-containing and
MSE-lacking minigenes. Loading was adjusted so that approximately equal
counts were loaded in each lane.
|
|
Differential ability of CELF proteins to promote exon inclusion via
MSE2 alone.
We previously reported that multiple copies of a
single, 39-nucleotide MSE, MSE2, is sufficient to drive robust
muscle-specific inclusion of a heterologous exon (10). To
determine whether the CELF proteins can promote exon inclusion via this
element alone, CUG-BP, ETR-3, CELF3, CELF4, and CELF5 were
cotransfected in QT35 fibroblasts with the M2/M2TB minigene, which
contains a 59-nucleotide alternative exon flanked on both sides by
three copies of MSE2 (Fig. 5A). Both
CELF3 and CELF4 promoted exon inclusion (Fig. 5B). CELF5 also promoted
exon inclusion, but to a much lesser extent. In contrast, neither
CUG-BP nor ETR-3 affected M2/M2TB exon inclusion (Fig. 5B), even when
up to 10 µg of expression plasmid was cotransfected with the minigene
(data not shown). This difference in ability to promote exon inclusion
via MSE2 alone indicates a functional division of the CELF protein
family into two subgroups, consistent with the division suggested by the sequence analysis discussed above.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 5.
CELF3, CELF4, and to a lesser extent CELF5, but not
CUG-BP or ETR-3, can promote exon inclusion via MSE2 alone. (A) The
M2/M2TB minigene contains a 52-nucleotide exon flanked upstream and
downstream by three copies of the 39-nucleotide cTNT MSE2 from intron
5. RSV, Rous sarcoma virus. (B) QT35 cells were cotranfected with 2 µg of the M2/M2TB minigene and 0 ( ), 10, 30, 100, or 300 ng of
CELF5, CELF4, CELF3, CUG-BP, or ETR-3 expression plasmid. RT-PCR
analysis was performed on RNA harvested 48 h posttransfection.
Loading was adjusted so that approximately equal counts were loaded in
each lane.
|
|
CELF protein expression is dynamic during striated muscle and brain
development.
The expression of CUG-BP, ETR-3, and CELF4 in
striated muscle and brain and the ability of these proteins to regulate
the splicing of cTNT, a transcript that undergoes developmental
stage-specific alternative splicing, prompted us to investigate whether
the expression of these CELF proteins is developmentally regulated in
muscle and brain. To examine the developmental profiles of the three widely expressed CELF proteins, Western blot analyses were performed on
total protein samples collected from mice at different stages of
embryonic and postnatal life using the antibodies against CUG-BP, ETR-3, and CELF4 (Fig. 6). All three
family members displayed changes during development. The abundance of
CUG-BP decreased significantly throughout skeletal muscle development
to low levels in adult thigh muscle. CUG-BP remained constant during
early stages of brain development and was reduced to a very low but
detectable level in the adult brain. ETR-3 increased in abundance in
skeletal muscle and brain and underwent a transition from
high-molecular-mass isoforms (primarily a band at approximately 52 kDa)
in embryonic limb to predominantly lower-molecular-mass isoforms
(approximately 42 and 50 kDa) in adult thigh. CELF4 levels increased in
adult skeletal muscle without any apparent change in isoform
distribution, while a low-molecular-mass isoform (approximately 42 kDa)
is lost in adult brain.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 6.
Developmental profile of CELF proteins in skeletal
muscle and brain. Western blot analysis was performed on total protein
samples extracted from embryonic-day-14 (e14), newborn (NB),
postnatal-day-4 (d4), and adult pregnant or 0- to 4-day-postpartum
female Swiss Webster mice. Fifty micrograms of total protein was loaded
in each lane. In brain samples, high levels of a 30-kDa protein are
observed on CELF4 blots (data not shown), suggesting that a high degree
of tissue-specific cleavage or degradation of CELF4 may be occurring in
brain as described for Fig. 2.
|
|
Changes in ETR-3 protein correlate with developmental changes in
cTNT splicing in cardiac and skeletal muscle.
