Previous Article | Next Article 
Molecular and Cellular Biology, March 2001, p. 1499-1508, Vol. 21, No. 5
Departments of Molecular Biology and Cell
Biology, The Scripps Research Institute, La Jolla, California 92037
Received 4 October 2000/Returned for modification 21 November
2000/Accepted 30 November 2000
The G2 DNA damage and DNA replication checkpoints in
many organisms act through the inhibitory phosphorylation of Cdc2 on tyrosine-15. This phosphorylation is catalyzed by the Wee1/Mik1 family
of kinases. However, the in vivo role of these kinases in checkpoint
regulation has been unclear. We show that, in the fission yeast
Schizosaccharomyces pombe, Mik1 is a target of both checkpoints and that the regulation of Mik1 is, on its own, sufficient to delay mitosis in response to the checkpoints. Mik1 appears to have
two roles in the DNA damage checkpoint; one in the establishment of the
checkpoint and another in its maintenance. In contrast, Wee1 does not
appear to be involved in the establishment of either checkpoint.
Checkpoints are mechanisms that
allow cells to deal with DNA damage or other insults (10,
18). A major role of checkpoints is to delay cell cycle
transitions, in order to allow time for the damage to be repaired. It
is therefore important to understand how checkpoints regulate the
basic cell cycle machinery. In the fission yeast
Schizosaccharomyces pombe and in mammalian cells, the DNA
damage and DNA replication checkpoints arrest cells in G2 through inhibitory phosphorylation of Cdc2 on
tyrosine-15 (5, 19, 35, 38). Cdc2, in association with its
regulatory subunit cyclin B, is the kinase that determines the timing
of the G2-M transition. While Cdc2 is controlled in many
ways, the dephosphorylation of tyrosine-15 is the rate-limiting step
for Cdc2 activation at mitosis and therefore regulates the timing of
the G2-M transition (17, 20). This
phosphorylation is catalyzed by members of the Wee1/Mik1/Myt1 family of
tyrosine kinases (Wee1 and Myt1 in vertebrates and Wee1 and Mik1 in
S. pombe) and removed by Cdc25 phosphatases
(8). Thus, to regulate Cdc2 by tyrosine-15
phosphorylation, the checkpoints must increase its phosphorylation
by one or more of the Wee1/Mik1/Myt1 kinases or decrease its
dephosphorylation by Cdc25.
In fission yeast, the DNA damage and DNA replication checkpoints
act through related signal transduction pathways that culminate in the
serine/threonine kinase Chk1, the effector of the DNA damage checkpoint, or the serine/threonine kinase Cds1, the effector of
the DNA replication checkpoint (reviewed in references 10, 36, and 37). In S. pombe and vertebrate cells, Cdc25
has been shown to be a target of these checkpoint pathways
(4, 15, 21, 33, 38). Both Chk1 and Cds1 phosphorylate
Cdc25 in vitro, and this phosphorylation inhibits its phosphatase
activity (4, 14, 15, 21, 33, 40, 44). In addition,
checkpoint-dependent phosphorylation of Cdc25 inhibits its nuclear
import, presumably sequestering it away from Cdc2 (9, 22, 24, 43,
45). However, recent studies have shown that the regulation of
Cdc25's subcellular localization is not required to enforce a
checkpoint-dependent cell cycle delay (25). In
S. pombe, Cdc2 is also dephosphorylated by the tyrosine
phosphatase Pyp3 (28). Pyp3 plays a minor role in normal
mitotic control, and unlike Cdc25, loss of its activity does not arrest
the cell cycle. Therefore, Pyp3 cannot be a sufficient checkpoint target.
It has been less certain to what extent the regulation of the
Wee1/Mik1/Myt1 kinases contributes to the function of the
checkpoints. There have been several reports correlating
checkpoint activation with changes in Wee1 abundance and
phosphorylation. The degradation of exogenous Wee1 appears to be
inhibited by the DNA replication checkpoint in Xenopus
egg extracts (27). In S. pombe cell
lysates, exogenous Wee1 is bound to and phosphorylated by Cds1 in a
checkpoint-dependent manner (6). Wee1 has been
reported to be phosphorylated in vivo in response to UV radiation, and
it is also phosphorylated by Chk1 in vitro (32). However,
none of these studies provide evidence that Wee1 regulation is
important for checkpoint function in vivo.
Mik1 has also been proposed to be a target of the checkpoints.
While Mik1 is not required for either checkpoint, cells deficient for both wee1 and cdc25 still arrest before
mitosis in response to a replication block induced by hydroxyurea (HU),
suggesting that regulation of Mik1 or Pyp3 is sufficient to enforce the
replication checkpoint (11, 26). That Mik1 may play a
role in this circumstance is suggested by the accumulation of Mik1
during a replication arrest. In response to the DNA replication
checkpoint, mik1+ mRNA accumulates to high
levels and Mik1 protein appears to be stabilized, leading to a dramatic
increase in steady-state protein levels (1, 6, 7).
Prolonged activation of the DNA damage checkpoint causes an
increase in the steady-state level of Mik1 to a lesser extent, without
affecting the level of mik1+ mRNA (1,
7). The increase in Mik1 abundance in response to prolonged
exposure to DNA damage may explain how Mik1 acts to enforce the
extended maintenance of a DNA damage checkpoint (1).
Despite these correlations between Mik1 protein abundance and
checkpoint activation, it is unknown if Mik1 regulation is involved
in establishing a G2 delay in response to either checkpoint.
These studies on checkpoint regulation of Wee1 and Mik1 have led to
models in which both kinases are proposed to be important targets of
the checkpoints. We designed an experimental system to
directly test these hypotheses. By using S. pombe
strains in which Cdc25 is replaced with a phosphatase that is not
regulated by the checkpoints, we created a situation in which any
checkpoint regulation of Cdc2 phosphorylation must act through Wee1
or Mik1. This experimental system allowed us to examine the
checkpoint regulation of Wee1 and Mik1 in vivo.
