This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, Q.
Right arrow Articles by Greider, C. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Q.
Right arrow Articles by Greider, C. W.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, March 2001, p. 1819-1827, Vol. 21, No. 5
0270-7306/01/$04.00+0   DOI: 10.1128/MCB.21.5.1819-1827.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Two Survivor Pathways That Allow Growth in the Absence of Telomerase Are Generated by Distinct Telomere Recombination Events

Qijun Chen, Arne Ijpma, and Carol W. Greider*

Department of Molecular Biology and Genetics, Graduate Program in Cell and Molecular Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205

Received 25 July 2000/Returned for modification 20 September 2000/Accepted 30 November 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Yeast cells can survive in the absence of telomerase RNA, TLC1, by recombination-mediated telomere elongation. Two types of survivors, type I and type II, can be distinguished by their characteristic telomere patterns. RAD52 is essential for the generation of both types of survivors. Deletion of both RAD50 and RAD51 produces a phenotype similar to that produced by deletion of RAD52. Here we examined the effects of the RAD50 and the RAD51 epistasis groups as well as the RAD52 homologue, RAD59, on the types of survivors generated in the absence of telomerase. rad59 mutations completely abolished the ability to generate type II survivors, while rad50 mutations decreased the growth viability of type II survivors but did not completely eliminate their appearance. Mutations in RAD51, RAD54, and RAD57 had the converse affect: they eliminated the ability of cells to generate type I survivors in a tlc1 strain. The triple mutant, tlc1 rad51 rad59, was not able to generate survivors. Thus either type I or type II recombination pathways can allow cells to survive in the absence of telomerase; however, elimination of both pathways in a telomerase mutant leads to the inability to elongate telomeres and ultimately cell death.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Telomere integrity is essential for stable chromosome transmission and for cell viability. In Saccharomyces cerevisiae, telomeres contain a characteristic pattern of repeated sequences. The most terminal telomere sequences consist of an irregular repeat of TG1-3 sequences (25). Just internal to the TG1-3 repeats, there are more complex telomere-associated repeats, termed Y' elements and X elements. All yeast telomeres have one X element, whereas Y' elements are found only at some telomeres (3). Y' elements are often found in multiple copies, and in some cases there are TG1-3 repeats between adjacent Y' elements (3). Two classes of Y' elements have been defined, Y'-long and Y'-short, which are 6.7 and 5.2 kb in length, respectively (17, 18).

Telomere function depends on a number of specific proteins that bind to the terminal TG1-3 repeats (reviewed in reference 6). In wild-type yeast cells, the overall length of the TG1-3 sequence is maintained at an equilibrium of around 300 bp, by activities that remove and those that add TG1-3 telomeric repeat sequences. Telomere repeats are added by the enzyme telomerase (8), which contains an essential RNA component (TLC1) (27) and a catalytic protein component (EST2) (16). In the absence of telomerase, telomeres shorten progressively due to incomplete end replication and possibly also specific nuclease activity, and after a lag of about 60 cell divisions, the growth potential of the culture decreases (19, 21, 27). This suggests that after a certain number of TG1-3 repeats have been lost from yeast chromosomes, telomere function is lost.

Although telomerase is the major pathway for telomere elongation, in the absence of telomerase, recombination can efficiently elongate telomeres and lead to the survival of a population of cells (19). In a tlc1 culture, there is a progressive decline in the fraction of growing cells to less than 1%, followed by the selection for a small population of cells that maintains telomeres via a recombination-mediated pathway (19). If the major recombination gene, RAD52, is deleted, these "survivor" cells are not generated. Thus, telomere elongation in the survivors is thought to occur via a recombinational mechanism (19).

Break-induced replication (BIR) is a gene conversion mechanism that can allow telomere healing. A centromere-proximal double-stranded break can be healed by the broken end invading a homologous region on another chromosome (20, 23). A replication fork can be established, and the entire chromosome arm can be copied, resulting in the duplication of a large portion of the chromosome arm (12). The mechanism proposed for the generation of survivors in the absence of telomerase is similar to the mechanism proposed for BIR (5, 19, 29).