To test whether
changes in CELF proteins occur concomitantly with changes in cTNT
splicing during development, Western blot analyses were performed on
total protein extracts from heart at different stages of development
using antibodies against CUG-BP, ETR-3, and CELF4. Because the
developmental switch in cTNT splicing is conserved among species,
whole-tissue extracts were collected from both chickens and mice at
various stages of embryonic and postnatal life. Primer extension or
RT-PCR analysis was performed on parallel tissue samples to determine
the extent of cTNT exon 5 inclusion over the same time course. In both
chickens and mice, a dramatic transition from high- to
low-molecular-weight ETR-3 isoforms concomitant with a switch from cTNT
exon inclusion to exon skipping was observed (Fig.
7). Preliminary experiments indicate that
this transition is not due to changes in phosphorylation, and we have
cloned several alternatively spliced forms of ETR-3 from mouse heart
tissue (data not shown). CUG-BP protein levels are somewhat reduced in
the adult heart in both chickens and mice but do not change
concomitantly with changes in cTNT splicing (data not shown). CELF4 is
also slightly reduced in the adult chicken heart but does not undergo
any apparent changes in the avian embryo or in the developing or adult
mouse heart (data not shown). Therefore, the conserved developmental
switch in cTNT splicing occurs concomitantly with a conserved switch in
ETR-3 isoforms.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7.
An ETR-3 isoform switch that correlates with cTNT
splicing is conserved in avian and mammalian heart development. (A)
ETR-3 Western blot of total protein samples extracted from embryonic
and adult chicken hearts. Sixty micrograms of total proteins was loaded
in each lane. (B) Results from primer extension of endogenous cTNT mRNA
from the same time course using a 32P-labeled
oligonucleotide complementary to exon 6. (C) ETR-3 Western blot of
total protein samples from embryonic-day-14 (e14), newborn (NB),
postnatal-day-4 (d4), and adult mouse hearts. Fifty micrograms of total
protein was loaded per lane. (D) RT-PCR of endogenous cTNT was
performed over the same time course and quantitated by
PhosphorImager.
|
|
Muscle-specific splicing is induced as part of the myogenic program,
since it can be induced in fibroblasts by expression of the myogenic
regulators MyoD and myogenin (50). To monitor cTNT
splicing during muscle differentiation, we transfected the R35C
minigene containing MSEs 1 to 4 into C2C12 mouse myoblast cells induced
to differentiate and monitored the extent of exon inclusion over time.
An exogenous minigene was used to examine splicing during myoblast
differentiation because endogenous cTNT mRNA cannot be detected until
differentiation is well under way. As shown in Fig.
8B, cTNT exon inclusion is strongly
induced during C2C12 differentiation. This effect is MSE dependent as
alternative exons flanked by introns that lack MSEs maintain a constant
level of exon inclusion (data not shown). Western blot analysis on
total protein extracts from differentiating C2C12 cultures demonstrates a dramatic increase in ETR-3 protein expression during the same time
course (Fig. 8A). CUG-BP and CELF4 protein levels were invariant during
differentiation (41; data not shown).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 8.
Induction of ETR-3 protein expression and cTNT exon
inclusion occur simultaneously during skeletal muscle differentiation.
(A) ETR-3 Western blot of total protein extracts from C2C12 murine
myoblast cells induced to differentiate. Fifty micrograms of total
protein was loaded in each lane. (B) RT-PCR analysis of cTNT minigene
RNA from similar cultures transfected with R35C harvested over the same
time course. Loading was adjusted so that approximately equal counts
were loaded in each lane.
|
|
 |
DISCUSSION |
A novel family of splicing regulators.
In this study, we
provide evidence that members of the CELF family of RNA binding
proteins are regulators of cell-specific alternative splicing. This
family includes CUG-BP, a protein that has previously been reported to
bind to a conserved intronic splicing element and regulate alternative
splicing in a sequence-dependent manner (46). By screening
human EST databases, we identified four paralogs of CUG-BP including
ETR-3, originally identified in a fetal heart library
(25), and three novel factors we called CELF3, CELF4, and
CELF5. Following submission of the manuscript of this report, another
group reported the identification of these proteins and called them
Bruno-like (BRUNOL) proteins (17). CUG-BP, ETR-3, and
CELF4 all bind to RNA substrates containing chicken cTNT MSEs, and all
five CELF proteins promote MSE-dependent exon inclusion in chicken cTNT
minigene pre-mRNAs in quail fibroblast cells. The ability of the human
CELF proteins to regulate MSE-dependent alternative splicing of avian
cTNT pre-mRNAs, the conservation in sequence and position of MSE2 in
chicken and human cTNT (46), and the high degree of
conservation in the splicing pattern of cTNT transcripts in birds and
mammals (11, 28, 39, 60) all indicate that MSE-dependent
regulation of alternative splicing by the CELF family is a conserved
mechanism of regulating gene expression during development in vertebrates.
