Previous Article | Next Article ![]()
Molecular and Cellular Biology, March 2001, p. 1730-1736, Vol. 21, No. 5
Department of
Genetics1 and Howard Hughes Medical
Institute,8 Harvard Medical School,
Cardiovascular Division, Department of
Medicine,2 and Howard Hughes Medical
Institute,9 Brigham and Women's
Hospital, and Children's Hospital and Harvard Medical
School,6 Boston, and Cardiovascular
Research Center, Massachusetts General Hospital,
Charlestown,3 Massachusetts;
Laboratório de Genética e Cardiologia Molecular,
Instituto do Coração (InCor) HC-FMUSP, São Paulo
05403-000, Brazil4; Johns Hopkins
University, Baltimore, Maryland5; and
University of Ottawa Heart Institute at the Ottawa
Hospital, Ottawa, Ontario K1Y 4H9, Canada7
Received 28 September 2000/Returned for modification 10 November
2000/Accepted 28 November 2000
To define the role of Irx4, a member of the Iroquois
family of homeobox transcription factors in mammalian heart development and function, we disrupted the murine Irx4 gene. Cardiac
morphology in Irx4-deficient mice (designated
Irx4 The atrial and ventricular chambers
of the mammalian heart are exquisitely tailored for their precise
roles in circulating blood. Unique properties of atrial and
ventricular cells, conserved throughout vertebrate evolution,
enable the specialized roles that each chamber plays in cardiac
function (2, 17, 22, 23, 31, 37, 41). Structurally, atrial
myocytes have poorly developed sarcoplasmic reticulums and
disorganized sarcomeres compared to ventricular myocytes and contain
dense-core secretory granules that are absent in the ventricles. Atrial
myocytes display shorter times of contraction and relaxation than their
ventricular counterparts, and misexpression of chamber-specific
contractile proteins results in abnormal myocardial function (20,
41, 47). Presumably such differences have evolved to accommodate the specific hemodynamic load of each chamber; these differences may
also be important for myocardial adaptation to diseases such as
hypertension and hypertrophy (12, 13, 17, 28).
The anatomical and functional differences between atrial and
ventricular myocardium reflect the expression of specific genes in each
chamber. Experiments with chickens suggest that external positional
information acts on the precardiac cells in the earliest stages of
differentiation, but soon after cardiac differentiation the plasticity
of the myocytes is lost, and cardiac cells are irreversibly programmed
as atrial or ventricular (40, 55, 56). Subsequently,
however, the establishment of chamber-specific gene expression occurs
as a gradual and dynamic process throughout embryogenesis. Prior to
heart tube formation, expression of ventricle-specific gene
myosin light chain 2v (MLC2v) is already
regionalized, presumably in the ventricular precursors
(34). During heart tube formation and subsequent
morphogenetic remodeling to form the mature heart, regionalization of
most other transcripts is evident, so that by the time the heart has
two atria and ventricles the majority of chamber-specific genes are
expressed in their final anatomical compartments (10, 29, 33, 35,
38, 53, 56). Some genes exhibit delayed regionalization; for
example, the atrial natriuretic factor (ANF) gene
is expressed in both embryonic atria and ventricles but at birth
ventricular expression is down-regulated (17, 57). Despite
progress in determining the patterns of chamber-specific gene
expression during mammalian development, the factors that control the
assignment of one gene to its predominant site of expression are not known.
We have recently identified in chickens, mice, and humans a new member
of the Iroquois gene family, Irx4, whose cardiac
expression is restricted to the ventricles of the developing heart
(1, 9). Irx4 is the earliest marker of the
ventricular precursors and is expressed in ventricular myocardium
during all stages of cardiac development, including during adulthood.
Transient misexpression of mouse Irx4 or of a dominant-negative Irx4
molecule in chicken embryos disrupted the chamber-specific expression
of cardiac myosin heavy chain genes (1). By
virtue of its homology to Iroquois patterning genes and its
ventricle-specific expression pattern, Irx4 is a good candidate for a
molecule involved in regulating ventricular specification in the
developing heart. To fully elucidate its role in heart development and
function, we disrupted the murine Irx4 gene. Irx4-deficent
mice develop adult-onset cardiac hypertrophy that is preceded by
abnormal ventricular gene expression.
Generation of Irx4-targeted and transgenic
mice.
A genomic clone comprising the Irx4 gene was
isolated by screening a 129/SvJ mouse genomic phage library with the
Irx4 cDNA. A replacement targeting construct was constructed
(see Fig. 1); this resulted in the deletion of a 650-bp fragment that
includes the 3' end of exon 2 (including the translation initiation
codon), intron 2, and part of exon 3. The thymidine kinase
gene driven by the PGK promoter was inserted at the end of
the 3' region of homology. The targeting construct was electroporated
into 3 × 107 C1 embryonic stem cells
(30). Three separate embryonic stem cell lines were
injected into mouse blastocysts; one chimeric mouse transmitted the
targeted allele through the germ line.
Irx4 Physiological measurements.
Echocardiography of adult mice
was performed as previously described (36) using a Sonos
5500 (Hewlett-Packard) with a 12-MHz transducer. Conscious systolic
blood pressure was measured by tail cuff using a Visitech BP2000. Mice
were acclimatized to the instrument twice a day for 5 days; sequential
measurements were acquired twice a day for 3 days. In vivo left
ventricle (LV) physiological measurements and electrophysiological
analysis were performed as previously described (4, 24).
All physiological analyses were done blinded to the genotypes of the animals.
Analysis of gene expression.