Two apparently distinct types of telomere elongation events can occur via recombination in the absence of telomerase (19, 29). The two types of survivors can be distinguished on a Southern blot by the characteristic telomere bands that appear. Type I survivors show amplification of the telomere-associated Y' elements and have very short TG1-3 repeat tracts on the ends. Type II survivors show a variable pattern of long tracts of TG1-3 repeats and only modest Y' amplification (29). In a tlc1 mutant, there is a distribution of the two survivor types. The exact percentage of each type is strain dependent (19, 29). Type II survivors grow faster than type I survivors. Thus, if a continuous liquid culture is grown, only type II will be seen at the end of a long growth period. To determine the distribution of survivor types, single colonies from plates where there was no growth competition must be assayed (29).

Two independent pathways defined by RAD50 and RAD51 are both capable of generating survivors (15). The RAD51 pathway involves RAD51, RAD54, and RAD57 (15). These genes are known to interact with each other genetically, and the protein products interact physically (11). The RAD50 pathway involves RAD50, XRS2, and MRE11. The protein products from these genes interact to form a complex that participates in both homologous recombination and DNA end-joining pathways (reviewed in reference 10). Deletion of either RAD50 or RAD51 alone does not abolish the ability of yeast cells to generate survivors. However, deletion of RAD50 and RAD51 prevents the generation of survivors in the absence of telomerase (15).

To explore these two recombination pathways in more detail, we examined the role of RAD59 in the generation of survivors. RAD59 was identified as a gene that when mutated decreased recombination in a rad51 background (1). RAD59 has homology to RAD52, and overexpression of RAD52 will rescue a RAD59 mutant but not vise versa. Deletion of RAD59 has little effect on its own in most recombination assays; however, in a rad51 background, rad59 significantly decreases spontaneous intrachromosomal recombination (1). This synergistic effect of the two mutations suggests that rad59 plays a role in a recombination pathway separate from the rad51 pathway. In other assays, however, such as HO cleavage-induced recombination, there is little synergy between the rad59 and rad51 mutations (28).

To investigate the role of RAD59 and the RAD50 and RAD51 epistasis groups in telomere maintenance, we combined mutations in the telomerase RNA, TLC1, with single and double mutations in these pathways. The tlc1 rad50 and tlc1 rad59 mutants generated predominantly type I survivors, while the tlc1 rad51, tlc1 rad54, and tlc1 rad57 mutants generated only type II survivors. This suggests that the two genetic pathways, which we previously defined, can be distinguished by their different physical effects at telomeres. Both RAD50 and RAD59 play a role in a RAD51-independent survivor pathway. Recent experiments that demonstrate a RAD51-independent BIR pathway involving RAD59 and the RAD50-MRE11-XRS2 complex suggested that BIR may be the mechanism that allows the generation of survivors in the absence of telomerase (L. Signon, A. Malkova, M. Naylor, H. Klein, and J. E. Haber, unpublished data).


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Yeast strains and plasmid constructs. All yeast strains used in this study are summarized in Table 1. The isogenic strains with mutations in several RAD genes and TLC1 gene have been described previously (22). Strains JHUY564 and JHUY563 (tlc1::URA3/TLC1 rad50::hisG'/RAD50 rad59::kanMX4/RAD59 and tlc1::URA3/TLC1 rad51::LEU2/RAD51 rad59::kanMX4/RAD59, respectively) were constructed by PCR-mediated gene disruption (2) of the RAD59 gene in strains CSHY92 and CSHY91, respectively. The rad59::kanMX4 deletion fragment was PCR amplified from pRS400 (2) with oligonucleotides AY23F (5'AGTTTAGCACATGCTTTGGACCATTAAAGGGTTACGTAGAGATTGTACTGAGAGTGCAC 3') and AY24R (5'ATCAACGATACTGTTGATAAAGGTAAGTCGATACCTGTTCTGTGCGGTATTTCACACCG 3'). The yeast strains CSHY91 and CSHY92 were transformed using the lithium acetate method (24). The rad59 deletions were confirmed by Southern blot analysis. The genomic DNA was digested with BstEII and probed with a DNA sequence produced by PCR using the oligonucleotides AY25F (5' CATACCATTCCAAGGTAA 3') and AY26R (5' TAGCAGGCGACGAAGAAT 3') by random hexamer primed DNA synthesis with the Klenow fragment in the presence of 32P-labeled dATP and dGTP (7). Deletion of RAD59, TLC1, and RAD50 in all diploid strains was confirmed by Southern blot analysis. The pRAD59 plasmid was constructed by cloning the 1.2-kb ScaI-BglII fragment of the RAD59 gene (1) by PCR amplification with oligonucleotides QC22F (5'CGGGATCCCGGCATCACCCATAATTG) and QC23R (5'GCTCTAGAGCCCATGCCTTCGTTACC). The resulting fragment was cloned into the vector pRS315 (26) to make pRAD59. The full 1.2-kb ScaI-BglII DNA fragment was sequenced to verify its accuracy. To generate the appropriate haploid strains for the cell density assay, triple- or double-mutant diploid cells were sporulated, tetrads were dissected, and spore clones were tested for the appropriate markers or by Southern blot analysis.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Yeast strains used in this study

