Previous Article | Next Article 
Molecular and Cellular Biology, March 2001, p. 1647-1655, Vol. 21, No. 5
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.5.1647-1655.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Pir1p Mediates Translocation of the Yeast Apn1p
Endonuclease into the Mitochondria To Maintain Genomic
Stability
Ratsavarinh
Vongsamphanh,
Pierre-Karl
Fortier, and
Dindial
Ramotar*
Guy-Bernier Research Centre, University of
Montreal, Montreal, Quebec, Canada H1T 2M4
Received 1 September 2000/Returned for modification 21 November
2000/Accepted 30 November 2000
 |
ABSTRACT |
The mitochondrial genome is continuously subject to attack by
reactive oxygen species generated through aerobic metabolism. This
leads to the formation of a variety of highly genotoxic DNA lesions,
including abasic sites. Yeast Apn1p is localized to the nucleus, where
it functions to cleave abasic sites, and apn1
mutants
are hypersensitive to agents such as methyl methanesulfonate (MMS) that
induce abasic sites. Here we demonstrate for the first time that yeast
Apn1p is also localized to the mitochondria. We found that Pir1p,
initially isolated as a cell wall constituent of unknown function,
interacts with the C-terminal end of Apn1p, which bears a bipartite
nuclear localization signal. Further analysis revealed that Pir1p is
required to cause Apn1p mitochondrial localization, presumably by
competing with the nuclear transport machinery. pir1
mutants displayed a striking (~3-fold) increase of Apn1p in the
nucleus, which coincided with drastically reduced levels in the
mitochondria. To explore the functional consequences of the Apn1p-Pir1p
interaction, we measured the rate of mitochondrial mutations in the
wild type and pir1
and apn1
mutants.
pir1
and apn1
mutants exposed to MMS
exhibited 3.6- and 5.8-fold increases, respectively, in the rate of
mitochondrial mutations, underscoring the importance of Apn1p in repair
of the mitochondrial genome. We conclude that Pir1p interacts with
Apn1p, at the level of either the cytoplasm or nucleus, and facilitates
Apn1p transport into the mitochondria to repair damaged DNA.
 |
INTRODUCTION |
The yeast Saccharomyces
cerevisiae possesses a 40.5-kDa DNA repair enzyme, Apn1p, that is
localized to the nucleus (29, 30). Apn1p, a key enzyme in
the base excision repair pathway, functions to hydrolyze
apurinic/apyrimidinic (AP) sites produced either spontaneously or upon
removal of damaged bases by DNA glycosylases (17, 30).
This enzyme also possesses a 3'-diesterase activity that removes
blocked 3' ends from single-strand DNA breaks. Cells lacking Apn1p are
hypersensitive to the alkylating agent methyl methanesulfonate (MMS)
due to defective repair of MMS-induced AP sites (30).
apn1
mutants also display a 10- to 15-fold increase in
the rate of spontaneous single-base-pair mutations arising mainly as a
result of unrepaired AP sites (9, 20, 21). Recent studies
have shown that Apn1p homologues also exist in the fission yeast
Schizosaccharomyces pombe, as well as in the nematode
Caenorhabditis elegans, underscoring the importance of Apn1p
family members in the repair of damaged DNA (27). To date, no homologue of Apn1p has been found in human cells (27).
Deletion analysis and immunofluorescence studies established that the
extreme C-terminal end of Apn1p possesses a bipartite nuclear
localization signal (NLS), which is characterized by two interdependent
positively charge clusters separated by a spacer of 10 to 12 amino acid
residues (28, 29). Removal of a portion of the NLS, i.e.,
the last 12 amino acid residues (SQMTKKRKTKKE), from the C
terminus of Apn1p had no effect on the enzymatic activities of the
resultant protein (Apn355) but abolished the nuclear
localization of Apn1p, leading to extranuclear accumulation
(29). Consequently, the Apn355 variant is
unable to restore MMS resistance to an apn1
mutant.
Addition of the simian virus 40 nuclear localization signal to
Apn355 failed to target this protein to the nucleus,
suggesting that the Apn1p nuclear transport mechanism is highly
specific (29). Proteins with a classical monopartite NLS,
such as that of simian virus 40, and bipartite NLS, such as
nucleoplasmin, are imported in the nucleus by a heterodimer consisting
of karyopherin
(Kar
p; also called importin
) and karyopherin
(Kar
p, or importin
). Kar
p recognizes the classical NLS,
and Kar
p binds to Kar
p, thus attaching the heterotrimeric complex
to the nuclear pore complex for subsequent nuclear transport (2,
11, 44). Whether Apn1p is imported into the nucleus through the
Kar
p/Kar-
p complex, or directly by one of the several Kar
-like
proteins that bind to NLS (14, 15, 42), is not known.
The N-terminal region of Apn1p possesses a putative mitochondrial
transit sequence as revealed by the PSORT
(http: //psort.nibb.ac.jp/) program. This raises the possibility
that Apn1p could also be targeted to the mitochondria and involved in
the repair of mitochondrial DNA. Consistent with this notion, many DNA
repair enzymes are targeted to both the nucleus and the mitochondria.
These include (i) S. cerevisiae Ntg1p, which repairs
oxidative DNA lesions such as thymine glycol (51); (ii)
S. pombe Uvdep, which incises a variety of DNA lesions
including pyrimidine dimers and AP sites (49); and (iii)
several human DNA glycosylases, e.g., uracil DNA glycosylase, OGG1,
hNTH1, and MTH1 (4, 25, 32, 40). Additional DNA repair
enzymes belonging to the base excision repair pathway such as DNA
polymerase and DNA ligase also exist in the mitochondria. Recent
studies show that the entire base excision repair pathway can be
reconstituted from purified enzymes derived from Xenopus
laevis mitochondria, and complete repair of uracil opposite
guanine has been demonstrated with rat liver mitochondrial extract
(26, 39). The mitochondrial DNA is proximate to the electron transport chain, which produces, as by-products, reactive oxygen species. Reactive oxygen species are known to generate a variety
of DNA lesions including AP sites (12, 31); it is therefore logical that DNA repair enzymes would exist in the
mitochondria to maintain stability of the genome. For example, yeast
mutants lacking the mitochondrial mismatch repair protein Msh1p exhibit a high rate of mitochondrial mutation (38). Thus, defects
in mitochondrial DNA repair could contribute to human diseases
(36, 46). In fact, a multitude of mitochondrial mutations
have been identified, and some have been associated with a variety of
human disorders including Parkinson's disease, Alzheimer's disease, and some forms of diabetes mellitus (1, 6, 33).
We initially set out to identify the karyopherin that recognizes the
bipartite NLS of Apn1p for subsequent translocation into the nucleus by
using the Apn1p C-terminal end as bait in a yeast two-hybrid screen.
However, we report the unexpected identification of Pir1p, a previously
isolated cell wall protein, which interacts with the Apn1p C-terminal
end. We show that this interaction mediates Apn1p translocation into
the mitochondria. Deletion of the PIR1 gene from two
different parental backgrounds did not hamper Apn1p translocation into
the nucleus but instead decreased cytoplasmic and mitochondrial Apn1p
levels. Our findings support a model where Pir1p binds to Apn1p, in
either the cytoplasm or nucleus, and facilitates its entry into the
mitochondria to prevent genetic instability.
 |
MATERIALS AND METHODS |
Strains, media, genetic analysis, and transformation.
The
S. cerevisiae strains used in this study were PJ69-4A
(MATa trp-901 leu2-3, 112 ura3-52 his3-200
gal4
gal80
LYS2::GAL1-HIS3 GAL2-ADE2
met2::GAL7-lacZ), SEY6210
(APN1+, laboratory stock), DRY377
(apn1
::HIS3), YAT1530
(PIR1+), and YAT1529 (pir1
pir2
) (kindly provided by A. Toh-E, Tokyo, Japan). The
pir1
::KanMX mutant strains RVY1 and
RVY2 were derived from SEY6210 and YAT1530, respectively, by one-step
gene targeting using the KanMX gene module
(45). Yeast cells were grown in either complete yeast
peptone dextrose (YPD) or minimal synthetic complete medium, to which
nutritional supplements were added at 20 µg/ml (37).