In situ hybridization of whole
embryos was performed as previously described (44). In
situ hybridization on paraffin sections was done using a modification
of the whole-mount protocol. Northern blots were prepared and
hybridized according to standard protocols, using cDNA or
oligonucleotide probes. Blots were quantitated using a phosphorimager
(Molecular Dynamics) and normalized to the signal from a
GAPDH probe. Fold increases are reported as means of three to five individual samples and are significantly different from control
values at P values of <0.05. Oligonucleotide probes
corresponding to cDNA probes.
The cDNA probes used were Mice with a targeted disruption of Irx4 were generated
by homologous recombination in embryonic stem cells (Fig.
1). The first coding exon and part of the
second coding exon of Irx4 were eliminated, resulting in
targeted allele designated Irx4
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.5.1730-1736.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Cardiomyopathy in Irx4-Deficient Mice Is
Preceded by Abnormal Ventricular Gene Expression

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
ex2/
ex2) was normal during
embryogenesis and in early postnatal life. Adult
Irx4
ex2/
ex2 mice developed a
cardiomyopathy characterized by cardiac hypertrophy and impaired
contractile function. Prior to the development of cardiomyopathy,
Irx4
ex2/
ex2 hearts had abnormal
ventricular gene expression: Irx4-deficient embryos exhibited reduced
ventricular expression of the basic helix-loop-helix transcription
factor eHand (Hand1), increased Irx2 expression, and ventricular induction of an atrial
chamber-specific transgene. In neonatal hearts, ventricular expression
of atrial natriuretic factor and
-skeletal
actin was markedly increased. Several weeks subsequent to these
changes in embryonic and neonatal gene expression, increased expression
of hypertrophic markers BNP and
-myosin heavy
chain accompanied adult-onset cardiac hypertrophy. Cardiac
expression of Irx1, Irx2, and Irx5 may
partially compensate for loss of Irx4 function. We conclude
that Irx4 is not sufficient for ventricular chamber formation but is
required for the establishment of some components of a
ventricle-specific gene expression program. In the absence of genes
under the control of Irx4, ventricular function deteriorates and
cardiomyopathy ensues.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
ex2/
ex2 and
Irx4
ex2/+ mice were maintained on a mixed
(SvJ × BlackSwiss) background. Genotyping was performed by PCR using
three primers designed to amplify the wild-type and mutant alleles;
primer sequences are available upon request. Reverse transcription-PCR
(RT-PCR) was performed using primer pairs i (GCGGGCCGGCTCTTTCCTG)
and iv (AGTTCTAGCTCCTTGTCGTCTTTG) or ii
(CCCGGCATGTCCTACCCGCAGTTT) and iii
(GCAGGCCCGGAATCAGCCAGTGTG). SMyHC3-HAP transgenic mice
were generated as previously described (54) and were
crossed with Irx4
ex2/
ex2 mice.
-skeletal actin,
-myosin heavy chain
(
MHC),
-myosin heavy chain
(
MHC), phospholamban, serca2, MLC1a, MLC1v,
MLC2a, and MLC2v were synthesized according to
previously published sequences (36). cDNA probes are
listed below. Alkaline phosphatase (AP) staining of embryos was done as
previously described (54).
MHC
(35),
MHC (35),
Chisel (R. P. Harvey, unpublished data),
COUP-TFII (42), dHand
(49), eHand (49), FOG-2
(51), Hermes (25), Irx4
(9), Irx2 (referred to as Irx6 in
reference 15) (7), MLC1a
(35), MLC1v (35), MLC2a
(33), MLC2v (38),
MLC3f(32), Msg1 (19),
and Tbx5 (10). ANF, BNP, BMP10, and
FGF12 cDNAs were cloned by PCR amplification of
reverse-transcribed heart RNA using primers based on the published mouse sequences (GenBank accession no. K02781, D16497, AF101033, and
AF020738, respectively). Mouse Irx1 and Irx5
cDNAs were obtained from a mouse embryonic heart cDNA library
(Stratagene) that was screened with the Irx4 cDNA. Mouse
Irx3 cDNAs were identified initially in a library screen;
the probe used here was obtained as an expressed sequence tag (GenBank
accession no. AI154095).
![]()
RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
ex2 (Fig.
1A to D). One-fourth of the offspring of
Irx4
ex2/+ animals were
Irx4
ex2/
ex2 animals, thereby
indicating that Irx4 is not essential for viability. There was no
increase in mortality in Irx4
ex2/
ex2
animals compared to that of wild-type mice. Northern blot and RT-PCR
analyses revealed that two transcripts are still transcribed at normal
levels from the Irx4
ex2 allele. The
sequencing of RT-PCR products generated using oligonucleotide primers
outside the deleted region (Fig. 1E; see Materials and Methods) defined
the structure of the Irx4 transcripts produced from the
Irx4
ex2 allele. Two transcripts that
contained Irx4 sequences were identified. The 5' ends of
these transcripts contained exon 1 of the Irx4 gene, the 3'
end of the PGKneo gene, and sequences from Irx4
exon 3; all of Irx4 exon 2 and part of exon 3 were deleted.
All of these transcripts lacked a ribosome binding site and initiation codon (data not shown). We concluded that the
Irx4
ex2 allele does not encode a
functional Irx4 protein.

View larger version (28K):
[in a new window]
FIG. 1.