Cell viability assay. Cells of the appropriate genotype were picked up from a fresh dissecting plate and grown in yeast extract-peptone-dextrose (YPD) medium to saturation (1 × 108 to 2 × 108 cells/ml). Every 24 h the cell density was measured by counting cells in a hemocytometer, and then the culture was diluted with fresh YPD liquid medium to a density of 105 cells/ml (15, 27). This cycle was repeated for 10 to 16 days. At various time points during growth, cells were plated to examine for possible contamination and some samples were collected and frozen for telomere length analysis.

Single-colony streak assay. Cells of the appropriate genotype were picked from a fresh dissecting plate and streaked onto a YPD plate. After incubation for 48 h at 30°C, single colonies were picked and restreaked on a YPD plate. This restreaking was repeated four times to allow loss of viability and appearance of survivors. Generation of survivors typically occurred after 3 to 4 days at 30°C. Single colonies from streak 5 were grown in YPD medium overnight, and cells were pelleted for the telomere length assay.

Telomere Southern blots. Southern blot analysis was performed for examination of telomere length. Yeast genomic DNA was isolated, and ~4 µg of DNA was digested with XhoI and separated on a 1% agarose gel. DNA was then transferred to a HybondN+ (Amersham, Piscataway, N.J.) membrane and UV cross-linked. The membrane was then hybridized with a random primed telomeric poly(d[GT/CA]) (Pharmacia, Piscataway, N.J.), and hybridization was detected with an ECL direct nucleotide labeling kit (Amersham).


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

RAD59 is required to generate survivors in a rad51 background. RAD59 defines a RAD51-independent recombination pathway (1). To examine how RAD59 affects the two previously defined telomere maintenance pathways involving RAD51 and RAD50, we compared the viabilities and telomere lengths of a set of isogenic mutants, including the tlc1, rad59, tlc1 rad59, tlc1 rad51 rad59, and tlc1 rad50 rad59 mutants. The growth of these cells and the ability to generate survivors were compared to growth and survivor generation of the wild-type, tlc1 rad52, and tlc1 rad50 rad51 cells. Cell viability was measured by diluting liquid cultures to 105 cells/ml, allowing them to grow for 24 h, and then measuring the cell density. While wild-type cells reach a density of 108 cells/ml in 24 h, mutant cells that have a loss of viability or a decreased growth rate will reach lower cell densities (15, 27). The ability to generate survivors was defined as the ability of the culture to recover after reaching a minimum growth rate after about 6 days in culture. The tlc1 rad59 double mutant showed a decline in its growth rate similar to that of the single tlc1 mutant, and survivors were generated. In contrast, the tlc1 rad51 rad59 triple mutant showed an accelerated decline in growth similar to the accelerated rate of decline seen in tlc1 rad52 (Fig. 1) (15, 19). As with the tlc1 rad52 and tlc1 rad50 rad51 mutants, no survivors were generated in the tlc1 rad51 rad59 mutant culture. These results indicate that RAD59 plays a role in generation of survivors and that RAD59 and RAD51 are in separate pathways for the generation of survivors in the absence of telomerase.


