INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Cell cycle checkpoints are thought to provide time for DNA repair by delaying cell cycle progress in the face of DNA damage (reviewed in reference 21). Saccharomyces cerevisiae arrests in metaphase for up to 8 h when chromosomes are damaged (e.g., by a double-stranded DNA [dsDNA] break), after which it adapts and continues through the cell cycle (12, 18, 20). Two classes of proteins have been identified that are required for checkpoint adaptation: repair proteins and signaling proteins. Mutations in KU increase the amount of single-stranded DNA that forms at a dsDNA break, thereby increasing the strength of the checkpoint signal and eliminating adaptation (13). Strains in which the casein kinase II specificity subunits (CKB1 or CKB2) are deleted or that contain a special allele of the gene encoding the polo kinase Cdc5p (cdc5-ad) are also unable to adapt to DNA damage arrest (20).

dsDNA breaks can be processed by many mechanisms that result in different outcomes. Archetypal homologous recombination (reattachment of two broken ends using a homologous template) allows error-free repair. However, other, more error-prone outcomes are also seen: (i) nonhomologous end joining results in deletions; (ii) single-strand annealing (SSA) between direct repeats results in deletions; (iii) break-induced replication (BIR) can yield translocations or large gene conversion tracts that cause loss of heterozygosity; (iv) ectopic telomere addition causes terminal truncations; and (v) unrepaired chromosomes may be lost altogether (reviewed in references 4 and 5). Each of these pathways can lead to the loss of genetic information (genomic instability). Which of these scenarios occurs may depend upon where the cell is in the cell cycle when it repairs the damage.

Several variables determine where cells are in the cell cycle when they attempt repair of a dsDNA break: where the cells are in the cycle when they receive the break, the speed with which they repair the break, whether they undergo a checkpoint-mediated arrest in response to the break, and how long they maintain that arrest before adapting. Here, we examine whether some events that lead to genomic instability (e.g., chromosome deletions, translocations, or loss) occur only after cells have first undergone a checkpoint arrest and subsequently have adapted to that arrest. We employed adaptation-defective mutants to show that in the absence of archetypal homologous recombination (which is typically error free), most irradiated cells undergo checkpoint adaptation and only after this adaptation do they undergo BIR, translocations, or chromosome loss. Therefore, checkpoint adaptation serves to increase resistance to DNA damage, but in doing so it allows cells to undergo mutagenic events. Adaptation-defective diploids are particularly sensitive to X rays compared to adaptation-proficient diploids. We suggest that adaptation is more important for achieving maximum radio-resistance in diploids than in haploids, because diploids are able to survive with genetic rearrangements more easily than are haploids. Since adaptation is required to generate many of these rearrangements, adaptation is only seen to increase viability in strains that are able to grow after loss or rearrangement of chromosomes.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Scoring of X-ray sensitivity, adaptation, chromosome loss, and rearrangements. All strains were derived from LS20 (additional information is available on request) (18), which has the genotype mat cyh2 can1 lys5 ade2 ade3::GalHO trp1 his3 ura3 leu2. Some strains were also leu1::URA3 (see Fig. 3, 4, and 5). The additional chromosome VII was aro2 adh4::HIS3. ckb2, rad51, and rad52 strains were disrupted with LEU2 as indicated. Strains were grown in synthetic media with glucose at 30°C unless noted otherwise. Means and standard deviations were determined for three independent experiments (with the exception of experiments shown below in Fig. 3 [rows 3 and 4] and Table 2 [rows 1 and 2], for which the means and ranges of two experiments are reported). For damage-induced events, frequencies are the number of induced events divided by the number of viable cells. For X-ray sensitivity experiments, cells were sonicated for 7 s on level 2.5 of a Fisher-550 sonicator, plated, and subjected to various doses of X rays. Viability was determined as the number of colonies formed after irradiation, compared to the number of colonies with no irradiation. Haploid MAT strains (rad52 cdc5-ad or rad52 CDC5) were transformed with a plasmid encoding the MAT locus and mated to themselves to produce isogenic diploids (20). Diploids were then streaked on 5-fluoroorotic acid (FOA) plates to select against the MAT URA3 plasmid.