Targeted disruption of Irx4. (A) Diagram of
the Irx4 genomic locus, targeting construct, and targeted
locus. Open boxes, untranslated sequences; solid boxes, coding
sequences; hatched boxes, homeodomain-coding sequences. Only relevant
restriction enzyme sites are shown. (B) Southern blot of
XbaI-digested embryonic stem cell DNA using a probe external
to the targeting construct, showing a targeting event (lane 2) as
evidenced by two bands representing the endogenous 9-kb allele and the
6-kb targeted allele. (C) PCR identification of wild-type and targeted
alleles in Irx4+/+ (+/+),
Irx4
ex2/+ (+/
) and
Irx4
ex2/
ex2 (
/
) mice. (D) RT-PCR
of mouse heart RNA for all three genotypes using primers internal to
the deletion (ii and iii in panel A). (E) RT-PCR of mouse heart RNA for
all three genotypes using primers external to the deletion (i and iv in
panel A). Xb, XbaI; B, BamHI; N,
NotI.
We assessed cardiac gene expression in the hearts of
Irx4
ex2/
ex2 embryos and 10-day-,
6-week-, and 24-week-old animals by Northern blot analysis or in situ
hybridization. At all time points examined, Irx4
ex2/
ex2 and wild-type LVs
contained equal amounts of
-cardiac myosin heavy chain
(MHC), phospholamban, serca2, MLC1a, MLC1v, MLC2a, MLC2v, and Tbx5. In contrast, at 10 days postbirth
ANF and
-skeletal actin mRNA levels were
higher by factors of 5.2 ± 0.6 and 5.8 ± 1.3 in
Irx4
ex2/
ex2 hearts than in wild-type
hearts, respectively (Fig. 2A). At 6 weeks,
MHC mRNA levels were also increased (by a factor
of 2.1 ± 0.2 versus the wild-type level). By 24 weeks,
Irx4
ex2/
ex2 hearts contained increased
levels of ANF (factor of 6.7 ± 1.3), BNP
(factor of 4.3 ± 0.6),
-skeletal actin (factor of
5.4 ± 0.8), and
MHC (factor of 2.7 ± 0.15)
mRNAs compared to mRNA levels in wild-type hearts (Fig. 2A).
Heterozygous Irx4
ex2/+ animals exhibited
intermediate increases of these mRNAs, suggesting an inverse dose
relationship between Irx4 levels and RNA expression. In situ
hybridization of an ANF-specific probe to sections of adult
Irx4
ex2/
ex2 myocardium demonstrated an
uneven distribution of ANF, with ANF mRNA
localized mainly in the trabecular zone, an area of normal ANF expression in fetal, but not postnatal, life (Fig. 2B
and C). No difference in ANF expression between wild-type
and Irx4
ex2/
ex2 mice was observed in
embryonic day 13.5 (E13.5) fetal hearts (data not shown).
|
To determine if Irx4 regulates the developmental expression of
chamber-specific transcription factors implicated in cardiac development or of other chamber-specific genes, in situ hybridization of whole-mount Irx4
ex2/
ex2 embryos
(E10.5 to E11.5) was performed with cDNA probes. The expression
patterns of Chisel, COUP-TFII, dHand, FGF12, FOG-2, Hermes,
Msg1, BMP10, Tbx5, MLC1a, MLC1v, MLC2a, MLC2v,
MHC,
and
MHC in wild-type and
Irx4
ex2/
ex2 embryonic hearts were
comparable (data not shown). However, expression of the basic
helix-loop-helix (bHLH) transcription factor eHand, which at
E10.5 to E11.5 predominates in the LV and part of the right ventricle
(RV) (5, 49), was altered (Fig. 2D to F). eHand
expression in Irx4
ex2/
ex2 embryos was
diminished in the anterior and ventral regions of the developing LV
(n = 4).
To further explore the role of Irx4 in directing chamber-specific gene
expression, we mated Irx4
ex2/+ mice to
transgenic mice expressing human AP under the control of the slow
myosin heavy chain 3 (SMyHC3) promoter. The
SMyHC3 gene is the quail homolog of the chicken atrial
myosin heavy chain gene, and the transgenic mice express AP
robustly in developing atria but not in ventricles (54).
Heterozygous SMyHC3-HAP/Irx4
ex2/+
mice were mated to Irx4
ex2/+ mice to
generate SMyHC3-HAP/Irx4
ex2/
ex2
embryos. At E9.5, the atrial chamber-specific transgene was expressed in the presumptive LV as well as the atria of
SMyHC3-HAP/Irx4
ex2/
ex2 embryos (Fig.
3), showing derepression of the
SMyHC3-HAP transgene in a portion of the ventricles. At
E10.5 and E12.5, marked AP staining was detected in both the LV and RV
(Fig. 3). However, AP expression was nonuniform and restricted to the
LV and RV free walls at E10.5; by E12.5 the entire RV expressed the
reporter gene, but transgene expression was excluded from the region to the left of the interventricular septum. These data imply a role for
Irx4 and other factors in regulating chamber-specific gene expression
in the early embryo; Irx4 can function to repress atrial gene
expression within developing ventricular chambers.
|
Members of the Iroquois gene family in Xenopus
laevis and Drosophila melanogaster are functionally
interchangeable and partially redundant (3, 11, 18, 26,
27). To determine whether other Iroquois family members
compensated for the lack of Irx4 in mutant mice, we attempted to
identify additional Iroquois genes exhibiting cardiac expression. An
E10 embryonic heart cDNA library was screened with the
Irx4 cDNA, and three additional Iroquois genes were
identified: Irx1, Irx2, and Irx5. Expression of
Irx1, -2, -3, and -5 was
assessed in wild-type and Irx4
ex2/
ex2
hearts. Only Irx1, Irx2, and Irx5 were expressed
in the heart (Fig. 4).
Irx1 and Irx2 were detectable in a subset of
cells near the interventricular groove (Fig. 4C, D, F, and G).
Irx5 was present in both atria and ventricles but was
excluded from the atrioventricular junction (Fig. 4A, B, and D).
