INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

mRNA degradation, an important aspect of gene expression, is a regulated process that is often linked to mRNA translation (30, 59). Specific pathways of mRNA decay have been studied in several experimental systems and have been most extensively characterized in the yeast Saccharomyces cerevisiae (5, 30). In yeast, wild-type mRNAs are primarily degraded by a 5'-to-3' deadenylation-dependent mechanism in which the initial nucleolytic event is the shortening of the poly(A) tail to an oligo(A) length of 10 to 15 nucleotides. After poly(A) shortening, transcripts are decapped by the product of the DCP1 gene (Dcp1p) and digested exonucleolytically by the 5'-to-3' exoribonuclease, Xrn1p (6, 9, 37). Although this decay pathway appears to comprise the predominant mode of mRNA degradation, recent evidence indicates that mRNAs can also be degraded by a 3'-to-5' mechanism that requires the products of the SKI2, SKI3, and SKI8 genes, as well as Ski6p (also known as Rrp41) and Rrp4p, two 3'-to-5' exonucleases of the exosome (46, 29, 67).

mRNAs containing a premature termination codon are degraded by the nonsense-mediated mRNA decay pathway (26, 31, 54). This type of mRNA decay has been observed in all eukaryotic cells so far examined and may, in part, serve as a surveillance mechanism that eliminates aberrant mRNAs (14, 22, 50, 57). Degradation of nonsense-containing mRNAs is deadenylation independent, proceding from decapping by Dcp1p to Xrn1p-catalyzed 5'-to-3' decay without prior poly(A) shortening (6, 21, 47, 65). Nonsense-mediated mRNA decay also requires at least three additional trans-acting factors: Upf1p, Nmd2p (Upf2p), and Upf3p. Mutations or deletions of one or more of the genes encoding these factors (UPF1, NMD2 [UPF2], and UPF3) generally lead to the same phenotype: the selective stabilization of nonsense-containing mRNAs with no apparent effect on the stability of most wild-type mRNAs (10, 23, 38, 40-42, 52, 54, 68).

The UPF1, NMD2, and UPF3 genes and their products, have been characterized extensively. UPF1 encodes a 109-kDa protein that has two putative Zn fingers near its N terminus and seven conserved motifs common to the members of RNA/DNA helicase superfamily 1 (1, 36, 41). Upf1p has been purified from yeast cells and shown to possess nucleic acid-binding activity as well as nucleic acid-dependent ATPase and helicase activities (12). Nmd2p, a 127-kDa acidic protein, and Upf3p, a 45-kDa basic protein, both contain putative bipartite nuclear localization signals (23, 38). However, both proteins, as well as Upf1p, are primarily localized in the cytoplasm and appear to be polyribosome associated (3, 4, 23, 44, 53; F. He and A. Jacobson, unpublished data). Nmd2p interacts with Upf3p and Upf1p, and the latter, in turn, can also interact with itself, the release factors Sup35p and Sup45p, and Nmd1p, Nmd3p, and Dbp2p (7, 13, 23-25; A. Bond, D. Mangus, F. He, and A. Jacobson, submitted for publication; F. He and A. Jacobson, submitted for publication).

Although the identification and characterization of Upf1p, Nmd2p, and Upf3p have provided insight into the mechanism of nonsense-mediated mRNA decay, the precise functions of these factors remain unknown. For example, a role in regulating translational termination and fidelity is suggested by the interaction of Upf1p with Sup35p and Sup45p (13) and by the occurrence of allosuppression, omnipotent suppression, and 1 frameshifting phenotypes in upf1, nmd2, and upf3 mutants (11, 17, 39, 43, 61; He and Jacobson, submitted). Whether the translational functions of these proteins dictate their mRNA decay functions (or vice versa) remains to be determined, but it is noteworthy that the two roles of Upf1p have been separated by distinct mutations (69, 70; He and Jacobson, submitted) and by overexpression (43; He and Jacobson, submitted). Likewise, little is known about the epistatic and regulatory interactions of the respective factors. DCP1, XRN1, UPF1, NMD2, and UPF3 are all required for degradation of nonsense-containing mRNAs, but the only dissection of their regulatory interactions has been a study demonstrating that Nmd2p and Upf3p regulate Upf1p's activity in nonsense suppression (43).

To address these basic issues, we constructed a set of yeast strains that contain single or multiple deletions of the DCP1, XRN1, UPF1, NMD2, and UPF3 genes and analyzed mRNA decay phenotypes in these strains. We show that (i) deletions of UPF1, NMD2, or UPF3 lead to increased accumulation of capped nonsense-containing mRNAs, regardless of Xrn1p function; (ii) deletions of these genes in xrn1 cells differentially affect the accumulation of decapped nonsense-containing mRNAs, as well as capped and decapped wild-type mRNAs; and (iii) deletions of these genes in dcp1 cells differentially affect the accumulation of capped nonsense-containing and wild-type mRNAs. Our data indicated that Upf1p, Nmd2p, and Upf3p can regulate decapping and exonucleolytic degradation of both nonsense-containing mRNAs and wild-type mRNAs and suggest that these effects may be a consequence of the roles played by these factors in regulating a general aspect of translation termination.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

General methods. Preparation of standard yeast media and methods of cell culture were as described (58). Transformation of yeast was done by the high-efficiency method (63). DNA manipulations were performed according to standard techniques (62). All PCR amplifications were performed with Taq DNA polymerase (71). Plasmid DNAs were prepared from Escherichia coli DH5. The oligonucleotides used in this study were obtained from Operon, Inc.