Molecular methods. Yeast DNA was prepared and contour-clamped homogeneous electric field (CHEF) gels were run as described previously (10). Gels were blotted to nylon filters and probed with a 1,657-bp XhoI/KpnI fragment of ADE3 specific for the test chromosome. DNA was fluorescently labeled for DNA array analysis as described elsewhere (9). DNA arrays (kindly provided by J. DeRisi) were probed as described previously (2). PCR analysis (see Fig. 5C) was performed using the oligonucleotides TGTTCGTAAGCAATAATAAATCAAT and TGTGGTGTATATTGACCCAACGAGT.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Adaptation is important for achieving maximum X-ray resistance in diploids but not haploids. To determine the importance of adaptation in tolerating irreparable DNA damage, we examined the sensitivity of adaptation-proficient (CDC5) and adaptation-deficient (cdc5-ad) cells to X-irradiation in a repair-defective background (rad52) (Fig. 1A). cdc5-ad mutants are unable to adapt to a DNA damage arrest induced by an endonucleolytic break (20) or by X-irradiation (Fig. 1B and C). Despite this, there was no difference in the X-ray sensitivities of rad52 CDC5 and rad52 cdc5-ad haploid strains (Fig. 1A). This was likely because the rad52 CDC5 cells that adapted underwent lethal rearrangements or chromosome loss. We reasoned that this may not be the case in diploids, since they have two copies of each chromosome and are therefore able to tolerate the loss of part or even all of one of their two homologs (Fig. 1E). This is in fact the case; homozygous rad52 CDC5 diploids form many more colonies after X-irradiation than adaptation-defective strains (Fig. 1A). Similar, albeit less dramatic results were seen in RAD52 strains with high X-ray doses; RAD52 cdc5-ad diploids are 3.7 times more sensitive to X rays than RAD52 CDC5 diploids at 45 kilorads. Diploids are also more resistant to DNA damage due to heterozygosity of the MAT genes (8). However, our observations were due to ploidy itself and not due to the genetic difference between haploids and diploids, since the MAT locus was deleted in all strains used in this paper.

View larger version (40K): [in this window] [in a new window]   FIG. 1.   Adaptation increases X-ray resistance in diploids. (A) Strains were plated and X-irradiated, and all resulting colonies were counted, regardless of their growth rate. Haploid strains (rad52 cdc5-ad or rad52 CDC5) were mated to themselves to produce isogenic diploids (20). (B and C) Cells were irradiated with 3 kilorads, and microcolony assays were performed to determine the percentage of cells that had adapted, as described elsewhere (20). (D) Either 30,000 cells (rad52 CDC5/rad52 CDC5 diploids, left) or 100,000 cells (rad52 cdc5-ad/rad52 cdc5-ad diploids, right) were plated, subjected to 3 kilorads of X-irradiation, and allowed to form colonies. (E) Model showing one broken and two unbroken chromosomes (each line represents two identical sisters) in haploid and diploid strains. Adaptation generates viable but karyotypically altered monosomic diploids.

Checkpoint adaptation precedes chromosome loss. To examine better whether genomic instability was responsible for the differences seen between the rad52 CDC5 and rad52 cdc5-ad strains shown in Fig. 1, we performed chromosome loss assays on two adaptation-deficient mutants (cdc5-ad and ckb2) (20). These experiments, as well as those shown in all subsequent figures, were performed on disomic strains which harbored a nonessential copy of chromosome VII containing several genetic markers, including ADE3, which is required for the formation of a red pigment, and CYH2, which causes sensitivity to cycloheximide. These experiments allowed us to examine chromosome loss or rearrangements on chromosome VII without loss of essential genes. We found that the frequency with which this chromosome was lost, either spontaneously or after X-irradiation, was strikingly decreased in the adaptation-defective mutants rad52 cdc5-ad and rad52 ckb2 (Table 1). This argues against models in which chromosome loss events are thought to occur either because cells occasionally do not detect the damaged DNA or because the chromosome becomes damaged after the stage of the cell cycle where the checkpoint arrest takes place. Instead, these data suggest that most observed chromosome loss events are preceded by a checkpoint arrest and a subsequent adaptation to that arrest. Similarly, missegregation of minichromosomes correlates with a transient MAD1-dependent checkpoint arrest (23).

