Previous Article
Molecular and Cellular Biology, February 2001, p. 1429-1439, Vol. 21, No. 4
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.4.1429-1439.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Human L1 Retrotransposition: cis
Preference versus trans Complementation
Wei
Wei,1
Nicolas
Gilbert,1
Siew Loon
Ooi,2
Joseph F.
Lawler,2
Eric M.
Ostertag,3
Haig H.
Kazazian,3
Jef D.
Boeke,2 and
John V.
Moran1,*
Departments of Human Genetics and Internal
Medicine, The University of Michigan Medical School, Ann Arbor,
Michigan 481091; Department of Molecular
Biology and Genetics, Johns Hopkins School of Medicine, Baltimore,
Maryland 212052; and Department of
Genetics, The University of Pennsylvania Medical School,
Philadelphia, Pennsylvania 191043
Received 21 August 2000/Returned for modification 18 October
2000/Accepted 6 November 2000
 |
ABSTRACT |
Long interspersed nuclear elements (LINEs or L1s) comprise
approximately 17% of human DNA; however, only about 60 of the
~400,000 L1s are mobile. Using a retrotransposition assay in cultured
human cells, we demonstrate that L1-encoded proteins predominantly
mobilize the RNA that encodes them. At much lower levels, L1-encoded
proteins can act in trans to promote retrotransposition of
mutant L1s and other cellular mRNAs, creating processed pseudogenes.
Mutant L1 RNAs are mobilized at 0.2 to 0.9% of the retrotransposition
frequency of wild-type L1s, whereas cellular RNAs are mobilized at much lower frequencies (ca. 0.01 to 0.05% of wild-type levels). Thus, we
conclude that L1-encoded proteins demonstrate a profound
cis preference for their encoding RNA. This mechanism could
enable L1 to remain retrotransposition competent in the presence of the overwhelming number of nonfunctional L1s present in human DNA.
 |
INTRODUCTION |
Retrotransposons are DNA sequences
that can move (i.e., retrotranspose) to different genomic locations via
an RNA intermediate. They are present in the genomes of virtually all
eukaryotes and can be subdivided into two general structural classes.
Long terminal repeat (LTR) retrotransposons resemble simple
retroviruses but lack a functional envelope (Env) gene
(2). Non-LTR retrotransposons lack LTRs and generally
terminate in a polyadenylic acid [poly(A)] tail (20,
23).
L1s are the most abundant non-LTR retrotransposons in the human genome
and comprise approximately 17% of nuclear DNA (42). The
overwhelming majority of L1s are retrotransposition defective (RD-L1s)
and cannot retrotranspose because they are 5' truncated, internally
rearranged, or mutated (23); however, an estimated 30 to
60 human L1s remain retrotransposition competent (RC-L1s) (40). RC-L1s are 6.0 kb in length and contain a 5'
untranslated region (UTR) harboring an internal promoter
(43), two nonoverlapping open reading frames (open reading
frame 1 [ORF1] and ORF2) (7, 41), and a 3' UTR ending in
an unorthodox poly(A) tail (20, 46). In addition, these
elements are flanked by variable-length target site duplications, which
are hallmarks of the retrotransposition process (20).
Non-LTR retrotransposons encode endonuclease activities, which can
generate either site-specific (4, 11, 47) or relatively non-site-specific nicks in chromosomal DNA (5, 10). The
liberated 3' hydroxyl residue then acts as a primer for reverse
transcription of the retrotransposon RNA by the retrotransposon-encoded
reverse transcriptase (RT) by a mechanism termed target site-primed
reverse transcription (TPRT) (28, 29). Thus, the processes
of integration and reverse transcription are coupled for non-LTR retrotransposons.
Biochemical studies revealed that ORF1 encodes a 40-kDa RNA binding
protein that colocalizes with L1 RNA in cytoplasmic ribonucleoprotein particles (RNPs) (17, 18). ORF2 encodes a multifunctional protein containing endonuclease and RT activities (10, 34) and also has a carboxyl-terminal cysteine-rich domain (C) of unknown function (9). Using an assay to monitor L1
retrotransposition in cultured human HeLa cells, we demonstrated that a
wide variety of site-directed point mutations in conserved domains of
the ORF1- and ORF2-encoded proteins essentially abolish L1
retrotransposition (10, 37).
L1 retrotransposition can be mutagenic and has resulted in various
genetic disorders (23, 24). The characterization of mutagenic L1 insertions in humans and mice yielded the unexpected finding that each insertion is derived from a progenitor L1 containing intact ORFs (7, 19, 25, 38). Thus, despite the vast
majority of RD-L1s in the genome, it appears that only RNAs derived
from RC-L1s efficiently retrotranspose (i.e., the L1 proteins
demonstrate an apparent cis preference) (7, 8,
37). Paradoxically, it also is proposed that the proteins
encoded by RC-L1s function in trans to promote both
processed pseudogene formation and the retrotransposition of certain
short interspersed nuclear elements (SINEs) (1, 6, 8, 21, 23, 30,
44).
Here, we use a two-plasmid complementation assay to demonstrate that
the RC-L1 proteins preferentially mobilize the transcript from which
they are encoded. This cis-preference mechanism likely allows RC-L1s to persist despite the presence of overwhelming numbers
of nonfunctional elements. We further show that the RC-L1 proteins can
function at a low level in trans to retrotranspose both
mutant L1 RNAs and cellular mRNAs, resulting in the formation of
processed pseudogenes.
 |
MATERIALS AND METHODS |
The oligonucleotides used in this study were as follows:
437SNEO, 5'-CAGCCCCTGATGCTCTTCGTCC; 6664NEO,
5'CCCTTCCCGCTTCAGTGACA; 1808ASNEO,
5'-CATTGAACAAGATGGATTGCACGC; RT TESTB,
5'-CGATTTCGAACCCTGACGTC; ORF1END,
5'-TACCAGCCGCTGCAAAATCATGCC; PAI1B5',
5'-GCCCTCACCTGCCTAGTCC; PAI1BMID,
5'-GGGAGAGAAGTTTGAAGCAC; PAI1B3',
5'-CAGAGTGAATGTCCCCCATC; ABL5',
5'-TTTATGGGGCAGCAGCCTGGAAAAGTACTTGGG; ABL3',
5'-TCACTGGGTCCAGCGAGAAGGTTTTCCTTGGAGTT; IPCRPAI1B1,
5'-GATGGGGGACATTCACTCTG; IPCRPAI1B2,
5'-CTGTCACCAGCCTCCTCCG; L1PCRA,
5'-GGTTCGAAATCGATAAGCTTGG; L1IPCRB,
5'-GGACAAACCACAACTAGAATGC; JB3169,
5'-TAATACGACTCACTATAGGGGTTGACGCAAATGGGCGGTAGGCGTGTACGG; JB3165,
5'-AATTAACCCTCACTAAAGGGCAGGTTGACGCAAATGGGCGGTAGGCGTGTACGG; JB3168,
5'-TAATACGACTCACTATAGGGCAGCGGGCAGTTCGGTTTCAGGCAGGTCTTGC; and JB3167,
5'-AATAACCCTCACTAAAGGGCAGCCAGCGTCTTGTCATTGGCGAATTCGAACACGC.
Recombinant DNA plasmids.
The following recombinant plasmids
contain the indicated restriction fragments of L1 DNA cloned into pCEP4
(Invitrogen) unless otherwise indicated.
pJM108/L1.3 contains a 7.2-kb NotI-BamHI fragment
containing L1.3 ORF1, L1.3 ORF2, and the mneoI indicator
cassette. A nonsense mutation (S119X) is present in ORF1. The mutation
introduces a BclI restriction site.
pJM111/L1.3 contains a 7.2-kb
NotI-
BamHI fragment
containing L1.3 ORF1, L1.3 ORF2, and the
mneoI indicator
cassette. Two missense
mutations (R261A and R262A) are present in ORF1.
The mutation
introduces a
SacII restriction
site.
pJM116/L1.3 contains a 7.2-kb
NotI-
BamHI fragment
containing L1.3 ORF1, L1.3 ORF2, and the
mneoI indicator
cassette. A missense
mutation (H230A) is present in the endonuclease
domain of ORF2.
The mutation introduces an
NheI restriction
site.
pJM105/L1.3 contains a 7.2-kb
NotI-
BamHI fragment
containing L1.3 ORF1, L1.3 ORF2, and the
mneoI indicator
cassette. A missense
mutation (D702A) is present in the RT domain of
ORF2. The mutation
introduces a
PvuII site into the
plasmid.
pJM124/L1.3 contains a 7.2-kb
NotI-
BamHI fragment
containing L1.3 ORF1, L1.3 ORF2, and the
mneoI indicator
cassette. The construct
contains two missense mutations (R261A and
R262A) in ORF1 and
a missense mutation (D702A) in the RT domain of
ORF2.
pJM101/L1.3

neo and pJM101/L1
RP 
neo (and mutant
derivatives) contain 6.0-kb
NotI-
BamHI fragments
containing the complete
sequence of L1.3 or L1
RP,
respectively. These clones lack the
mneoI indicator
cassette.
L1.3 ORF1mneoI contains a 3.8-kb
NotI-
BamHI fragment containing the L1.3 5' UTR,
L1.3 ORF1, and the
mneoI cassette.
pPAI1amneoI contains a 2.8-kb
NotI-
BamHI fragment containing a 1.0-kb fragment
of PAI1 cDNA and the
mneoI indicator cassette.
The 1.0-kb
PAI1 cDNA fragment is in the antisense
orientation.
pPAI1bmneoI contains a 3.8-kb
NotI-
BamHI fragment containing a 2.0-kb fragment
of PAI1 cDNA and the
mneoI indicator cassette.
The increased
length of the PAI1 cDNA is due to a length increase
in the 3' UTR
because of the use of an alternative polyadenylation
site.
pPAI1cmneoI contains a 2.8-kb
NotI-
BamHI fragment containing a 1.0-kb fragment
of PAI1 cDNA and the
mneoI indicator
cassette.
p