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 1.   RAD59 is required to generate survivors in a rad51 background. Cells were grown to saturation in YPD medium and then diluted to 105 cells/ml every 24 h with fresh YPD medium. Cells were counted every 24 h with a hemocytometer. The curves shown are the average of results for four independent clones from each genotype.

To determine whether the accelerated decline in the growth rate for the tlc1 rad51 rad59 mutant resulted from a more rapid telomere shortening, we examined telomere lengths in three mutants, tlc1, tlc1 rad52, and tlc1 rad51 rad59. There was no evidence for a more rapid telomere shortening in the tlc1 rad51 rad59 or tlc1 rad52 mutants than in the tlc1 mutant in the first 3 days of culturing (Fig. 2). Thus the accelerated decline in the growth rate of tlc1 rad51 rad59 mutants is not due to a faster decrease in telomere length.


View larger version (51K):
[in this window]
[in a new window]
 
FIG. 2.   The tlc1 rad51 rad59 mutant does not show a higher rate of telomere shortening. tlc1, tlc1 rad52, and tlc1 rad51 rad59 cells were grown for five successive days in liquid culture, and telomere length was determined on Southern blots for the first 3 days. The tlc1 rad52 and tlc1 rad51 rad59 mutants reached a minimum growth rate at day 4. Solid arrows indicate X telomeres and the open arrow indicates Y' telomeres in the wild-type strain.

In contrast to results for the tlc1 rad51 rad59 triple mutant, the tlc1 rad50 rad59 triple mutant did generate survivors (Fig. 1). However, the recovery for the tlc1 rad50 rad59 triple mutant was slower than that for tlc1. This slow recovery is similar to the slow recovery of tlc1 rad50 mutants (15) and may be due to the low growth rate of rad50 mutants (14). The ability of the tlc1 rad50 rad59 mutants to generate survivors as do the tlc1 rad50 and tlc1 rad59 mutants suggests that RAD50 and RAD59 are in the same pathway for telomere maintenance in the absence of telomerase. The failure of tlc1 rad51 rad59 to generate survivors supports the conclusion that RAD59 and RAD51 are in different pathways.

tlc1 rad59 mutants generate only type I survivors. In the absence of telomerase, at least two distinct types of survivors are generated (19, 29). Type I and type II survivors can be distinguished by the pattern of telomere restriction fragments on Southern blots. The telomere bands in type II survivors have long tracts of telomeric TG1-3 sequence and some amplification of Y' elements (Fig. 3) (29). In these survivors, the multiple distinct telomere bands between 1 and 6 kb represent individual chromosomes with different lengths of TG1-3 repeats. The major XhoI band near 1 kb, representing telomeres containing Y' elements, is no longer prominent, since these short telomeres are all elongated. In contrast, type I survivors have a short XhoI band just below 1 kb, lack telomere bands between 1 and 6 kb, and show strong amplification of the 5.2- and 6.7-kb Y' elements. Since type II survivors have a growth advantage over type I survivors, type II survivors are expected to predominate when cells are grown in liquid culture (29). Consistent with this, the Southern analysis of tlc1 survivors grown in liquid culture showed type II survivors. In contrast, the liquid cultures of tlc1 rad59 mutants showed only type I survivors (Fig. 3). Thus the absence of RAD59 inhibits type II survivor formation.


View larger version (78K):
[in this window]
[in a new window]
 
FIG. 3.   tlc1 rad59 double mutants generate only type I survivors. Southern blots of tlc1 and tlc1 rad59 mutants are shown. The numbers at the top of the lane represent the number of days that cells were grown in liquid culture. The letter S at the top of the lanes represents survivor cells that were streaked out at least two times after survivors were generated. The numbers on the side indicate the DNA molecular size markers in kilobases. The survivor type is indicated below each lane as type I or type II. Solid arrows indicate X telomeres and open arrows indicate Y' telomeres in the wild-type strain. (A) tlc1 mutants were grown in liquid culture, and telomeres were measured on Southern blots at days 1 and 4, before the generation of survivors (lanes 1 and 2). At days 9, 10, and 15, type II survivors were apparent (lanes 3 to 5). Wild-type telomeres are shown for comparison in lane 6. (B) The telomere patterns of tlc1 rad59 double mutants are shown before the generation of survivors at days 1, 4, and 9 (lanes 2 to 4) and after type I survivors were generated at days 13, 17, and 21 (lanes 5 to 7). (C) The single-colony assay was used for tlc1 rad59 cells. Wild-type cells (lane 1), a presurvivor colony at the second streak-out (lane 2), and four independent type I tlc1 rad59 survivor colonies are shown.