Although the levels of Irx1 and Irx5 in the
mutant hearts were not significantly altered (data not shown),
increased Irx2 expression was observed in
Irx4
ex2/
ex2 hearts (Fig. 4F and G;
n = 3).
|
To determine the consequences of Irx4 deficiency on postnatal cardiac
structure and function, histopathologic and hemodynamic studies were
performed. The hearts from 10-day-old
Irx4
ex2/
ex2 and
Irx4
ex2/+ pups were indistinguishable
from those of wild-type pups (assessed by morphology, heart
weight-to-body weight ratios, and histology; data not shown).
Chamber-specific analyses demonstrated right atrium (RA) enlargement in
Irx4
ex2/
ex2 mice at 6 weeks of age,
with an average increase in RA weight/body weight ratio of 51%
compared to that for their wild-type or heterozygous littermates
(n = 6; P < 0.02), a finding
suggestive of RV dysfunction. Hearts from mature
Irx4
ex2/
ex2 mice, age 24 weeks,
exhibited significant increases in the ratios of each chamber weight to
body weight compared to those from wild-type or heterozygous mice (left
atrium, +44%; RA, +57%; LV, +18%; RV, +32%; n = 7;
P < 0.05 for each). In vivo assessments confirmed LV
hypertrophy (Table 1) in adult mutant
mice; wall thickness was greatest in homozygous
Irx4
ex2/
ex2 mice, but LV hypertrophy
was evident in heterozygous Irx4
ex2/+
mice compared to wild-type mice. Despite increased wall thickness, light microscopy revealed normal myocardial histology without fibrosis
in adult heterozygous and homozygous mice. Immunohistochemistry and
electron microscopy revealed no pro-ANF secretory granules (data not
shown), an ultrastructure unique to atrial cardiocytes (17).
|
Cardiac echocardiography demonstrated abnormal ventricular function in
Irx4
ex2/
ex2 mice including increased
end-systolic dimensions, reduced fractional shortening, and diminished
velocity of fiber shortening compared to wild-type mice (Table 1 and
Fig. 5). In vivo physiological measurements confirmed echocardiographic findings and showed increased end-systolic volumes and decreased ejection fractions (data not shown)
in Irx4
ex2/
ex2 mice at 10 and 24 weeks
of age. Blood pressure and electrical parameters were normal in
Irx4
ex2/
ex2 mice (data not shown). We
conclude that Irx4 deficiency adversely effects ventricular function
and causes a cardiomyopathy characterized by myocardial hypertrophy,
chamber dilation, and systolic dysfunction.
|
| |
DISCUSSION |
|---|
|
|
|---|
We have shown that mice with a targeted disruption of the
ventricle-specific homeodomain gene Irx4 exhibit aberrant
ventricular gene expression and maturity onset cardiomyopathy.
Decreased ventricular eHand expression and derepression of
an atrial chamber-specific transgene in Irx4-targeted
embryos indicate a role for Irx4 in some, but not all, aspects of
ventricle-specific gene expression and patterning during heart
development. Inappropriate postnatal ventricular expression of
ANF,
-skeletal actin, and
MHC in
Irx4
ex2/
ex2 mice suggests that Irx4
participates in lifelong maintenance of the ventricular phenotype.
While not essential for ventricular chamber formation, Irx4 is required
for normal ventricular function.
The response of eHand and of the SMyHC3-HAP
transgene in Irx4
ex2/
ex2 embryos
indicates that Irx4 controls specific aspects of ventricle-specific gene expression in the developing mouse heart. Aberrant
eHand expression in the
Irx4
ex2/
ex2 embryo may indicate that
Irx4 functions in a manner analogous to Iroquois proteins in
Drosophila and Xenopus that establish boundaries
of proneural bHLH expression (3, 26, 27) or simply
reflects a role for Irx4 in maintaining increased eHand expression levels. The regulation of eHand gene expression
in heart development has not been well defined; however it has been shown that eHand expression is decreased in mice lacking
Nkx2-5 or FOG-2 (5, 50, 52).
Irx4 expression is reduced in mice lacking Nkx2-5
(9) but not in FOG-2-deficient mice (52), suggesting that parallel pathways regulate cardiac eHand
expression. This is the case in Drosophila, where parallel
pathways involving the Drosophila homologs of
Irx4 (Iroquois genes) and FOG-2
(u-shaped) are responsible for the regulation of proneural
bHLH genes (16, 26). The role of eHand in cardiomyocytes
is unclear and appears not to be related to normal cardiac
differentiation, but instead is likely to be related to growth and the
looping of the myocardium (21, 45, 46).
Our observation that lack of Irx4 results in the derepression of ANF in the ventricles shortly after birth indicates that Irx4 is a key negative modulator of ANF. Irx4 is expressed in the postnatal ventricular myocardium (9), supporting a role in regulating gene expression after birth as well as in the embryo. The regulation of the ANF gene in cardiac development is complex (17, 48, 57). ANF is initially expressed in the RV precursors, after which its expression appears in the atrial precursors. Subsequent to chamber formation, ANF expression remains strong in the atria and the trabecular region of the ventricles. After birth, ventricular ANF expression decreases to less than 1% of atrial levels. Irx4 is therefore likely to be involved in repressing ANF expression in the ventricular myocardium after birth. We believe that the increased ANF expression in Irx4-deficient mice is independent of the development of cardiomyopathy in these animals, which only becomes physiologically apparent at 6 weeks of age and which is functionally and morphologically measurable at 6 months of age. Despite aberrant ANF expression, we note that ventricular myocytes lacking Irx4 do not express ANF granules as do atrial cells; presumably these ventricular cells lack molecular factors and/or cellular machinery required to produce these secretory granules.