GAL-

NLS and p

GAL-

NLS contain the

or

fragments,
respectively, of the

-galactosidase gene
35 in the pRK5
mammalian
expression vector. Each fragment is expressed from the
cytomegalovirus
(CMV) immediate-early promoter and uses the simian
virus 40 (SV40)
late polyadenylation signal; therefore, they are in
expression
contexts similar to that of the L1s used in this
study.
DNA preparation and DNA sequencing.
Plasmid DNAs were
purified on Qiagen Maxi or Midi prep columns according to the
procedures specified by the manufacturer. DNAs for transfection
experiments were checked for superhelicity by electrophoresis on 0.7%
agarose-ethidium bromide gels. Only highly supercoiled preparations of
DNA (>90%) were used for transfection. Genomic DNA from tissue
culture cells was isolated using the Blood and Cell Midi Prep Kit
(Qiagen). DNA sequencing was performed on an Applied Biosystems DNA
sequencer (ABI 377) at the University of Michigan Core facilities.
Growth of HeLa cells.
HeLa cells were grown at 37°C in an
atmosphere containing 7% carbon dioxide and 100% humidity in Dulbecco
modified Eagle medium (DMEM)-high-glucose medium lacking pyruvate
(Gibco-BRL). DMEM was supplemented with 10% fetal bovine calf serum,
0.4 mM glutamine, and 20 U of penicillin-streptomycin per ml
(DMEM-complete). Cell passage and cloning of cells by limiting dilution
was performed using standard techniques.
Transfection conditions.
We used a modified version of a
transient-transfection protocol (45). Approximately 2 × 105 cells/ml were plated in each well of a six-well
dish, and the cells were grown to about 50 to 80% confluency. The
following day, duplicate dishes were cotransfected with equal amounts
of a reporter plasmid (pGreen Lantern) and an L1 allele tagged with the
mneoI indicator cassette. We routinely use 3 µl of
Fugene-6 transfection reagent (Roche Molecular Biochemicals) and 0.5 to 1.0 µg of Qiagen prepared DNA per transfection reaction for HeLa cells plated in six-well dishes. For 175-cm2 plates, we
typically plate 6 × 106 HeLa cells/dish and use 90 µl of Fugene and 30 µg of DNA per transfection reaction
(45). At 72 h posttransfection, the HeLa cells in one
set of tissue culture dishes were trypsinized and subjected to flow
cytometry. The percentage of green fluorescent cells was used to
determine the transfection efficiency of each sample (39,
45). The remaining samples were visualized to ensure that they
were transfected and then were subjected to G418r selection
(400 µg/ml) to score for retrotransposition. After 12 days, the media
were aspirated, the cells were washed in 1× phosphate-buffered saline
(PBS), and the washed cells were fixed to plates by treating with FIX
solution (2% formaldehyde [of a 37% stock solution in water], 0.2%
glutaraldehyde, 1× PBS) at 4°C for 30 min. The fixed cells were then
stained with 0.4% Giemsa at room temperature overnight. The
retrotransposition efficiency was then scored as the number of
G418r foci/number of cells transfected with green
fluorescent protein (GFP).
Fluorescent microscopy and fluorescence-activated cell scanning
(FACS).
Fluorescence microscopy was performed using a Leica DM-IL
inverted microscope with an ultra-high-pressure lamp (HBO/50W), a
vertical fluorescence illuminator, and a fluorescein isothiocyanate filter set (530-nm peak excitation; Chroma). The cells were prepared for cell sorting by washing them once with 2 ml of PBS and then were
removed from six-well dishes with trypsin (0.05% solution; Gibco-BRL).
The suspended cells were transferred to polystyrene tubes and kept on
ice until FACS analysis. Cells were analyzed with a Coulter Epics Elite
tabletop analysis instrument (Beckman-Coulter) containing a blue argon
laser (488 nm) and fluorescein filter sets (525-band-pass filter).
Between 10,000 and 20,000 cells were analyzed per sample. Live-dead
gating was performed based on the forward-scatter versus the
side-scatter profile. Living cells were analyzed for fluorescence
intensity, and the proportion of GFP-positive cells was determined.
Mock-transfected HeLa cells were used as negative controls in these
experiments. Data analysis was performed using the Coulter Elite
software package.
PCR analysis.
PCR reactions were carried out in 50-µl
volumes. Each reaction contained 10 U of Taq polymerase, 0.2 mM concentrations of deoxynucleoside triphosphates (dNTPs), and 200 ng
of each primer in the buffer supplied by the vendor (Perkin-Elmer). In
general, reactions were conducted at an annealing temperature 5°C
below the Tm of the primer. One-fifth of the
reaction volume was separated on 1% agarose gels containing ethidium bromide.
Inverse PCR.
The procedure described below was adapted from
that of Li et al. (27). HeLa cell DNA (5 µg) derived
from G418r clonal lines was digested to completion with
either XbaI or SspI (New England Biolabs) in a
total reaction volume of 50 µl; heating at 65°C for 30 min stopped
the reactions. Restricted DNA was circularized by dilution and ligation
using T4 DNA ligase (3,200 U; New England Biolabs) in a volume of 600 µl at 16°C for at least 16 h. The ligated DNA was precipitated
with ethanol and dissolved in 40 µl of distilled water. Then, 2 µl
of DNA was used in the primary PCR reaction in a 50-µl reaction
volume containing a 20 nM concentration of each dNTP, 10 pmol of
primers IPCRPAI1B1 and L1IPCRA, 1× buffer 2, and 2.5 U of enzyme mix
in the Expand Long Template PCR system (Roche Molecular Biochemicals).
We used a Hybaid Thermocycler programmed as follows: 95°C for 2 min,
followed by 30 cycles of 94°C for 10 s, 63°C for 30 s,
and 68°C for 15 min, and a final extension step at 68°C for 30 min.
The amount of primary PCR was semiquantified on a 0.7%
agarose-ethidium bromide gel, and 1 µl was used in a secondary PCR
reaction using the same conditions, except that we used primers
IPCRPAI1B2 and L1IPCRB. The secondary PCR product was separated on a
0.7% agarose-ethidium bromide gel, the product was band isolated using
GeneClean (Bio 101), and the gel purified fragment was cloned into
pGEM-T easy (Promega) using the manufacturer's protocols.
RNase protection analysis.
A total of 106 HeLa
cells were transfected with 2.5 µg of plasmid using
Lipofectamine-Plus reagent as described by the manufacturer (Gibco-BRL). Approximately 52 h after transfection, transfected cells were lysed directly in 1 ml of TRIzol reagent (Gibco-BRL), and
the total RNA was isolated as described by the manufacturer. The total
RNA was subjected to RQ1 DNase (Promega) digestion at 37°C for 20 min. The resultant RNA was extracted with phenol-chloroform and
collected by ethanol precipitation. PCR products containing T7 promoter
sequences were used as template for in vitro transcription, which was
carried out using T7 RNA polymerase in the presence of
[
-32P]CTP using the Maxiscript in vitro transcription
kit (Ambion). The primers JB3169 and JB3165 were used to generate the
L1 probes, while JB3168 and JB3167 were used to generate the
hyg probe (see above). JB3169 and JB3168 contain T7 promoter
sequences, while JB3165 and JB3167 contain T3 promoter sequences. The
RNA ladder was similarly transcribed using RNA Century Marker Plus
Template Set (Ambion) as a template. Incubating the resultant samples
with 2 U of DNase at 37°C for 15 min (Ambion) degraded the DNA
templates. RNase protection assays were performed using the RPA III
nuclease protection kit as described by the manufacturer (Ambion).
Briefly, 20 µg of total RNA were hybridized to gel-purified labeled
RNA probes at 42°C overnight. The hybridization products were
digested using a mixture of RNase A (0.375 U) and RNase T1 (15 U) for
12 h. The remaining products were precipitated and resolved on 5% denaturing polyacrylamide gels.
 |
RESULTS |
ORF1 and ORF2 mutants are not complemented efficiently.
We
previously demonstrated that missense mutations in conserved domains of
the ORF1- and ORF2-encoded proteins greatly reduce or abolish the
ability of L1 to retrotranspose (10, 37). Here, we sought
to determine whether RD-L1s tagged with the mneoI indicator cassette could be complemented if they were cotransfected into HeLa
cells with a RC-L1 lacking the cassette (Fig.
1). The absence of G418r foci
would be consistent with a cis-preference model. However, the absence of G418r foci also could occur either if
expression of the RD-L1 proteins interfered with the function of the
RC-L1 proteins or if the RD-L1 RNA were unstable. By contrast, the
presence of G418r foci would suggest that the RC-L1
proteins function in trans to retrotranspose RD-L1 RNAs.
However, G418r foci also could arise if the RC-L1
recombined with the mneoI-tagged RD-L1 to create a
recombinant L1, which could undergo subsequent retrotransposition
in cis.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Rationale of the assay. Retrotransposition-defective L1s
(RD-L1s) containing the mneoI indicator cassette were
cotransfected into HeLa cells with retrotransposition-competent L1s
(RC-L1s) lacking the cassette, and retrotransposition was determined as
described in Materials and Methods. Explanations for the possible
experimental outcomes are noted.
|
|
As a control for cotransfection, we used a two-plasmid system to
demonstrate efficient
trans complementation of