Standard genetic analysis and transformation were carried out as
described previously (10, 13). The Escherchia coli strain used for plasmid maintenance was DH5
.
Construction of the bait plasmid pGBD-APN1-CT.
Plasmid
YEpAPN1, which contains the entire S. cerevisiae APN1 gene
with its transcriptional termination sequence (29), was used as the template to amplify by PCR (34) the 3' end of
the APN1 gene (bp +780 to +1435). The primers used were
APN1-1
(5'-+780GCGCACTCTGAATTCCTGCAGGG+803-3')
and DR2
(5'-+1435CCAGCGGTCGACCATTACAAGTA+1413-3')
bearing restriction sites (underlined) for EcoRI and
SalI, respectively. This yielded a 600-bp fragment
containing basic clusters 1 and 2 of the APN1 gene, which
was digested with EcoRI and SalI and then
subcloned next to the Gal4 DNA binding domain in the S. cerevisiae expression vector pGBDUC2 to produce pGBD-APN-CT (16).
Yeast two-hybrid screening.
Yeast two-hybrid screening was
performed as described by James et al. (16). The bait
plasmid pGBD-APN-CT was introduced in the two-hybrid strain PJ69
(Ura3
Leu2
Ade
His
), which bears three reporter genes, ADE,
HIS, and lacZ. This strain cannot grow in the absence
of adenine and histidine unless the reporter genes are activated upon
association of the Gal4 DNA binding and activation domains
(16). A genomic library consisting of yeast DNA fragments
fused to the Gal4 activation domain (GAD) bearing the selective marker
LEU2 was subsequently introduced into strain PJ69 already
carrying plasmid pGBD-APN-CT. The transformed cells were allowed to
grow in 100 ml of selective SD medium (lacking leucine and uracil)
overnights at 30°C to allow expression of both plasmids. The cells
were resuspended in 3 ml of H2O, and 100 µl of this
suspension was plated on SD medium lacking leucine, adenine, and
uracil. The resulting transformants (60,000 Ura3+ Leu2+ colonies)
were screened for growth in the absence of adenine. At least 20 Ade+ colonies were obtained, and only one
(PJ69/pGBD-APN-CT/pGAD-RV2) strongly expressed the two additional
reporter genes HIS3 and lacZ (data not shown). In
these experiments, the IMP2 gene, encoding a transcriptional
coactivator that interacts with the product of the YLR368w
gene, was used as a control (43). Plasmid pGAD-RV2 was
extracted from the positive colony and subjected to DNA sequence analysis.
DNA sequence analysis.
The primers 2H-GADUP
(5'-TTCGATGATGAAGATACC-3') and 2H-GADDOWN
(5'-TGAAGTGAACTTGCGGGG-3') were used to sequence the 5' and 3' ends, respectively, of the insert. The insert was sequenced completely by the dideoxy-chain termination method (35).
Construction of full-length PIR1.
Yeast genomic
DNA was used as template to amplify the full-length PIR1
gene (bp
23 to +1208) using primers PIR1-UP(B)
(5'-
23CCCCTATAGTGAATTCAAGAAAATGC+4-3')
and PIR1-DO
(5'-+1208GTGAAGAACTGTCGACCTCATTTCATAGG+1180-3')
bearing restriction sites (underlined) for EcoRI and
SalI, respectively. The PCR-amplified 1.2-kb fragment
contains the entire coding region of the PIR1 gene. After
digestion with EcoRI and SalI, the fragment was
subcloned to the GAD in the yeast plasmid pGADC3 (16).
Protein extracts.
Total extracts were prepared as previously
described (21) in yeast extraction buffer (50 mM Tris-HCl
[pH 8.0], 50 mM NaCl, 5% glycerol, 1 mM each EDTA,
phenylmethylsulfonyl fluoride, and dithiotheritol, 0.5 µg each of
pepstatin, aprotinin, and leupeptin per ml).
Preparation of green fluorescent protein (GFP) fusions.
Plasmids pGBD-APN1-CT, pGAD-pRV2, and pGAD-PIR1, and pNlexA-IMP2
(22) were digested with EcoRI and
SalI to release the DNA fragments encoding the Apn1
C-terminal basic clusters (Apn-Ct), 87% of PIR1, and the
full-length PIR1 and IMP2 genes, respectively. Each fragment was then subcloned adjacent to the GFP gene,
which was under the GAL1 promoter in the yeast expression
vector pYES2.0, to produce pGFP-APN-CT, pGFP-pRV2, pGFP-PIR1, and
pGFP-IMP2. Plasmid pGFP-APN1 was created by digesting pGBDU-APN1 with
EcoRI, and the resulting APN1 fragment was
inserted next to GFP in the pYES2.0 vector.
Phenyl-agarose column.
For the preparation of phenyl-agarose
columns, 1 ml of the phenyl-agarose slurry (Pharmacia) was added to an
Eppendorf tube and centrifuged to pellet the beads, which were then
washed twice with 2 M (NH4)SO4 in yeast
extraction buffer. The equilibrated matrix was transferred to a 2-ml
column (Bio-Rad). Crude extracts (500 µg) derived from yeast strains
expressing the indicated GFP fusion protein was adjusted to 1.7 M
(NH4)SO4 and allowed to bind to the column over
a 20-min period at room temperature. The column was washed with
extraction buffer until the optical density at 280 nm
(OD280) was baseline. The (GST) glutathione
S-transferase (GST)-Apn-Ct fusion protein (200 ng) or total
extract (500 µg) derived from strain SEY6210 carrying the
Apn1p-overproducing plasmid (YEpAPN1) was slowly applied onto the
columns at 4°C over a period of 8 h. The column was washed with
1× phosphate-buffered saline to remove nonspecific interactions and
directly analyzed by Western blotting.
Preparation of subcellular fractions from yeast.
Cells were
grown overnight in 1 liter of
ura selective medium with 2% raffinose
at 30°C. The next day, the cultures were induced, where indicated,
with 0.5% galactose for 0, 2, and 4 h. Samples of 300 ml were
taken at each time point for nuclear and cytoplasmic extractions. The
cell pellets were weighed, washed with H2O, resuspended
(0.3 g/ml) in 100 mM Tris-SO4 (pH 9.3) buffer containing 10 mM dithiothereitol, incubated with gentle shaking at 30°C for 10 min,
and centrifuged 3,000 × g for 5 min at room temperature. Following centrifugation, the pellets were washed once
with buffer B (1.2 M D-sorbitol, 20 mM KPB [pH 7.4]), and zymolyase at 2.5 mg/g of cell pellet in 0.1 g of cell pellet/ml of
buffer B was added. The pellets were incubated for 60 min at 30°C
with gentle shaking until the cell wall was completely digested. The
spheroplasts were collected at 3,000 × g for 5 min at
room temperature and washed three times (1 g/10 ml of buffer B). From this point, all manipulations were performed at 4°C. The spheroplasts were suspended at 1 g/2 ml of MIB (0.6 M D-mannitol, 20 mM
HEPES-KOH [pH 7.4], 0.5 mM phenylmethylsulfonyl fluoride) and broken
in a Dounce homogenizer with 15 strokes using the pestle (glass and Teflon). The homogenate was then diluted 2-fold in MIB and centrifuged at 3,000 × g for 5 min. The pellet contained crude
nuclei, and the supernatant represents the crude cytoplasm and
mitochondria. The supernatant was spun at 12,000 × g;
the resulting pellet contained the crude mitochondria, and the
supernatant is termed the cytoplasmic fraction.
To obtain purified mitochondria, the crude mitochondria were diluted in
200 µl of MIB and layered on a two-step Nycodenz (Sigma) gradient
made in a 14- by 89-mm Ultra-Clear centrifuge tube. The bottom layer of
the gradient contained 5 ml of 18% and the top layer contained 5 ml of
14% Nycodenz in MIB. The tubes were spun at 40,000 × g in an SW41 rotor for 30 min, and the purified mitochondria were
recovered between the two layers as a light brown band. The purified
mitochondria were diluted fivefold in MIB and centrifuged at
12,000 × g for 10 min. The resulting mitochondrial
pellet was lysed by addition of 200 µl of yeast extraction buffer to
produce the mitochondrial fraction. Protease K treatment was carried
out before and after lysis of the mitochondria at 37°C for 30 min, using 1 µg of protease K per ml. Succinate dehydrogenase was used to
normalize the amount of mitochondrial protein extract.