The SMyHC3 gene is the quail ortholog of chicken AMHC1, which previously we have shown to be repressed by Irx4 (1). SMyHC3 elements promote atrial chamber-specific transgenic expression in mice (54); although there is no mammalian ortholog of SMyHC3, the mechanisms for transcriptional regulation of chamber-specific expression appear to have been conserved during myosin gene evolution. It is not known if Irx4 directly binds to SMyHC3 regulatory elements. The DNA-binding site of Irx4 has not been defined; however a bipartite AT-rich binding site in the achaete-scute regulatory sequence has been defined for Drosophila Iroquois protein araucan (26). Since the SMyHC3 promoter region does not contain such a sequence, we suggest either that Irx4 has different DNA-binding specificity than its Drosophila counterparts or that Irx4 acts via protein-protein interactions as do other three-amino-acid length extended class homeodomain proteins (39, 43).
Our data implicate other molecules in specification of the ventricular
phenotype. Some are likely to be Iroquois gene family members that incompletely compensate for Irx4 deficiency in
Irx4
ex2/
ex2 mice. In
Drosophila and Xenopus, Iroquois genes
are known to be redundant and functionally interchangeable (3,
11, 18, 26, 27). A deletion of at least two of the
Drosophila Iroquois genes araucan,
caupolican, and mirror is required to cause a
morphological defect, and deletion of all three results in
more-profound abnormalities (11, 18, 26). We have shown
that besides Irx4 three additional Iroquois genes
are expressed in the developing mouse heart. Two of these,
Irx1 and Irx2, are expressed in an overlapping
pattern in a subset of ventricular cells on the left of the
interventricular groove. Additionally, embryonic ventricular
Irx2 expression is increased in
Irx4
ex2/
ex2 mice. It is intriguing
that the sites of expression of Irx1 and Irx2
colocalize with regions where SMyHC3 transgene induction does not occur
in Irx4
ex2/
ex2 embryos. In addition we
and others (6, 14, 15) have identified a novel
Iroquois gene, Irx5. Although widely expressed in
both ventricles and atria, Irx5 is excluded from the
atrioventricular junction and the outflow tract. Collectively these
observations suggest that combinatorial interactions between several
Iroquois transcription factors refine the spatial regulation of cardiac gene expression. It is noteworthy in this regard that Irx3 has been
shown to play a role in a combinatorial process of neuronal precursor
definition in concert with other homeodomain proteins (8).
Our previous studies in which Irx4 function was disrupted with a putative dominant-negative Irx4 molecule in fact indicated a role for Irx4 in ventricle-specific gene expression but not in ventricular morphogenesis (1). While these experiments clearly demonstrated that a dominant-negative molecule could modulate chamber-specific gene expression in a vertebrate heart, they were greatly limited due to multiple technical issues. The chicken cardiac myosin heavy-chain genes are the only chamber-specific genes identified in chicken hearts to date and do not have mammalian orthologs; thus it is difficult to anticipate the response of mammalian chamber-specific genes to similar experimental manipulations. Furthermore, the dominant-negative molecule used in these experiments is predicted to interfere with the actions of multiple Irx family proteins. In addition, the chicken embryos did not survive and are not well suited for physiological measurements of cardiac function; therefore we were not able to address the functional consequences of the manipulation. Also, the timing of viral misexpression is only adequate to disrupt Irx4 function much later than the initiation of Irx4 expression in the developing heart. Thus, using gene targeting, we have been able to address the functional consequences of Irx4 deficiency and now have a useful tool to elucidate the molecular pathways regulated by Irx4.
Previously described etiologies of cardiomyopathy in mice and humans
have involved contractile proteins, cytoskeletal proteins, or signaling
molecules. The development of cardiomyopathy in
Irx4
ex2/
ex2 mice reveals a novel
transcriptional pathway in the regulation of ventricular function. We
speculate that this cardiomyopathy indicates that Irx4-deficient
myocytes lack normal functional properties, thus leading to
decompensation when subjected to ventricular load. While it is
recognized that cardiac pathologies, in particularly cardiomyopathies,
cause ventricular expression of ANF, BNP,
MHC, and
-skeletal actin (12, 13, 17), the expression
of ANF and
-skeletal actin in postnatal
ventricular Irx4
ex2/
ex2 myocytes is
far in advance of cardiac dysfunction, indicating that Irx4-mediated
repression of these (and presumably other) genes is important for
physiological ventricular function. Identification of other genes
regulated by Irx4 and other Iroquois family members should offer
further insights into the differences between atrial and ventricular myocytes.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by the Howard Hughes Medical Institute (D.F., C.L.C., J.G.S., C.E.S.), the American Heart Association (B.G.B.), the Medical Research Council of Canada/Canadian Institutes of Health Research (B.G.B., M.L.K.B., A.J.B.), the National Institutes of Health (Z.-Z.B., N.R., J.G.S., C.E.S.), the Heart and Stroke Foundation of Ontario (M.L.K.B., A.J.B.).
We thank M. Giewat and J. Vatner for technical assistance, and J. O. Mudd for help with the blood pressure monitoring. We are also grateful to R. Beddington, M. Buckingham, K. Chien, P. Gruss, R. Harvey, C.-C. Hui, S. Izumo, P. Krieg, G. Lyons, S. Orkin, D. Srivastava, S. Tevosian, and S. Tsai for cDNA probes and to C.-C. Hui and R. Harvey for sharing data prior to publication.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Genetics, Harvard Medical School, 200 Longwood Ave., Boston, MA 02115. Phone: (617) 432-7830. Fax: (617) 432-7832. E-mail: seidman{at}rascal.med.harvard.edu.