Yeast strains. The yeast strains used in this study are listed in Table 1. Strains containing deletions of XRN1 or DCP1 were constructed by gene replacement (60). A NotI-SalI fragment containing the xrn1::ADE2 allele isolated from pHF2095 or a DraI-ClaI fragment containing the dcp1::URA3 allele isolated from pRP716 was used for yeast transformation. ADE⁺ or URA⁺ transformants were selected, and the disruption was confirmed by PCR analysis of genomic DNA.

Plasmids. Plasmids used in this study included (i) pHF2095, which contains the xrn1::ADE2 allele in pBluescript KSII (+); (ii) pRP716 (a gift from Roy Parker, University of Arizona), which contains the dcp1::URA3 allele in pBluescript; (iii) pHF2105, which contains the MER2 gene in YEplac112; and (iv) pHF1083, pHF1085, and pHF1463, which contain the ADH1-HA-UPF1, -NMD2, or -UPF3 alleles in YEplac112, respectively.

Construction of the xrn1::ADE2 allele. The plasmid pHF2095, which carries the xrn1::ADE2 allele, was constructed in two steps. First, a 514-bp PCR-derived NotI-BglII fragment containing the promoter and 5' untranslated region and a 425-bp PCR-derived BglII-SalI fragment containing sequences 3' to the translational stop codon of XRN1 were ligated into Bluescript digested previously by NotI and SalI in a three-fragment ligation reaction, generating pHF2095a. The oligonucleotide pairs XRN1-DS1 (AAAAGCGGCCGCCAACAGAGACAAACAAGAAGAGGTTA) and XRN1-DS2 (AAA AGATCTACCGTACTGATATATATTTGTTGCTGC) and XRN1-DS3 (AAAAGATCTACCGTACTGATATATATTTGTTGCTGC) and XRN1-DS4 (AAAGTCGACAGAAGACCCTGCAATAACATTTACACA) were used for PCR amplification of both fragments, respectively. Second, a 2,526-bp BglII-BglII ADE2 fragment was ligated into pHF2095a digested previously by BglII. This led to a replacement of the entire XRN1 coding region by the ADE2 gene.

RNA analysis. RNA isolation, Northern blotting, and primer extension analyses were performed as described previously (23). The DNA fragments used for Northern blot analysis included a 0.6-kb EcoRI-HindIII fragment of CYH2, a 0.7-kb BglII-XbaI fragment of MER2, a 0.8-kb EcoRI-HindIII fragment of TCM1, a 0.8-kb ClaI-EcoRI fragment of ADE3, a 2.0-kb Asp718-EcoRI fragment of URA5, a 0.65-kb Asp718-BglII fragment of PGK1, a 3.0-kb EcoRI-SalI fragment of GCN4, a 1.3-kb BamHI-BamHI fragment of CUP1, a 0.7-kb PCR fragment of PYK1 amplified by using PYK1-1 (AAAGTCGACCCAGTTATATCATGGTCCCCTTTCAAA) and PYK1-2 (TGACACCCTTGTGGGAACAGATCTTACCGG), and a 0.4-kb fragment of SCR1 amplified by PCR using SCR1-1 (AGGCTGTAATGGCTTTCTGGTGGGATGGGA) and SCR1-2 (GATATGTGCTATCCCGGCCGCCTCCATCAC). The oligonucleotides used for primer extension analysis included CYH2-IN4 (ATATACACACGA CATATTGGTTGCACAACA), which hybridizes to a region in the CYH2 pre-mRNA intron from nucleotides 59 to 88 downstream of the 5' splicing site; MER2-2 (CATCAACGAGTGTTCAGAATTAGCCTCTGAAAC), which hybridizes to a region in the first exon of MER2 pre-mRNA from nucleotides +40 to +72 downstream of the translation initiation codon; ADH1-1 (TATCCTTGTGTTCCAATTTACCGTGG), which hybridizes to a region in the ADH1 mRNA from nucleotides +45 to +70 downstream of the translation initiation codon; CUP1-1 (GGCATTGGCACTCATGACCTTC), which hybridizes to a region in the CUP1 mRNA from nucleotides +31 to +52 downstream of the translation initiation codon; and URA5-1 (AGTAGTATATCGCAGAAGTAATGCTTTATG), which hybridizes to a region in the URA5 mRNA from nucleotides 85 to 114 upstream of the translation initiation codon. RNA immunoprecipitations with polyclonal anti-m⁷ G antibodies were performed as described (48, 72).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Nonsense-containing mRNAs that accumulate in upf1, nmd2, or upf3 cells are full-length and capped. To define the functional roles and interrelationships of Upf1p, Nmd2p, Upf3p, Xrn1p, and Dcp1p, we first determined the 5' ends and cap status of two nonsense-containing mRNAs that were stabilized in otherwise isogenic cells harboring deletions of the genes encoding these factors. Primer extension and anti-m⁷ G immunoprecipitation assays were utilized to characterize the CYH2 and MER2 pre-mRNAs, two endogenous substrates of the nonsense-mediated mRNA decay pathway (22). These pre-mRNAs are normally very unstable, and their 5' ends were barely detectable in wild-type cells (Fig. 1A). However, CYH2 pre-mRNA transcripts accumulated in the upf1, nmd2, upf3, and dcp1 strains, and all had identical 5' ends, including a major transcript that initiated at nucleotide 18 and two minor species with ends at nucleotides 22 and 27 (Fig. 1A). In contrast, the predominant transcripts that accumulated in xrn1 cells had 5' ends at nucleotides +1, 3, and 16. Comparable results were obtained with the MER2 pre-mRNA. This transcript exhibited identical 5' ends at nucleotides 27, 36, 44, 67, and 70 in upf1, nmd2, upf3, and dcp1 cells but had 5' ends at nucleotides 23, 33, 55, 59, and 64 in xrn1 cells (Fig. 1A).