Several muscle-specific genes whose pre-mRNAs undergo regulated
alternative splicing contain potential MSE sequences (10), suggesting that the CELF family may be involved in the regulation of
the alternative splicing of a subset of genes in muscle. Although the
total abundance of the three widely expressed CELF proteins was
particularly high in striated muscle tissues, every tissue examined by
Western blot analysis contains at least one CELF family member. Dot
blots indicate that CELF3 and CELF5 are restricted to brain. Together,
these results suggest that each CELF protein may play a distinct role
in alternative splicing in different tissues or act on different target
pre-mRNAs within tissues where more than one family member is present.
The CELF proteins differ in their abilities to activate splicing by
MSE2 alone. We have previously shown that CUG-BP binds to an MSE2-like
sequence downstream of human cTNT exon 5 in correlation with regulation
in vivo (46). CUG-BP (and ETR-3) failed, however, to
activate inclusion of an exon flanked by multiple copies of MSE2 from
the chicken cTNT gene. It should be noted that, in the previous study,
MSE2 was in the context of the natural introns, which presumably
contain additional regulatory elements. Although the binding of CUG-BP
to the human MSE2-like sequence is clearly required for regulation, the
results presented in Fig. 5 indicate that MSE2 binding is not
sufficient. Additional elements flanking MSE2, different spacing
between elements, or elements within human MSE2 not found in chicken
MSE2 are required for CUG-BP function.
CELF proteins as regulators of alternative splicing during normal
development and disease.
The shift in alternative splicing of cTNT
exon 5 from exon inclusion in the embryo to exon skipping in adult
striated muscle is highly conserved in birds and mammals (11, 28,
39, 60). Western blot analysis demonstrates that in both chicken
and mouse heart, ETR-3 undergoes a developmental transition from high-
to low-molecular-weight isoforms concomitant with the switch to cTNT exon 5 skipping. CUG-BP and CELF4 remain largely invariant over this
same time course, strongly suggesting that ETR-3 may be the primary
regulator of cTNT alternative splicing in vivo. Preliminary evidence
suggests that the embryonic and adult ETR-3 isoforms observed in heart
are generated by alternative splicing, and at least some of the larger
ETR-3 isoforms expressed in embryonic mouse heart are also present in
differentiated C2C12 cells (A. N. Ladd and T. A. Cooper,
unpublished observations). Different splice forms of ETR-3 may differ
in their abilities to recognize or bind cTNT RNA, their abilities to
promote exon 5 inclusion, or their nuclear and cytoplasmic
localizations. We have cloned several different ETR-3 splice variants
and are currently addressing this issue. It is possible that a
different splicing factor is responsible for regulating both the switch
in cTNT splicing and the transition in ETR-3 isoforms during heart
development. ETR-3 mRNAs contain potential binding sites for CUG-BP and
ETR-3 (36), which raises the possibility of CELF protein
autoregulation or cross talk in the developing heart, where CUG-BP,
ETR-3, and CELF4 are all highly expressed. There is also a striking
correlation, however, between the level of ETR-3 protein (but not
CUG-BP or CELF4) and the extent of cTNT exon 5 inclusion during
differentiation of myoblasts into myotubes. Preliminary studies of
variants cloned from mouse heart indicate that high-molecular-weight
isoforms promote cTNT exon inclusion (A. N. Ladd and T. A. Cooper, unpublished observations). Both high- and low-molecular-weight
isoforms of ETR-3 protein are induced concomitantly with the increase
in cTNT exon inclusion during C2C12 differentiation. Therefore, in two independent systems (heart development and skeletal muscle
differentiation), changes in cTNT alternative splicing directly
correlate with changes in the expression of high-molecular-weight ETR-3
protein isoforms, ETR-3 shows sequence-specific binding to a conserved
intronic element demonstrated to be required for regulated splicing of cTNT exon 5, and coexpression of ETR-3 with cTNT minigenes promotes element-dependent exon inclusion in fibroblasts. Together, these results strongly suggest that ETR-3 plays a major role in cTNT alternative splicing regulation.