To obtain purified nuclei, the crude nuclei were washed three times
with MIB and each time spun at 3,000 ×
g for 5 min.
The
final washed pellet was resuspended in MIB and loaded onto a 30
to
50% Ficoll 400 (Pharmacia) step gradient in Ultra-Clear tubes
(
7). The gradient was spun in a Beckman SW28 rotor at
18,000
rpm for 60 min at 2°C. The nuclei band in the 40% layer was
collected
using a 20-ml syringe with a 16-gauge
needle.
Immunoblotting.
The antibodies used in this study were
monoclonal anti-GFP, monoclonal anti-GST, and polyclonal anti-Apn1p,
which were raised against purified Apn1p (29). For Western
analysis, the antibodies were used at dilutions of 1:5,000, 1:5,000,
and 1:2,500, respectively, in 10 mM Tris-HCl (pH 7.5)-150 mM NaCl-5%
powdered milk (8). Ten milliliters of this mixture was
used to probe nitrocellulose blots (8 by 10 cm) overnight at 4°C. The
secondary antibodies were anti-mouse for the GFP monoclonal antibodies
and anti-rabbit for the GST and Apn1p polyclonal antibodies. Anti-mouse
and anti-rabbit were used at dilutions of 1:2,500 and 1:5,000,
respectively, and detected by enhanced chemiluminescence (Dupont, NEN).
Gradient plate assays.
Gradient plate assays were performed
as previously described (23).
Enzyme assays.
-Galactosidase activity was determined
from crude extracts as previously described (22). AP
endonuclease activity was assayed using an AP site substrate prepared
by incorporation of [
-32P]dUTP, derived by deamination
of [
-32P]dCTP (48). The AP sites were
produced by removal of the uracil by uracil DNA glycosylase. A typical
assay consists of 1 pmol of substrate in 25 µl of reaction mix
containing 50 mM HEPES-KOH (pH 7.6), 50 mM KCl, 1 mM EDTA, 100 µg of
bovine serum albumin, and the indicated concentration of protein
extracts or purified protein. One unit of enzyme cleaves 1 pmol of the
substrate/min under the standard reaction condition (48).
Mutation rate assay.
The frequency of erythromycin-resistant
(Eryr) colonies was determined from 15 to 20 independent
cultures and used to compute the rates (18). Cells were
cultured to log phase (OD600 = 0.8 to 1.0), treated or
not with MMS for 1 h, washed, and plated onto YPEG plates
containing erythromycin (2 mg/ml). Eryr colonies were
scored after 10 days of incubation at 30°C.
 |
RESULTS |
Apn-Ct interacts with Pir1.
The APN1 C-terminal DNA
segment (APN-CT), encoding the last 103 amino acid residues
encompassing the entire bipartite NLS of Apn1p, was selected as bait
for a yeast two-hybrid screen. To verify that the bait retained nuclear
localization, the APN-CT fragment was fused to the
C-terminal end of the GFP gene and placed under the control
of the galactose-inducible GAL1 promoter. The resulting
plasmid, pGFP-APN-CT, was introduced into strain PJ69 and examined for
production of the GFP-Apn-Ct fusion protein using monoclonal anti-GFP
antibody. Western blot analysis revealed that plasmid pGFP-APN-CT
directed the expression of a polypeptide that corresponded to the
expected size (38 kDa) of the GFP-Apn-Ct fusion protein (Fig.
1A, lane 3); the pGFP vector produced the
native (~26-kDa) GFP (lane 2). Immunofluorescence analysis revealed
that GFP-Apn-Ct was localized to the nucleus as expected, whereas GFP alone was distributed throughout the cell (Fig. 1B and data not shown).
These data clearly indicate that Apn-Ct harbors a functional NLS.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1.
Expression and cellular location of GFP-Apn-Ct in
yeast. (A) Total extracts were derived from the two-hybrid strain PJ69
bearing the pYES2.0 vector (lane 1) and plasmids pGFP (lane 2) and
pGFP-APN-CT (lane 3) after 2 h of induction (see below). Each lane
contained 50 µg of total extract, and the blot was probed with
monoclonal anti-GFP antibody. Molecular weight standards are shown on
the left. (B) Immunofluorescence analysis of strain PJ69 expressing
GFP-Apn-Ct. Cells were grown in selective medium with 2% raffinose as
the carbon source followed by induction with 0.5% galactose for 2 h.
|
|
The
APN-CT DNA fragment was used in the yeast two-hybrid
screen, and one positive clone was identified. DNA sequence analysis
revealed that this clone contained 87% of the
PIR1 gene,
encoding
a protein with internal repeats (Fig.
2) (
24,
41). This partial
PIR1 gene, designated
PIR1
-
44,
lacked the sequence that corresponded
to the N-terminal 44 amino acid
residues (Fig.
2). The native
PIR1 gene was predicted to
encode a polypeptide with 341 amino
acid residues and a calculated
molecular mass of 34.6 kDa. The
PIR1 gene product was
previously identified as a cell wall protein
with no known biological
function (
24,
41). The observed interaction
between Apn-Ct
and Pir1-p was not restricted to truncated forms
of the two proteins,
as the full-length genes
APN1 and
PIR1 also
produced a strong interaction in the two-hybrid assay (see below).
The
control gene used throughout these experiments was
IMP2,
which
encodes a transcriptional coactivator that interacts with the
product of the
YLR368w gene (
22,
43). The above
data indicate
that the C-terminal end of Apn1p may directly or
indirectly interact
with Pir1p in vivo and that this interaction is
specific for the
combination of Apn1p and Pir1p.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 2.
Deduced amino acid sequence of Pir1p. The seven tandemly
repeated sequences are shown in bold. The N-terminal 44 amino acid
residues (underlined) are missing in plasmid pGAD-RV2, and the
remaining portion is designated PIR1 -44.
|
|
Pir1p interacts with Apn1p in vitro.
To test if Pir1p is
associated with Apn1p in vitro, two independent expression plasmids,
pGFP-PIR1 and pGST-APN-CT, were designed to produce different tagged
forms of the proteins, GFP-Pir1 (~62 kDa) and GST-Apn-Ct (~38
kDa), in wild-type yeast and in E. coli, respectively (Fig.
3A, lane 3; Fig. 3B, lane 1). The
strongly hydrophobic nature of GFP was exploited to couple the GFP-Pir1 fusion protein onto phenyl-Sepharose columns to serve as an affinity step to bind GST-Apn-Ct (see Materials and Methods). Binding of GFP-Pir1 or the control GFP-Imp2 fusion protein (~63 kDa) onto the
column was detected by directly analyzing the column matrix by Western
analysis using monoclonal anti-GFP antibody (Fig. 3C, lanes 2 and 1, respectively). To assess whether GST-Apn-Ct can bind to the GFP-Pir1
column, a fixed amount of GST-Apn-Ct (200 ng) was loaded onto both
columns, the columns were extensively washed, and the matrices were
directly subjected to Western analysis using monoclonal anti-GST
antibodies (Fig. 3D). While GST-Apn-Ct was bound to the GFP-Pir1
column (Fig. 3D, lane 2), it showed no detectable binding to the
control GFP-Imp2 column (Fig. 3D, lane 1). In the case of the control
GFP-Imp2 column, the GST-Apn1-Ct was recovered in the flowthrough
washed fractions (data not shown). The GFP-Pir1 column (Fig. 3E, lane
2) but not the GFP-Imp2 column (lane 1) also specifically
retained the native Apn1p when total yeast extract derived from an
Apn1p-overproducing strain SEY6210/YEpAPN1 was applied. In this
latter experiment, the two additional polypeptides detected by the
anti-Apn1 antibodies were nonspecific and were retained by both columns
(Fig. 3E). Collectively, the data suggest that Pir1p interacts with
Apn1p and that the interaction involves the C-terminal end of Apn1p.