General methods for studying fission yeast were followed as
described previously (29). The following strains were
used: PR109 (h Synchronous cultures were prepared by centrifugal elutriation with a
Beckman JE-5.0 elutriation rotor, a technique that selects the smallest
cells from an asynchronous population. In S. pombe, replication occurs immediately after mitosis and concurrently with
cytokinesis; thus elutriation produces a population of early G2 cells. The time from elutriation to septation varies
reproducibly among various strains, with that of the
nmt1:pyp3+
cdc25::ura4+ strains being
particularly short. Because all of the experiments were internally
controlled, this variation does not affect the interpretation of the
results. The number of cells having passed mitosis (N) was
determined as N = (S + D)/(T The wee1-50 allele was used instead of wee1
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.5.1499-1508.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Roles of the Mitotic Inhibitors Wee1 and Mik1 in
the G2 DNA Damage and Replication Checkpoints
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
leu1-32 ura4-D18),
PR754 (h leu1-32 ura4-D18 wee1-50
mik1::ura4+), NR1826
(h leu1-32 ura4-D18
rad3::ura4+), NB2117
(h leu1-32 ura4-D18
cds1::ura4+), AL2521
(h leu1-32 ura4-D18
chk1+:9Myc), NR2648
(h leu1-32 ura4-D18
rad3::ura4+
chk1+:9Myc), NR2613
(h leu1-32 ura4-D18
nmt1:pyp3+
cdc25::ura4+), NR2640
(h leu1-32 ura4-D18
nmt1:pyp3+
cdc25::ura4+ wee1-3x),
NR2630 (h leu1-32 ura4-D18
nmt1:pyp3+
cdc25::ura4+
wee1-50ts), NR2657 (h+ leu1-32
ura4-? nmt1:pyp3+
cdc25::ura4+
mik1-s14ts), NR2634 (h
leu1-32 ura4-D18+
nmt1:pyp3+
cdc25::ura4+
mik1::ura4+), NR2644
(h leu1-32 ura4-?
nmt1:pyp3+
cdc25::ura4+ wee1-50
mik1-s14ts), NR2646 (h leu1-32
ura4-D18 nmt1:pyp3+
cdc25::ura4+
chk1+:9Myc), NR2650
(h leul-32 ura4-D18
nmt1:pyp3+
cdc25::ura4+
mik1+:13Myc), KS1362
(h+ leu1-32 ura4-? wee1-50ts
cdc25-22ts), and PR1928 (h leu1-32
ura4-? wee1-50ts cdc25-22ts mik1::ura4). The
designation "ura4-?" indicates that the ura4
allele may be ura4-D18 or ura4-294. Unless
otherwise stated, strains were grown in Edinburgh minimal medium 2, supplemented with leucine, uracil, adenine, and histidine, with or
without 5 µg of thiamine per ml at 32°C. For the experiments presented in Fig. 3, strains were grown in YES, a yeast extract-based medium with the same supplements. Strains were grown in the indicated media for at least 48 h before each experiment.
D), where S
is the number of septated cells, D is the number of divided
cells, and T is the total number of cells. This equation
corrects for the fact that once a cell has divided it is counted as two
cells. Cells were photographed and measured using a Quantix digital
camera (Photometrics) and IP Lab software (Signal Analytics
Corporation). Cells were irradiated with gamma radiation from a
cesium-137 source at 3.3 Gy min1 for 30 min, or at 1 Gy
min1 for the continuous exposure used in Fig. 1. For HU
experiments, cells were grown for 60 to 90 min in 10 mM HU before
elutriation. This protocol ensures that the elutriated cells are
arrested in S phase. HU was then washed out of half the culture, which
replicated and went on to divide with kinetics similar to that of
untreated cultures.
because wee1 cells diploidize at a high frequency.
wee1-50 strains were maintained at 25°C and shifted to
32°C for at least 12 h before any experiment conducted at 32°C. To
establish that 32°C is a restrictive temperature for
wee1-50, we compared the length of wee1-50 cells
at various temperatures. wee1-50 cells at 32°C are
indistinguishable from wee1 cells (Table 1). To determine
if wee1-50 might have some residual activity at 32°C that
would be unmeasurable at normal expression levels, we overexpressed
wee1-50 approximately 30- to 60-fold from the
adh1 promoter (our unpublished data). The normalized
activity of wee1-50 at 32°C is less than 3%, assuming 30-fold overexpression (Table 1). In
addition, all experiments with wee1-50 strains were repeated
at 35°C with comparable results. Since wee1 mutant strains
replicate later in the cell cycle than wild-type strains, we confirmed
by flow cytometry that the synchronized cultures had completed
replication before being irradiated (our unpublished data). The
temperature-sensitive (ts) mik1-s14 allele was isolated on
the basis of its synthetic lethality with wee1-50. It is
tightly linked to mik1 and rescued by
mik1+ genomic sequences (our unpublished data).
The lowest restrictive temperature for mik1-s14, as assayed
by viability of wee1 mik1-s14 cells, is
33°C. For the HU experiments involving mik1-s14, cells were grown and elutriated at 25°C and then cultured at 25°C for 60 min to allow the cells that had been washed out of HU to replicate. The
cultures were then shifted to 35°C to inactivate Mik1.
TABLE 1.
Comparison of activities of length of S. pombe strains at various temperatures
The nmt1 promoter was inserted in place of the pyp3 promoter by one-step replacement. pFA6a-kanMX-P3nmt1 was amplified with the following primers (Integrated DNA Technologies, Inc): 5'-GAATGTGAACGTGAACTAGATT ACGACTACAACTAGAAACTAGCGCTATGTGGGGGCCGTACAATGAT GATTTATTAAACGAATTCGAGCTCGTTTAAAC-3' and 5'-ATAATCATG TACGCTTTTTCTTTTATTGTGATCAAGGGTGTTAGAACACCATTTTC TGTAGATACTTCTTTAAAAGACATGATTTAACAAAGCGACTATA-3'. The amplified DNA was transformed into PR109, and integrants were selected as described previously (2).
Protein affinity purifications, Western blotting, and kinase assays were performed as previously described (1, 6, 35).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Constitutive overexpression of pyp3+
rescues cdc25.
We sought to create a strain of
S. pombe in which the dephosphorylation of Cdc2 tyrosine-15
was not regulated by the checkpoints. To that end, we integrated
the thiamine-repressible nmt1 promoter upstream of the
pyp3+ genomic open reading frame. When grown in
the absence of thiamine, nmt1:pyp3+ cells
overexpress Pyp3 to a level sufficient to rescue the
lethality of cdc25 (Fig.
1A).
nmt1:pyp3+ cdc25 cells are
healthy and grow with a generation time of 3.0 h, similar to the
wild type (data not shown). They divide at about 16 µm, compared with
13 µm for the wild type, suggesting that, at this level of
expression, Pyp3 is not quite as active as endogenous Cdc25 (Fig. 1A).
To demonstrate that the nmt1:pyp3+
cdc25 cells are still responsive to variations in Wee1
activity, we used wee1-3x, an allele that has three copies
of wee1+ integrated at its genomic locus
(39). These cells divide at about 21 µm, the same length
as otherwise-wild-type wee1-3x cells (39).