View larger version (59K): [in this window] [in a new window]   FIG. 1.   Analysis of the 5' ends and cap status of nonsense-containing mRNAs that accumulate in yeast strains defective in nonsense-mediated mRNA decay. (A) Analysis of the 5' ends of the CYH2 and MER2 pre-mRNAs by primer extension. Total RNA was isolated from yeast strains of the indicated genotypes. Radiolabeled primers (CYH2-IN4 or MER2-2) were annealed to aliquots (20 µg) of each RNA sample and extended by avian myeloblastosis virus reverse transcriptase. DNA sequencing reactions with the same primers (run in lanes G, A, T, and C) were used to determine the positions of the primer extension products. The major transcriptional start sites (positions noted are relative to the initiation codon) for both pre-mRNAs are indicated by arrows. The atypical extension products detected in RNA from xrn1 cells are denoted by asterisks. (B) Analysis of the 5' cap status of the CYH2 pre-mRNA by anti-m7 G immunoprecipitation. Aliquots (10 µg) of total RNA isolated from the indicated yeast strains were immunoprecipitated using polycolonal anti-m7 G antibodies. RNA comprising the supernatant (S) (uncapped) and pellet (P) (capped) fractions, as well as an aliquot of the input RNA (I), were analyzed by Northern blotting, using a CYH2 probe. The positions of the CYH2 pre-mRNA and mRNA are indicated. Quantitation of this experiment is summarized in Table 2. WT, wild type.

upf1, nmd2

upf3

dcp1

dcp1

upf1, nmd2

upf3

xrn1

Nonsense-containing mRNAs that accumulate in xrn1 cells are decapped, shortened at their 5' ends, and generated by partial Rat1p digestion. As shown in Fig. 1, the CYH2 and MER2 pre-mRNAs that accumulate in xrn1 cells are uncapped and shortened at their 5' ends. The structure of these RNAs suggests that they may be decay intermediates, possibly arising by either of two general mechanisms. In the first, decapping could proceed by the usual Dcp1p-mediated event, but be followed by inefficient 5'-to-3' exonucleolytic digestion by a nuclease other than Xrn1p. In the second, the premature nonsense codon could trigger decapping by a 5'-proximal Dcp1p-independent endonucleolytic cleavage. To distinguish between these possibilities, we first determined whether the appearance of the atypical RNA species is dependent on Dcp1p. To this end, we constructed a dcp1 xrn1 double mutant and examined the 5' ends and 5'-cap status of the CYH2 and MER2 pre-mRNAs that accumulated in this strain. As shown in Fig. 1A, in dcp1 xrn1 cells all putative decay intermediates are absent and both pre-mRNAs have the same 5' ends as do their counterparts in dcp1 cells. Moreover, approximately 90% of the CYH2 and MER2 pre-mRNAs present in dcp1 xrn1 cells are capped (Fig. 1B and data not shown). These results indicate that the RNA species peculiar to xrn1 cells must arise from decapping by Dcp1p, thereby ruling out the second possibility. To test the first possibility directly, we sought to identify a 5'-to-3' exonuclease that might generate the respective truncated RNAs.

xrn1

rat1-1 xrn1

xrn1

rat1-1 xrn1

xrn1

rat1-1 xrn1

xrn1

View larger version (72K): [in this window] [in a new window]   FIG. 2.   Inactivation of Rat1p inhibits accumulation of CYH2 pre-mRNA decay intermediates in xrn1 cells. rat1-1 and rat1-1 xrn1 cells were grown at 24°C and then shifted to 37°C for 1, 2, or 4 h. Total RNA was isolated from each culture at the indicated time points and used for primer extension analysis of the 5' ends (A) or Northern analysis of the levels of the CYH2 pre-mRNA (B), as in Fig. 1.