View larger version (44K): [in this window] [in a new window]   FIG. 2.   Adaptation precedes spontaneous chromosome loss. The frequency of spontaneous chromosome loss was determined using haploid strains harboring an extra copy of chromosome VII containing the CYH2 and ADE3 genes. Haploid CDC5 rad52 and cdc5-ad rad52 disomic strains (as in Table 1) were grown on nonselective plates and photographed. Chromosome losses appear as white sectors.

Checkpoint adaptation precedes chromosome translocation and BIR. While examining chromosome loss rates in rad51 strains, we observed that the spontaneous and X-ray-induced rates of another form of genomic instability, BIR, are also diminished in cdc5-ad. BIR is a recombinational repair event during which only one of the halves of a broken chromosome invades a template such that the entire arm of the broken chromosome is copied from that template (6, 15, 16). This gene conversion event results in loss of heterozygosity over very large sections of the chromosome. Moreover, chromosomes other than homologs can be used for the template, generating nonreciprocal translocations (1) (see also Fig. 4D). This form of recombination is also unusual in that it is independent of the rad51 gene (15), allowing this event to be studied in the absence of competing forms of recombination. To examine adaptation's role in BIR more thoroughly, we generated a disomic strain in which both copies of chromosome VII are marked throughout their length (Fig. 3, "starting strain"). In this strain, the CEN-linked marker LEU1 (marker B) was replaced with the URA3 gene on the control chromosome.

View larger version (32K): [in this window] [in a new window]   FIG. 3.   Adaptation is required for spontaneous and damage-induced BIR events. Haploid CDC5 rad51 and cdc5-ad rad51 strains (as in Table 1) were altered to replace the centromere-linked LEU1 gene on the control chromosome with the URA3 gene (shown as B and b::URA3, respectively). Markers A, D, E, and F represent ADE3, ARO2, LYS5, and adh4::HIS3, respectively. Control chromosome DNA is shown in outline. For spontaneous events, strains were plated on medium lacking leucine (selecting for marker B) and containing cycloheximide (selecting against CYH2). The prominent classes of rearrangements are diagrammed. For X-ray induced events, cells were plated on nonselective plates, subjected to 3 kilorads of X rays, allowed to form colonies, and replica plated on cycloheximide plates lacking leucine to screen for BIR events.

View larger version (38K): [in this window] [in a new window]   FIG. 4.   Translocations and BIR can both arise from a DNA lesion. (A) This diagram illustrates the expected outcome of a reciprocal recombination event in G2 between sister chromatids of different homologs. Segregation of sisters after mitosis will yield two possible outcomes: (i) both daughters can have markers identical to the starting strain (not shown), or (ii) each daughter can be homozygous for markers distal to the site of recombination (shown). (B) Outline of the experiment, the results of which are shown in panel C. Disomic rad51 CDC5 colonies (from irradiated nonselective plates) were scored for BIR events (as described in Materials and Methods). Colonies found to contain cells that had undergone BIR were restreaked from the original nonselective plate, and the resultant colonies were analyzed genetically for rearrangements of chromosome VII (BIR and/or deletions-translocations, as determined genetically). (C) DNA from the following strains were run on CHEF gels, blotted, and probed for the test chromosome: "starting strain" and "control strain" are marker strains with and without the test chromosome, respectively; 13 translocations-truncations isolated after restreaking 13 independent BIR-containing colonies (one translocation-truncation from each original colony) (lanes 1 to 13); and 4 translocations-truncations (lanes 14A to D) and 2 BIR (lanes 14 BIR E and F) colonies isolated from the same irradiated BIR-containing colony (6 total colonies isolated from one original colony). (D) Model showing three pairs of sister chromatids; the black and outlined sets represent the test and control chromosomes, respectively, and gray represents a different chromosome. Adaptation results in daughters that repair independently.