Thus, in nmt1:pyp3+ cdc25
cells, in which Pyp3 replaces Cdc25, the cells undergo mitosis with
close-to-wild-type timing and retain a normal response to changes in
Wee1 activity.
|
cells about 40 min to dephosphorylate Cdc2 when shifted to
35°C, and the cells septate about 20 min later (Fig. 1B)
(35). If either checkpoint is activated before the
shift (by gamma radiation or by pretreatment of the cells with HU so that the elutriated cells are arrested in S phase), the
dephosphorylation is delayed 40 to 60 min. These results demonstrate,
as previously shown, that the dephosphorylation of Cdc2 by Cdc25 is
inhibited by both checkpoints (Fig. 1B) (35, 38). When
the experiments were repeated in an
nmt1:pyp3+ cdc25 wee1-ts
mik1-ts strain, no delay in mitosis was observed, demonstrating
that Pyp3 is not regulated by either checkpoint (Fig. 1C).
These results show that nmt1:pyp3+
cdc25 cells are unable to regulate the rate of Cdc2
dephosphorylation in response to either checkpoint. Because both
checkpoints are dependent on tyrosine-15 phosphorylation of Cdc2
(35, 38), any checkpoint regulation of mitosis in the
nmt1:pyp3+ cdc25 cells must be
due to regulation of the rate of Cdc2 phosphorylation by Wee1 or Mik1.
We used this situation to test if Wee1 or Mik1 is regulated by either checkpoint.
Regulation of Wee1 and Mik1 by the DNA damage checkpoint.
To determine whether Wee1 and Mik1 are regulated in response to
activation of the checkpoint, we examined the ability of
nmt1:pyp3+ cdc25 cells to
delay mitosis in response to DNA damage. A synchronous population of
nmt1:pyp3+ cdc25 cells was
exposed to 100 Gy of gamma radiation in G2 and was
monitored through the first mitosis. Wild-type cells delayed mitosis
about 60 min in response to such treatment (Fig.
2A). nmt1:pyp3+ cdc25 cells also
showed a delay in G2, albeit a much reduced one, of about
20 min (Fig. 2B). A delay of this length was reproducibly seen in four
similar experiments, and all other cell cycle kinetic results presented
are representative of at least three similar experiments. This
demonstrates that in the absence of Cdc25 regulation, cells are able to
delay mitosis in response to DNA damage but not to the full extent seen
in wild-type cells. We conclude that the regulation of either Wee1 or
Mik1 must play a role in delaying mitosis in response to DNA damage.
|
or mik1
backgrounds. The partial delay seen in
nmt1:pyp3+ cdc25 cells is also
seen in nmt1:pyp3+ cdc25
wee1-ts cells at the restrictive temperature (Fig. 2C). In
nmt1:pyp3+ cdc25
wee1-ts cells, neither Cdc25 nor Wee1 can be regulated, and
thus Mik1 regulation must be responsible for the delay observed. nmt1:pyp3+ cdc25
mik1 cells, in which neither Cdc25 nor Mik1 can be
regulated, are unable to delay mitosis in response to DNA damage (Fig.
2D). Thus, Wee1 is not significantly up-regulated in response to DNA damage, and Cdc25 and Mik1 are the only major targets controlling Cdc2
phosphorylation in response to the checkpoint.
The level of Mik1 protein has been reported to increase in
response to DNA damage. We therefore tried to correlate the
accumulation of Mik1 with the delay seen in
nmt1:pyp3+ cdc25 cells. Mik1
accumulated in response to prolonged checkpoint activation such as
that evoked by continuous exposure to the DNA-damaging drug bleomycin
or high doses of gamma radiation (250 Gy) (1, 7). However,
Mik1 did not accumulate in response to the dose of gamma radiation (100 Gy) used in this study (Fig. 2E), presumably because this dose triggers
only a relatively short delay which provides insufficient time for Mik1
to significantly accumulate (Fig. 2B). Thus, Mik1 activity must be
regulated at some other level to induce the delay seen in
nmt1:pyp3+ cdc25 cells.
As a control, to show that overexpression of Pyp3 does not interfere
with activation of the DNA damage signal transduction pathway, we
examined the phosphorylation of Chk1. This phosphorylation results in a
decrease in the mobility of Chk1 on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and correlates with the
activation of the DNA damage checkpoint (42). Chk1 is
phosphorylated normally in response to DNA damage in the
nmt1:pyp3+ cdc25 background,
demonstrating that the checkpoint signal transduction pathway is
intact (Fig. 2F).
As an alternate test of the function of Mik1 in the DNA damage
checkpoint, we examined the checkpoint responses of cells
lacking both Wee1 and Cdc25 functions. Cells mutated for both
wee1 and cdc25 are viable but have severely
compromised mitotic control and are thus difficult to synchronize
(12, 34). However, by using the double-ts strain
wee1-50ts cdc25-22ts, we were able to maintain and
synchronize the cells at a permissive temperature and then to
inactivate both Wee1 and Cdc25 by shifting the cells to a restrictive
temperature. wee1-50ts and cdc25-22ts are both strong-ts alleles that are inactivated quickly and behave as null alleles at 35°C (12, 30, 39). If Mik1 is up-regulated by the DNA damage, wee1-50ts cdc25-22ts cells should show a DNA
damage-induced delay of mitosis.
wee1-50ts cdc25-22ts cells were elutriated at 25°C,
shifted to 35°C to inactivate Wee1 and Cdc25, and then treated with
gamma radiation, UV radiation, or bleomycin, a gamma ray mimetic. In response to either radiation treatment the cells exhibited
approximately a 20-min delay of mitosis, similar to the delay seen in
the nmt1:pyp3+ cdc25
background (Fig. 2A and 3A). In response to bleomycin, which causes
persistent DNA damage, the cells delayed mitosis for the duration of
the experiment. The delay seen in this strain is due to Mik1, since
wee1-50ts cdc25-22ts mik1 cells fail to mitosis to any of
the DNA-damaging agents (Fig. 3B). While
the brief Cdc25-independent, Mik1-dependent delay induced by UV
radiation in wee1-50ts cdc25-22ts cells is detectable in
synchronized cultures, it is not obvious in asynchronous cultures (Fig.
3C). To more easily measure this delay in asynchronous cultures, we
used bleomycin. As with the synchronous cultures, the Cdc25-independent
delay is completely dependent on Mik1 (Fig. 3C).
|
strain allow another informative comparison. Because wee1-50ts
mik1 cells cannot phosphorylate Cdc2 at 35°C, the rate at
which they enter mitosis is dependent on the rate at which Cdc25
dephosphorylates Cdc2, that is, on the in vivo activity of Cdc25.