-galactosidase

and

fragments in HeLa cells (Fig.
2A; see Materials and Methods)
(
35). Thus, HeLa cells efficiently can accommodate and
express
proteins from two different expression vectors. Next, we
conducted
RT-PCR (not shown) and RNase protection assays to demonstrate
that both RC-L1 and RD-L1 RNAs are expressed at similar levels
(Fig.
2B
and C, lanes 2 to 7). Thus, the RD-L1 mutants do not
dramatically
affect the stability of L1 RNA.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 2.
Controls used in this study. (A) trans
complementation of -galactosidase enzymatic activity in HeLa cells.
Plasmids with the or regions of the -galactosidase
gene that contained a nuclear localization signal (nls) were
transfected into HeLa cells individually or together, and
-galactosidase activity was monitored 3 days posttransfection
(35). Mock transfection (no DNA) and a wild-type
-galactosidase gene (CMV -gal; Clontech; GenBank accession
no. U02451) served as negative and positive controls, respectively. (B)
Mutants used in this study. Mutations in ORF1 or the endonuclease or RT domains of L1.3mneoI
are indicated. The wild-type amino acids that were mutated are
underlined. The arrows indicate the mutant amino acid sequence changes
(e.g., ARR was changed to AAA). (C) RNA expression of representative L1
constructs. Structures of the hyg (hygromycin resistance
gene) and L1 probes. Sizes of the full-length input and protected bands
are indicated at the top of the figure. RNase protection assays were
carried out of total RNAs prepared from HeLa cells transfected with the
indicated plasmids. Probes that have undergone the RNase protection
assay with (lanes 8 and 10) or without (lanes 9 and 11) the addition of
RNase are shown. A longer exposure of the pCEP4-derived hyg
transcripts, which serves as an internal control, is shown in the
bottom panel. Consistent with earlier studies, we were unable to detect
the expression of endogenous L1 transcripts in HeLa cells
(43).
|
|
We first asked whether RD-L1s containing either a nonsense or a
missense mutation in L1.3 ORF1 (JM108/L1.3 and JM111/L1.3;
Fig.
2B)
could be complemented if they were cotransfected into
HeLa cells with
equal molar amounts of an RC-L1 lacking the
mneoI indicator
cassette (JM101/L1.3

neo). As expected, the mutants
could not
retrotranspose by themselves (Table
1).
However, upon
cotransfection of the RD-L1s with JM101/L1.3

neo, some
G418
r foci were obtained (0.2 to 0.3% of the level of
JM101/L1.3; Fig.
3A; Table
1), indicating
that the L1.3 ORF1-encoded protein may
function at a low level in
trans.

View larger version (98K):
[in this window]
[in a new window]
|
FIG. 3.
L1s retrotranspose in cis. (A) Results of the
retrotransposition assay. RD-L1s containing the mneoI
indicator cassette were cotransfected into 2 × 105
HeLa cells with an RC-L1 lacking the cassette (JM101/L1.3 neo).
G418r foci were fixed and stained with Giemsa for
visualization. Samples cotransfected with JM101/L1.3 neo and
representative mutants in ORF1 (JM111/L1.3), the endonuclease or RT
domains of ORF2 (JM116/L1.3 or JM105/L1.3), or a double mutant
(JM124/L1.3) are shown. Cells transfected with JM101/L1.3, as well as
1/10 (2 × 104) and 1/100 (2 × 103)
dilutions of transfected cells are indicated as positive controls.
Cells transfected with JM105/L1.3 are shown as a negative control. (B)
The coexpression of RD-L1s does not inhibit RC-L1 retrotransposition. A
RC-L1 containing the mneoI indicator cassette (JM101/L1.3)
was cotransfected into 2 × 104 HeLa cells with RD-L1s
lacking the cassette, and retrotransposition was determined as
described above. An experiment using a 1:9 (RC-L1 to RD-L1) molar ratio
of transfected DNAs is shown. Cells transfected with JM101/L1.3 and an
empty expression vector (CEP4) yielded G418r foci at
roughly the same levels as cells that were cotransfected with
JM101/L1.3 and RD-L1s lacking the indicator cassette (i.e., there was
less than a 20% difference between respective samples). JM105/L1.3 was
used as a negative control. Notably, RD-L1s whose transcription is
driven from either the CMV promoter or the CMV promoter and L1 5' UTR
are complemented to similar extents (not shown).
|
|
Next, we repeated the experiment to determine whether RD-L1s containing
point mutations in either the endonuclease (pJM116/L1.3)
or the RT
domain (pJM105/L1.3) of L1.3 ORF2 could be complemented
in
trans. Again, the mutant constructs alone could not
retrotranspose
efficiently (<0.04% of the level of JM101/L1.3; Table
1). However,
cotransfection with JM101/L1.3

neo resulted in a modest
increase
in the number of G418
r foci (ca. 0.7 to 0.9% of
the level of JM101/L1.3; Fig.
3A and
Table
1). Finally, we demonstrated
that a construct containing
missense mutations in both ORF1 and ORF2
(JM124) was complemented
to the same extent as constructs containing
nonsense or missense
mutations in ORF1 alone (ca. 0.2% of JM101/L1.3;
Fig.
3A and Table
1 [see also Table
2]).
Coexpression of RD-L1s does not interfere with RC-L1
retrotransposition.
Our failure to detect efficient
trans complementation suggests that the RC-L1 proteins
preferentially function in cis. However, it remained
possible that expression of the mutant RD-L1 proteins actively
interferes with the wild-type RC-L1 proteins. To exclude this
possibility, we cotransfected RD-L1s lacking the mneo1
indicator gene with an RC-L1 containing the indicator gene. A drastic
reduction in RC-L1 retrotransposition would be expected if dominant
interference was significant.
The coexpression of various RD-L1s had little or no effect on
JM101/L1.3 retrotransposition. Moreover, increasing the molar
ratios of
RD-L1 to RC-L1 (4:1 and 9:1, respectively) did not result
in a
significant reduction in the number of G418
r foci (Fig.
3B). Finally, we demonstrated that the retrotransposition
of an allele
of JM101/L1
RP tagged with an enhanced green fluorescent
protein retrotransposition indicator cassette (
39) was not
affected
by the coexpression of representative RD-L1s harboring the
mneoI reporter cassette (not shown). Thus, we conclude that
coexpression
of mutant RD-L1 proteins does not interfere with the
retrotransposition
of RC-L1s.
Recombination does not account for the prevalence of
G418r foci.
To determine whether homologous DNA
recombination affected our results, a mutant allele of
L1.3mneoI, which contains intact ORFs but lacks both the CMV
and L1 promoters (
JM101/L1.3), was cotransfected into HeLa
cells with pJM101/L1.3
neo. In this case, G418r foci
will only result from homologous recombination between 
JM101/L1.3 and pJM101/L1.3
neo, leading to the formation of a recombinant L1, which subsequently could undergo retrotransposition in
cis (Fig. 4A).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 4.
G418r foci must arise by trans
complementation. (A) The low-level rescue of RD-L1s cannot be accounted
for by DNA recombination. An allele of JM101/L1.3 that lacked both the
5' UTR and the CMV promoter ( JM101/L1.3) was transfected into
HeLa cells alone or with a wild-type allele of L1.3 that lacked the
mneoI indicator cassette, and retrotransposition was assayed
as described in Fig. 3. The rationale for this experiment is described
in the text. JM101/L1.3 and JM105/L1.3 were used as appropriate
positive and negative controls. (B) Constructs used in the study. The
structure of L1.3 ORF1mneoI is shown, and the rationale for
the experiment is described in the text. (C) The resultant
G418r foci have the predicted structure. PCR experiments
using the oligonucleotides depicted in Fig. 4B (indicated by converging
arrows) revealed that the retrotransposed mneoI cassette
lacked the intron and was linked physically to L1.3 ORF1.
The details of the experiment are provided in the text.
|
|
As expected,


JM101/L1.3 did not retrotranspose when transfected
into HeLa cells alone (Fig.
4A). Moreover, cotransfection
of


JM101/L1.3 with either JM101/L1.3

neo or point-mutated
derivatives
of JM101/L1.3

neo resulted in only rare
G418
r foci (<0.03% of the activity of JM101/L1.3; Fig.
4A
and data
not shown). Thus, homologous recombination cannot account for
the G418
r foci observed in Fig.
3A.
G418r foci must arise by trans
complementation.
To prove that the RC-L1 proteins could function
in trans, we sought to determine whether the
retrotransposition of L1.3 ORF1mneoI could be stimulated by
the cotransfection of JM101/L1.3
neo (Fig. 4B). Here,
G418r foci will arise only if the JM101/L1.3 ORF2-encoded
protein functions in trans to retrotranspose the L1.3
ORF1mneoI RNA. Since L1.3 ORF1mneoI completely lacks
ORF2 sequences, it is difficult to envision how homology-dependent DNA
recombination would recreate a recombinant L1 that could undergo
subsequent retrotransposition in cis.
As expected,
L1.3 ORF1mneoI was unable
to retrotranspose when transfected into HeLa cells alone (Table
1).
However, upon
cotransfection with JM101/L1.3