cTNT is likely to be just one of multiple targets of CELF protein
regulation. Although neither CUG-BP nor CELF4 expression correlated
with changes in cTNT splicing in the heart, both underwent developmental changes in skeletal muscle. The abundance of CUG-BP decreased significantly during thigh muscle development, while CELF4
levels increased dramatically during this same period. CUG-BP, ETR-3,
and CELF4 also displayed changes in expression during brain development. This is consistent with their involvement in the developmental-stage-specific regulation of other target pre-mRNAs. CUG-BP has been suggested to play a role in neuron-specific splicing of
an exon in the
2 of GABAA transcripts;
GABAA gene expression is known to undergo changes during
brain development (67). The identification of other CELF
family target genes will be an important goal for future studies.
CELF family members are likely to play a critical role during
development. ETR-1, a putative homolog of CUG-BP in
Caenorhabditis elegans, is essential for muscle
differentiation (42). CUG-BP has also been implicated in
the pathogenesis of myotonic dystrophy (59), a
neuromuscular disease caused by an expansion of an unstable region of
CTG repeats in the 3' UTR of the DMPK gene (2, 15, 37).
Congenital patients have numerous developmental problems, including
arrested or delayed muscle maturation (55), the absence or
reduction of some muscle fiber types, and mental retardation (22). Overexpression of DMPK transcripts containing
expanded CUG repeats suppresses myogenic differentiation in culture
(51, 61), suggesting a direct link between CUG expansion
and the developmental defects observed in congenital patients.
The importance of CELF family function is probably not diminished in
adulthood. DM1 is the most common form of adult onset muscular
dystrophy and is associated with manifestations in several different
tissues. The most affected are striated muscle and brain, the tissues
that demonstrate the highest levels of CELF protein expression. It has
been proposed that the expanded CUG repeats in the DMPK transcripts of
affected individuals create a gain-of-function mutation that affects
the processing of other mRNAs by disrupting RNA processing proteins
(62). Consistent with this model, DMPK is actively
transcribed and both expanded DMPK transcripts (12) and
the hypophosphorylated isoform of CUG-BP (59) accumulate in the nuclei of DM1 cells. The splicing of cTNT is also disrupted in
striated-muscle cultures from DM1 patients and in normal cells expressing transcripts with large CUG repeats (46),
consistent with the altered function of CELF proteins. If CELF family
function is disrupted in DM1, the missplicing of a battery of target
pre-mRNAs including cTNT could explain many of the different
manifestations of the disease in affected individuals.
Other potential functions of the CELF proteins.
Phylogenetic
analysis indicates that the CELF family is most closely related to the
Hu family, which regulates mRNA stability and translation (reviewed in
reference 32). Embryo deadenylation element binding
protein, a homolog of CUG-BP identified in Xenopus laevis,
has been shown to regulate mRNA deadenylation (45). Bruno,
a Drosophila protein similar to CUG-BP, regulates
translation of oskar mRNAs not localized to the
posterior pole of the oocyte (33). Based on the
similarities of the mammalian CELF proteins to these factors, it is
likely that CELF protein function is not limited to regulation of
alternative splicing. Other splicing regulatory factors have been
implicated in transport or processing of mRNAs within the cytoplasm,
including PTB (29), hnRNP A1 (47), and
several SR proteins (6). CUG-BP is known to be localized
in both the nucleus and cytoplasm (49), consistent with
its having roles in both nuclear and cytoplasmic RNA processing events
such as splicing, translation, regulation of mRNA stability, and mRNA
shuttling. Indeed, the loss of cytoplasmic CUG-BP in DM1 cells may
contribute as much to the pathogenesis of DM1 through changes in
translation or mRNA stability as the changes in alternative splicing
caused by its accumulation in the nucleus.
 |
ACKNOWLEDGMENTS |
We thank Lubov Timchenko, C. C. Liew, and Maurice Swanson
for kind gifts of reagents or clones, Claire Lo, Gopal Singh, and Wade
Haaland for their technical assistance, and Sue Berget, Rajesh Savkur,
Chris Smith, and Maurice Swanson for helpful discussions on the manuscript.