Inactivation of Cdc25 by the DNA damage checkpoint delays the entry
of wee1-50ts mik1 cells shifted to 35°C by about 40 min
(35). We compared this amount of delay with that caused by
inactivating Cdc25 with the cdc25-22ts allele.
wee1-50ts mik1 cells were elutriated, irradiated with 100 Gy of gamma radiation or mock irradiated, and shifted to 35°C. The
mitotic entry of these cells was graphed with that of wee1-50ts
cdc25-22ts mik1 cells shifted to 35°C at the same amount of
time after elutriation (Fig. 3D). The wee1-50ts cdc25-22ts
mik1 cells and the irradiated wee1-50ts mik1
cells display the same kinetics of mitotic entry, demonstrating that, to a first approximation, the DNA damage checkpoint inhibits Cdc25 to the same extent as a strong-ts allele.
Regulation of Wee1 and Mik1 by the DNA replication
checkpoint.
Next, we tested the DNA replication checkpoint
response in nmt1:pyp3+ cdc25
cells. We treated the asynchronous starting culture with HU for 90 min
before elutriation. In this way, we could obtain a synchronous
population arrested in S phase. HU was removed from half of the
culture. This HU-released culture completes replication and goes on to
divide with kinetics similar to that of an untreated culture. In
wild-type cells, activation of the DNA replication checkpoint
arrests cells for the duration of the experiment (Fig. 4A). Similarly, in
nmt1:pyp3+ cdc25 cells, the
DNA replication checkpoint is able to arrest the majority of cells
(Fig. 4B). Thus, either Wee1 or Mik1 must be up-regulated by the DNA
replication checkpoint. To determine which one is regulated, we
repeated the experiment for strains in which Wee1 or Mik1 is
inactivated. HU inhibits mitosis in
nmt1:pyp3+ cdc25
wee1-ts cells at the restrictive temperature, suggesting that Wee1 is not significantly up-regulated in response to the DNA
replication checkpoint (Fig. 4C). In contrast,
nmt1:pyp3+ cdc25
mik1-ts cells at the restrictive temperature fail to arrest (Fig. 4D). Therefore, Mik1 is up-regulated in response to the DNA
replication checkpoint, and such up-regulation is sufficient to
arrest most cells.
|
strains (Fig.
4E).
In the DNA replication checkpoint experiments, we used a ts allele
of mik1 instead of a deletion. This was done because
nmt1:pyp3+ cdc25
mik1 cells divide soon after being arrested in S phase with HU. They divide sooner than normal, about 1 h after the
previous division compared with 3 h for untreated cells, and they
divide at a smaller size than normal, 11.1 ± 1.7 µm (mean ± standard deviation) compared with 17.4 ± 1.5 µm for
untreated cells (data not shown). Checkpoint-defective
rad3 cells behave similarly when treated with HU,
dividing at 9.3 ± 0.9 µm when arrested in HU, compared with
13.2 ± 1.2 µm normally (data not shown). These results are
consistent with the conclusion that
nmt1:pyp3+ cdc25
mik1 cells lack all the targets of the DNA replication checkpoint. Possible reasons for this accelerated division of checkpoint-defective cells in HU are discussed below.
In these experiments we used nmt:pyp3 to suppress the
cell cycle arrest phenotype of cdc25. Another plausible
strategy is to use human T-cell PTPase to replace Cdc25. PTPase rescues
cdc25 but has no sequence similarity to Cdc25
(16). Thus, it is unlikely to be regulated by the
checkpoints in S. pombe. We performed the synchronous-checkpoint experiments illustrated in Fig. 2 and 4 in
an nmt1:PTPase background and obtained comparable results
(our unpublished data). However, for technical reasons we had to use a
cdc25-ts allele instead of cdc25, and we were
unable to do the controls shown in Fig. 1. We therefore used
nmt1:pyp3 for the experiments described in this paper.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
We constructed strains of S. pombe in which a checkpoint delay of mitosis in response to DNA damage or a DNA replication block can act only through Wee1 or Mik1. We did this by replacing Cdc25, the phosphatase that normally dephosphorylates Cdc2, with overexpressed Pyp3, another Cdc2 phosphatase that is not regulated by either checkpoint. Since the G2 checkpoints in S. pombe act through the tyrosine-15 phosphorylation of Cdc2 (35, 38), this situation leaves Wee1 and Mik1 as the remaining possible targets of the checkpoints and allows us to assay the regulation of Wee1 and Mik1 in the absence of confounding regulation of Cdc25.
Experiments with these strains show that Mik1 is regulated by both
checkpoints. Mik1 regulation in response to the DNA replication checkpoint is sufficient to arrest most cells in G2,
independent of checkpoint regulation of Cdc25 (Fig. 4C). This
regulation may be due to the large increase in Mik1 protein levels in
response to the replication checkpoint (6, 7),
although the specific activity of Mik1 may also be regulated. Cdc25
regulation is also able to arrest cells independent of Mik1 activity
(26). The fact that some cells leak through the arrest in
the nmt1:pyp3+ cdc25
background, while mik1 cells arrest tightly in HU,
suggests that Cdc25 is a somewhat more important target. However, both Mik1 and Cdc25 appear to be major targets of the DNA replication checkpoint in S. pombe.
Mik1 regulation plays a less important role in the DNA damage
checkpoint. nmt1:pyp3+
cdc25 cells and wee1-50ts cdc25-22ts cells
have an attenuated DNA damage checkpoint, delaying mitosis by less
than 20 min in response to damage that arrests wild-type cells for 60 min (Fig. 2A and B and 3A). This delay is dependent upon Mik1 (Fig. 2D
and 3B). Mik1 has also been shown to be required for prolonged arrest in response to continuous DNA damage (1). However, the
effect described in that work is different from the one described here. In that work, mik1 cells still arrested but were unable
to maintain a prolonged arrest in the presence of continuous damage.
Here, we show that in response to a short pulse of DNA damage,
mik1 cells that are also cdc25 are unable
to establish a checkpoint (Fig. 2D and 3B). Conversely, cells that
lack Cdc25 but retain Mik1 can establish a checkpoint but cannot
maintain it for as long as wild-type cells (Fig. 2A and B and 3A).
These two roles for Mik1, one in establishment and the other in
maintenance of the checkpoint, may be due to different modes of
Mik1 regulation. The requirement of Mik1 in maintaining a prolonged DNA
damage checkpoint correlates with increased abundance of Mik1 (1). In contrast, the short duration of checkpoint
used in this work is insufficient to cause Mik1 accumulation (Fig. 2E). These results suggest that Mik1 activity is up-regulated immediately by
a mechanism independent of protein level and that this up-regulation is
able to cause a brief delay of mitosis. If the damage persists, Mik1
protein levels increase, and this increase may be important for
maintenance of a prolonged arrest. Therefore, there may be two modes of
regulation of Mik1 in response to the DNA damage checkpoint: one
that increases Mik1 activity immediately to establish the
checkpoint and another that increases Mik1 abundance over time to
maintain the checkpoint. Both modes of regulation are dependent on
Chk1, as demonstrated by the fact that the checkpoint is abolished
in chk1 cells. It is plausible that Chk1 acts in both
cases through the direct phosphorylation of Mik1. Alternatively, Chk1
may regulate Mik1 indirectly.