Growth in liquid culture for many population doublings provides a strong selection for the fastest-growing cells. Thus we used a single-colony assay to determine the distribution of survivor types in mutant strains. We plated for single colonies and assayed for type I or type II telomere length patterns on Southern blots. The tlc1 and tlc1 rad59 cells were each streaked five successive times on YPD plates until survivors were generated (approximately 125 cell divisions). Single colonies were then inoculated into liquid culture for overnight growth, and genomic DNA was isolated. Of 39 single tlc1 colonies assayed, 24 (62%) showed a type I pattern and 15 (38%) showed a type II telomere pattern (Table 2 and Fig. 5A). This ratio of type I to type II is similar to that found in other strain backgrounds (19, 29). In contrast, of the 22 tlc1 rad59 single colonies analyzed, all 22 showed type I survivors (Table 2 and Fig. 3C). This result further supports the conclusion that RAD59 is required for the formation of type II survivors.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Distribution of survivor types

tlc1 rad50 mutants have a reduced percentage of type II survivors. The specific requirement for RAD59 for the generation of type II survivors suggested that the two different survivor pathways defined by the RAD50 and RAD51 epistasis groups might independently affect the two survivor types. We thus assayed whether deletion of genes in these groups would also affect the distribution of survivor types. In a liquid culture assay, the cell density of the tlc1 rad50 double mutant declined continuously until survivors were generated, and then the cell density increased (data not shown) (15). Telomere length in the tlc1 rad50 double mutant shortened progressively, and in two of three independent experiments only type I survivors were found. In the third experiment, type II survivors were detected at day 10, but they were no longer present at days 15, 19, and 23 (Fig. 4). The cell growth rate from day 10 to 23 was similar to that of wild-type cells (data not shown). This suggested that type II survivors were initially formed but that they were not maintained during continued growth.


View larger version (72K):
[in this window]
[in a new window]
 
FIG. 4.   Type II survivors that are generated in tlc1 rad50 cells are not maintained during continuous culturing. tlc1 cells were cultured for 15 days, and telomeres were examined at days 1, 4, 9, 10, and 15 (lanes 1 to 5). Type II survivors were detected at days 9, 10, and 15 (lanes 3 to 5). tlc1 rad50 cells were grown for 23 days, and telomeres were examined at days 1, 4, 10, 15, 19, and 23 (lanes 8 to 12). Type II survivors were detected at day 10 but not at days 15, 19, and 23. The survivor type is indicated below each lane as type I or type II.

The instability of type II survivors in tlc1 rad50 cells was also seen in single-colony assays. In the first streak after survivor generation, 2 of 20 individual tlc1 rad50 survivor colonies assayed showed the type II pattern (Table 2). However, after streaking an additional three times, only type I survivors were detected (data not shown). This is consistent with the appearance of type II survivors in tlc1 rad50 mutants seen in earlier work (15) when cells were assayed soon after survivor generation. These data suggest that type II survivors are generated at a low frequency in tlc1 rad50 mutants but cannot be maintained during subsequent growth. Thus RAD50 facilitates the formation and maintenance of type II survivors.