Consistent with this observation, Apn1p and GFP-Pir1 were found to
copurify on two separate columns, DEAE-Sepharose and single-stranded
DNA-agarose (data not shown).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of GFP-Pir1 and GST-Apn-Ct and interaction
detected by affinity column. (A) Total extracts were derived from
strain SEY6210 harboring either the vector pYES2.0 (lane 1) or plasmid
pGFP (lane 2) or pGFP-PIR1 (lane 3) and probed with anti-GFP monoclonal
antibody. (B) Total extracts derived from bacteria carrying plasmid
pGST-APN-CT (lane 1) or pGST (lane 2) were subjected to purification on
a GST affinity column and stained with Ponceau red. (C) Binding of the
control protein GFP-Imp2 (lane 1) or GFP-Pir1 (lane 2) to the
phenyl-agarose column. The matrices were probe by Western analysis
using anti-GFP antibody. (D) Equal amounts of GST-Apn-Ct (200 ng) were
separately loaded onto GFP-Imp2 (lane 1) and GFP-Pir1 (lane 2)
phenyl-agarose columns, followed by extensive washing and direct
analysis of the column matrix by Western blotting with anti-GST
antibody as the probe. (E) Same as panel D except that total extract
(500 µg) derived from strain SEY6210 overproducing Apn1p was used and
the column matrix was probed by Western blotting using anti-Apn1p
polyclonal antibodies. In all panels, sizes are indicated in
kilodaltons.
|
|
Detection of full-length GFP-Pir1 depends on the presence of native
Apn1p.
We then tested if GFP-Pir1 fusion protein levels are
dependent on the presence of Apn1p. Freshly prepared crude extracts
derived from the parent strain SEY6210 (i.e., harboring pGFP-PIR1)
expressed the full-length GFP-Pir1 protein (Fig.
4A, lane 3), but extracts derived from an
apn1
mutant carrying pGFP-PIR1 did not (lane 4). However,
full-length GFP-Pir1 was detected in the apn1
mutant upon
reintroduction of the native APN1 gene on a multicopy
plasmid YEpAPN1 (Fig. 4A and B, lane 5) or the bait plasmid pGBD-APN-CT (data not shown). The full-length GFP-Pir1 was not seen in the apn1
mutant carrying the multicopy plasmid pAPN355, which
expresses the Apn355 protein lacking the extreme C-terminal
12 amino acid residues (Fig. 4A and B, lane 6). The data are consistent
with the notion that Pir1p and native Apn1p can form a complex in vivo. In the case of the apn1
mutant, it is not clear whether
the GFP-Pir1 protein is degraded or translocated to the cell wall (see
Discussion).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Detection of full-length GFP-Pir1 depends on the
presence of native Apn1p. Western blots of freshly prepared total
extracts derived from strains SEY6210/pGFP (wild type [wt]; lane 1),
apn1 /pGFP (lane 2), SEY6210/pGFP-PIR1 (lane 3), and
apn1 harboring pGPF-PIR1 (lanes 4 to 6) and either the
vector Yep352 (lane 4) or the multicopy plasmids YEpAPN1 (lane 5) and
pAPN355 (lane 6) were probed with anti-GFP monoclonal (A) and
anti-Apn1p polyclonal (B) antibodies. In crude extracts, the anti-Apn1p
polyclonal antibodies recognize several nonspecific polypeptides (B,
lane 2) and detect Apn1p only when the latter is overproduced (B, lanes
5 and 6). Each lane contained 50 µg of total protein extracts.
|
|
pir1
mutants are not sensitive to MMS.
To
explore the possible biological role of Apn1p-Pir1p interaction, we
first tested if pir1
mutants were similarly
hypersensitive as the apn1
mutants to MMS. The
PIR1 gene was deleted from two different parental strains,
SEY6210 and YAT1530, to produce the pir1
strains RVY1 and
RVY2, respectively. Interestingly, the pir1
mutants
showed parental resistance to MMS compared to the apn1
mutant (data not shown) (30). Moreover, an
apn1
pir1
double mutant was no more
sensitive than the single apn1
mutant (data not shown).
It would thus appear that Pir1p is not absolutely required for Apn1p
function in the repair of MMS-induced DNA lesions.
Pir1p deficiency causes Apn1p to accumulate in the nucleus.
Since Pir1p does not directly influence Apn1p-modulated DNA repair, we
examined if it affects the distribution of Apn1p in the cell. In this
experiment, plasmid pGFP-APN1 was designed to express a N-terminal
GFP-Apn1 functional fusion protein under the control of the
GAL1 promoter. Introduction of the pGFP-APN1 plasmid into
either the parent strain SEY6210 or the pir1
mutant, following induction, revealed that the GFP-Apn1 fusion protein was
present in the nucleus (Fig. 5A and B).
Strikingly, however, the GFP-Apn1 protein was visually at least three
times more intense in the nucleus of the pir1
mutant
compared to the parent strain. In contrast, the control protein
GFP-Imp2 showed both cytoplasmic and nuclear localization; most
important, the pattern of staining did not differ between the parent
(Fig. 5C) and the pir1
mutant (Fig. 5D). It appears that
GFP-Apn1 accumulated in the nucleus of the pir1
mutant.

View larger version (90K):
[in this window]
[in a new window]
|
FIG. 5.
Increased staining intensity of GFP-Apn1 in the nucleus
of the pir1 mutant. Strains SEY6210 (parent)/pGFP-APN1
(A), RVY1 (pir1 )/pGFP-APN1 (B), SEY6210/pGFP-IMP2 (C),
and RVY1/pGFP-IMP2 (D) were grown in selective medium with 2%
raffinose and induced with 0.5% galactose for 2 h before being
photographed at a magnification of ×100 with a CoolSnap camera
attached to a Leitz immunofluorescence microscrope. Final
magnification, ×50.
|
|
To further support the above finding, nuclear extracts were prepared
from purified nuclei derived from the four strains as
in Fig.
5 after
various time of induction, and the levels of GFP-Apn1
and GFP-Imp2 were
quantified by Western blot analysis using anti-GFP
antibody. In the
absence of induction, i.e., at time zero, a basal
level of GFP-Apn1
expression was detected in both the parent and
pir1
mutant due to leaky expression from the
GAL1 promoter (Fig.
6A) (
29). After 2 h of induction, at least fourfold
more GFP-Apn1
accumulated in the nucleus of the
pir1
mutant compared to the
parent (Fig.
6A).
The level of accumulated GFP-Apn1 in the
pir1
nucleus is
likely higher than fourfold, as a considerable amount
of the protein
existed as truncated forms, presumably due to nuclear
degradation (Fig.
6A). The difference in the nuclear amount of
GFP-Apn1 between the two
strains cannot be due to the protein
being more readily lost from the
parent during preparation of
the nuclei, as the same phenomenon was
observed in living cells
(Fig.
5A and B). Moreover, parallel
experiments conducted with
the parent and
pir1
mutant
showed no difference in the nuclear
amount of the control protein
GFP-Imp2 (Fig.
6A, bottom panel).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 6.
Altered distribution of GFP-Apn1 in the nucleus and
cytoplasm of the pir1 mutant. (A) Nuclear extract (NE)
derived from strains SEY6210 (wild type [wt]) and RVY1
(pir1 ) bearing either plasmid pGFP-APN1 (top) or plasmid
pGFP-IMP2 (bottom). (B) Total extract (TE) prepared from strains
SEY6210 and RVY1 carrying plasmid pGFP-APN1 (lanes 2, 3, and 5 to 10).
Lanes 1 and 4, total extracts from SEY6210 harboring pGFP-IMP2.