In contrast to Mik1, Wee1 does not appear to be required for the
establishment of either checkpoint. The presence of Wee1, in the
absence of Mik1, is not sufficient to effect a mitotic delay in
response to either DNA damage or replication inhibition (Fig. 2D, 3B,
and 4D). Were Wee1 up-regulated even threefold, it would be readily
apparent, as demonstrated by the effect of adding two copies of
wee1+ to the
nmt1:pyp3+ cdc25 background
(Fig. 1A). The different effects of the wee1 and
mik1 mutations on checkpoint control in the
nmt1:pyp3+ cdc25 background
contrast sharply with the fact that during a normal cell cycle, cells
are quite sensitive to mutations in wee1 but not sensitive
to mutations in mik1 (13, 26). Thus it appears
that Wee1 is the more important kinase under normal growth conditions,
while Mik1 is the more important kinase in checkpoint situations.
Previous work has shown that Wee1 binds to and is phosphorylated by
Cds1 in response to activation of the replication checkpoint
(6). These results lead to the hypothesis that Wee1 is an
important target of the replication checkpoint. The experiments
presented here, undertaken in large part to test that hypothesis, do
not support an important role for Wee1 regulation in establishment of
the replication checkpoint. However, while Wee1 does not appear to
be regulated by either checkpoint, it should be noted that these
experiments were designed to assay specifically the establishment of
the checkpoints. In addition to checkpoint establishment, the
maintenance of and adaptation to checkpoints are also regulated
(1, 41). It is possible that Wee1 could be regulated at
some other point in the checkpoint cycle.
A recently published study, using approaches similar to some of the
ones described here, has reached a different conclusion regarding the
role of Wee1 in the DNA damage checkpoint (34). Raleigh and O'Connell conclude that Wee1 is regulated by the DNA damage checkpoint. They present two sets of experiments examining cell cycle kinetics in response to DNA damage that support their conclusions. First, they demonstrate that cells lacking Cdc25 but
viable due to either the expression of human T-cell PTPase or the
presence of a suppressing mutation in cdc2 can delay mitosis in response to DNA damage. These results are similar to those presented
here and elsewhere and support the conclusion that there is a target
other than Cdc25 (Fig. 2B) (1). For these experiments, Raleigh and O'Connell used synchronous cultures and were able to
detect a brief Cdc25-independent delay, similar to the one seen in Fig.
2. They then base their conclusion that Wee1 is the other target on the
fact that strains lacking functional Wee1 and Cdc25 display no
DNA damage-induced delay of mitosis. However, they use only
asynchronous cultures for these experiments and are therefore unable to
detect the Cdc25- and Wee1-independent delay seen in Fig. 2 and 3.
Previous experiments with asynchronous cultures have also failed
to detect the attenuated Mik1-dependent DNA damage checkpoint delay
in cdc25 strains. In fact, when we originally
investigated the role of Cdc25 in the DNA damage checkpoint, we
used asynchronous cultures and were unable to detect any
Cdc25-independent checkpoint delay (15). The
attenuated Mik1-dependent delay is apparent only when the experiments
are done with synchronous cultures (Fig. 2B and 3A) (1).
Thus, the asynchronous experiments presented by Raleigh and O'Connell
and reproduced in Fig. 3C, would not be expected to detect the
Cdc25-independent delay that they had identified in their synchronous
experiments. Moreover, a prolonged checkpoint delay that can be
seen in asynchronous cultures is induced by bleomycin in cells lacking
functional Cdc25 and Wee1 (Fig. 3A and C), and this arrest is entirely
dependent on Mik1 (Fig. 3B and C).
Our conclusion that the checkpoint up-regulates Mik1 has the positive attribute of providing a straightforward explanation for why wee1 mutations suppress mutational inactivation of Cdc25 and yet wee1 mutants are fully checkpoint proficient (3, 12, 39). If the damage checkpoint regulated only Wee1 and Cdc25, as proposed by Raleigh and O'Connell, then wee1 mutations should suppress cell cycle arrest caused by negative regulation of Cdc25 by Chk1. On the other hand, if the damage checkpoint up-regulates Mik1, wee1 mutants should undergo checkpoint arrest in response to DNA damage, as in fact they do.
In the course of the DNA replication checkpoint experiments, we
discovered that nmt1:pyp3+
cdc25 mik1 cells, when grown in HU, greatly
advance the timing of mitosis. nmt1:pyp3+
cdc25 mik1 cells placed in HU during
G2 will grow to about 16 µm, the normal size for mitosis,
divide, and then attempt to replicate. Because of HU, the cells will
arrest in early S phase. Up to this point,
nmt1:pyp3+ cdc25
mik1 cells behave in the same way as wild-type cells. However, instead of delaying mitosis as wild-type cells would, nmt1:pyp3+ cdc25
mik1 cells divide again. In fact, they divide sooner than
normal, and consequently, they divide at a smaller than normal size.
Because cdc25 and mik1 are both deleted, Wee1
remains as the sole major regulator of mitotic timing. Thus, one might
conclude that the DNA replication checkpoint down-regulates Wee1 in
order to advance mitosis. However, this explanation runs counter to the
idea that the checkpoint should delay mitosis and, if anything, up-regulate Wee1. We therefore prefer an alternate explanation based
upon the proposed role of Wee1 in size control.
The size of S. pombe cells at mitosis is proportional to
ploidy, with 4C cells being roughly twice as big as 2C cells
(31). It has been proposed that this mitotic size control
acts through the regulation of Wee1 (13). This model
predicts that a cell arrested in HU with a 1C DNA content and lacking a
DNA replication checkpoint would divide at about half the size of a
normal 2C cell, since it has half the ploidy of a 2C cell. Thus, the
advancement of mitosis in nmt1:pyp3+
cdc2.5 mik1 cells could be due not to the
direct down-regulation of Wee1 by the DNA replication checkpoint
but rather to the down-regulation of Wee1 as a result of the fact that
the cells are past the size for mitosis of a 1C cell. Consistent with
this idea, checkpoint-deficient rad3 cells also
advance mitosis when treated with HU. rad3 cells are
thought to entirely lack the DNA replication checkpoint; thus, the
fact that they advance mitosis is inconsistent with a model in which
the checkpoint directly down-regulates Wee1.