A 218-kb region between two leucine tRNA genes is commonly deleted. To characterize further the internal deletions seen in Fig. 3, 13 isolates from rad51 CDC5 and rad51 cdc5-ad were run on a CHEF gel, blotted, and probed for the test chromosome (Fig. 5A). Interestingly, the majority of the deletion events appear to produce a chromosome of the same size. Most of these events were independent, since the 26 events shown were taken from six independent strains. DNA from one such deletion was compared to DNA from the starting strain by hybridization on a DNA array. A large region of chromosome VII (from YGL041 to YGL158) displayed a 50% reduction in hybridization (Fig. 5B). The junctions of this deletion each contain genes encoding a 99% identical leucine tRNA. To verify that this deletion occurred between these tRNA genes, we amplified the junction by PCR (Fig. 5C) and sequenced the product (results not shown). Given that these events were homology based and independent of RAD51 (11), they probably arose by SSA (Fig. 5D). CDC5 and cdc5-ad had indistinguishable rates of SSA as measured by inducing an HO endonuclease cut between two direct repeats (data not shown; see Materials and Methods).

View larger version (33K): [in this window] [in a new window]   FIG. 5.   A large region of chromosome VII flanked by two homologous tRNA genes is frequently deleted. (A) Marker strains with (lane 1) or without (lane 2) the control chromosome; 13 strains identified as large internal deletions from rad51 CDC5 (lanes 3 to 15) or rad51 cdc5-ad (lanes 16 to 28) were run on a CHEF gel, blotted, and probed for the test chromosome. (B) DNA from the starting strain or a strain containing a large internal deletion (as in panel A, lane 3) was fluorescently labeled and hybridized to a DNA array as described previously (9). Hybridization ratios are shown for genes on the left arm of chromosome VII. Arrows designate leucine tRNA genes flanking the deletion. (C) Oligonucleotides corresponding to the outside of the deletion were used in a PCR on the strains shown in panel A. M, marker. (D) The putative SSA intermediate between the centromere proximal [TL (CAA) G2] and distal [TL (CAA) G1] tRNA genes flanking the internal deletions mapped in panels A to C. The oligonucleotides used in panel C are indicated as arrows.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

While adaptation to the DNA damage checkpoint has now been clearly documented in response to several forms of damage, including X-irradiation, an endonucleolytic break, and damage generated by the cdc13 mutation (12, 18, 20), the biological consequences of adaptation to this checkpoint had not been previously explored. We found that at least three forms of genomic instability (chromosome loss, translocation, and BIR) occur after cells have arrested at the checkpoint and subsequently adapted. Previous studies have shown that the rate of nonreciprocal translocation and chromosome loss is higher in checkpoint mutants than in wild-type cells (3, 22). Our data address the events which nonetheless appear in wild-type cells and show that these events are preceded by adaptation to a checkpoint arrest.

The X-ray-induced chromosome loss rate we observed is compatible with the hypothesis that chromosome loss is largely responsible for X-ray-induced death in rad52 CDC5 and rad52 cdc5-ad haploids: if a loss rate of 16% seen for chromosome VII (Table 1) is similar for all 16 chromosomes, then approximately 6% (84%¹⁶) of cells should not have a loss event. This corresponds to the viability of the haploid at this dose (6% viability at 2 kilorads [Fig. 1A]). In diploids, only 0.4% (84%³²) of cells will not have a chromosome loss event. We propose that rad52 CDC5 diploids are viable well above this level (14% at 2 kilorads; Fig. 1A) because they can often form colonies monosomic for the lost chromosome after adapting to the irreparable damage (Fig. 1E). While the initial growth rates of such colonies are quite low, strong selection for subsequent nondisjunctions in the nascent colonies may allow some of these cells to eventually form fast-growing colonies. If rad52 cdc5-ad diploids arrest permanently with a single unrepaired chromosome, their viability at 2 kilorads should be more similar to 0.4%, which it is (1.1% at 2 kilorads; Fig. 1A). These calculations assume that the absolute frequency of events that lead to chromosome loss is equal in CDC5 and cdc5-ad strains.