Extracts were derived from the strains following the indicated times of
induction. (C) Cytoplasmic extract (CE) derived from strains SEY6210
and RVY1 bearing either plasmid pGFP-APN1 (top) or plasmid pGFP-IMP2
(bottom). The extracts were prepared from cells after the indicated
times of induction with galactose, as in Fig. 5, and all panels were
probed with anti-GFP monoclonal antibodies. The amounts of nuclear,
total, and cytoplasmic extracts assessed by Western blot analysis were
30, 50, and 150 µg, respectively. Sizes are indicated in
kilodaltons.
|
|
In a separate experiment, the level of AP endonuclease activity was
measured in the nuclear extracts using a synthetic substrate
containing
AP sites (
48). After 2 h of induction, AP
endonuclease
levels in the extracts derived from purified nuclei
isolated from
the four strains SEY6210/pGFP-APN1, RVY1/pGFP-APN1,
SEY6210/pGFP-IMP2,
and RVY1/pGFP-IMP2 were 169.1, 1,015.6, 42.3, and
189.2 U per
mg of protein, respectively. Induction had no effect on the
levels
of AP endonuclease in the two latter strains bearing plasmid
pGFP-IMP2
and in nuclear extracts from an
apn1
mutant
that expressed extremely
low level of AP endonuclease, <1.0 U per mg
of protein. The data
are consistent with an increased level of GFP-Apn1
in the
pir1
nucleus. Moreover, it indicates that
endogenous levels of Apn1p,
i.e., in the absence of the overproducing
plasmid pGFP-APN1, were
also accumulating in the
pir1
nucleus. Since the accumulated
Apn1p in the
pir1
nucleus
is also fully active, Pir1p cannot
play a role in modulating Apn1p
activity. Despite the higher level
of Apn1p in the
pir1
nucleus, this mutant was no more resistant
to MMS than the parent. This
finding was not unexpected, as Apn1p
is not a limiting enzyme in parent
strains (
30).
To exclude the possibility that the accumulation of GFP-Apn1 in the
nucleus of the
pir1
mutant did not reflect either
increased
protein expression or decreased turnover, the level of
GFP-Apn1
was determined in total cell extracts derived from the parent
and
pir1
mutant. Western analysis revealed that the
amount of
GFP-Apn1 expressed was nearly the same in both strains within
a linear range of induction (Fig.
6B). In addition, the extent
of
degradation of GFP-Apn1 was no different between the two strains
after
1 h of induction (Fig.
6B, lanes 9 and 10). Therefore, the
accumulated level of GFP-Apn1 within the nucleus of
pir1
mutant
must reflect an imbalance of Apn1p level from another
organelle.
The pir1
mutant has reduced levels of cytoplasmic
and mitochondrial Apn1p.
Since Apn1p is synthesized in the
cytoplasm and translocated to the nucleus, we examined the amount of
GFP-Apn1 in the cytoplasm in both the parent and pir1
strains harboring pGFP-APN1 after various time of induction. In the
absence of induction, no GFP-Apn1 was detected in the cytoplasm of
either strain (Fig. 6C). However, after 2 h of induction, GFP-Apn1
was detected in the cytoplasm of the parent but not the
pir1
mutant (Fig. 6C). In contrast, the control GFP-Imp2
protein was detected at the same level in the cytoplasm of the parent
and pir1
mutant-bearing plasmid pGFP-IMP2 (Fig. 6C,
bottom panel). These data indicate that Pir1p is not required to target
Apn1p into the nucleus per se but rather regulates its distribution in
the cell.
We therefore considered the possibility that Pir1p may target Apn1p to
the mitochondria. Extracts were prepared from purified
mitochondria
isolated from the parent,
pir1
, and
apn1
strains,
and Apn1p polypeptide was analyzed by Western blotting using
anti-Apn1p
polyclonal antibodies (Fig.
7). Mitochondria derived from
the
pir1
mutant contained at least fivefold less Apn1p
cross-reactive
polypeptide compared to the parent (Fig.
7A, lane 3 versus lane
1). No
Apn1p-reactive polypeptide was detected in mitochondria
derived from
the
apn1
mutant (Fig.
7A, lane 5). Plasmid pDR6,
overproducing Apn1p, increased the level of the protein in the
mitochondria and bypassed the need for Pir1p (Fig.
7, lane 4).
Thus, in
normal cells, Pir1p is required to ensure that Apn1p
is efficiently
distributed to the mitochondria, but this function
can be compensated
for by overproduction of Apn1p. It is noteworthy
that overproduction of
Pir1p did not increase Apn1p levels in
the mitochondria.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 7.
Diminished level of Apn1p in mitochondria derived from
the pir1 mutant. (A and B) Western blot analysis of
mitochondrial extracts. For panel A, mitochondrial extracts were
prepared from the parent strain SEY6210 (wild type[wt]), the
pir1 mutant, and the apn1 mutant bearing
the indicated vector or plasmid. Plasmid pDR6 contained the entire
coding region of Apn1p placed under the control of the GAL1
promoter in vector pYES2.0 (29). For panel B, intact or
disrupted mitochondria were untreated and treated with proteinase K. Each lane contained 200 µg of mitochondrial extract, and the blot was
probed with anti-Apn1p antibodies. (C) Levels of AP endonuclease
activity in extracts derived from purified mitochondria obtained from
the indicated strains. Prot., protein.
|
|
To ascertain that Apn1p is indeed in the mitochondria and not attached
to the outer membranes, intact mitochondria derived
from strain
SEY6210/pDR6 were either untreated or treated with
proteinase K and
extensively washed before extract preparation
(Fig.
7B). The proteinase
K pretreatment of intact mitochondria
did not alter the amount of
detectable Apn1p polypeptide, strongly
indicating that Apn1p is present
in the mitochondria (Fig.
7B,
lane 2). However, if the mitochondria
were first disrupted and
pretreated with proteinase K, the amount of
Apn1p polypeptide
detected was much less than with no pretreatment
(Fig.
7B, lane
4 versus lane
3).
To assess if the level of Apn1p polypeptide detected in the
mitochondrial extracts corresponded to the AP endonuclease activity,
the extracts were quantified for AP endonuclease using the synthetic
AP
site substrate. Mitochondrial extracts derived from the
pir1
mutant contained substantially (~10%) lower
levels of AP endonuclease
activity compared to the parent (Fig.
7C). No
AP endonuclease
activity was detected in the mitochondrial extract
derived from
the
apn1
mutant (Fig.
7C). Introduction of a
plasmid (pPIR) carrying
the
PIR1 gene into the
pir1
mutant restored the level of AP endonuclease
in the
mitochondria to nearly parental levels (Fig.
7C). These
data strongly
indicate that Apn1p level in the mitochondria is
dependent on Pir1p
function.
The pir1
mutant exhibits increased level of
mitochondrial mutations, which can be prevented by Apn1p
overproduction.
Since Apn1p is essential to maintain the stability
of the nuclear genome, we tested if Apn1p plays a similar role in the
mitochondria. The rate of mitochondrial mutations was determined in the
parent, pir1
, and apn1
mutants by scoring
independent colonies for Eryr. Eryr
colonies can occur as a result of mutation in the mitochondrial gene encoding the large (21S)rRNA (5). Interestingly,
the spontaneous mutation rates of Eryr colonies
were similar for the parent, pir1
, and apn1
strains, suggesting that these mutations originate independently of
Apn1p function (Table 1). However, if the
cells were exposed to a low dose of MMS (0.05% for 30 min), levels of
Eryr mutations increased 3.6- and 5.8-fold in
the pir1
and apn1
mutants, respectively,
compared to the parent (Table 1). Overproduction of Apn1p or
introduction of the PIR1 gene into the pir1
mutant prevented the MMS-induced mutations (Table 1). Collectively, the
data strongly indicate that Pir1p facilitates Apn1p translocation into
the mitochondria, where it can act to process excess AP sites in the
mitochondrial genome.
 |
DISCUSSION |
We demonstrate that the C-terminal end of the DNA repair enzyme
Apn1p, comprising a bipartite NLS, interacts either directly or
indirectly with Pir1 protein, a cell wall constituent of previously unknown function. We believe that this interaction is required to
facilitate Apn1p translocation into the mitochondria. This is supported
by our findings that Pir1p-deficient cells manifest an imbalance in the
subcellular distribution of Apn1p, i.e., an accumulation in the nucleus
and concomitant reduction in the mitochondria. An apparently dire
consequence of Pir1p deficiency is reflected by the elevated levels of
MMS-induced mitochondrial mutations due to reduced levels of
mitochondrial Apn1p. We conclude that Apn1p exists among the plethora
of DNA repair enzymes that maintain genome stability in the
mitochondria. Apn1p may serve in the elimination of excess AP sites
and/or to repair specific oxidative DNA lesions (30), as
well as to remove 3'-blocking lesions that are created after the action
of AP lyases such as Ntg1p (30, 50).