The results of this study, along with previous work on Cdc25
regulation, define the major in vivo cell cycle targets of the G2 DNA damage and DNA replication checkpoints in
S. pombe (Fig. 5). The DNA
damage checkpoint, acting through its effector, Chk1, strongly
inhibits Cdc25, to approximately the same extent as a strong-ts allele
(Fig. 3C) (15, 35). We show here that, in the absence of
this regulation of Cdc25, regulation of Mik1 can cause an attenuated
mitotic delay (Fig. 2B and D and 3A and B). These results show that
Cdc25 is the major target of the DNA damage checkpoint, with Mik1
as a secondary target, consistent with previous reports that Cdc25 is
the major target of the DNA damage checkpoint (1, 15).
In contrast, both Cdc25 and Mik1 are major targets of the DNA
replication checkpoint. The ability of Cdc25 to dephosphorylate Cdc2 in vivo is inhibited by the DNA replication checkpoint, and this inhibition is sufficient to delay mitosis in the absence of Mik1
(26, 38). Conversely, Mik1 up-regulation in response to
the DNA replication checkpoint is also sufficient to delay mitosis
in most cells (Fig. 4B and D). The fact that cells lacking both Cdc25
and Mik1 are unable to delay mitosis in response to either DNA damage
or a replication block demonstrates that they are the only major cell
cycle targets of the two checkpoints (Fig. 2D, 3B, and 4D).
|
Fission yeast cells have provided an excellent model for framing checkpoint studies in more complex multicellular organisms. Indeed, Cdc25 was first identified as a checkpoint target through investigations of fission yeast cells, and it is now evident that regulation of Cdc25 by Chk1 is substantially conserved among fission yeast cells, mammalian cells, and Xenopus oocytes (15, 21, 33, 35, 40). These facts raise the question of whether Wee1/Mik1 homologs are checkpoint targets in multicellular organisms. As experiments aiming to answer this question go forward, it will be important to keep in mind that mammalian and Xenopus Wee1 protein sequences are equally related to Wee1 and Mik1 in fission yeast cells. Thus, it is possible that human Wee1 may be functionally more similar to Mik1 than Wee1 in fission yeast cells. As we learn more about how Mik1 is regulated by checkpoints in fission yeast cells and are able to compare this knowledge to studies of Wee1/Mik1-related genes in other species, a better understanding of the functional distinctions between Wee1 and Mik1 will emerge.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to Kathy Gould for providing the nmt1:PTPase construct with which preliminary experiments were done, Michael Boddy for providing the glutathione S-transferase Wee1, and Beth Baber-Furnari for providing the chk1+:9Myc strain. We also thank the members of the TSRI Cell Cycle Group for many interesting discussions and useful suggestions, in particular Jean-Marc Brondello for suggesting the use of a conditional mik1 allele.
N.R. was supported by an NIH postdoctoral fellowship and a special fellowship from the Leukemia and Lymphoma Society. This work was supported by an NIH grant awarded to P.R.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Departments of Molecular Biology and Cell Biology, The Scripps Research Institute, La Jolla, CA 92037. Phone: (858) 784-8273. Fax: (858) 784-2265. E-mail: prussell{at}scripps.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Baber-Furnari, B. A.,
N. Rhind,
M. N. Boddy,
P. Shanahan,
A. Lopez-Girona, and P. Russell.
2000.
Regulation of mitotic inhibitor mik1 helps to enforce the DNA damage checkpoint.
Mol. Biol. Cell
11:1-11 |
| 2. | Bähler, J., J. Q. Wu, M. S. Longtine, N. G. Shah, A. McKenzie III, A. B. Steever, A. Wach, P. Philippsen, and J. R. Pringle. 1998. Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14:943-951[CrossRef][Medline]. |
| 3. | Barbet, N. C., and A. M. Carr. 1993. Fission yeast wee1 protein kinase is not required for DNA damage-dependent mitotic arrest. Nature 364:824-827[CrossRef][Medline]. |
| 4. | Blasina, A., I. V. de Weyer, M. C. Laus, W. H. Luyten, A. E. Parker, and C. H. McGowan. 1999. A human homologue of the checkpoint kinase Cds1 directly inhibits Cdc25 phosphatase. Curr. Biol. 9:1-10[CrossRef][Medline]. |
| 5. | Blasina, A., E. S. Paegle, and C. H. McGowan. 1997. The role of inhibitory phosphorylation of CDC2 following DNA replication block and radiation-induced damage in human cells. Mol. Biol. Cell 8:1013-1023[Abstract]. |
| 6. |
Boddy, M. N.,
B. Furnari,
O. Mondesert, and P. Russell.
1998.
Replication checkpoint enforced by kinases Cds1 and Chk1.
Science
280:909-912 |
| 7. |
Christensen, P. U.,
N. J. Bentley,
R. G. Martinho,
O. Nielsen, and A. M. Carr.
2000.
Mik1 levels accumulate in S phase and may mediate an intrinsic link between S phase and mitosis.
Proc. Natl. Acad. Sci. USA
97:2579-2584 |
| 8. | Coleman, T. R., and W. G. Dunphy. 1994. Cdc2 regulatory factors. Curr. Opin. Cell Biol. 6:877-882[CrossRef][Medline]. |
| 9. |
Dalal, S. N.,
C. M. Schweitzer,
J. Gan, and J. A. DeCaprio.
1999.
Cytoplasmic localization of human cdc25C during interphase requires an intact 14-3-3 binding site.
Mol. Cell. Biol.
19:4465-4479 |
| 10. |
Elledge, S. J.
1996.
Cell cycle checkpoints: preventing an identity crisis.
Science
274:1664-1672 |
| 11. |
Enoch, T.,
A. M. Carr, and P. Nurse.
1992.
Fission yeast genes involved in coupling mitosis to completion of DNA replication.
Genes Dev.
6:2035-2046 |
| 12. | Fantes, P. 1979. Epistatic gene interactions in the control of division in fission yeast. Nature 279:428-430. |
| 13. | Fantes, P. A., and P. Nurse. 1978. Control of the timing of cell division in fission yeast. Cell size mutants reveal a second control pathway. Exp. Cell Res. 115:317-329[CrossRef][Medline]. |
| 14. |
Furnari, B.,
A. Blasina,
M. N. Boddy,
C. H. McGowan, and P. Russell.
1999.
Cdc25 inhibited in vivo and in vitro by checkpoint kinases Cds1 and Chk1.
Mol. Biol. Cell
10:833-845 |
| 15. |
Furnari, B.,
N. Rhind, and P. Russell.
1997.
Cdc25 mitotic inducer targeted by Chk1 DNA damage checkpoint kinase.
Science
277:1495-1497 |
| 16. |
Gould, K. L.,
S. Moreno,
N. K. Tonks, and P. Nurse.
1990.
Complementation of the mitotic activator, p80cdc25, by a human protein-tyrosine phosphatase.