In xrn1 cells, incomplete Rat1p digestion also leads to the accumulation of decay intermediates of wild-type mRNAs. Decapped and 5' shortened species of wild-type PGK1 and RP51A mRNAs have been identified in xrn1 cells previously (28, 49). Since Xrn1p plays a general role in mRNA degradation, we reasoned that the accumulation of decay intermediates in xrn1 cells might be a general phenomenon. To evaluate this possibility further, we analyzed the 5' ends and cap status of additional wild-type transcripts that accumulated in xrn1 cells. As shown in Fig. 3A, ADH1, URA5, and CUP1 mRNAs that accumulated in wild-type; upf1, nmd2, upf3, or dcp1 strains all had identical 5' ends. The ADH1, URA5, and CUP1 mRNAs had major transcription start sites at nucleotides 39 and 30, 267 and 255, and 70 and 61, respectively. In contrast, novel species of each of these mRNAs accumulated in xrn1 cells, including those with 5' ends at nucleotides 38, 37, 28, 27, and 23 for ADH1 mRNA, nucleotides 260 and 248 for URA5 mRNA, and nucleotides 66, 57, 51, 43, 37, and 32 for CUP1 mRNA. Consistent with these primer extension data, anticap immunoprecipitation experiments showed that transcripts accumulating in the wild-type, upf1, nmd2, upf3, and dcp1 strains were largely in the capped fraction and those accumulating in xrn1 cells were predominantly in the decapped fraction (data not shown; see also Fig. 6). Two observations indicate that these shortened and decapped species of wild-type mRNAs arise in xrn1 cells by the same mechanism that generated decay intermediates of nonsense-containing mRNAs. First, the 5'-shortened species of ADH1, URA5, and CUP1 mRNAs detected in the xrn1 strain are absent in dcp1 xrn1 cells (Fig. 3A). Second, although rat1-1 xrn1 cells grown at the permissive temperature accumulated 5'-shortened species of URA5 mRNA, these cells did not accumulate the shortened transcripts when shifted to the nonpermissive temperature for 1, 2, or 4 h (Fig. 3B).

View larger version (46K): [in this window] [in a new window]   FIG. 3.   Formation of decay intermediates of wild-type mRNAs in xrn1 cells requires the decapping enzyme Dcp1p and the 5'-to-3' exoribonuclease Rat1p. (A) Inactivation of Dcp1p inhibits the formation of mRNA decay intermediates in xrn1 cells. Total RNA was isolated from yeast strains of the indicated genotypes and the 5' ends of wild-type ADH1, URA5, and CUP1 mRNAs were analyzed by primer extension, as in Fig. 1A. Radiolabeled primers (ADH1-1, URA5-1, and CUP1-1) were used for both reverse transcription and DNA sequencing reactions. The major transcriptional start sites (position noted is relative to the translation initiation codon) for each mRNA are indicated by arrows. mRNA decay intermediates that accumulate in xrn1 cells are marked by asterisks. WT, wild type. (B) Inactivation of Rat1p inhibits the formation of mRNA decay intermediates in xrn1 cells. rat1-1 xrn1 cells were grown at 24°C and then shifted to 37°C. Total RNA was isolated from cells at the indicated time points, and the 5' ends of the URA5 mRNA were analyzed by primer extension as in panel A.

Cells harboring both xrn1 and upf1, nmd2, or upf3 mutations accumulate nonsense-containing mRNAs that are full length and capped. The experiments shown in Fig. 1 indicated that Upf1p, Nmd2p, and Upf3p may play a role in the decapping of nonsense-containing mRNAs (see above). To test this idea further, we constructed xrn1 upf1, xrn1 nmd2, and xrn1 upf3 double mutants and analyzed the 5' ends and relative abundance of capped and uncapped CYH2 pre-mRNAs in these strains. In contrast to xrn1 cells, in which the CYH2 pre-mRNA was principally present as an uncapped species, xrn1 upf1, xrn1 nmd2, and xrn1 upf3 cells all exhibited substantially increased levels of this RNA in the capped fraction (Fig. 4A and Table 2). Consistent with their increased levels of capped CYH2 pre-mRNAs, the doubly mutant strains also contained higher levels of full-length transcripts (Fig. 4B). However, in contrast to xrn1 dcp1 cells, which accumulated only the full-length and capped transcripts (Fig. 1), the xrn1 upf1, xrn1 nmd2, and xrn1 upf3 strains also retained significant amounts of decapped and 5'-shortened CYH2 pre-mRNA (Fig. 4A and B and Table 2). Since inactivation of Upf1p, Nmd2p, or Upf3p in xrn1 cells leads to an increased accumulation of full-length and capped nonsense-containing mRNAs without completely eliminating the accumulation of decapped and 5'-shortened RNAs, it is likely that these factors regulate but do not catalyze decapping of nonsense-containing transcripts.