neo, G418
r
foci were obtained at levels comparable to those of RD-L1s containing
mutations in L1.3 ORF2 (Table
1). Next, we pooled the G418
r
foci obtained in these experiments and established three polyclonal
cell lines. We isolated genomic DNA from each cell line and conducted
PCR to determine whether the resultant retrotransposition events
had
the predicted structures. In each sample we detected the predicted
product, indicating that ORF1 was linked physically to the
retrotransposed
mneoI indicator cassette (Fig.
4C). Thus, we
conclude that the
G418
r foci obtained in these experiments
arise because of
trans complementation.
L1-encoded proteins can promote the retrotransposition of other
cellular mRNAs.
The finding that the RC-L1 proteins could function
in trans led us to ask whether other cellular mRNAs could
also serve as substrates for the L1 retrotransposition machinery. Thus,
we constructed a variety of plasminogen activator inhibitor 1 expression cassettes tagged with the mneoI indicator
cassette [pPAI1(a-c)mneoI; see Materials and Methods]. We
chose these cDNAs because they are expressed at relatively high levels
in human cells (13). Indeed, the expression of each cDNA
was confirmed by RT-PCR (not shown). Notably, we only used DNA
sequences corresponding to the gene region of PAI1; thus,
polyadenylation will occur at the SV40 pA site present in the pCEP4
expression vector (36, 37).
The resultant constructs were cotransfected into HeLa cells with either
JM101/L1.3