Science
250:1573-1576 |
| 17. | Gould, K. L., and P. Nurse. 1989. Tyrosine phosphorylation of the fission yeast cdc2+ protein kinase regulates entry into mitosis. Nature 342:39-45[CrossRef][Medline]. |
| 18. |
Hartwell, L. H., and T. A. Weinert.
1989.
Checkpoints: controls that ensure the order of cell cycle events.
Science
246:629-634 |
| 19. |
Jin, P.,
Y. Gu, and D. O. Morgan.
1996.
Role of inhibitory CDC2 phosphorylation in radiation-induced G2 arrest in human cells.
J. Cell Biol.
134:963-970 |
| 20. | Krek, W., and E. A. Nigg. 1991. Mutations of p34cdc2 phosphorylation sites induce premature mitotic events in HeLa cells: evidence for a double block to p34cdc2 kinase activation in vertebrates. EMBO J. 10:3331-3341[Medline]. |
| 21. |
Kumagai, A.,
Z. Guo,
K. H. Emami,
S. X. Wang, and W. G. Dunphy.
1998.
The Xenopus Chk1 protein kinase mediates a caffeine-sensitive pathway of checkpoint control in cell-free extracts.
J. Cell Biol.
142:1559-1569 |
| 22. |
Kumagai, A.,
P. S. Yakowec, and W. G. Dunphy.
1998.
14-3-3 proteins act as negative regulators of the mitotic inducer Cdc25 in Xenopus egg extracts.
Mol. Biol. Cell
9:345-354 |
| 23. |
Lindsay, H. D.,
D. J. Griffiths,
R. J. Edwards,
P. U. Christensen,
J. M. Murray,
F. Osman,
N. Walworth, and A. M. Carr.
1998.
S-phase-specific activation of Cds1 kinase defines a subpathway of the checkpoint response in Schizosaccharomyces pombe.
Genes Dev.
12:382-395 |
| 24. | Lopez-Girona, A., B. Furnari, O. Mondesert, and P. Russell. 1999. Nuclear localization of Cdc25 is regulated by DNA damage and a 14-3-3 protein. Nature 397:172-175[CrossRef][Medline]. |
| 25. | Lopez-Girona, A., J. Kanoh, and P. Russell. Regulated localization of Cdc25 is not required for DNA damage checkpoint control. Curr. Biol., in press. |
| 26. | Lundgren, K., N. Walworth, R. Booher, M. Dembski, M. Kirschner, and D. Beach. 1991. Mik1 and Wee1 cooperate in the inhibitory tyrosine phosphorylation of Cdc2. Cell 64:1111-1122[CrossRef][Medline]. |
| 27. |
Michael, W. M., and J. Newport.
1998.
Coupling of mitosis to the completion of S phase through Cdc34-mediated degradation of Wee1.
Science
282:1886-1889 |
| 28. | Millar, J. B. A., G. Lenaers, and P. Russell. 1992. Pyp3 PTPase acts as a mitotic inducer in fission yeast. EMBO J. 11:4933-4941[Medline]. |
| 29. | Moreno, S., A. Klar, and P. Nurse. 1991. Molecular genetic analysis of the fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194:795-823[Medline]. |
| 30. | Nurse, P. 1975. Genetic control of cell size at cell division in yeast. Nature 256:547-551[CrossRef][Medline]. |
| 31. |
Nurse, P., and P. Thuriaux.
1980.
Regulatory genes controlling mitosis in the fission yeast Schizosaccharomyces pombe.
Genetics
96:627-637 |
| 32. | O'Connell, M. J., J. M. Raleigh, H. M. Verkade, and P. Nurse. 1997. Chk1 is a wee1 kinase in the G2 DNA damage checkpoint inhibiting cdc2 by Y15 phosphorylation. EMBO J. 16:545-554[CrossRef][Medline]. |
| 33. |
Peng, C. Y.,
P. R. Graves,
R. S. Thoma,
Z. Wu,
A. S. Shaw, and H. Piwnica-Worms.
1997.
Mitotic and G2 checkpoint control: regulation of 14-3-3 protein binding by phosphorylation of Cdc25C on serine-216.
Science
277:1501-1505 |
| 34. | Raleigh, J. M., and M. J. O'Connell. 2000. The G2 DNA damage checkpoint targets both Wee1 and Cdc25. J. Cell Sci. 113:1727-1736[Abstract]. |
| 35. |
Rhind, N.,
B. Furnari, and P. Russell.
1997.
Cdc2 tyrosine phosphorylation is required for the DNA damage checkpoint in fission yeast.
Genes Dev.
11:504-511 |
| 36. | Rhind, N., and P. Russell. 2000. Chk1 and Cds1: linchpins of the DNA damage and replication checkpoint pathways. J. Cell Sci. 113:3889-3896[Abstract]. |
| 37. | Rhind, N., and P. Russell. 1998. Mitotic DNA damage and replication checkpoints in yeast. Curr. Opin. Cell Biol. 10:749-758[CrossRef][Medline]. |
| 38. |
Rhind, N., and P. Russell.
1998.
Tyrosine phosphorylation of Cdc2 is required for the replication checkpoint in Schizosaccharomyces pombe.
Mol. Cell. Biol.
18:3782-3787 |
| 39. | Russell, P., and P. Nurse. 1987. Negative regulation of mitosis by wee1+, a gene encoding a protein kinase homolog. Cell 49:559-567[CrossRef][Medline]. |
| 40. |
Sanchez, Y.,
C. Wong,
R. S. Thoma,
R. Richman,
Z. Wu,
H. Piwnica-Worms, and S. J. Elledge.
1997.
Conservation of the Chk1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25.
Science
277:1497-1501 |
| 41. | Toczyski, D. P., D. J. Galgoczy, and L. H. Hartwell. 1997. CDC5 and CKII control adaptation to the yeast DNA damage checkpoint. Cell 90:1097-1106[CrossRef][Medline]. |
| 42. | Walworth, N. C., and R. Bernards. 1996. rad-dependent response of the chk1-encoded protein kinase at the DNA damage checkpoint. Science 271:353-356[Abstract]. |
| 43. | Yang, J., K. Winkler, M. Yoshida, and S. Kornbluth. 1999. Maintenance of G2 arrest in the Xenopus oocyte: a role for 14-3-3-mediated inhibition of Cdc25 nuclear import. EMBO J. 18:2174-2183[CrossRef][Medline]. |
| 44. | Zeng, Y., K. C. Forbes, Z. Wu, S. Moreno, H. Piwnica-Worms, and T. Enoch. 1998. Replication checkpoint requires phosphorylation of the phosphatase Cdc25 by Cds1 or Chk1. Nature 395:507-510[CrossRef][Medline]. |
| 45. |
Zeng, Y., and H. Piwnica-Worms.
1999.