The involvement of Pir1p in the subcellular distribution of Apn1p is
unexpected and suggests that Pir1p is subjected to intracellular localization in compartments other than the cell wall (24,
41). Pir1p bears no obvious organelle targeting signal sequence,
and no extensive cell fractionation experiments have been performed to
examine its cellular location. It is noteworthy that a significant portion of the GFP-Pir1 fusion protein used in this study is cleaved to
generate GFP, and thus this fusion cannot be used to examine Pir1p
proper cellular location. Accordingly we are currently engineering a
much smaller epitope tag (hemagglutinin) next to Pir1p to precisely determine how the cellular distribution of this protein is affected by Apn1p.
A major challenge is to determine the mechanism by which Pir1p
facilitates Apn1p distribution into the mitochondria. At least two
models can be envisaged. In one model, Pir1p would compete with Kar
p
for binding to Apn1p bipartite NLS; alternatively, it would directly
bind to the NLS and sequester a fraction of the Apn1p to be
translocated into mitochondria. Pir1p contains seven tandem repeats of
a stretch of 18 to 19 amino acid residues (AAAVSQIGDGQIQATTKTT/K),
constituting 38% of the protein. These repeats may engage in the
interaction with the basic amino acid residues of Apn1p NLS, so as to
prevent Kar
p from accessing the NLS. Kar
p itself consists of 10 tandemly repeated modules termed armadillo (ARM) motifs that form an
-helical structure which creates several contacts with the basic
amino acid residues of monopartite and bipartite NLS (2).
Although Pir1p repeats are not identical to those of Kar
p, three
short amino acid stretches, VSO, QIQA, and KTK, belonging to the Pir1
repeats are present in ARM 9 (VSQ and QIQA) and ARM 10 (KTK) of
Kar
p. These short amino acid stretches of Pir1p could compete for
the NLS of Apn1p.
In a second model, Pir1p could be viewed as a transport receptor or
exportin like the Kar
p superfamily that shuttles between the nucleus
and cytoplasm (14, 15, 42). In such a case, Pir1p could
mediate the export of Apn1p through the nuclear pore complexes, thus
facilitating Apn1p uptake into the mitochondria. This model predicts
that a pir1
mutant would also favor a nuclear distribution of Apn1p, and concomitant depletion in the mitochondria, as observed here. This model is supported by a recent study showing that overproduction of either Pse1p/Kar
121p or Kar
123p, two members of the Kar
p family, facilitates the translocation of hydrophobic proteins into the mitochondria (3). These
proteins include the mitochondrial ABC transporter Atm1p and a reporter protein fused to the transmembrane domains of apocytochrome
p (3). Based on this model, it would be
expected that overproduction of Pir1p would deplete the nuclear level
of Apn1p and display a DNA repair-deficient phenotype. However, this
was not observed, as yeast cells do not appear to sustain higher levels
of Pir1p expression from the GAL1 control promoter. The
second model further predicts that Pir1p would be recycled into the
nucleus, thereby exhibiting a nucleocytoplasmic distribution. In fact,
many exportins, e.g., Crm1p and Msn5p which export Yap1p and Pho4p,
respectively, are known to cycle between the cytoplasm and nucleus
(19, 47).
One caveat associated with the second model is that it is energetically
less feasible, since it would require that Apn1p cross the nuclear
membrane twice before entry into the mitochondria, as opposed to the
first model, where Apn1p would enter directly from the cytoplasm.
However, considering the high rate at which spontaneous mutagenic AP
sites are generated in the nuclear genome, the cell may opt to first
import Apn1p into the nucleus followed by its distribution to the
mitochondria. This seems feasible, as yeast cells retain at least 50 mitochondria under normal growth conditions and may be more tolerant of
mitochondrial than of nuclear DNA damage. To distinguish between the
above two models, it is imperative to define a single amino acid
substitution (perhaps involving the unique proline in the spacer region
of the bipartite NLS) that blocks Apn1p entry into the nucleus, while
still allowing it to interact with Pir1p. According to the first model,
the modified Apn1p should be able to enter the mitochondria, unless
Apn1p nuclear entry precedes mitochondrial translocation.
Although Apn1p has a putative N-terminal presequence, this is
apparently not sufficient to target the protein to the mitochondria. Such a notion is supported by the observation that Apn355,
which lacks a portion of the bipartite NLS, was predominantly localized to the cytoplasm, as determined by indirect immunofluorescence microscopy and by GFP-tagged Apn355 (29) (R. Vongsamphanh and D. Ramotar, unpublished data). In any case, the
putative N-terminal presequence is not likely to be a strong signal for
targeting Apn1p to the mitochondria. An independent study demonstrated
that attachment of the presequence of S. pombe, but not of
S. cerevisiae Apn1p to GFP was sufficient to target the
protein to the mitochondria of HeLa cells (J. Connolly, R. Perez-Jannotti, and D. Bogenhagen, personal communication). Since
S. pombe lacks Pir1p, this organism may have evolved to
effectively use the N-terminal presequence. Thus, any experimental
design to demonstrate that the Apn1p N-terminal presequence is capable
of targeting a heterologous protein into the mitochondria will work
only if the fusion protein also bears the stretch of amino acids
residues that promote interaction with Pir1p.
 |
ACKNOWLEDGMENTS |
We sincerely thank Eric Alani, Dan Bogenhagen, Brian Burke,
Michael Weinfeld, and Elliot Drobetsky for critical comments on the
manuscript. We also thank Andrea Shatilla and Xiaoming Yang for
technical assistance in preparation of the AP site substrate, Jocelyn
David for constructing the pGFP plasmid, and Anick Leduc for sequencing
the fusion constructs.
This work was supported by research grant OGP0138503 to D.R. from the
Natural Science and Engineering Research Council of Canada. D.R. is a
career Scientist of the National Cancer Institute of Canada.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: University of
Montreal, Guy-Bernier Research Centre, 5415 de l'Assomption, Montreal, Quebec, Canada H1T 2M4. Phone: (514) 252-3400, ext. 4684. Fax: (514)
252-3430. E-mail: dramotar{at}hmr.qc.ca.
 |
REFERENCES |
| 1.
|
Bandmann, O.,
M. G. Sweeney,
S. E. Daniel,
C. D. Marsden, and N. W. Wood.
1997.
Mitochondrial DNA polymorphisms in pathologically proven Parkinson's disease.
J. Neurol.
244:262-265[CrossRef][Medline].
|
| 2.
|
Conti, E.,
M. Uy,
L. Leighton,
G. Blobel, and J. Kuriyan.
1998.
Crystallographic analysis of the recognition of a nuclear localization signal by the nuclear import factor karyopherin alpha.
Cell
94:193-204[CrossRef][Medline].
|
| 3.
|
Corral-Debrinski, M.,
N. Belgareh,
C. Blugeon,
M. G. Claros,
V. Doye, and C. Jacq.
1999.
Overexpression of yeast karyopherin Pse1p/Kap121p stimulates the mitochondrial import of hydrophobic proteins in vivo.
Mol. Microbiol.
31:1499-1511[CrossRef][Medline].
|
| 4.
|
Croteau, D. L.,
C. M. ap Rhys,
E. K. Hudson,
G. L. Dianov,
R. G. Hansford, and V. A. Bohr.
1997.
An oxidative damage-specific endonuclease from rat liver mitochondria.
J. Biol. Chem.
272:27338-27344[Abstract/Free Full Text].
|
| 5.
|
Cui, Z., and T. L. Mason.
1989.
A single nucleotide substitution at the rib2 locus of the yeast mitochondrial gene for 21S rRNA confers resistance to erythromycin and cold-sensitive ribosome assembly.
Curr. Genet.
16:273-279[CrossRef][Medline].
|
| 6.
|
Davis, R. E.,
S. Miller,
C. Herrnstadt,
S. S. Ghosh,
E. Fahy,
L. A. Shinobu,
D. Galasko,
L. J. Thal,
M. F. Beal,
N. Howell, and W. D. Parker, Jr.
1997.
Mutations in mitochondrial cytochrome c oxidase genes segregate with late-onset Alzheimer disease.