This work was supported by grants to T.A.C. from the Muscular Dystrophy
Association and NIH (AR45653). A.N.L. was supported by a postdoctoral
NRSA fellowship from the NIH.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pathology, Baylor College of Medicine, Houston, TX 77030. Phone: (713) 798-3141. Fax: (713) 798-5838. E-mail:
tcooper{at}bcm.tmc.edu.
 |
REFERENCES |
| 1.
|
Black, D. L.
1992.
Activation of c-src neuron-specific splicing by an unusual RNA element in vivo and in vitro.
Cell
69:795-807[CrossRef][Medline].
|
| 2.
|
Brook, J. D.,
M. E. McCurrach,
H. G. Harley,
A. J. Buckler,
D. Church,
H. Aburatani,
K. Hunter,
V. P. Stanton,
J. P. Thirion,
T. Hudson,
R. Sohn,
B. Zemelman,
R. G. Snell,
S. A. Rundle,
S. Crow,
J. Davies,
P. Shelbourne,
J. Buxton,
C. Jones,
V. Juvonen,
K. Johnson,
P. S. Harper,
D. J. Shaw, and D. E. Housman.
1992.
Molecular basis of myotonic dystrophy expansion of a trinucleotide (CTG) repeat at the 3' end of a transcript encoding a protein kinase family member.
Cell
68:799-808[CrossRef][Medline].
|
| 3.
|
Buckanovich, R. J., and R. B. Darnell.
1997.
The neuronal RNA binding protein Nova-1 recognizes specific RNA targets in vitro and in vivo.
Mol. Cell. Biol.
17:3194-3201[Abstract].
|
| 4.
|
Buckanovich, R. J.,
J. B. Posner, and R. B. Darnell.
1993.
Nova, the paraneoplastic Ri antigen, is homologous to an RNA-binding protein and is specifically expressed in the developing motor system.
Neuron
11:657-672[CrossRef][Medline].
|
| 5.
|
Burd, C. G., and G. Dreyfuss.
1994.
Conserved structures and diversity of functions of RNA-binding proteins.
Science
265:615-621[Abstract/Free Full Text].
|
| 6.
|
Cáceres, J. F.,
G. R. Screaton, and A. R. Krainer.
1998.
A specific subset of SR proteins shuttles continuously between the nucleus and the cytoplasm.
Genes Dev.
12:55-66[Abstract/Free Full Text].
|
| 7.
|
Choi, D. K.,
T. Ito,
Y. Mitsui, and Y. Sakaki.
1998.
Fluorescent differential display analysis of gene expression in apoptotic neuroblastoma cells.
Gene
223:21-31[CrossRef][Medline].
|
| 8.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 9.
|
Cooper, T. A.
1992.
In vitro splicing of cardiac troponin T precursors. Exon mutations disrupt splicing of the upstream intron.
J. Biol. Chem.
267:5330-5338[Abstract/Free Full Text].
|
| 10.
|
Cooper, T. A.
1998.
Muscle-specific splicing of a heterologous exon mediated by a single muscle-specific splicing enhancer from the cardiac troponin T gene.
Mol. Cell. Biol.
18:4519-4525[Abstract/Free Full Text].
|
| 11.
|
Cooper, T. A., and C. P. Ordahl.
1985.
A single cardiac troponin T gene generates embryonic and adult isoforms via developmentally regulated alternate splicing.
J. Biol. Chem.
260:11140-11148[Abstract/Free Full Text].
|
| 12.
|
Davis, B. M.,
M. E. McCurrach,
K. L. Taneja,
R. H. Singer, and D. E. Housman.
1997.
Expansion of a CUG trinucleotide repeat in the 3' untranslated region of myotonic dystrophy protein kinase transcripts results in nuclear retention of transcripts.
Proc. Natl. Acad. Sci. USA
94:7388-7393[Abstract/Free Full Text].
|
| 13.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 14.
|
Fu, X. D.
1995.
The superfamily of arginine/serine-rich splicing factors.
RNA
1:663-680[Medline].
|
| 15.
|
Fu, Y. H.,
A. Pizzuti,
R. G. Fenwick,
J. King,
S. Rajnarayan,
P. W. Dunne,
J. Dubel,
G. A. Nasser,
T. Ashizawa,
P. Dejong,
B. Wieringa,
R. Korneluk,
M. B. Perryman,
H. F. Epstein, and C. T. Caskey.
1992.