DNA damage and replication checkpoints in fission yeast require nuclear exclusion of the Cdc25 phosphatase via 14-3-3 binding.
Mol. Cell. Biol.
19:7410-7419 |
Molecular and Cellular Biology, March 2001, p. 1499-1508, Vol. 21, No. 5
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.5.1499-1508.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Willis, N., Rhind, N.
(2009). Mus81, Rhp51(Rad51), and Rqh1 Form an Epistatic Pathway Required for the S-Phase DNA Damage Checkpoint. Mol. Biol. Cell
20: 819-833
[Abstract] [Full Text] -
Jin, Z., Homola, E., Tiong, S., Campbell, S. D.
(2008). Drosophila Myt1 Is the Major Cdk1 Inhibitory Kinase for Wing Imaginal Disc Development. Genetics
180: 2123-2133
[Abstract] [Full Text] -
Dutta, C., Patel, P. K., Rosebrock, A., Oliva, A., Leatherwood, J., Rhind, N.
(2008). The DNA Replication Checkpoint Directly Regulates MBF-Dependent G1/S Transcription. Mol. Cell. Biol.
28: 5977-5985
[Abstract] [Full Text] -
Hu, F., Gan, Y., Aparicio, O. M.
(2008). Identification of Clb2 Residues Required for Swe1 Regulation of Clb2-Cdc28 in Saccharomyces cerevisiae. Genetics
179: 863-874
[Abstract] [Full Text] -
Diaz-Cuervo, H., Bueno, A.
(2008). Cds1 Controls the Release of Cdc14-like Phosphatase Flp1 from the Nucleolus to Drive Full Activation of the Checkpoint Response to Replication Stress in Fission Yeast. Mol. Biol. Cell
19: 2488-2499
[Abstract] [Full Text] -
De Schutter, K., Joubes, J., Cools, T., Verkest, A., Corellou, F., Babiychuk, E., Van Der Schueren, E., Beeckman, T., Kushnir, S., Inze, D., De Veylder, L.
(2007). Arabidopsis WEE1 Kinase Controls Cell Cycle Arrest in Response to Activation of the DNA Integrity Checkpoint. Plant Cell
19: 211-225
[Abstract] [Full Text] -
Jalota, A., Singh, K., Pavithra, L., Kaul-Ghanekar, R., Jameel, S., Chattopadhyay, S.
(2005). Tumor Suppressor SMAR1 Activates and Stabilizes p53 through Its Arginine-Serine-rich Motif. J. Biol. Chem.
280: 16019-16029
[Abstract] [Full Text] -
Pankratz, D. G., Forsburg, S. L.
(2005). Meiotic S-Phase Damage Activates Recombination without Checkpoint Arrest. Mol. Biol. Cell
16: 1651-1660
[Abstract] [Full Text] -
Zachos, G., Rainey, M. D., Gillespie, D. A. F.
(2005). Chk1-Dependent S-M Checkpoint Delay in Vertebrate Cells Is Linked to Maintenance of Viable Replication Structures. Mol. Cell. Biol.
25: 563-574
[Abstract] [Full Text] -
Zhang, K., Diederich, L., John, P. C.L.
(2005). The Cytokinin Requirement for Cell Division in Cultured Nicotiana plumbaginifolia Cells Can Be Satisfied by Yeast Cdc25 Protein Tyrosine Phosphatase. Implications for Mechanisms of Cytokinin Response and Plant Development. Plant Physiol.
137: 308-316
[Abstract] [Full Text] -
Zhao, H., Russell, P.
(2004). DNA Binding Domain in the Replication Checkpoint Protein Mrc1 of Schizosaccharomyces pombe. J. Biol. Chem.
279: 53023-53027
[Abstract] [Full Text] -
Kumar, S., Huberman, J. A.
(2004). On the Slowing of S Phase in Response to DNA Damage in Fission Yeast. J. Biol. Chem.
279: 43574-43580
[Abstract] [Full Text] -
Agapova, L. S., Volodina, J. L., Chumakov, P. M., Kopnin, B. P.
(2004). Activation of Ras-Ral Pathway Attenuates p53-independent DNA Damage G2 Checkpoint. J. Biol. Chem.
279: 36382-36389
[Abstract] [Full Text] -
Lu, R., Niida, H., Nakanishi, M.
(2004). Human SAD1 Kinase Is Involved in UV-induced DNA Damage Checkpoint Function. J. Biol. Chem.
279: 31164-31170
[Abstract] [Full Text] -
Nakamura, T. M., Du, L.-L., Redon, C., Russell, P.
(2004). Histone H2A Phosphorylation Controls Crb2 Recruitment at DNA Breaks, Maintains Checkpoint Arrest, and Influences DNA Repair in Fission Yeast. Mol. Cell. Biol.
24: 6215-6230
[Abstract] [Full Text] -
Kellogg, D. R.
(2003). Wee1-dependent mechanisms required for coordination of cell growth and cell division. J. Cell Sci.
116: 4883-4890
[Abstract] [Full Text] -
Zhao, H., Tanaka, K., Nogochi, E., Nogochi, C., Russell, P.
(2003). Replication Checkpoint Protein Mrc1 Is Regulated by Rad3 and Tel1 in Fission Yeast. Mol. Cell. Biol.
23: 8395-8403
[Abstract] [Full Text] -
Chahwan, C., Nakamura, T. M., Sivakumar, S., Russell, P., Rhind, N.
(2003). The Fission Yeast Rad32 (Mre11)-Rad50-Nbs1 Complex Is Required for the S-Phase DNA Damage Checkpoint. Mol. Cell. Biol.
23: 6564-6573
[Abstract] [Full Text] -
Wigle, D. A., Jurisica, I., Radulovich, N., Pintilie, M., Rossant, J., Liu, N., Lu, C., Woodgett, J., Seiden, I., Johnston, M., Keshavjee, S., Darling, G., Winton, T., Breitkreutz, B.-J., Jorgenson, P., Tyers, M., Shepherd, F. A., Tsao, M. S.
(2002). Molecular Profiling of Non-Small Cell Lung Cancer and Correlation with Disease-free Survival. Cancer Res.
62: 3005-3008
[Abstract] [Full Text] -
Rupes, I., Webb, B. A., Mak, A., Young, P. G.
(2001). G2/M Arrest Caused by Actin Disruption Is a Manifestation of the Cell Size Checkpoint in Fission Yeast. Mol. Biol. Cell
12: 3892-3903
[Abstract] [Full Text] -
Tanaka, K., Boddy, M. N., Chen, X.-B., McGowan, C. H., Russell, P.
(2001). Threonine-11, Phosphorylated by Rad3 and ATM In Vitro, Is Required for Activation of Fission Yeast Checkpoint Kinase Cds1. Mol. Cell. Biol.
21: 3398-3404
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»