Proc. Natl. Acad. Sci. USA
94:4526-4531[Abstract/Free Full Text].
|
| 7.
|
Dove, J. E.,
J. S. Brockenbrough, and J. P. Aris.
1998.
Isolation of nuclei and nucleoli from the yeast Saccharomyces cerevisiae.
Methods Cell Biol.
53:33-46[Medline].
|
| 8.
|
Gershoni, J. M., and G. E. Palade.
1983.
Protein blotting: principles and applications.
Anal. Biochem.
131:1-15[CrossRef][Medline].
|
| 9.
|
Gibbs, P. E., and C. W. Lawrence.
1995.
Novel mutagenic properties of abasic sites in Saccharomyces cerevisiae.
J. Mol. Biol.
251:229-236[CrossRef][Medline].
|
| 10.
|
Gietz, R. D., and R. H. Schiestl.
1991.
Applications of high efficiency lithium acetate transformation of intact yeast cells using single-stranded nucleic acids as carrier.
Yeast
7:253-263[CrossRef][Medline].
|
| 11.
|
Gorlich, D.,
P. Henklein,
R. A. Laskey, and E. Hartmann.
1996.
A 41 amino acid motif in importin-alpha confers binding to importin-beta and hence transit into the nucleus.
EMBO J.
15:1810-1807[Medline].
|
| 12.
|
Grishko, V. I.,
N. Druzhyna,
S. P. LeDoux, and G. L. Wilson.
1999.
Nitric oxide-induced damage to mtDNA and its subsequent repair.
Nucleic Acids Res.
27:4510-4516[Abstract/Free Full Text].
|
| 13.
|
Guthrie, C., and G. R. Fink.
1991.
Guide to yeast genetics and molecular biology.
Methods Enzymol.
194:3-37[CrossRef][Medline].
|
| 14.
|
Henderson, B. R., and P. Percipalle.
1997.
Interactions between HIV Rev and nuclear import and export factors: the Rev nuclear localisation signal mediates specific binding to human importin-beta.
J. Mol. Biol.
274:693-707[CrossRef][Medline].
|
| 15.
|
Jakel, S., and D. Gorlich.
1998.
Importin beta, transportin, RanBP5 and RanBP7 mediate nuclear import of ribosomal proteins in mammalian cells.
EMBO J.
17:4491-4502[CrossRef][Medline].
|
| 16.
|
James, P.,
J. Halladay, and E. A. Craig.
1996.
Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast.
Genetics
144:1425-1436[Abstract].
|
| 17.
|
Johnson, A. W., and B. Demple.
1988.
Yeast DNA 3'-repair diesterase is the major cellular apurinic/apyrimidinic endonuclease: substrate specificity and kinetics.
J. Biol. Chem.
263:18017-18022[Abstract/Free Full Text].
|
| 18.
|
Jones, M. E.
1993.
An improved estimator of spontaneous mutation rates in Luria-Delbruck fluctuation experiments.
Mutat. Res.
292:191-198[Medline].
|
| 19.
|
Kaffman, A.,
N. M. Rank,
E. M. O'Neill,
L. S. Huang, and E. K. O'Shea.
1998.
The receptor Msn5 exports the phosphorylated transcription factor Pho4 out of the nucleus.
Nature
396:482-486[CrossRef][Medline].
|
| 20.
|
Kunz, B. A.,
E. S. Henson,
H. Roche,
D. Ramotar,
T. Nunoshiba, and B. Demple.
1994.
Specificity of the mutator caused by deletion of the yeast structural gene (APN1) for the major apurinic endonuclease.
Proc. Natl. Acad. Sci. USA
91:8165-8169[Abstract/Free Full Text].
|
| 21.
|
Masson, J. Y., and D. Ramotar.
1997.
Normal processing of AP sites in Apn1-deficient Saccharomyces cerevisiae is restored by Escherichia coli genes expressing either exonuclease III or endonuclease III.
Mol. Microbiol.
24:711-721[CrossRef][Medline].
|
| 22.
|
Masson, J. Y., and D. Ramotar.
1996.
The Saccharomyces cerevisiae IMP2 gene encodes a transcriptional activator that mediates protection against DNA damage caused by bleomycin and other oxidants.
Mol. Cell. Biol.
16:2091-2100[Abstract].
|
| 23.
|
Masson, J. Y., and D. Ramotar.
1998.
The transcriptional activator Imp2p maintains ion homeostasis in Saccharomyces cerevisiae.
Genetics
149:893-901[Abstract/Free Full Text].
|
| 24.
|
Mrsa, V., and W. Tanner.
1999.
Role of NaOH-extractable cell wall proteins Ccw5p, Ccw6p, Ccw7p and Ccw8p (members of the Pir protein family) in stability of the Saccharomyces cerevisiae cell wall.
Yeast
15:813-820[CrossRef][Medline].
|
| 25.
|
Muller-Weeks, S.,
B. Mastran, and S. Caradonna.
1998.
The nuclear isoform of the highly conserved human uracil-DNA glycosylase is an Mr 36,000 phosphoprotein.
J. Biol. Chem.
273:21909-21917[Abstract/Free Full Text].
|
| 26.
|
Pinz, K. G., and D. F. Bogenhagen.
1998.
Efficient repair of abasic sites in DNA by mitochondrial enzymes.
Mol. Cell. Biol.
18:1257-1265[Abstract/Free Full Text].
|
| 27.
|
Ramotar, D.
1997.
The apurinic-apyrimidinic endonuclease IV family of DNA repair enzymes.
Biochem. Cell Biol.
75:327-336[CrossRef][Medline].
|
| 28.
|
Ramotar, D., and B. Demple.
1996.
Functional expression of Escherichia coli endonuclease IV in apurinic endonuclease-deficient yeast.
J. Biol. Chem.
271:7368-7374[Abstract/Free Full Text].
|
| 29.
|
Ramotar, D.,
C. Kim,
R. Lillis, and B. Demple.
1993.
Intracellular localization of the Apn1 DNA repair enzyme of Saccharomyces cerevisiae. Nuclear transport signals and biological role.
J. Biol. Chem.
268:20533-20539[Abstract/Free Full Text].
|
| 30.
|
Ramotar, D.,
S. C. Popoff,
E. B. Gralla, and B. Demple.
1991.
Cellular role of yeast Apn1 apurinic endonuclease/3'-diesterase: repair of oxidative and alkylation DNA damage and control of spontaneous mutation.
Mol. Cell. Biol.
11:4537-4544[Abstract/Free Full Text].
|
| 31.
|
Richter, C.
1992.
Reactive oxygen and DNA damage in mitochondria.
Mutat. Res.
275:249-255[CrossRef][Medline].
|
| 32.
|
Rosenquist, T. A.,
D. O. Zharkov, and A. P. Grollman.
1997.
Cloning and characterization of a mammalian 8-oxoguanine DNA glycosylase.
Proc. Natl. Acad. Sci. USA
94:7429-7434[Abstract/Free Full Text].
|
| 33.
|
Rotig, A.,
J. P. Bonnefont, and A. Munnich.
1996.
Mitochondrial diabetes mellitus.
Diabetes Metab.
22:291-298[Medline].
|
| 34.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 35.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 36.
|
Schapira, A. H.
1999.
Mitochondrial disorders.
Biochim. Biophys Acta
1410:99-102[Medline].
|
| 37.
|
Sherman, F.,
G. Fink, and J. Hicks (ed.).
1983.
Methods in yeast genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 38.
|
Sia, E. A.,
C. A. Butler,
M. Dominska,
P. Greenwell,
T. D. Fox, and T. D. Petes.
2000.
Analysis of microsatellite mutations in the mitochondrial DNA of Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
97:250-255[Abstract/Free Full Text].
|
| 39.
|
Stierum, R. H.,
G. L. Dianov, and V. A. Bohr.
1999.
Single-nucleotide patch base excision repair of uracil in DNA by mitochondrial protein extracts.
Nucleic Acids Res.
27:3712-3719[Abstract/Free Full Text].
|
| 40.
|
Takao, M.,
H. Aburatani,
K. Kobayashi, and A. Yasui.
1998.
Mitochondrial targeting of human DNA glycosylases for repair of oxidative DNA damage.