An unstable triplet repeat in a gene related to myotonic muscular dystrophy.
Science
255:1256-1258[Abstract/Free Full Text].
|
| 16.
|
Godt, R. E.,
R. T. H. Fogaca,
I. K. Silva, and T. M. Nosek.
1993.
Contraction of developing avian heart muscle.
Comp. Biochem. Physiol. [A]
105:213-218[CrossRef].
|
| 17.
|
Good, P. J.,
Q. Chen,
S. J. Warner, and D. Herring.
2000.
A family of human RNA-binding proteins related to the Drosophila Bruno translational regulator.
J. Biol. Chem.
275:28583-28592[Abstract/Free Full Text].
|
| 18.
|
Gooding, C.,
G. C. Roberts,
G. Moreau,
B. Nadal-Ginard, and C. W. Smith.
1994.
Smooth muscle-specific switching of alpha-tropomyosin mutually exclusive exon selection by specific inhibition of the strong default exon.
EMBO J.
13:3861-3872[Medline].
|
| 19.
|
Guo, W.,
G. J. Mulligan,
S. Wormsley, and D. M. Helfman.
1991.
Alternative splicing of beta-tropomyosin pre-mRNA: cis-acting elements and cellular factors that block the use of a skeletal muscle exon in nonmuscle cells.
Genes Dev.
5:2096-2107[Abstract/Free Full Text].
|
| 20.
|
Hanamura, A.,
J. F. Caceres,
A. Mayeda,
B. R. Franza, Jr., and A. R. Krainer.
1998.
Regulated tissue-specific expression of antagonistic pre-mRNA splicing factors.
RNA
4:430-444[Abstract].
|
| 21.
|
Hanke, J.,
D. Brett,
I. Zastrow,
A. Aydin,
S. Delbruck,
G. Lehmann,
F. Luft,
J. Reich, and P. Bork.
1999.
Alternative splicing of human genes: more the rule than the exception?
Trends Genet.
15:389-390[CrossRef][Medline].
|
| 22.
|
Harper, P. S.
1998.
Myotonic dystrophy as a trinucleotide repeat disorder a clinical perspective, p. 115-130.
In
R. D. Wells, and S. T. Warren (ed.), Genetic instabilities and hereditary neurological diseases. Academic Press, Boston, Mass.
|
| 23.
|
Higgins, D. G., and P. M. Sharp.
1989.
Fast and sensitive multiple sequence alignments on a microcomputer.
Comput. Appl. Biosci.
5:151-153[Abstract/Free Full Text].
|
| 24.
|
Hofmann, K.,
P. Bucher,
L. Falquet, and A. Bairoch.
1999.
The PROSITE database, its status in 1999.
Nuceic Acids Res.
27:215-219[Abstract/Free Full Text].
|
| 25.
|
Hwang, D. M.,
W. S. Hwang, and C. C. Liew.
1994.
Single pass sequencing of a unidirectional human fetal heart cDNA library to discover novel genes of the cardiovascular system.
J. Mol. Cell Card
26:1329-1333[CrossRef][Medline].
|
| 26.
|
Ichida, M.,
H. Endo,
U. Ikeda,
C. Matsuda,
E. Ueno,
K. Shimada, and Y. Kagawa.
1998.
MyoD is indispensable for muscle-specific alternative splicing in mouse mitochondrial ATP synthase gamma-subunit pre-mRNA.
J. Biol. Chem.
273:8492-8501[Abstract/Free Full Text].
|
| 27.
|
Jensen, K. B.,
B. K. Dredge,
G. Stefani,
R. Zhong,
R. J. Buckanovich,
H. J. Okano,
Y. Y. Yang, and R. B. Darnell.
2000.
Nova-1 regulates neuron-specific alternative splicing and is essential for neuronal viability.
Neuron
25:359-371[CrossRef][Medline].
|
| 28.
|
Jin, J. P., and J. J. Lin.
1989.
Isolation and characterization of cDNA clones encoding embryonic and adult isoforms of rat cardiac troponin T.
J. Biol. Chem.
264:14471-14477[Abstract/Free Full Text].
|
| 29.
|
Kaminski, A.,
S. L. Hunt,
J. G. Patton, and R. J. Jackson.
1995.