Present address: Division of Cardiovascular Research, The Hospital
for Sick Children, Toronto, Ontario, Canada.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Bao, Z.-Z.,
B. G. Bruneau,
J. G. Seidman,
C. E. Seidman, and C. L. Cepko.
1999.
Irx4 regulates chamber-specific gene expression in the developing heart.
Science
283:1161-1164 |
| 2. | Bass, A., M. Stejskalova, B. Ostadal, and M. Samanek. 1993. Differences between atrial and ventricular energy-supplying enzymes in five mammalian species. Physiol. Res. 42:1-6[Medline]. |
| 3. | Bellefroid, E. J., A. Kobbe, P. Gruss, T. Pieler, J. B. Gurdon, and N. Papalopulu. 1998. Xiro3 encodes a Xenopus homolog of the Drosophila Iroquois genes and functions in neural specification. EMBO J. 17:191-203[CrossRef][Medline]. |
| 4. | Berul, C. I., M. E. Christe, M. J. Aronovitz, C. E. Seidman, J. G. Seidman, and M. E. Mendelsohn. 1997. Electrophysiological abnormalities and arrhythmias in alpha MHC mutant familial hypertrophic cardiomyopathy mice. J. Clin. Investig. 99:570-576[Medline]. |
| 5. |
Biben, C., and R. P. Harvey.
1997.
Homeodomain factor Nkx2-5 controls left/right asymmetric expression of bHLH gene eHand during murine heart development.
Genes Dev.
11:1357-1369 |
| 6. | Bosse, A., A. Stoykova, K. Nieselt-Struwe, K. Chowdhury, N. G. Copeland, N. A. Jenkins, and P. Gruss. 2000. Identification of a novel mouse Iroquois homeobox gene, Irx5, and chromosomal localization of all members of the mouse Iroquois gene family Dev. Dyn. 218:160-174[CrossRef][Medline]. |
| 7. | Bosse, A., A. Zulch, M.-B. Becker, M. Torres, J.-L. Gomez-Skarmeta, J. Modolell, and P. Gruss. 1997. Identification of the mammalian Iroquois gene family with overlapping expression during development of the early nervous system. Mech. Dev. 69:169-181[CrossRef][Medline]. |
| 8. | Briscoe, J., A. Pierani, T. M. Jessell, and J. Ericson. 2000. A homeodomain protein code specifies progenitor cell identity and neuronal fate in the ventral neural tube. Cell 101:435-445[CrossRef][Medline]. |
| 9. | Bruneau, B. G., Z. Z. Bao, M. Tanaka, J. J. Schott, S. Izumo, C. L. Cepko, J. G. Seidman, and C. E. Seidman. 2000. Cardiac expression of the ventricle-specific homeobox gene Irx4 is modulated by Nkx2-5 and dHand. Dev. Biol. 217:266-277[CrossRef][Medline]. |
| 10. | Bruneau, B. G., M. Logan, N. Davis, T. Levi, C. J. Tabin, J. G. Seidman, and C. E. Seidman. 1999. Chamber-specific cardiac expression of Tbx5 and heart defects in Holt-Oram syndrome. Dev. Biol. 211:100-108[CrossRef][Medline]. |
| 11. | Cavodeassi, F., R. Diez Del Corral, S. Campuzano, and M. Dominguez. 1999. Compartments and organising boundaries in the Drosophila eye: the role of the homeodomain Iroquois proteins. Development 126:4933-4942[Abstract]. |
| 12. | Chien, K. R., K. U. Knowlton, H. Zhu, and S. Chien. 1991. Regulation of cardiac gene expression during myocardial growth and hypertrophy: molecular studies of an adaptive physiologic response. FASEB J. 5:3037-3046[Abstract]. |
| 13. | Chien, K. R., H. Zhu, K. U. Knowlton, W. Miller-Hance, M. van-Bilsen, T. X. O'Brien, and S. M. Evans. 1993. Transcriptional regulation during cardiac growth and development. Annu. Rev. Physiol. 55:77-95[CrossRef][Medline]. |
| 14. | Christoffels, V. M., A. G. Keijser, A. C. Houweling, D. E. Clout, and A. F. Moorman. 2000. Patterning the embryonic heart: identification of five mouse Iroquois homeobox genes in the developing heart. Dev. Biol. 224:263-274[CrossRef][Medline]. |
| 15. | Cohen, D. R., C. W. Cheng, S. H. Cheng, and C. C. Hui. 2000. Expression of two novel mouse Iroquois homeobox genes during neurogenesis. Mech. Dev. 91:317-321[CrossRef][Medline]. |
| 16. |
Cubadda, Y.,
P. Heitzler,
R. P. Ray,
M. Bourouis,
P. Ramain,
W. Gelbart,
P. Simpson, and M. Haenlin.
1997.
u-shaped encodes a zinc finger protein that regulates the proneural genes achaete and scute during the formation of bristles in Drosophila.
Genes Dev.
11:3083-3095 |
| 17. | de Bold, A. J., and B. G. Bruneau. 2000. Natriuretic peptides, p. 377-409. In J. C. S. Fray (ed.), Handbook of physiology, vol. III. Oxford University Press, Oxford, United Kingdom. |
| 18. |
Diez del Corral, R.,
P. Aroca,
J.-L. Gomez-Skarmeta,
F. Cavodeassi, and J. Modolell.
1999.
The Iroquois homeodomain proteins are required to specify body wall identity in Drosophila.
Genes Dev.