tlc1 rad51, tlc1 rad54, and tlc1 rad57 mutants generate only type II survivors. RAD51 defines a pathway that includes RAD54 and RAD57 and is separate from the RAD50 pathway that is able to maintain telomere length in the absence of telomerase (15). We used Southern analysis to determine the type of survivors that are formed in tlc1 rad51, tlc1 rad54, and tlc1 rad57 double-mutant cells. In liquid culture, all survivors showed a type II pattern (15) (data not shown). Since type II survivors have a growth advantage and will take over a liquid culture, we assayed single colonies to examine the distribution of survivor types. tlc1 rad51, tlc1 rad54, and tlc1 rad57 double mutants were streaked five times on YPD plates to allow the generation of survivors, and single colonies were examined by Southern blot analysis. Each of the double mutants tlc1 rad51, tlc1 rad54, and tlc1 rad57 generated only type II survivor clones (Table 2 and Fig. 5B, C, and D). This differs significantly from the tlc1 single-mutant survivors in the same genetic background, where only 38% of the survivors were type II (Table 2 and Fig. 5A). Thus RAD51, RAD54, and RAD57 are required for the formation of type I survivors in the absence of telomerase.


View larger version (83K):
[in this window]
[in a new window]
 
FIG. 5.   tlc1 rad51 mutants generate only type II survivors in the single-colony assay. tlc1 and tlc1 rad51 cells were streaked out repeatedly until survivors were generated (see Material and Methods). DNA samples from either presenescence cells (streak 2) or survivor cells (S) were used for telomere length pattern analysis. (A) For tlc1, both type I (lanes 3 to 5) and type II (lanes 2 and 6) survivors were detected. (B) For tlc1 rad51, of four independent survivors, all were type II (lanes 3 to 6). (C) For tlc1 rad54, of four independent survivors, all were type II (lanes 3 to 6). (D) For tlc1 rad57, of four independent survivors, all were type II (lanes 3 to 6). The survivor type is indicated below each lane. Solid arrows indicate X telomeres and open arrows indicate Y' telomeres in the wild-type strain.

Reintroduction of the RAD59 gene into late tlc1 rad59 survivors does not reestablish a wild-type distribution of type I and type II survivors. To examine the role that RAD59 might play in the generation of type II survivors, we tested whether reintroduction of the wild-type gene at three different points during survivor generation would rescue the ability to generate type II survivors (Fig. 6A). A plasmid containing RAD59 was transformed into a diploid heterozygous for tlc1 and rad59. The diploid was sporulated, and haploid spore clones were selected. tlc1 rad59 spore clones without the pRAD59 plasmid generated only type I survivors in liquid culture (Fig. 6B). However, tlc1 rad59 spore clones with the pRAD59 plasmid generated type II survivors, showing that the plasmid can complement the loss of rad59 from the genome (Fig. 6B) (see Materials and Methods). As an independent control, we tested the methyl methanesulfonate (MMS) sensitivity of the spore clones. The cells without pRAD59 were sensitive to MMS, but the cells with pRAD59 were not (data not shown). We next tested whether transformation of the pRAD59 plasmid into tlc1 rad59 cells just before or just after survivors were generated would affect the distribution of survivor types. Transformation into a culture that had undergone approximately 60 cell divisions (before survivors were generated) restored the ability to generate type II survivors in 10 of the 18 transformants examined. The remaining 8 transformants showed the type I pattern (Fig. 6C and data not shown). Transformation of a control vector plasmid generated only type I survivors, indicating that the transformation itself did not restore type II survivors. Strikingly, transformation of the pRAD59 plasmid into cells that were initially grown for 130 cell divisions (after survivors were generated) did not restore the appearance of type II survivors (Fig. 6D). Telomeres were examined for five independent transformants at days 1, 2, 3, and 4 during growth of the culture, and an additional seven transformants were assayed at day 4 only. None of these transformants showed type II survivors (Fig. 6d and data not shown). Thus the restoration of RAD59 function after the establishment of type I survivors does not allow conversion to type II despite the type II survivor growth advantage.