neo or JM101/L1
RP 
neo, a second RC-L1
that
retrotransposes at a slightly higher frequency than JM101/L1.3
(
25). As before, JM101/L1.3 and JM101/L1
RP
retrotransposed extremely
efficiently, and
L1.3 ORF1mneoI
and RD-L1s were complemented at
about 0.3 to 0.7% of the level of
their respective controls (Table
2). By contrast, the
PAI1(a-c)mneoI constructs were complemented
at
reproducibly far lower levels (ca. 0.004 to 0.05% of the respective
wild-type controls; Table
2). Notably, a construct containing
a von
Willebrand factor expression cassette tagged with
mneoI retrotransposed at a similar low frequency (not shown).
Functional domains in both the L1.3 ORF1- and ORF2-encoded proteins
are required for the retrotransposition of cellular RNAs.
We
determined that retrotransposition of pAI1bmneoI was
dependent on both the L1.3 ORF1- and L1.3 ORF2-encoded proteins.
Missense mutations in either L1.3 ORF1 or in the endonuclease or RT
domains of L1.3 ORF2 were unable to stimulate the retrotransposition of pAI1bmneoI above background levels (Table
3). Moreover, cotransfection of L1.3 ORF2
alone could not stimulate pAI1bmneoI retrotransposition (Table 3). Thus, we conclude that specific functional domains in both
the L1.3 ORF1- and L1.3 ORF2-encoded proteins are required for this
process.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Distinct functional domains of the L1.3 ORF1- and L1.3
ORF2-encoded proteins are required to retrotranspose
PAI1bmneoIa
|
|
The resultant integration events resemble processed pseudogenes
with some unusual features.
To characterize the L1-stimulated
pAI1bmneoI retrotransposition events further, we isolated
genomic DNA from six clonal cell lines that were established from
individual G418r foci (see Materials and Methods). Southern
blot analysis demonstrated that each cell line contained a
retrotransposition event, and PCR analysis indicated that the resultant
retrotransposed sequences were variably 5' truncated (data not shown
[but see Fig. 5]).
We next used inverse PCR to characterize the
pAI1bmneoI
retrotransposition event in clones 1 to 3 (
27). Each of
the resultant
integration events contained the hallmarks of a
retrotransposition
event (Fig.
5). They
were 5' truncated, lacked the intron, ended
in poly(A) tails, and were
flanked by variable-length target site
duplications. In each case, the
cDNA integration site resembles
a consensus L1 endonuclease cleavage
site (5-TTTT/A) (
5,
10,
21). Moreover, L1 sequences were
not present at the respective
"empty" target sites in HeLa DNA.
Thus, we conclude that, although
inefficient, the L1-encoded proteins
can promote the retrotransposition
of non-L1 RNAs in HeLa cells,
leading to the formation of processed
pseudogenes.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 5.
The RC-L1 proteins can generate processed pseudogenes.
The structures of three pAI1bmneoI processed pseudogenes and
the accession numbers of the empty sites prior to insertion of the
pseudogenes are indicated. Vertical upward arrows indicate the precise
insertion sites. The poly(A) tail length in each insertion is indicated
in subscript; notably, polyadenylation occurred precisely at the SV40
pA site present in the CEP4 vector (36, 37). The target
site duplications flanking each insertion are underlined. The black
boxes represent pAI1b sequences, while the gray boxes in clones 2 and 3 represent L1 sequences that lie immediately upstream of the cDNA. The
gray box between the inverted L1s indicates the pCEP4 derived plasmid
sequences (see the text for additional details).
|
|
Notably, the structures of two of three characterized pseudogenes
(clones 2 and 3; Fig.
5) were unusual and contained RC-L1
sequences
immediately upstream of the 5' truncated cDNA. In both
instances, the
L1-cDNA junction sequences occur in an area that
lacks extensive
sequence homology between the RC-L1 and pAI1b
cDNAs (two or three
bases, respectively; see Discussion for how
these sequences may have
been
generated).
Pseudogene 2 contains a 1.7-kb fragment of the RC-L1 that spans bases
1723 to 3405 (
7) and is in the same transcriptional
orientation as the
pPAI1mneoI cDNA. Pseudogene 3 contains an
internally
rearranged 1.5-kb fragment of the RC-L1. The 3' fragment
spans
bases 4444 to 5495 (
7) of the RC-L1 and is in the
same transcriptional
orientation as the
pPAI1bmneoI cDNA.
The 5' fragment is in the
opposite transcriptional orientation of the
pPAI1bmneoI cDNA and
contains the first 393 bp of L1, as
well as 32 bp of the pCEP4
expression vector. The pCEP4 sequences are
immediately upstream
of the RC-L1 and begin 14 bp downstream of the CMV
transcription
start site. Thus, it appears that the RC-L1-derived
portion of
pseudogene 3 was initiated from the CMV promoter and then
underwent
an inversion and deletion upon its retrotransposition. Such
inversion
or deletion events are relatively common and may represent
about
15% of all L1 retrotransposition events (
14,
20).
 |
DISCUSSION |
L1s retrotranspose by cis preference.
We have
provided genetic evidence in support of the cis-preference
model of L1 retrotransposition. Population genetic and phylogenetic
analyses revealed that new L1 retrotransposition events in mice and
humans likely emanated from a small number of "founder genes"
(3, 12, 15, 22). Mutational and biochemical studies also
have provided additional data in support of a cis preference. First, all mutagenic L1 insertions characterized in humans
and mice are derived from progenitor L1s that contain intact ORFs
(7, 19, 25, 37, 38). Second, cytoplasmic RNPs, which are
proposed intermediates in the L1 retrotransposition pathway, are
enriched for the RNAs and proteins encoded by young L1s (17, 18,
26, 31). Finally, Esnault et al. (8) recently provided experimental evidence consistent with the notion that human
L1s retrotranspose by cis preference in cultured feline cells. Our finding that stable RD-L1 RNAs are complemented
inefficiently provides the most compelling evidence to date that L1s
predominantly retrotranspose via cis preference.
Our data are consistent with two versions of a relatively simple model
for the molecular mechanism of
cis preference in which
L1
RNAs cotranslationally bind nascent L1 proteins. The binding
of the
nascent proteins to L1 RNA could be mediated by proximity.
Alternatively, the RC-L1 protein(s) might only have a limited
half-life
in the absence of L1 RNA. In either case, these mechanisms
would ensure
that functional L1 RNAs were far more likely than
RD-L1 RNAs or
cellular mRNAs to serve as substrates for
TPRT.
Processed pseudogene formation.
We demonstrated that the RC-L1
proteins also function in trans at low levels to promote the
retrotransposition of other mRNAs, leading to the formation of
processed pseudogenes. Interestingly, two of three characterized
pAI1bmneoI processed pseudogenes were linked physically to
sequences in the cotransfected RC-L1, generating chimeric L1-cDNA
pseudogene structures that have not yet been found in nature. These
L1-cDNA chimeras could occur if the RC-L1 and the pAI1bmneoI
plasmids underwent an illegitimate (i.e., not mediated by homology)
interplasmid recombination event, leading to the formation of a
recombinant L1-cDNA mRNA that subsequently was retrotransposed in
trans by the RC-L1 proteins. Alternatively, it is possible
that L1 retrotransposition intermediates contain two RNAs and that RNA
or cDNA recombination during TPRT yielded the chimeras (12,
16).
In either case, our data demonstrate that RD-L1s are
trans
complemented at much higher frequencies than non-L1 cDNAs. Since
both the RD-L1s and cDNAs are in identical expression contexts,
it is
unlikely that the effect we observe is due to transcript
abundance.
Instead, it remains possible that the RD-L1 RNAs either
colocalize with
RC-L1 RNAs or that the RD-L1 RNAs contain
cis-acting
sequences that can recruit the RC-L1 encoded proteins
(
18).
It is worth comparing our results to those generated recently by
Esnault et al., who demonstrated that human L1s could mediate
processed
pseudogene formation in a heterologous cultured feline
cell system
(
8). We agree that the RC-L1 proteins function
preferentially in
cis but act at a low level in
trans to promote
the retrotransposition of non-L1 RNAs.
Moreover, we both found
that the structures of the processed
pseudogenes were somewhat
unusual. However, differences between our
studies are noteworthy.
In the experiments of Esnault et al., none of
the pseudogenes
that arose in the feline cells integrated at consensus
L1 endonuclease
cleavage sites. Indeed, two of three "pseudogenes"
actually lacked
poly(A) sequences. All three of our pseudogenes had all
the characteristics
of retrotransposition events generated via
TPRT.
In addition, our data demonstrate that pseudogene formation in human
cells is extremely rare (ca. 0.01 to 0.05% of the rate
of L1
retrotransposition) and only is detected when our most "active"
L1s
are used as sources of the L1-encoded proteins. By contrast,
in
feline-cultured cells, the frequency of processed pseudogene
formation
is only 10-fold lower than the frequency of L1 retrotransposition.
While it remains possible that these discrepancies reflect subtle
differences that exist between our assays, it is interesting to
note
that both we and Dhellin et al. were unable to detect pseudogene
formation when L1.2 was overexpressed in human cells (
6;
J.
V. Moran et al., unpublished data). Thus, it appears that the
feline cells are more permissive for L1-mediated processed pseudogene
formation than human HeLa
cells.
Finally, it is notable that the studies conducted by Esnault et al.
were performed in the presence of phleomycin, a known
clastogen. Thus,
it remains possible that interplasmid recombination
occurred more
frequently in their study. Moreover, the unusual