Nucleic Acids Res.
26:2917-2922[Abstract/Free Full Text].
|
| 41.
|
Toh-e, A.,
S. Yasunaga,
H. Nisogi,
K. Tanaka,
T. Oguchi, and Y. Matsui.
1993.
Three yeast genes, PIR1, PIR2 and PIR3, containing internal tandem repeats, are related to each other, and PIR1 and PIR2 are required for tolerance to heat shock.
Yeast
9:481-494[CrossRef][Medline].
|
| 42.
|
Truant, R., and B. R. Cullen.
1999.
The arginine-rich domains present in human immunodeficiency virus type 1 Tat and Rev function as direct importin beta-dependent nuclear localization signals.
Mol. Cell. Biol.
19:1210-1217[Abstract/Free Full Text].
|
| 43.
|
Uetz, P.,
L. Giot,
G. Cagney,
T. A. Mansfield,
R. S. Judson,
J. R. Knight,
D. Lockshon,
V. Narayan,
M. Srinivasan,
P. Pochart,
A. Qureshi-Emili,
Y. Li,
B. Godwin,
D. Conover,
T. Kalbfleisch,
G. Vijayadamodar,
M. Yang,
M. Johnston,
S. Fields, and J. M. Rothberg.
2000.
A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae.
Nature
403:623-627[CrossRef][Medline].
|
| 44.
|
Vetter, I. R.,
A. Arndt,
U. Kutay,
D. Gorlich, and A. Wittinghofer.
1999.
Structural view of the Ran-importin beta interaction at 2.3 ° resolution.
Cell
97:635-646[CrossRef][Medline].
|
| 45.
|
Wach, A.,
A. Brachat,
R. Pohlmann, and P. Philippsen.
1994.
New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae.
Yeast
10:1793-1808[CrossRef][Medline].
|
| 46.
|
Wallace, D. C.
1999.
Mitochondrial diseases in man and mouse.
Science
283:1482-1488[Abstract/Free Full Text].
|
| 47.
|
Yan, C.,
L. H. Lee, and L. I. Davis.
1998.
Crm1p mediates regulated nuclear export of a yeast AP-1-like transcription factor.
EMBO J.
17:7416-7429[CrossRef][Medline].
|
| 48.
|
Yang, X.,
P. Tellier,
J. Y. Masson,
T. Vu, and D. Ramotar.
1999.
Characterization of amino acid substitutions that severely alter the DNA repair functions of Escherichia coli endonuclease IV.
Biochemistry
38:3615-3623[CrossRef][Medline].
|
| 49.
|
Yasuhira, S., and A. Yasui.
2000.
Alternative excision repair pathway of UV-damaged DNA in Schizosaccharomyces pombe operates both in nucleus and in mitochondria.
J. Biol. Chem.
275:11824-11828[Abstract/Free Full Text].
|
| 50.
|
You, H. J.,
R. L. Swanson, and P. W. Doetsch.
1998.
Saccharomyces cerevisiae possesses two functional homologues of Escherichia coli endonuclease III.
Biochemistry
37:6033-6040[CrossRef][Medline].
|
| 51.
|
You, H. J.,
R. L. Swanson,
C. Harrington,
A. H. Corbett,
S. Jinks-Robertson,
S. Senturker,
S. S. Wallace,
S. Boiteux,
M. Dizdaroglu, and P. W. Doetsch.
1999.
Saccharomyces cerevisiae Ntg1p and Ntg2p: broad specificity N-glycosylases for the repair of oxidative DNA damage in the nucleus and mitochondria.
Biochemistry
38:11298-11306[CrossRef][Medline].
|
Molecular and Cellular Biology, March 2001, p. 1647-1655, Vol. 21, No. 5
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.5.1647-1655.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
de la Loza, M. C. D., Wellinger, R. E.
(2009). A novel approach for organelle-specific DNA damage targeting reveals different susceptibility of mitochondrial DNA to the anticancer drugs camptothecin and topotecan. Nucleic Acids Res
37: e26-e26
[Abstract]
[Full Text]
-
Chaffin, W. L.
(2008). Candida albicans Cell Wall Proteins. Microbiol. Mol. Biol. Rev.
72: 495-544
[Abstract]
[Full Text]
-
Gakh, O., Park, S., Liu, G., Macomber, L., Imlay, J. A., Ferreira, G. C., Isaya, G.
(2006). Mitochondrial iron detoxification is a primary function of frataxin that limits oxidative damage and preserves cell longevity. Hum Mol Genet
15: 467-479
[Abstract]
[Full Text]
-
Sumita, T., Yoko-o, T., Shimma, Y.-i., Jigami, Y.
(2005). Comparison of Cell Wall Localization among Pir Family Proteins and Functional Dissection of the Region Required for Cell Wall Binding and Bud Scar Recruitment of Pir1p. Eukaryot Cell
4: 1872-1881
[Abstract]
[Full Text]
-
Ishchenko, A. A., Yang, X., Ramotar, D., Saparbaev, M.
(2005). The 3'->5' Exonuclease of Apn1 Provides an Alternative Pathway To Repair 7,8-Dihydro-8-Oxodeoxyguanosine in Saccharomyces cerevisiae. Mol. Cell. Biol.
25: 6380-6390
[Abstract]
[Full Text]
-
Aouida, M., Leduc, A., Poulin, R., Ramotar, D.
(2005). AGP2 Encodes the Major Permease for High Affinity Polyamine Import in Saccharomyces cerevisiae. J. Biol. Chem.
280: 24267-24276
[Abstract]
[Full Text]
-
Doudican, N. A., Song, B., Shadel, G. S., Doetsch, P. W.
(2005). Oxidative DNA Damage Causes Mitochondrial Genomic Instability in Saccharomyces cerevisiae. Mol. Cell. Biol.
25: 5196-5204
[Abstract]
[Full Text]
-
Wysocki, R., Fortier, P.-K., Maciaszczyk, E., Thorsen, M., Leduc, A., Odhagen, A., Owsianik, G., Ulaszewski, S., Ramotar, D., Tamas, M. J.
(2004). Transcriptional Activation of Metalloid Tolerance Genes in Saccharomyces cerevisiae Requires the AP-1-like Proteins Yap1p and Yap8p. Mol. Biol. Cell
15: 2049-2060
[Abstract]
[Full Text]
-
Aouida, M., Page, N., Leduc, A., Peter, M., Ramotar, D.
(2004). A Genome-Wide Screen in Saccharomyces cerevisiae Reveals Altered Transport As a Mechanism of Resistance to the Anticancer Drug Bleomycin. Cancer Res.
64: 1102-1109
[Abstract]
[Full Text]
-
Abe, H., Shimma, Y.-i., Jigami, Y.
(2003). In vitro oligosaccharide synthesis using intact yeast cells that display glycosyltransferases at the cell surface through cell wall-anchored protein Pir. Glycobiology
13: 87-95
[Abstract]
[Full Text]
-
Wang, Y., Lyu, Y. L., Wang, J. C.
(2002). Dual localization of human DNA topoisomerase IIIalpha to mitochondria and nucleus. Proc. Natl. Acad. Sci. USA
99: 12114-12119
[Abstract]
[Full Text]
-
Dirmeier, R., O'Brien, K. M., Engle, M., Dodd, A., Spears, E., Poyton, R. O.
(2002). Exposure of Yeast Cells to Anoxia Induces Transient Oxidative Stress. IMPLICATIONS FOR THE INDUCTION OF HYPOXIC GENES. J. Biol. Chem.
277: 34773-34784
[Abstract]
[Full Text]
-
Kim, G., Sikder, H., Singh, K. K.
(2002). A colony color method identifies the vulnerability of mitochondria to oxidative damage. Mutagenesis
17: 375-381
[Abstract]
[Full Text]
-
O'Rourke, T. W., Doudican, N. A., Mackereth, M. D., Doetsch, P. W., Shadel, G. S.
(2002). Mitochondrial Dysfunction Due to Oxidative Mitochondrial DNA Damage Is Reduced through Cooperative Actions of Diverse Proteins. Mol. Cell. Biol.
22: 4086-4093
[Abstract]
[Full Text]