13:1754-1761 |
| 19. | Dunwoodie, S. L., T. A. Rodriguez, and R. S. P. Beddington. 1998. Msg1 and mrg1, founding members of a gene family, show distinct patterns of gene expression during mouse embryogenesis. Mech. Dev. 72:27-40[CrossRef][Medline]. |
| 20. | Fewell, J. G., T. E. Hewett, A. Sanbe, R. Klevitsky, E. Hayes, D. Warshaw, D. Maughan, and J. Robbins. 1998. Functional significance of cardiac myosin essential light chain isoform switching in transgenic mice. J. Clin. Investig. 101:2630-2639[Medline]. |
| 21. | Firulli, A. B., D. G. McFadden, Q. Lin, D. Srivastava, and E. N. Olson. 1998. Heart and extra-embryonic mesodermal defects in mouse embryos lacking the bHLH transcription factor Hand1. Nat. Genet. 18:266-270[CrossRef][Medline]. |
| 22. | Fishman, M. C., and K. R. Chien. 1997. Fashioning the vertebrate heart: earliest embryonic decisions. Development 124:2099-2117[Abstract]. |
| 23. | Fishman, M. C., and E. N. Olson. 1997. Parsing the heart: genetic modules for organ assembly. Cell 91:153-156[CrossRef][Medline]. |
| 24. | Georgakopoulos, D., M. E. Christe, M. Giewat, C. M. Seidman, J. G. Seidman, and D. A. Kass. 1999. The pathogenesis of familial hypertrophic cardiomyopathy: early and evolving effects from an alpha-cardiac myosin heavy chain missense mutation. Nat. Med. 5:327-330[CrossRef][Medline]. |
| 25. | Gerber, W. V., T. A. Yatskievych, P. B. Antin, K. M. Correia, R. A. Conlon, and P. A. Krieg. 1999. The RNA-binding protein gene, hermes, is expressed at high levels in the developing heart. Mech. Dev. 80:77-86[CrossRef][Medline]. |
| 26. | Gomez-Skarmeta, J. L., R. D. del Corral, E. de la Calle-Mustienes, D. Ferre-Marco, and J. Modolell. 1996. Araucan and caupolican, two members of the novel iroquois complex, encode homeoproteins that control proneural and vein-forming genes. Cell 85:95-105[CrossRef][Medline]. |
| 27. | Gomez-Skarmeta, J. L., A. Glavic, E. de la Calle-Mustienes, J. Modolell, and R. Mayor. 1998. Xiro, a Xenopus homolog of the Drosophila Iroquois complex genes, controls development at the neural plate. EMBO J. 17:181-190[CrossRef][Medline]. |
| 28. |
Gottshall, K. R.,
J. J. Hunter,
N. Tanaka,
N. Dalton,
K. D. Becker,
J. Ross, Jr., and K. R. Chien.
1997.
Ras-dependent pathways induce obstructive hypertrophy in echo-selected transgenic mice.
Proc. Natl. Acad. Sci. USA
94:4710-4715 |
| 29. | Gruber, P. J., S. W. Kubalak, and K. R. Chien. 1998. Downregulation of atrial markers during cardiac chamber morphogenesis is irreversible in murine embryos. Development 125:4427-4438[Abstract]. |
| 30. |
Hendrickson, B. A.,
D. A. Conner,
D. J. Ladd,
D. Kendall,
J. E. Casanova,
B. Corthesy,
E. E. Max,
M. R. Neutra,
C. E. Seidman, and J. G. Seidman.
1995.
Altered hepatic transport of immunoglobulin A in mice lacking the J chain.
J. Exp. Med.
182:1905-1911 |
| 31. |
Hume, J. R., and A. Uehara.
1985.
Ionic basis of the different action potential configurations of single guinea-pig atrial and ventricular myocytes.
J. Physiol. (London)
368:525-544 |
| 32. | Kelly, R. G., P. S. Zammit, V. Mouly, G. Butler-Browne, and M. E. Buckingham. 1998. Dynamic left/right regionalisation of endogenous myosin light chain 3F transcripts in the developing mouse heart. J. Mol. Cell. Cardiol. 30:1067-1081[CrossRef][Medline]. |
| 33. |
Kubalak, S. W.,
W. C. Miller-Hance,
T. X. O'Brien,
E. Dyson, and K. R. Chien.
1994.
Chamber specification of atrial myosin light chain-2 expression precedes septation during murine cardiogenesis.
J. Biol. Chem.
269:16961-16970 |
| 34. | Lints, T. J., L. M. Parsons, L. Hartley, I. Lyons, and R. P. Harvey. 1993. Nkx-2.5: a novel murine homeobox gene expressed in early heart progenitor cells and their myogenic descendants. Development 119:419-431[Abstract]. |
| 35. |
Lyons, G. E.,
S. Schiaffino,
D. Sassoon,
P. Barton, and M. Buckingham.
1990.
Developmental regulation of myosin gene expression in mouse cardiac muscle.
J. Cell Biol.
111:2427-2436 |
| 36. | McConnell, B. K., K. A. Jones, D. Fatkin, L. H. Arroyo, R. T. Lee, O. Aristizabal, D. H. Turnbull, D. Georgakopoulos, D. Kass, M. Bond, H. Niimura, F. J. Schoen, D. Conner, D. A. Fischman, C. E. Seidman, and J. G. Seidman. 1999. Dilated cardiomyopathy in homozygous myosin-binding protein-C mutant mice J. Clin. Investig. 104:1235-1244[Medline]. |
| 37. |
McNutt, N. S., and D. W. Fawcett.
1969.
The ultrastructure of the cat myocardium. II. Atrial muscle.
J. Cell Biol.
42:46-66 |
| 38. |
O'Brien, T. X.,
K. J. Lee, and K. R. Chien.
1993.
Positional specification of ventricular myosin light chain 2 expression in the primitive murine heart tube.