View larger version (49K): [in this window] [in a new window]   FIG. 4.   In xrn1 cells, single or multiple deletions of UPF1, NMD2, or UPF3 differentially affect the levels of decapped nonsense-containing transcripts. (A) Analysis of the levels of CYH2 pre-mRNAs by anti-m7 G immunoprecipitation. Total RNA was isolated from yeast strains of the indicated genotypes, capped mRNAs were immunoprecipitated as in Fig. 1B, and each sample was analyzed by Northern blotting, using a CYH2 probe. Lanes I, S, and P designate input, supernatant, and pellet, respectively. (B) Analysis of the levels of CYH2 pre-mRNA decay intermediates. Primer extension analysis of the CYH2 pre-mRNA was performed on total RNA from each yeast strain as in Fig. 1A. The major transcriptional start sites of the CYH2 pre-mRNA and the 5' ends of its decay intermediates are indicated by arrows and asterisks, respectively. Total RNA from the upf3 strain was used as a control. (C) Northern analysis of the steady-state levels of CYH2 pre-mRNA. Total RNA was isolated from yeast strains of the indicated genotypes and analyzed by Northern hybridization. The SCR1 RNA (20), which is transcribed by RNA polymerase III, was used as an internal control. WT, wild type. In panels A and C, the CYH2 DNA probe used was the same as in Fig. 1B. Quantitation of this experiment is summarized in Table 2.

In xrn1 cells, deletions of UPF1, NMD2, or UPF3 differentially affect the accumulation of decapped nonsense-containing mRNAs. As shown in Fig. 4C, comparable amounts of the CYH2 pre-mRNA accumulated in XRN1 cells that contain deletions of UPF1, NMD2, or UPF3. However, in an xrn1 background, deletions of the same genes affected the levels of the CYH2 pre-mRNA to different extents. The level of the CYH2 pre-mRNA was highest in the xrn1 upf1 strain, intermediate in the xrn1 upf3 strain, and lowest in the xrn1 nmd2 strain (Fig. 4C and Table 2). Analyses of anticap immunoprecipitation assays indicate that these differences are largely a reflection of variations in the accumulation of decapped transcripts, i.e., xrn1 upf1, xrn1 nmd2, and xrn1 upf3 strains accumulated levels of capped CYH2 pre-mRNA that differed by at most 30%, but varied more than twofold in their levels of the decapped version of the same transcript (Fig. 4A and Table 2). Much like the variations seen in the distribution of unfractionated CYH2 pre-mRNA, the level of decapped transcripts was highest in xrn1 upf1 cells, intermediate in xrn1 upf3 cells, and lowest in xrn1 nmd2 cells. Consistent with these variations in the levels of decapped transcripts, primer extension analyses revealed the same relationships between strains for the accumulation of CYH2 pre-mRNA decay intermediates (Fig. 4B). Comparable analyses of the levels of total, capped, and decapped MER2 pre-mRNA in these strains yielded essentially identical results (data not shown). Since deletions of UPF1, NMD2, and UPF3 in xrn1 cells have differential effects on the accumulation of decapped nonsense-containing mRNAs, it appears that Upf1p, Nmd2p, and Upf3p may also regulate the degradation of decapped nonsense-containing mRNAs.

In xrn1 cells, deletions of UPF1, NMD2, or UPF3 also have a differential effect on the accumulation of capped and decapped wild-type mRNAs. In our analyses of xrn1 cells it became apparent that deletions of UPF1, NMD2, and UPF3 also had differential effects on the steady-state level of the CYH2 mRNA. These differences were comparable to the effects seen with the CYH2 pre-mRNA, such that levels of the mature mRNA were highest in xrn1 upf1 cells, intermediate in xrn1 upf3 cells, and lowest in xrn1 nmd2 cells (Fig. 4C). To determine whether the variations seen in these strains were restricted to the CYH2 mRNA, we examined the accumulation of seven other wild-type mRNAs that represented a broad range of inherent stabilities. As shown in Fig. 5, for all but the PGK1 mRNA (see below), levels were highest in the xrn1 upf1 strain, intermediate in the xrn1 upf3 strain, and lowest in the xrn1 nmd2 strain. The level of the PGK1 mRNA, in contrast, was highest in the xrn1 nmd2 strain, intermediate in the xrn1 upf3 strain, and lowest in the xrn1 upf1 strain (Fig. 5 and Table 3). These results indicate that, in xrn1 cells, deletions of UPF1, NMD2, or UPF3 affect the accumulation of wild-type mRNAs differentially and in an mRNA-specific manner.