Direct evidence that polypyrimidine tract binding protein (PTB) is essential for internal initiation of translation of encepthalomyocarditis virus RNA.
RNA
1:924-938[Abstract].
|
| 30.
|
Kamma, H.,
D. S. Portman, and G. Dreyfuss.
1995.
Cell type-specific expression of hnRNP proteins.
Exp. Cell Res.
221:187-196[CrossRef][Medline].
|
| 31.
|
Kanopka, A.,
O. Muhlemann,
S. Petersen-Mahrt,
C. Estmer,
C. Ohrmalm, and G. Akusjarvi.
1998.
Regulation of adenovirus alternative RNA splicing by dephosphorylation of SR proteins.
Nature
393:185-187[CrossRef][Medline].
|
| 32.
|
Keene, J. D.
1999.
Why is Hu where? Shuttling of early-response-gene messenger RNA subsets.
Proc. Natl. Acad. Sci. USA
96:5-7[Free Full Text].
|
| 33.
|
Kim-Ha, J.,
K. Kerr, and P. M. Macdonald.
1995.
Translational regulation of oskar mRNA by bruno, an ovarian RNA-binding protein, is essential.
Cell
81:403-412[CrossRef][Medline].
|
| 34.
|
Lin, C. H., and J. G. Patton.
1995.
Regulation of alternative 3' splice site selection by constitutive splicing factors.
RNA
1:234-245[Abstract].
|
| 35.
|
Lopez, A. J.
1998.
Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation.
Annu. Rev. Genet.
32:279-305[CrossRef][Medline].
|
| 36.
|
Lu, X.,
N. A. Timchenko, and L. T. Timchenko.
1999.
Cardiac elav-type RNA-binding protein (ETR-3) binds to RNA CUG repeats expanded in myotonic dystrophy.
Hum. Mol. Genet.
8:53-60[Abstract/Free Full Text].
|
| 37.
|
Mahadevan, M.,
C. Tsilfidis,
L. Sabourin,
G. Shutler,
C. Amemiya,
G. Jansen,
C. Neville,
M. Narang,
J. Barcelo,
K. Ohoy,
S. Leblond,
J. Earlemacdonald,
P. J. Dejong,
B. Wieringa, and R. G. Korneluk.
1992.
Myotonic dystrophy mutation an unstable CTG repeat in the 3' untranslated region of the gene.
Science
255:1253-1255[Abstract/Free Full Text].
|
| 38.
|
Margolis, R. L.,
M. R. Abraham,
S. B. Gatchell,
S. H. Li,
A. S. Kidwai,
T. S. Breschel,
O. C. Stine,
C. Callahan,
M. G. McInnis, and C. A. Ross.
1997.
cDNAs with long CAG trinucleotide repeats from human brain.
Hum. Genet.
100:114-122[CrossRef][Medline].
|
| 39.
|
McAuliffe, J. J.
1994.
Delineation of the cardiac troponin T expression pattern during murine development.
J. Cell. Biochem.
18(Suppl.):W347.
|
| 40.
|
McAuliffe, J. J.,
L. Z. Gao, and R. J. Solaro.
1990.
Changes in myofibrillar activation and troponin C Ca2+ binding associated with troponin T isoform switching in developing rabbit heart.
Circ. Res.
66:1204-1216[Abstract/Free Full Text].
|
| 41.
|
Miller, J. W.,
C. R. Urbinati,
P. Teng-Umnuay,
M. G. Stenberg,
B. J. Byrne,
C. A. Thornton, and M. S. Swanson.
2000.
Recruitment of human muscleblind proteins to (CUG)n expansions associated with myotonic dystrophy.
EMBO J.
19:4439-4448[CrossRef][Medline].
|
| 42.
|
Milne, C. A., and J. Hodgkin.
1999.
ETR-1, a homologue of a protein linked to myotonic dystropy, is essential for muscle development in Caenorhabditis elegans.
Curr. Biol.
9:1243-1246[CrossRef][Medline].
|
| 43.
|
Min, H.,
C. W. Turck,
J. M. Nikolic, and D. L. Black.
1997.
A new regulatory protein, KSRP, mediates exon inclusion through an intronic splicing enhancer.
Genes Dev.
11:1023-1036[Abstract/Free Full Text].
|
| 44.
|
Nakai, K., and M. Kanehisa.