structures of the
pseudogenes suggest that they may have integrated
into chromosomal DNA
by an L1 endonuclease-independent
mechanism.
Evolutionary implications and practical considerations of the
cis-preference model.
The cis-preference
model would explain how a small number of autonomous L1s remain
retrotransposition competent among an overwhelming abundance of
nonfunctional elements. Indeed, such a mechanism would select for the
retrotransposition of RC-L1 RNAs and would be consistent with the
apparent patterns of concerted evolution that L1s display in different
species (15, 32). It also would limit the extent to which
the proteins encoded by RC-L1s could function to retrotranspose other
cellular RNAs (e.g., RD-L1s and other cellular RNAs). However, it is
noteworthy that particular RNAs (e.g., Alu RNAs) likely have evolved
ways to usurp the cis-preference retrotransposition
machinery of human RC-L1s (possible mechanisms are discussed further
elsewhere [1, 23, 33]).
Finally, the finding that L1s retrotranspose by
cis
preference may have practical value. For example, if engineered L1s
were
used as transposon mutagens, there is a high likelihood that any
resultant mutations would be due to the retrotransposition of
the
engineered L1 RNA and would not be caused by the
trans
mobilization
of endogenous retrotransposons. Indeed, the inability of
the RC-L1
proteins to efficiently mobilize cellular RNAs may prove
useful
when considering L1 as a potential gene delivery
vehicle.
 |
ACKNOWLEDGMENTS |
We thank Anne Marie DesLauriers at the University of Michigan
Flow Core for help with flow cytometry, Robert Lyons at the University
of Michigan DNA Sequencing Core for help with oligonucleotide synthesis
and DNA sequencing, and Ali Lotia for help with generating computer
graphics. We thank David Ginsburg for providing pAI1 cDNAs. We thank
Alice Telesnitsky, John Goodier, Eline Luning Prak, Tom Glaser, Dennis
Hartigan-O'Connor, and current members of the Moran Lab for critical
reading of the manuscript and for helpful discussions during the course
of this work.
This work was supported in part by a Damon Runyon Scholar Award
(J.V.M.) and National Institutes of Health grants GM60518 (J.V.M.) and
CA16519 (J.D.B.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Departments of
Human Genetics and Internal Medicine, The University of Michigan
Medical School, Ann Arbor, MI 48109. Phone: (734) 615-0456. Fax: (734) 763-3784. E-mail: moranj{at}umich.edu.
 |
REFERENCES |
| 1.
|
Boeke, J. D.
1997.
LINEs and Alus the polyA connection.
Nat. Genet.
16:6-7[CrossRef][Medline].
|
| 2.
|
Boeke, J. D., and J. P. Stoye.
1997.
Retrotransposons, endogenous retroviruses, and the evolution of retroelements, p. 343-435.
In
J. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 3.
|
Boissinot, S.,
P. Chevret, and A. V. Furano.
2000.
L1 (LINE-1) retrotransposon evolution and amplification in recent human history.
Mol. Biol. Evol.
17:915-928[Abstract/Free Full Text].
|
| 4.
|
Christensen, S.,
G. Pont-Kingdon, and D. Carroll.
2000.
Target specificity of the endonuclease from the Xenopus laevis non-lung terminal repeat retrotransposon, Tx1L.
Mol. Cell. Biol.
20:1219-1226[Abstract/Free Full Text].
|
| 5.
|
Cost, G. J., and J. D. Boeke.
1998.
Targeting of human retrotransposon integration is directed by the specificity of the L1 endonuclease for regions of unusual DNA structure.
Biochemistry
37:18081-18093[CrossRef][Medline].
|
| 6.
|
Dhellin, O.,
J. Maestre, and T. Heidmann.
1997.
Functional differences between the human LINE retrotransposon and retroviral reverse transcriptases for in vivo mRNA reverse transcription.
EMBO J.
16:6590-6602[CrossRef][Medline].
|
| 7.
|
Dombroski, B. A.,
S. L. Mathias,
E. Nanthakumar,
A. F. Scott, and H. H. Kazazian, Jr.
1991.
Isolation of an active human transposable element.
Science
254:1805-1808[Abstract/Free Full Text].
|
| 8.
|
Esnault, C.,
J. Maestre, and T. Heidmann.
2000.
Human LINE retrotransposons generate processed pseudogenes.
Nat. Genet.
24:363-367[CrossRef][Medline].
|
| 9.
|
Fanning, T., and M. Singer.
1987.
The LINE-1 DNA sequences in four mammalian orders predict proteins that conserve homologies to retrovirus proteins.
Nucleic Acids Res.
15:2251-2260[Abstract/Free Full Text].
|
| 10.
|
Feng, Q.,
J. V. Moran,
H. H. Kazazian, Jr., and J. D. Boeke.
1996.
Human L1 retrotransposon encodes a conserved endonuclease required for retrotransposition.
Cell
87:905-916[CrossRef][Medline].
|
| 11.
|
Feng, Q.,
G. Schumann, and J. D. Boeke.
1998.
Retrotransposon R1Bm endonuclease cleaves the target sequence.
Proc. Natl. Acad. Sci. USA
95:2083-2088[Abstract/Free Full Text].
|
| 12.
|
Furano, A. V.
2000.
The biological properties and evolutionary dynamics of mammalian LINE-1 retrotransposons.
Prog. Nucleic Acid Res. Mol. Biol.
64:255-294[Medline].
|
| 13.
|
Ginsburg, D.,
R. Zeheb,
A. Y. Yang,
U. M. Rafferty,
P. A. Andreasen,
L. Nielsen,
K. Dano,
R. V. Lebo, and T. D. Gelehrter.
1986.
cDNA cloning of human plasminogen activator-inhibitor from endothelial cells.
J. Clin. Investig.
78:1673-1680.
|
| 14.
|
Goodier, J. L.,
E. M. Ostertag, and H. H. Kazazian, Jr.
2000.
Transduction of 3'-flanking sequences is common in L1 retrotransposition.
Hum. Mol. Genet.
9:653-657[Abstract/Free Full Text].
|
| 15.
|
Hardies, S. C.,
S. L. Martin,
C. F. Voliva,
C. A. D. Hutchison, and M. H. Edgell.
1986.
An analysis of replacement and synonymous changes in the rodent L1 repeat family.
Mol. Biol. Evol.
3:109-125[Abstract].
|
| 16.
|
Hayward, B. E.,
M. Zavanelli, and A. V. Furano.
1997.
Recombination creates novel L1 (LINE-1) elements in Rattus norvegicus.
Genetics
146:641-654[Abstract].
|
| 17.
|
Hohjoh, H., and M. F. Singer.
1996.
Cytoplasmic ribonucleoprotein complexes containing human LINE-1 protein and RNA.
EMBO J.
15:630-639[Medline].
|
| 18.
|
Hohjoh, H., and M. F. Singer.
1997.
Sequence-specific single-strand RNA binding protein encoded by the human LINE-1 retrotransposon.
EMBO J.
16:6034-6043[CrossRef][Medline].
|
| 19.
|
Holmes, S. E.,
B. A. Dombroski,
C. M. Krebs,
C. D. Boehm, and H. H. Kazazian, Jr.
1994.
A new retrotransposable human L1 element from the LRE2 locus on chromosome 1q produces a chimaeric insertion.
Nat. Genet.
7:143-148[CrossRef][Medline].
|
| 20.
|
Hutchison, C. A.,
S. C. Hardies,
D. D. Loeb,
W. R. Shehee, and M. H. Edgell.
1989.
LINES and related retroposons: long interspersed sequences in the eucaryotic genome, p. 593-617.
In
D. E. Berg, and M. M. Howe (ed.), Mobile DNA. ASM Press, Washington, D.C.
|
| 21.
|
Jurka, J.
1997.
Sequence patterns indicate an enzymatic involvement in integration of mammalian retroposons.
Proc. Natl. Acad. Sci. USA
94:1872-1877[Abstract/Free Full Text].
|
| 22.
|
Kaplan, N.,
T. Darden, and C. H. Langley.
1985.
Evolution and extinction of transposable elements in Mendelian populations.
Genetics
109:459-480[Abstract/Free Full Text].
|
| 23.
|
Kazazian, H. H., Jr., and J. V. Moran.
1998.
The impact of L1 retrotransposons on the human genome.
Nat. Genet.
19:19-24[CrossRef][Medline].
|
| 24.
|
Kazazian, H. H., Jr.,
C. Wong,
H. Youssoufian,
A. F. Scott,
D. G. Phillips, and S. E. Antonarakis.
1988.
Haemophilia A resulting from de novo insertion of L1 sequences represents a novel mechanism for mutation in man.
Nature
332:164-166[CrossRef][Medline].
|
| 25.
|
Kimberland, M. L.,
V. Divoky,
J. Prchal,
U. Schwahn,
W. Berger, and H. H. Kazazian, Jr.
1999.
Full-length human L1 insertions retain the capacity for high-frequency retrotransposition in cultured cells.
Hum. Mol. Genet.
8:1557-1560[Abstract/Free Full Text].
|
| 26.
|
Kolosha, V. O., and S. L. Martin.
1995.
Polymorphic sequences encoding the first open reading frame protein from LINE-1 ribonucleoprotein particles.
J. Biol. Chem.
270:2868-2873[Abstract/Free Full Text].
|
| 27.
|
Li, J.,
H. Shen,
K. L. Himmel,
A. J. Dupuy,
D. A. Largaespada,
T. Nakamura,
J. D. Shaughnessy, Jr.,
N. A. Jenkins, and N. G. Copeland.
1999.
Leukaemia disease genes: large-scale cloning and pathway predictions.
Nat. Genet.
23:348-353[CrossRef][Medline].
|
| 28.
|
Luan, D. D., and T. H. Eickbush.
1995.
RNA template requirements for target DNA-primed reverse transcription by the R2 retrotransposable element.
Mol. Cell. Biol.
15:3882-3891[Abstract].
|
| 29.
|
Luan, D. D.,
M. H. Korman,
J. L. Jakubczak, and T. H. Eickbush.
1993.
Reverse transcription of R2Bm RNA is primed by a nick at the chromosomal target site: a mechanism for non-LTR retrotransposition.
Cell
72:595-605[CrossRef][Medline].
|
| 30.
|
Maestre, J.,
T. Tchenio,
O. Dhellin, and T. Heidmann.
1995.
mRNA retroposition in human cells: processed pseudogene formation.
EMBO J.
14:6333-6338[Medline].
|
| 31.
|
Martin, S. L.
1991.
Ribonucleoprotein particles with LINE-1 RNA in mouse embryonal carcinoma cells.
Mol. Cell. Biol.
11:4804-4807[Abstract/Free Full Text].
|
| 32.
|
Martin, S. L.,
C. F. Voliva,
S. C. Hardies,
M. H. Edgell, and C. A. D. Hutchison.
1985.
Tempo and mode of concerted evolution in the L1 repeat family of mice.
Mol. Biol. Evol.
2:127-140[Abstract].
|
| 33.
|
Mathews, D. H.,
A. R. Banerjee,
D. D. Luan,
T. H. Eickbush, and D. H. Turner.
1997.
Secondary structure model of the RNA recognized by the reverse transcriptase from the R2 retrotransposable element.
RNA
3:1-16[Abstract].
|
| 34.
|
Mathias, S. L.,
A. F. Scott,
H. H. Kazazian, Jr.,
J. D. Boeke, and A. Gabriel.
1991.
Reverse transcriptase encoded by a human transposable element.
Science
254:1808-1810[Abstract/Free Full Text].
|
| 35.
|
Mohler, W. A., and H. M. Blau.
1996.
Gene expression and cell fusion analyzed by lacZ complementation in mammalian cells.
Proc. Natl. Acad. Sci. USA
93:12423-12427[Abstract/Free Full Text].
|
| 36.
|
Moran, J. V.,
R. J. DeBerardinis, and H. H. Kazazian.
1999.
Exon shuffling by L1 retrotransposition.
Science
283:1530-1534[Abstract/Free Full Text].
|