View larger version (56K): [in this window] [in a new window]   FIG. 5.   Single or multiple deletions of UPF1, NMD2, or UPF3 in xrn1 cells differentially affect the levels of wild-type (WT) mRNAs. Total RNA was isolated from yeast strains of the indicated genotypes and analyzed by Northern blotting, using the SCR1 RNA as an internal control. Quantitation of the results for the URA5, TCM1, and PGK1 mRNAs is summarized in Table 3.

upf1, nmd2

upf3

View larger version (39K): [in this window] [in a new window]   FIG. 6.   Effects of single or mutiple deletions of UPF1, NMD2, UPF3, and XRN1 on the accumulation of capped and decapped wild-type mRNAs. (A and B) Analysis of the levels of capped and decapped wild-type (WT) mRNAs by anti-m7 G immunoprecipitation. Total RNA was isolated from yeast strains of the indicated genotypes, and anticap immunoprecipitation was carried out as in Fig. 1B. DNA probes specific for URA5, TCM1, and PGK1 were used for Northern analysis of the respective RNA fractions. Lanes I, S, and P represent input, supernant, and pellet, respectively. Quantitation of this experiment is summarized in Table 3. (C) Analysis of the levels of URA5 mRNA decay intermediates. Primer extension analysis of the URA5 mRNA was performed on total RNA from each indicated yeast strain, as in Fig. 3A. Total RNA isolated from the upf3 strain was used as a control. The major transcriptional start sites of the URA5 mRNA and the 5' ends of its decay intermediates are indicated by arrows and asterisks, respectively.

xrn1

xrn1 upf1

xrn1 nmd2

xrn1 upf1

xrn1 upf3

xrn1 nmd2

xrn1 upf1, xrn1 nmd2

xrn1 upf3

The function of Upf1p is epistatic to those of Nmd2p and Upf3p in the degradation of nonsense-containing and wild-type mRNAs. Cells harboring xrn1 upf1, xrn1 nmd2, or xrn1 upf3 mutations contained similar levels of capped but different levels of decapped CYH2 pre-mRNA (Fig. 4A and Table 2). By constructing a set of xrn1 strains harboring double and triple deletions of UPF1, NMD2, and UPF3, we were able to exploit the differences in the levels of decapped CYH2 pre-mRNA to determine the epistatic relationships of Upf1p, Nmd2p, and Upf3p. These experiments showed that all strains containing a upf1 allele (i.e., xrn1 upf1 nmd2, xrn1 upf1 upf3, and xrn1 upf1 nmd2 upf3 strains) accumulated the same level of decapped transcripts as did the xrn1 upf1 strain. The xrn1 nmd2 upf3 strain accumulated the same level of decapped transcripts as the xrn1 upf3 strain but differed from the level in the xrn1 nmd2 strain (Fig. 4A and Table 2). Primer extension analyses showed the same relationships among UPF1, NMD2, and UPF3 mutations for accumulation of CYH2 pre-mRNA decay intermediates (Fig. 4B). These results indicate that, at least with regard to effects on the abundance of decapped nonsense-containing mRNAs in xrn1 cells, the function of Upf1p is epistatic to Upf3p, and that of Upf3p is epistatic to Nmd2p.

Overexpression of UPF1 in xrn1 cells decreases the levels of mRNA decay intermediates. As described above, Upf1p, Nmd2p, and Upf3p influence the steady-state levels of decapped nonsense-containing and wild-type mRNAs in xrn1 cells. Of the three factors, Upf1p appears to play the most significant role in this regulatory event because all xrn1 strains in which Upf1p is retained (i.e., xrn1 nmd2, xrn1 upf3, and xrn1 nmd2 upf3 strains) accumulate lower levels of total and decapped transcripts than the xrn1 upf1 strain (Fig. 4C and 5; Tables 2 and 3). One possible explanation for this observation is that Upf1p promotes exonucleolytic degradation of decapped mRNAs. To test this idea, we examined the consequences of UPF1 overexpression on the accumulation of total mRNA and mRNA decay intermediates in xrn1 cells. These experiments showed that introduction of a high-copy-number plasmid expressing the UPF1 gene into xrn1 cells, xrn1 nmd2 cells, or xrn1 upf3 cells leads to reductions in (i) the abundance of all mRNAs examined (Fig. 7A) and (ii) the levels of decay intermediates for the CYH2 pre-mRNA and URA5 mRNA (Fig. 7B, compare lanes 2 and 3, 4 and 5, and 6 and 7). These results support the hypothesis that, in xrn1 cells, Upf1p can stimulate the degradation of decapped transcripts and suggest that this stimulation most likely affects the efficiency of 5'-to-3' decay and can occur independent of NMD2 or UPF3 function.

View larger version (42K): [in this window] [in a new window]   FIG. 7.   In xrn1 cells, overexpression of the UPF1 gene decreases total mRNA levels as well as the levels of mRNA decay intermediates. (A) Northern analysis of total mRNA. xrn1 upf1, xrn1 nmd2, and xrn1 upf3 strains were transformed with a single-copy (S.C.) or a high-copy-number (H.C.) plasmid harboring the UPF1 gene. Total RNAs isolated from the resulting yeast strains, as well as the xrn1upf1 strain, were analyzed by Northern hybridization, using probes for the CYH2, URA5, GCN4, and CUP1 mRNAs. The SCR1 RNA was used as an internal control. (B) Analysis of mRNA decay intermediates. Primer extension analysis of the CYH2 pre-mRNA and the URA5 mRNA was performed on each of the RNAs used in panel A. Radiolabeled primers CYH2-IN4 and URA5-1 were used for both reverse transcription and DNA sequencing reactions. The major transcriptional start sites and the 5' ends of decay intermediates are indicated by arrows and asterisks, respectively. The yeast strains labeled 1 to 7 correspond to those in panel A.