1992.
A knowledge base for predicting protein localization sites in eukaryotic cells.
Genomics
14:897-911[CrossRef][Medline].
|
| 45.
|
Paillard, L.,
F. Omilli,
V. Legagneux,
T. Bassez,
D. Maniey, and H. B. Osborne.
1998.
EDEN and EDEN-BP, a cis element and an associated factor that mediate sequence-specific mRNA deadenylation in Xenopus embryos.
EMBO J.
17:278-287[CrossRef][Medline].
|
| 46.
|
Philips, A. V.,
L. T. Timchenko, and T. A. Cooper.
1998.
Disruption of splicing regulated by a CUG-binding protein in myotonic dystrophy.
Science
280:737-741[Abstract/Free Full Text].
|
| 47.
|
Piñol-Roma, S., and G. Dreyfuss.
1992.
Shuttling of pre-mRNA binding proteins between nucleus and cytoplasm.
Nature
355:730-732[CrossRef][Medline].
|
| 48.
|
Polydorides, A. D.,
H. J. Okano,
Y. Y. Yang,
G. Stefani, and R. B. Darnell.
2000.
A brain-enriched polypyrimidine tract-binding protein antagonizes the ability of Nova to regulate neuron-specific alternative splicing.
Proc. Natl. Acad. Sci. USA
97:6350-6355[Abstract/Free Full Text].
|
| 49.
|
Roberts, R.,
N. A. Timchenko,
J. W. Miller,
S. Reddy,
C. T. Caskey,
M. S. Swanson, and L. T. Timchenko.
1997.
Altered phosphorylation and intracellular distribution of a (CUG)n triplet repeat RNA-binding protein in patients with myotonic dystrophy and in myotonin protein kinase knockout mice.
Proc. Natl. Acad. Sci. USA
94:13221-13226[Abstract/Free Full Text].
|
| 50.
|
Ryan, K. J., and T. A. Cooper.
1996.
Muscle-specific splicing enhancers regulate inclusion of the cardiac troponin T alternative exon in embryonic skeletal muscle.
Mol. Cell. Biol.
16:4014-4023[Abstract].
|
| 51.
|
Sabourin, L. A.,
K. Tamai,
M. A. Narang, and R. G. Korneluk.
1997.
Overexpression of 3'-untranslated region of the myotonic dystrophy kinase cDNA inhibits myoblast differentiation in vitro.
J. Biol. Chem.
272:29626-29635[Abstract/Free Full Text].
|
| 52.
|
Saitoh, O.,
E. N. Olson, and M. Periasamy.
1990.
Muscle-specific RNA processing continues in the absence of myogenin expression.
J. Biol. Chem.
265:19381-19384[Abstract/Free Full Text].
|
| 53.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 54.
|
Sanford, J. R., and J. P. Bruzik.
1999.
Developmental regulation of SR protein phosphorylation and activity.
Genes Dev.
13:1513-1518[Abstract/Free Full Text].
|
| 55.
|
Sarnat, H. B., and S. W. Silbert.
1976.
Maturational arrest of fetal muscle in neonatal myotonic dystrophy. A pathologic study of four cases.
Arch. Neurol.
33:466-474[Abstract].
|
| 56.
|
Schultz, J.,
F. Milpetz,
P. Bork, and C. P. Ponting.
1998.
SMART, a simple modular architecture research tool: identification of signalling domains.
Proc. Natl. Acad. Sci. USA
95:5857-5864[Abstract/Free Full Text].
|
| 57.
|
Screaton, G. R.,
J. F. Caceres,
A. Mayeda,
M. V. Bell,
M. Plebanski,
D. G. Jackson,
J. I. Bell, and A. R. Krainer.
1995.
Identification and characterization of three members of the human SR family of pre-mRNA splicing factors.
EMBO J.
14:4336-4349[Medline].
|
| 58.
|
Singh, R.,
J. Valcarcel, and M. R. Green.
1995.
Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins.
Science
268:1173-1176[Abstract/Free Full Text].
|
| 59.
|
Timchenko, L. T.,
J. W. Miller,
N. A. Timchenko,
D. R. Devore,
K. V. Datar,
L. J. Lin,
R. Roberts,
C. T. Caskey, and M. S. Swanson.
1996.
Identific |