| 37.
|
Moran, J. V.,
S. E. Holmes,
T. P. Naas,
R. J. DeBerardinis,
J. D. Boeke, and H. H. Kazazian, Jr.
1996.
High frequency retrotransposition in cultured mammalian cells.
Cell
87:917-927[CrossRef][Medline].
|
| 38.
|
Naas, T. P.,
R. J. DeBerardinis,
J. V. Moran,
E. M. Ostertag,
S. F. Kingsmore,
M. F. Seldin,
Y. Hayashizaki,
S. L. Martin, and H. H. Kazazian.
1998.
An actively retrotransposing, novel subfamily of mouse L1 elements.
EMBO J.
17:590-597[CrossRef][Medline].
|
| 39.
|
Ostertag, E. M.,
E. T. Prak,
R. J. DeBerardinis,
J. V. Moran, and H. H. Kazazian, Jr.
2000.
Determination of L1 retrotransposition kinetics in cultured cells.
Nucleic Acids Res.
28:1418-1423[Abstract/Free Full Text].
|
| 40.
|
Sassaman, D. M.,
B. A. Dombroski,
J. V. Moran,
M. L. Kimberland,
T. P. Naas,
R. J. DeBerardinis,
A. Gabriel,
G. D. Swergold, and H. H. Kazazian, Jr.
1997.
Many human L1 elements are capable of retrotransposition.
Nat. Genet.
16:37-43[CrossRef][Medline].
|
| 41.
|
Scott, A. F.,
B. J. Schmeckpeper,
M. Abdelrazik,
C. T. Comey,
B. O'Hara,
J. P. Rossiter,
T. Cooley,
P. Heath,
K. D. Smith, and L. Margolet.
1987.
Origin of the human L1 elements: proposed progenitor genes deduced from a consensus DNA sequence.
Genomics
1:113-125[CrossRef][Medline].
|
| 42.
|
Smit, A. F.
1999.
Interspersed repeats and other mementos of transposable elements in mammalian genomes.
Curr. Opin. Genet. Dev.
9:657-663[CrossRef][Medline].
|
| 43.
|
Swergold, G. D.
1990.
Identification, characterization, and cell specificity of a human LINE-1 promoter.
Mol. Cell. Biol.
10:6718-6729[Abstract/Free Full Text].
|
| 44.
|
Tchenio, T.,
E. Segal-Bendirdjian, and T. Heidmann.
1993.
Generation of processed pseudogenes in murine cells.
EMBO J.
12:1487-1497[Medline].
|
| 45.
|
Wei, W.,
T. A. Morrish,
R. S. Alisch, and J. V. Moran.
2000.
A transient assay reveals that cultured human cells can accommodate multiple LINE-1 retrotransposition events.
Anal. Biochem.
284:435-438[CrossRef][Medline].
|
| 46.
|
Weiner, A. M.,
P. L. Deininger, and A. Efstratiadis.
1986.
Nonviral retroposons: genes, pseudogenes, and transposable elements generated by the reverse flow of genetic information.
Annu. Rev. Biochem.
55:631-661[CrossRef][Medline].
|
| 47.
|
Xiong, Y. E., and T. H. Eickbush.
1988.
Functional expression of a sequence-specific endonuclease encoded by the retrotransposon R2Bm.
Cell
55:235-246[CrossRef][Medline].
|
Molecular and Cellular Biology, February 2001, p. 1429-1439, Vol. 21, No. 4
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.4.1429-1439.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kojima, K. K., Okada, N.
(2009). mRNA Retrotransposition Coupled with 5' Inversion as a Possible Source of New Genes. Mol Biol Evol
26: 1405-1420
[Abstract]
[Full Text]
-
Comeaux, M. S., Roy-Engel, A. M., Hedges, D. J., Deininger, P. L.
(2009). Diverse cis factors controlling Alu retrotransposition: What causes Alu elements to die?. Genome Res
19: 545-555
[Abstract]
[Full Text]
-
Khazina, E., Weichenrieder, O.
(2009). Non-LTR retrotransposons encode noncanonical RRM domains in their first open reading frame. Proc. Natl. Acad. Sci. USA
106: 731-736
[Abstract]
[Full Text]
-
Saito, E.-s., Keng, V. W., Takeda, J., Horie, K.
(2008). Translation from nonautonomous type IAP retrotransposon is a critical determinant of transposition activity: Implication for retrotransposon-mediated genome evolution. Genome Res
18: 859-868
[Abstract]
[Full Text]
-
Kirilyuk, A., Tolstonog, G. V., Damert, A., Held, U., Hahn, S., Lower, R., Buschmann, C., Horn, A. V., Traub, P., Schumann, G. G.
(2008). Functional endogenous LINE-1 retrotransposons are expressed and mobilized in rat chloroleukemia cells. Nucleic Acids Res
36: 648-665
[Abstract]
[Full Text]
-
Chung, T., Siol, O., Dingermann, T., Winckler, T.
(2007). Protein Interactions Involved in tRNA Gene-Specific Integration of Dictyostelium discoideum Non-Long Terminal Repeat Retrotransposon TRE5-A. Mol. Cell. Biol.
27: 8492-8501
[Abstract]
[Full Text]
-
Villasante, A., Abad, J. P., Planello, R., Mendez-Lago, M., Celniker, S. E., de Pablos, B.
(2007). Drosophila telomeric retrotransposons derived from an ancestral element that was recruited to replace telomerase. Genome Res
17: 1909-1918
[Abstract]
[Full Text]
-
Shpiz, S., Kwon, D., Uneva, A., Kim, M., Klenov, M., Rozovsky, Y., Georgiev, P., Savitsky, M., Kalmykova, A.
(2007). Characterization of Drosophila Telomeric Retroelement TAHRE: Transcription, Transpositions, and RNAi-based Regulation of Expression. Mol Biol Evol
24: 2535-2545
[Abstract]
[Full Text]
-
Goodier, J. L., Zhang, L., Vetter, M. R., Kazazian, H. H. Jr.
(2007). LINE-1 ORF1 Protein Localizes in Stress Granules with Other RNA-Binding Proteins, Including Components of RNA Interference RNA-Induced Silencing Complex. Mol. Cell. Biol.
27: 6469-6483
[Abstract]
[Full Text]
-
Babushok, D. V., Ohshima, K., Ostertag, E. M., Chen, X., Wang, Y., Mandal, P. K., Okada, N., Abrams, C. S., Kazazian, H. H. Jr.
(2007). A novel testis ubiquitin-binding protein gene arose by exon shuffling in hominoids. Genome Res
17: 1129-1138
[Abstract]
[Full Text]
-
Lucier, J.-F., Perreault, J., Noel, J.-F., Boire, G., Perreault, J.-P.
(2007). RTAnalyzer: a web application for finding new retrotransposons and detecting L1 retrotransposition signatures. Nucleic Acids Res
35: W269-W274
[Abstract]
[Full Text]
-
Dmitriev, S. E., Andreev, D. E., Terenin, I. M., Olovnikov, I. A., Prassolov, V. S., Merrick, W. C., Shatsky, I. N.
(2007). Efficient Translation Initiation Directed by the 900-Nucleotide-Long and GC-Rich 5' Untranslated Region of the Human Retrotransposon LINE-1 mRNA Is Strictly Cap Dependent Rather than Internal Ribosome Entry Site Mediated. Mol. Cell. Biol.
27: 4685-4697
[Abstract]
[Full Text]
-
Garcia-Perez, J. L., Marchetto, M. C.N., Muotri, A. R., Coufal, N. G., Gage, F. H., O'Shea, K. S., Moran, J. V.
(2007). LINE-1 retrotransposition in human embryonic stem cells. Hum Mol Genet
16: 1569-1577
[Abstract]
[Full Text]
-
Gentles, A. J., Wakefield, M. J., Kohany, O., Gu, W., Batzer, M. A., Pollock, D. D., Jurka, J.
(2007). Evolutionary dynamics of transposable elements in the short-tailed opossum Monodelphis domestica. Genome Res
17: 992-1004
[Abstract]
[Full Text]
-
Sen, S. K., Huang, C. T., Han, K., Batzer, M. A.
(2007). Endonuclease-independent insertion provides an alternative pathway for L1 retrotransposition in the human genome. Nucleic Acids Res
35: 3741-3751
[Abstract]
[Full Text]
-
Kinomoto, M., Kanno, T., Shimura, M., Ishizaka, Y., Kojima, A., Kurata, T., Sata, T., Tokunaga, K.
(2007). All APOBEC3 family proteins differentially inhibit LINE-1 retrotransposition. Nucleic Acids Res
35: 2955-2964
[Abstract]
[Full Text]
-
Garcia-Perez, J. L., Doucet, A. J., Bucheton, A., Moran, J. V., Gilbert, N.
(2007). Distinct mechanisms for trans-mediated mobilization of cellular RNAs by the LINE-1 reverse transcriptase. Genome Res
17: 602-611
[Abstract]
[Full Text]
-
Pace, J. K. II, Feschotte, C.
(2007). The evolutionary history of human DNA transposons: Evidence for intense activity in the primate lineage. Genome Res
17: 422-432
[Abstract]
[Full Text]
-
Li, Y. L. a. S.
(2007). Genome-wide analyses of retrogenes derived from the human box H/ACA snoRNAs. Nucleic Acids Res
35: 559-571
[Abstract]
[Full Text]
-
Xing, J., Wang, H., Belancio, V. P., Cordaux, R., Deininger, P. L., Batzer, M. A.
(2006). From the Cover: Eukaryotic Transposable Elements and Genome Evolution Special Feature: Emergence of primate genes by retrotransposon-mediated sequence transduction. Proc. Natl. Acad. Sci. USA
103: 17608-17613
[Abstract]
[Full Text]
-
Chiu, Y.-L., Witkowska, H. E., Hall, S. C., Santiago, M., Soros, V. B., Esnault, C., Heidmann, T., Greene, W. C.
(2006). High-molecular-mass APOBEC3G complexes restrict Alu retrotransposition. Proc. Natl. Acad. Sci. USA
103: 15588-15593
[Abstract]
[Full Text]
-
Nomura, Y., Kajikawa, M., Baba, S., Nakazato, S., Imai, T., Sakamoto, T., Okada, N., Kawai, G.
(2006). Solution structure and functional importance of a conserved RNA hairpin of eel LINE UnaL2. Nucleic Acids Res
0: gkl664v3-10
[Abstract]
[Full Text]
-
Muckenfuss, H., Hamdorf, M., Held, U., Perkovic, M., Lower, J., Cichutek, K., Flory, E., Schumann, G. G., Munk, C.
(2006). APOBEC3 Proteins Inhibit Human LINE-1 Retrotransposition. J. Biol. Chem.
281: 22161-22172
[Abstract]
[Full Text]
-
Wang, W., Zheng, H., Fan, C., Li, J., Shi, J., Cai, Z., Zhang, G., Liu, D., Zhang, J., Vang, S., Lu, Z., Wong, G. K.-S., Long, M., Wang, J.
(2006). High Rate of Chimeric Gene Origination by Retroposition in Plant Genomes. Plant Cell
18: 1791-1802
[Abstract]
[Full Text]
-
Matsumoto, T., Hamada, M., Osanai, M., Fujiwara, H.
(2006). Essential Domains for Ribonucleoprotein Complex Formation Required for Retrotransposition of Telomere-Specific Non-Long Terminal Repeat Retrotransposon SART1.. Mol. Cell. Biol.
26: 5168-5179
[Abstract]
[Full Text]
-
Bogerd, H. P., Wiegand, H. L., Hulme, A. E., Garcia-Perez, J. L., O'Shea, K. S., Moran, J. V., Cullen, B. R.
(2006). Cellular inhibitors of long interspersed element 1 and Alu retrotransposition. Proc. Natl. Acad. Sci. USA
103: 8780-8785
[Abstract]
[Full Text]
-
Kubo, S., Seleme, M. d. C., Soifer, H. S., Perez, J. L. G., Moran, J. V., Kazazian, H. H. Jr., Kasahara, N.
(2006). L1 retrotransposition in nondividing and primary human somatic cells. Proc. Natl. Acad. Sci. USA
103: 8036-8041
[Abstract]
[Full Text]
-
Belancio, V. P., Hedges, D. J., Deininger, P.
(2006). LINE-1 RNA splicing and influences on mammalian gene expression. Nucleic Acids Res
34: 1512-1521
[Abstract]
[Full Text]
-
Farkash, E. A., Kao, G. D., Horman, S. R., Prak, E. T. L.
(2006). Gamma radiation increases endonuclease-dependent L1 retrotransposition in a cultured cell assay. Nucleic Acids Res
34: 1196-1204
[Abstract]
[Full Text]
-