In dcp1 cells, deletions of UPF1, NMD2, and UPF3 differentially affect the accumulation of capped nonsense-containing and wild-type mRNAs. Experiments described above indicated that Upf1p, Nmd2p, and Upf3p promote, but do not catalyze, decapping of nonsense-containing mRNAs and also regulate the degradation of decapped transcripts of any type. Our epistasis analyses, as well as the experiments of Fig. 7, demonstrated that the latter effect could be attributable to increased efficiency of 5'-to-3' exonucleolytic digestion. Since exonucleolytic digestion of decapped transcripts has also been shown to occur by a 3'-to-5' mechanism (29) we sought to determine whether Upf1p, Nmd2p, and Upf3p have a role in modulating this pathway. Accordingly, we constructed dcp1upf1, dcp1 nmd2, and dcp1upf3 strains, rationalizing that the inhibition of decapping that would occur in such strains would eliminate 5'-to-3' decay. Indeed, all of the transcripts that accumulated in these strains were capped (Fig. 8A and data not shown). Northern analyses of RNAs isolated from these strains demonstrated that the abundance of the nonsense-containing CYH2 pre-mRNA and the wild-type CYH2 and TCM1 mRNAs were uniformly lowest in the dcp1 upf1 strain, intermediate in the dcp1 upf3 and dcp1 strains, and highest in the dcp1 nmd2 strain (Fig. 8B, Table 4, and data not shown). These results imply that Upf1p, Nmd2p, and Upf3p can also regulate 3'-to-5' exonucleolytic decay differentially, with Upf1p having apparent negative regulatory capability in dcp1 cells.

View larger version (48K): [in this window] [in a new window]   FIG. 8.   Deletion of UPF1, NMD2, or UPF3 in dcp1 cells differentially affects the levels of the CYH2 pre-mRNA and mRNA. (A) Analysis of 5' cap status. Total RNA was isolated from yeast strains of the indicated genotypes and anti-m7 G immunoprecipitation was performed as in Fig. 1B. Lanes I, S, and P represent input, supernatant, and pellet samples, respectively. (B) Northern analysis of total mRNA. Total RNA from yeast strains of the indicated genotypes was isolated and analyzed by Northern hybridization, using the SCR1 RNA as an internal control. WT, wild type. In both panels A and B, the CYH2 probe used was the same as in Fig. 1B. Quantitation of this experiment is summarized in Table 4.

View this table: [in this window] [in a new window]   TABLE 4.   Effects of deletions of UPF1, NMD2, or UPF3 on the accumulation of CYH2 pre-mRNA and mRNA in dcp1 cellsa

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Upf1p, Nmd2p, and Upf3p regulate decapping of nonsense-containing and wild-type mRNAs. In the yeast S. cerevisiae the rapid degradation of nonsense-containing mRNAs proceeds from deadenylation-independent removal of the 5' cap by the decapping enzyme, Dcp1p, to 5'3' digestion of the remainder of the mRNA by the exoribonuclease Xrn1p (6, 21, 47). This decay pathway also requires the activities of three additional trans-acting factors, Upf1p, Nmd2p, and Upf3p (10, 22, 23, 25, 38, 40, 41, 52, 54). Previous studies showed that mutations in any of the respective UPF or NMD genes led to the selective stabilization of nonsense-containing mRNAs but did not identify a mechanistic basis for such stabilization. Here, we show that loss of Upf1p, Nmd2p, or Upf3p inhibits the decapping of nonsense-containing mRNAs. This conclusion follows from experiments showing that inactivation of any or all of these factors, in XRN1 or xrn1 cells, leads to the accumulation of capped CYH2 and MER2 pre-mRNAs (Fig. 1, 2, and 4). Moreover, since dcp1 xrn1 cells accumulate only capped nonsense-containing transcripts, and all xrn1 strains containing single or multiple deletions of UPF1, NMD2, or UPF3 still accumulate some decapped transcripts, our data indicate that Upf1p, Nmd2p, and Upf3p regulate but do not catalyze decapping of nonsense-containing mRNAs.