Proc. Natl. Acad. Sci. USA
90:5157-5161 |
| 39. | Passner, J. M., H. D. Ryoo, L. Shen, R. S. Mann, and A. K. Aggarwal. 1999. Structure of a DNA-bound Ultrabithorax-Extradenticle homeodomain complex. Nature 397:714-719[CrossRef][Medline]. |
| 40. | Patwardhan, V., S. Fernandez, M. Montgomery, and J. Litvin. 2000. The rostro-caudal position of cardiac myocytes affect (sic) their fate. Dev. Dyn. 218:123-135[CrossRef][Medline]. |
| 41. |
Pawloski-Dahm, C. M.,
G. Song,
D. L. Kirkpatrick,
J. Palermo,
J. Gulick,
G. W. Dorn,
J. Robbins, and R. A. Walsh.
1998.
Effects of total replacement of atrial myosin light chain-2 with the ventricular isoform in atrial myocytes of transgenic mice.
Circulation
97:1508-1513 |
| 42. |
Pereira, F. A.,
Y. Qiu,
G. Zhou,
M. J. Tsai, and S. Y. Tsai.
1999.
The orphan nuclear receptor COUP-TFII is required for angiogenesis and heart development.
Genes Dev.
13:1037-1049 |
| 43. | Piper, D. E., A. H. Batchelor, C. P. Chang, M. L. Cleary, and C. Wolberger. 1999. Structure of a HoxB1-Pbx1 heterodimer bound to DNA: role of the hexapeptide and a fourth homeodomain helix in complex formation. Cell 96:587-597[CrossRef][Medline]. |
| 44. | Riddle, R. D., R. L. Johnson, E. Laufer, and C. Tabin. 1993. Sonic hedgehog mediates the polarizing activity of the ZPA. Cell 75:1401-1416[CrossRef][Medline]. |
| 45. | Riley, P., L. Anson-Cartwright, and J. C. Cross. 1998. The Hand1 bHLH transcription factor is essential for placentation and cardiac morphogenesis. Nat. Genet. 18:271-275[CrossRef][Medline]. |
| 46. | Riley, P. R., M. Gertenstein, K. Dawson, and J. C. Cross. 2000. Early exclusion of Hand1-deficient cells from distinct regions of the left ventricular myocardium in chimeric mouse embryos. Dev. Biol. 227:156-168[CrossRef][Medline]. |
| 47. |
Sanbe, A.,
J. Gulick,
E. Hayes,
D. Warshaw,
H. Osinska,
C. B. Chan,
R. Klevitsky, and J. Robbins.
2000.
Myosin light chain replacement in the heart.
Am. J. Physiol.
279:H1355-H1364 |
| 48. |
Seidman, C. E.,
D. W. Wong,
J. A. Jarcho,
K. D. Bloch, and J. G. Seidman.
1988.
Cis-acting sequences that modulate atrial natriuretic factor gene expression.
Proc. Natl. Acad. Sci. USA
85:4104-4108 |
| 49. | Srivastava, D., T. Thomas, Q. Lin, M. L. Kirby, D. Brown, and E. N. Olson. 1997. Regulation of cardiac mesodermal and neural crest development by the bHLH transcription factor, dHAND. Nat. Genet. 16:154-160[CrossRef][Medline]. |
| 50. | Tanaka, M., Z. Chen, M. Bartunkova, N. Yamazaki, and S. Izumo. 1999. The cardiac homeobox gene Csx/Nkx2.5 lies genetically upstream of multiple genes essential for heart development. Development 126:1269-1280[Abstract]. |
| 51. |
Tevosian, S. G.,
A. E. Deconinck,
A. B. Cantor,
H. I. Rieff,
Y. Fujiwara,
G. Corfas, and S. H. Orkin.
1999.
FOG-2: a novel GATA-family cofactor related to multitype zinc-finger proteins Friend of GATA-1 and U-shaped.
Proc. Natl. Acad. Sci. USA
96:950-955 |
| 52. | Tevosian, S. G., A. E. Deconinck, M. Tanaka, M. Schinke, S. H. Litovsky, S. Izumo, Y. Fujiwara, and S. H. Orkin. 2000. FOG-2, a cofactor for GATA transcription factors, is essential for heart morphogenesis and development of coronary vessels from epicardium. Cell 101:729-739[CrossRef][Medline]. |
| 53. |
Wang, G. F.,
W. Nikovits, Jr.,
M. Schleinitz, and F. E. Stockdale.
1998.
A positive GATA element and a negative vitamin D receptor-like element control atrial chamber-specific expression of slow myosin heavy-chain gene during cardiac morphogenesis.
Mol. Cell. Biol.
18:6023-6034 |
| 54. | Xavier-Neto, J., C. M. Neville, M. D. Shapiro, L. Houghton, G. F. Wang, W. Nikovits, F. E. Stockdale, and N. Rosenthal. 1999. A retinoic acid-inducible transgenic marker of sino-atrial development in the mouse heart. Development 126:2677-2687[Abstract]. |
| 55. | Yutzey, K., M. Gannon, and D. Bader. 1995. Diversification of cardiomyogenic cell lineages in vitro. Dev. Biol. 170:531-541[CrossRef][Medline]. |
| 56. | Yutzey, K. E., J. T. Rhee, and D. Bader. 1994. Expression of the atrial-specific myosin heavy chain AMHC1 and the establishment of anteroposterior polarity in the developing chicken heart. Development 120:871-883[Abstract]. |
| 57. |
Zeller, R.,
K. D. Bloch,
B. S. Williams,
R. J. Arceci, and C. E. Seidman.
1987.
Localized expression of the atrial natriuretic factor gene during cardiac embryogenesis.
Genes Dev.
1:693-698 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»