Li, P. W.-L., Li, J., Timmerman, S. L., Krushel, L. A., Martin, S. L.
(2006). The dicistronic RNA from the mouse LINE-1 retrotransposon contains an internal ribosome entry site upstream of each ORF: implications for retrotransposition. Nucleic Acids Res
34: 853-864
[Abstract]
[Full Text]
-
Alisch, R. S., Garcia-Perez, J. L., Muotri, A. R., Gage, F. H., Moran, J. V.
(2006). Unconventional translation of mammalian LINE-1 retrotransposons. Genes Dev.
20: 210-224
[Abstract]
[Full Text]
-
Nozawa, M., Aotsuka, T., Tamura, K.
(2005). A Novel Chimeric Gene, siren, With Retroposed Promoter Sequence in the Drosophila bipectinata Complex. Genetics
171: 1719-1727
[Abstract]
[Full Text]
-
Kulpa, D. A., Moran, J. V.
(2005). Ribonucleoprotein particle formation is necessary but not sufficient for LINE-1 retrotransposition. Hum Mol Genet
14: 3237-3248
[Abstract]
[Full Text]
-
Christensen, S. M., Eickbush, T. H.
(2005). R2 Target-Primed Reverse Transcription: Ordered Cleavage and Polymerization Steps by Protein Subunits Asymmetrically Bound to the Target DNA. Mol. Cell. Biol.
25: 6617-6628
[Abstract]
[Full Text]
-
Han, K., Sen, S. K., Wang, J., Callinan, P. A., Lee, J., Cordaux, R., Liang, P., Batzer, M. A.
(2005). Genomic rearrangements by LINE-1 insertion-mediated deletion in the human and chimpanzee lineages. Nucleic Acids Res
33: 4040-4052
[Abstract]
[Full Text]
-
Perreault, J., Noel, J.-F., Briere, F., Cousineau, B., Lucier, J.-F., Perreault, J.-P., Boire, G.
(2005). Retropseudogenes derived from the human Ro/SS-A autoantigen-associated hY RNAs. Nucleic Acids Res
33: 2032-2041
[Abstract]
[Full Text]
-
Kajikawa, M., Ichiyanagi, K., Tanaka, N., Okada, N.
(2005). Isolation and Characterization of Active LINE and SINEs from the Eel. Mol Biol Evol
22: 673-682
[Abstract]
[Full Text]
-
Soifer, H. S., Zaragoza, A., Peyvan, M., Behlke, M. A., Rossi, J. J.
(2005). A potential role for RNA interference in controlling the activity of the human LINE-1 retrotransposon. Nucleic Acids Res
33: 846-856
[Abstract]
[Full Text]
-
Seleme, M. d. C., Disson, O., Robin, S.ép., Brun, C., Teninges, D., Bucheton, A.
(2005). In vivo RNA localization of I factor, a non-LTR retrotransposon, requires a cis-acting signal in ORF2 and ORF1 protein. Nucleic Acids Res
33: 776-785
[Abstract]
[Full Text]
-
Penzkofer, T., Dandekar, T., Zemojtel, T.
(2005). L1Base: from functional annotation to prediction of active LINE-1 elements. Nucleic Acids Res
33: D498-D500
[Abstract]
[Full Text]
-
Simpson, E. B., Ross, S. L., Marchetti, S. E., Kennell, J. C.
(2004). Relaxed Primer Specificity Associated with Reverse Transcriptases Encoded by the pFOXC Retroplasmids of Fusarium oxysporum. Eukaryot Cell
3: 1589-1600
[Abstract]
[Full Text]
-
Lavie, L., Maldener, E., Brouha, B., Meese, E. U., Mayer, J.
(2004). The human L1 promoter: Variable transcription initiation sites and a major impact of upstream flanking sequence on promoter activity. Genome Res
14: 2253-2260
[Abstract]
[Full Text]
-
Bennett, E. A., Coleman, L. E., Tsui, C., Pittard, W. S., Devine, S. E.
(2004). Natural Genetic Variation Caused by Transposable Elements in Humans. Genetics
168: 933-951
[Abstract]
[Full Text]
-
Osanai, M., Takahashi, H., Kojima, K. K., Hamada, M., Fujiwara, H.
(2004). Essential Motifs in the 3' Untranslated Region Required for Retrotransposition and the Precise Start of Reverse Transcription in Non-Long-Terminal-Repeat Retrotransposon SART1. Mol. Cell. Biol.
24: 7902-7913
[Abstract]
[Full Text]
-
Pelissier, T., Bousquet-Antonelli, C., Lavie, L., Deragon, J.-M.
(2004). Synthesis and processing of tRNA-related SINE transcripts in Arabidopsis thaliana. Nucleic Acids Res
32: 3957-3966
[Abstract]
[Full Text]
-
Athanikar, J. N., Badge, R. M., Moran, J. V.
(2004). A YY1-binding site is required for accurate human LINE-1 transcription initiation. Nucleic Acids Res
32: 3846-3855
[Abstract]
[Full Text]
-
Boissinot, S., Entezam, A., Young, L., Munson, P. J., Furano, A. V.
(2004). The Insertional History of an Active Family of L1 Retrotransposons in Humans. Genome Res
14: 1221-1231
[Abstract]
[Full Text]
-
Goodier, J. L., Ostertag, E. M., Engleka, K. A., Seleme, M. C., Kazazian, H. H. Jr
(2004). A potential role for the nucleolus in L1 retrotransposition. Hum Mol Genet
13: 1041-1048
[Abstract]
[Full Text]
-
Bibillo, A., Eickbush, T. H.
(2004). End-to-End Template Jumping by the Reverse Transcriptase Encoded by the R2 Retrotransposon. J. Biol. Chem.
279: 14945-14953
[Abstract]
[Full Text]
-
Belshaw, R., Pereira, V., Katzourakis, A., Talbot, G., Paces, J., Burt, A., Tristem, M.
(2004). Long-term reinfection of the human genome by endogenous retroviruses. Proc. Natl. Acad. Sci. USA
101: 4894-4899
[Abstract]
[Full Text]
-
Fillingham, J. S., Thing, T. A., Vythilingum, N., Keuroghlian, A., Bruno, D., Golding, G. B., Pearlman, R. E.
(2004). A Non-Long Terminal Repeat Retrotransposon Family Is Restricted to the Germ Line Micronucleus of the Ciliated Protozoan Tetrahymena thermophila. Eukaryot Cell
3: 157-169
[Abstract]
[Full Text]
-
Farley, A. H., Luning Prak, E. T., Kazazian, H. H. Jr
(2004). More active human L1 retrotransposons produce longer insertions. Nucleic Acids Res
32: 502-510
[Abstract]
[Full Text]
-
Matsumoto, T., Takahashi, H., Fujiwara, H.
(2004). Targeted Nuclear Import of Open Reading Frame 1 Protein Is Required for In Vivo Retrotransposition of a Telomere-Specific Non-Long Terminal Repeat Retrotransposon, SART1. Mol. Cell. Biol.
24: 105-122
[Abstract]
[Full Text]
-
Casacuberta, E., Pardue, M.-L.
(2003). HeT-A elements in Drosophila virilis: Retrotransposon telomeres are conserved across the Drosophila genus. Proc. Natl. Acad. Sci. USA
100: 14091-14096
[Abstract]
[Full Text]
-
Biedler, J., Tu, Z.
(2003). Non-LTR Retrotransposons in the African Malaria Mosquito, Anopheles gambiae: Unprecedented Diversity and Evidence of Recent Activity. Mol Biol Evol
20: 1811-1825
[Abstract]
[Full Text]
-
Buzdin, A., Gogvadze, E., Kovalskaya, E., Volchkov, P., Ustyugova, S., Illarionova, A., Fushan, A., Vinogradova, T., Sverdlov, E.
(2003). The human genome contains many types of chimeric retrogenes generated through in vivo RNA recombination. Nucleic Acids Res
31: 4385-4390
[Abstract]
[Full Text]
-
Vincent, B. J., Myers, J. S., Ho, H. J., Kilroy, G. E., Walker, J. A., Watkins, W. S., Jorde, L. B., Batzer, M. A.
(2003). Following the LINEs: An Analysis of Primate Genomic Variation at Human-Specific LINE-1 Insertion Sites. Mol Biol Evol
20: 1338-1348
[Abstract]
[Full Text]
-
Ejima, Y., Yang, L.
(2003). Trans mobilization of genomic DNA as a mechanism for retrotransposon-mediated exon shuffling. Hum Mol Genet
12: 1321-1328
[Abstract]
[Full Text]
-
Copeland, C. S., Brindley, P. J., Heyers, O., Michael, S. F., Johnston, D. A., Williams, D. L., Ivens, A. C., Kalinna, B. H.
(2003). Boudicca, a Retrovirus-Like Long Terminal Repeat Retrotransposon from the Genome of the Human Blood Fluke Schistosoma mansoni. J. Virol.
77: 6153-6166
[Abstract]
[Full Text]
-
Brouha, B., Schustak, J., Badge, R. M., Lutz-Prigge, S., Farley, A. H., Moran, J. V., Kazazian, H. H. Jr.
(2003). Hot L1s account for the bulk of retrotransposition in the human population. Proc. Natl. Acad. Sci. USA
100: 5280-5285
[Abstract]
[Full Text]
-
Kolosha, V. O., Martin, S. L.
(2003). High-affinity, Non-sequence-specific RNA Binding by the Open Reading Frame 1 (ORF1) Protein from Long Interspersed Nuclear Element 1 (LINE-1). J. Biol. Chem.
278: 8112-8117
[Abstract]
[Full Text]
-
Prak, E. T. L., Dodson, A. W., Farkash, E. A., Kazazian, H. H. Jr.
(2003). Tracking an embryonic L1 retrotransposition event. Proc. Natl. Acad. Sci. USA
100: 1832-1837
[Abstract]
[Full Text]
-
Doak, T. G., Witherspoon, D. J., Jahn, C. L., Herrick, G.
(2003). Selection on the Genes of Euplotes crassus Tec1 and Tec2 Transposons: Evolutionary Appearance of a Programmed Frameshift in a Tec2 Gene Encoding a Tyrosine Family Site-Specific Recombinase. Eukaryot Cell
2: 95-102
[Abstract]
[Full Text]
-
Willhoeft, U., Buss, H., Tannich, E.
(2002). The Abundant Polyadenylated Transcript 2 DNA Sequence of the Pathogenic Protozoan Parasite Entamoeba histolytica Represents a Nonautonomous Non-Long-Terminal-Repeat Retrotransposon- Like Element Which Is Absent in the Closely Related Nonpathogenic Species Entamoeba dispar. Infect. Immun.
70: 6798-6804
[Abstract]
[Full Text]
-
Deininger, P. L., Batzer, M. A.
(2002). Mammalian Retroelements. Genome Res
12: 1455-1465
[Abstract]
[Full Text]
-
Zhang, Z., Harrison, P., Gerstein, M.
(2002). Identification and Analysis of Over 2000 Ribosomal Protein Pseudogenes in the Human Genome. Genome Res
12: 1466-1482
[Abstract]
[Full Text]
-
Roy-Engel, A. M., Salem, A.-H., Oyeniran, O. O., Deininger, L., Hedges, D. J., Kilroy, G. E., Batzer, M. A., Deininger, P. L.
(2002). Active Alu Element "A-Tails": Size Does Matter. Genome Res
12: 1333-1344
[Abstract]
[Full Text]
-
Ovchinnikov, I., Rubin, A., Swergold, G. D.
(2002). Tracing the LINEs of human evolution. Proc. Natl. Acad. Sci. USA
99: 10522-10527
[Abstract]
[Full Text]
-
Costas, J.
(2002). Characterization of the Intragenomic Spread of the Human Endogenous Retrovirus Family HERV-W. Mol Biol Evol
19: 526-533
[Abstract]
[Full Text]
-
Ostertag, E. M., Kazazian, H. H. Jr.
(2001). Twin Priming: A Proposed Mechanism for the Creation of Inversions in L1 Retrotransposition. Genome Res
11: 2059-2065
[Abstract]
[Full Text]
-
Malik, H. S., Eickbush, T. H.
(2001). Phylogenetic Analysis of Ribonuclease H Domains Suggests a Late, Chimeric Origin of LTR Retrotransposable Elements and Retroviruses. Genome Res
11: 1187-1197
[Abstract]
[Full Text]
-
Pavlicek, A., Paces, J., Elleder, D., Hejnar, J.
(2002). Processed Pseudogenes of Human Endogenous Retroviruses Generated by LINEs: Their Integration, Stability, and Distribution. Genome Res
12: 391-399
[Abstract]
[Full Text]