xrn1

xrn1

xrn1

Rat1p functions in cytoplasmic mRNA degradation. Rat1p, one of two 5'-to-3' exoribonucleases in yeast, is predominantly localized to the nucleus in the steady state and has an essential nuclear function (33, 35). Consistent with these characteristics, the protein is involved in the formation of the 5' ends of 5.8S rRNA and some snoRNAs (45, 55). Here, we have demonstrated that Rat1p also functions in 5'-to-3' exonucleolytic degradation of decapped yeast mRNAs, at least in the absence of Xrn1p. Inactivation of Xrn1p leads to the accumulation of nonsense-containing and wild-type mRNAs that lacked the cap structure and several 5' nucleotides. Two key observations indicate that these mRNA decay intermediates arise from decapping by Dcp1p and 5' trimming by Rat1p. First, in contrast to the xrn1 strain, the dcp1 xrn1 strain accumulated only full-length, capped mRNAs, indicating that formation of the decay intermediates in xrn1 cells requires the activity of Dcp1p. Second, mRNA decay intermediates present in rat1-1 xrn1 cells grown at the permissive temperature disappeared after a shift to the nonpermissive temperature, indicating that the formation of these decay intermediates in xrn1 cells also requires the activity of Rat1p.

xrn1

xrn1

Upf1p, Nmd2p, and Upf3p regulate exonucleolytic degradation of nonsense-containing and wild-type mRNAs. After decapping, the remainder of a nonsense-containing or wild-type transcript is eliminated by exonucleolytic digestion. In wild-type cells, decapped transcripts are principally degraded in a 5'-to-3' direction by Xrn1p (28, 47, 48). However, in xrn1 cells, decapped transcripts are degraded in both the 5'-to-3' and 3'-to-5' directions (47, 49). Our observation that inactivation of Rat1p in xrn1 cells eliminates the formation of 5'-to-3' mRNA decay intermediates but does not increase the levels of all mRNAs examined (Fig. 2 and 3) supports this conclusion further. Our analyses of xrn1 cells provide several lines of evidence that Upf1p, Nmd2p, and Upf3p can also regulate exonucleolytic degradation of decapped nonsense-containing and wild-type mRNAs, including the following: (i) inactivation of Upf1p, Nmd2p, or Upf3p differentially affects total mRNA levels only in xrn1 cells, but not in XRN1 cells (Fig. 4 and 5); (ii) inactivation of these factors differentially affects the accumulation of decapped transcripts and mRNA decay intermediates; and (iii) the phenotypes caused by inactivation of these factors exhibit epistatic relationships.

xrn1

xrn1 upf1

Functional relationships of Upf1p, Nmd2p, and Upf3p. The differential effects on the accumulation of decapped transcripts engendered by inactivation of Upf1p, Nmd2p, or Upf3p in xrn1 cells not only led us to conclude that these factors have different roles in regulating exonucleolytic degradation but also allowed us to determine their respective functional relationships. Our data indicate that the function of Upf1p is epistatic to Nmd2p and Upf3p and that the function of Upf3p is epistatic to that of Nmd2p. We interpret these relationships to suggest that Nmd2p and Upf3p regulate the activity of Upf1p, a conclusion consistent with our earlier analyses of nonsense suppression in upf and nmd cells (43) and with several observations in this study. Here, we show that (i) in an xrn1 background, all strains that contain UPF1, except the UPF or NMD wild-type strain, accumulate lower levels of decapped transcripts than strains lacking UPF1, indicating that Upf1p plays a more direct role in regulating exonucleolytic degradation than Nmd2p or Upf3p; (ii) the xrn1 upf1 nmd2, xrn1 upf1 upf3, and xrn1 upf1 nmd2 upf3 mutant strains accumulate the same level of decapped transcripts as an xrn1 upf1 strain, indicating that, in the absence of Upf1p, the presence of Nmd2p, Upf3p, or both, has no additional effects and that the functions of Nmd2p and Upf3p must operate through Upf1p; (iii) UPF or NMD wild-type, xrn1 nmd2, xrn1 upf3, and xrn1 nmd2 upf3 strains accumulate different levels of decapped transcripts, demonstrating that the presence of Nmd2p, Upf3p, or both, has different effects on the activity of Upf1p; (iv) xrn1 nmd2 cells accumulate a lower level of decapped transcripts than xrn1 nmd2 upf3 cells, indicating that, in the absence of Nmd2p, Upf3p enhances the function of Upf1p; and (v) xrn1 nmd2 upf3 cells accumulate the same level of decapped transcripts as xrn1 upf3 cells but a lower level than UPF or NMD wild-type cells. This last observation establishes that Nmd2p has no effect on Upf1p in the absence of Upf3p and that, in the presence of Upf3p, Nmd2p negatively regulates Upf1p.

xrn1

Reconciliation of the diverse functions of Upf1p, Nmd2p, and Upf3p. The data presented in this paper demonstrate that Upf1p, Nmd2p, and Upf3p function in the regulation of mRNA decapping and in both modes of exonucleolytic decay. These mRNA degradative events involve multiple factors, including Dcp1p, Xrn1p, Rat1p, and the components of the exosome (6, 28, 29, 46, 48), none of which have been shown to have significant physical interactions with the products of the UPF and NMD genes. How, then, could Upf1p, Nmd2p, and Upf3p function as such general regulators of mRNA decay? Since it is unlikely that these factors regulate the activities of all of the degradative enzymes directly, it seems reasonable to consider the possibility that they exert their regulatory effects by controlling substrate availability to the decay pathways.