The effect of adaptation on resistance to DNA damage depends upon whether the damage is repairable and whether the damaged chromosome is essential. When damage is in an essential chromosome and is irreparable (as with the X-irradiated rad52 haploids in Fig. 1), cells die regardless of whether they adapt. When damage is in a nonessential chromosome and is irreparable (as with the irradiated rad52 diploids in Fig. 1), adaptation mutants will have lower viability because they will remain arrested (and therefore eventually die) with damage that is often not inherently lethal. This scenario is seen even more strikingly when an irreparable HO-directed break is induced in a nonessential chromosome in a rad52 strain (as in Table 2 and reference 20). Cells can also be damaged in essential chromosomes in such a way that the damage is fully reversible using the cdc13 mutation. CDC13 encodes a telomere-binding protein that stabilizes telomeric DNA. When temperature-sensitive cdc13 mutants are brought to the nonpermissive temperature, they will suffer damage at all their telomeres. When the strain is brought to the permissive temperature again, it will repair the damaged telomeric DNA. In this case, adaptation mutants will retain their viability better than wild-type cells because they will remain checkpoint arrested until the temperature is lowered and the cells can repair their telomeres (20).

Our finding that adaptation-defective rad51 strains undergo fewer BIR events is consistent with experiments initially characterizing BIR (15). In these experiments, an endonucleolytic break was seen to initiate a BIR event in later cell cycles. Here, we show that adaptation to the DNA damage checkpoint is required for cells to complete BIR. One explanation is that cells must enter S phase in order for the broken chromosome to either invade the donor chromosome or complete the replication of the broken chromosome. The observation that three different rearrangements were seen in a colony that formed from an X-irradiated cell suggests that the break was carried through at least two cell cycles. It is not immediately obvious why cdc5-ad disomes damaged in G₁ could not undergo BIR during S phase. It is possible that the majority of double-stranded breaks that initiate BIR are formed when cells pass through S phase with damage, such that cells would need to pass through one S phase just to generate the correct initiating lesion. It had previously been noted that the checkpoint-defective mutant rad9 has a higher rate of nonreciprocal translocations but not reciprocal translocations (3). Given our findings, it is likely that these events represent BIR; if BIR occurs only after cells have continued through the checkpoint, then checkpoint mutants should have a higher BIR frequency.

Induction of an HO break at the TRP5 locus 50 kb from the centromere did not induce rad51-independent BIR in our strain. This is in contrast to published reports examining BIR in response to an HO break at the MAT locus of chromosome III (15). This suggests that the efficiency of BIR may vary considerably depending upon where the initiating lesion is in the genome. As seen previously, induction of an HO break in a nonessential chromosome leads to death in the cdc5-ad rad52 double mutant. The viability seen here was slightly higher than that seen previously (6.9% ± 1.4% versus 1% ± 1%) (Table 2 and reference 20). The number reported here is likely a slight overestimate because in these experiments HO is not induced before plating, so that many cells incur a break after having first divided once or twice on the plate. This will increase the viability two- to fourfold. Interestingly, rad51 cdc5-ad mutants are not as sensitive to break induction as rad52 cdc5-ad mutants (Table 2). It may be that rad51 strains are able to repair this break in such a way that the checkpoint signaling is shut down but the nearby centromere is destroyed (e.g., by SSA).

Our findings that spontaneous DNA damage seen in recombination-deficient mutants (rad51 and rad52) induces a checkpoint response have also been suggested in mammals. Mice with deletions of RAD51 or the RAD51-associated tumor suppressor BRCA1 die early in development; however, this phenotype is partially rescued by the deletion of the mammalian checkpoint gene p53 or (for BRCA1) p21 (7, 14). While BRCA1 is essential during mouse embryogenesis, the BRCA1 gene is lost during tumorigenesis in some familial breast cancers. In yeast, loss of the RAD51 pathway increases the incidence of BIR, possibly by eliminating competing pathways (15). Given that BRCA1 may be involved in the RAD51 repair pathway (19), it is possible that BIR (which leads to loss of heterozygosity across an entire chromosome arm) may be induced in BRCA1 preneoplastic cells, contributing to their tumorigenicity.