View larger version (79K):
[in this window]
[in a new window]
 
FIG. 6.   Reintroduction of the RAD59 gene into late-generation tlc1 rad59 survivor cultures does not reestablish a wild-type distribution of survivor types. (A) The pRAD59 plasmid was transformed into tlc1 rad59 cells at various times during the generation of survivor cells as indicated. (B) tlc1 rad59 spore clones that did not contain the pRAD59 plasmid (lanes 2 to 6) and those that did (lanes 7 to 11) were analyzed after 12 days of growth in liquid culture. Two additional spore clones containing the pRAD59 plasmid were also analyzed at day 12. (C) pRAD59 was transformed into tlc1 rad59 cells at generation ~60, and independent transformants were examined for their survivor type distribution by Southern blot analysis. Two independent transformants containing pRAD59 (lanes 2 to 4 and 5 to 7) were examined at days 1, 5, and 8. Control cells transformed with the pRS315 vector only are shown in lane 8. Additional independent transformants containing the pRAD59 plasmid were assayed at day 8 (lanes 9 to 13) or day 11 (lane 14). (D) pRAD59 or the vector pRS315 was transformed into tlc1 rad59 cells at generation ~130 (see Material and Methods), and independent transformants were cultured for 4 days to test survivor types. Two transformants containing pRAD59 (lanes 2 to 5 and 6 to 9) and one with the pRS315 vector (lanes 10 to 13) were assayed for telomere pattern. Additional independent colonies containing pRAD59 (lanes 15 to 18) or vector (lane 19) at day 4 were assayed. Numbers on the side are molecular size markers in kilobases. Lanes marked wt contain wild-type DNA as a control. Plas, plasmid.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Two types of survivors are generated via recombination-mediated telomere elongation in the absence of telomerase. Specific genes mediate the pathways that allow generation of the survivors; the RAD51, RAD54, and RAD57 genes are involved in the generation of type I survivors, and both RAD59 and RAD50 mediate the generation of type II survivors (Fig. 7). When both survivor generation pathways are eliminated, as in the tlc1 rad50 rad51 mutants or the tlc1 rad51 rad59 mutants, no survivors are generated.


View larger version (36K):
[in this window]
[in a new window]
 
FIG. 7.   Two types of survivors are generated by two distinct genetic pathways. A telomere containing two tandem Y' elements (large gray boxes) separated by TG1-3 repeats (small white boxes) is represented at the top. Telomere shortening occurs in the absence of telomerase. Survivors can be generated via two different mechanisms. (A) The RAD51-, RAD54-, and RAD57-dependent pathway generates type I survivors. Telomere shortening continues into the Y' element, exposing single-stranded 3' overhangs. The single-stranded DNA invades a homologous region in the Y' element on some other telomere, and BIR allows duplication of the intact telomere onto the telomere which had lost the TG1-3 repeats. The telomere that is copied is shown in light gray for clarity, to reveal the 3' end elongation of the invading strand. This kind of recombination event could also occur at X sequences on telomeres that do not contain Y' elements (see the text). (B) Telomere shortening results in recombination before all of the telomere repeats are lost from the ends. RAD50 and RAD59 allow recombination in the irregular TG1-3 repeats to occur efficiently. Alternatively, the telomeric TG1-3 tracts self-prime DNA replication and allow extension of the telomere sequences with a rolling-circle-type mechanism.

RAD51, sequence identity-dependent strand annealing, and type I survivors. Type I survivors involve the amplification of the telomere-adjacent Y' elements and require the presence of RAD51. These survivors may arise via continued resecting of the telomere in the absence of telomerase until the Y' elements are at the molecular terminus. Recombination is then initiated within the Y' elements. If the recombination occurs with an internal Y' element on a chromosome that has tandem Y' elements, amplification of Y's will occur (Fig. 7A). Alternatively, on chromosomes that have only X elements, resectioning into the X sequences may allow recombination with other X elements. This could lead to all chromosomes picking up Y's, since many chromosomes have both X and Y' elements. This would explain the apparent disappearance of the X-containing bands between 1 and 6 kb in the type I survivors. The requirements for RAD51 for type I survivors may be due to the fact that recombination in the Y's requires a high level of sequence identity. RAD51 mediates strand invasion during recombination, and it is very sensitive to the mismatches in the homologous region (4). Y' elements are very well conserved in sequence, showing only 1% sequence divergence (17), while TG1-3 telomere repeats are much more irregular in sequence. Thus, RAD51 may be able to mediate the recombination between Y's but not be able to mediate the recombination that occurs between the less identical TG1-3 tracts. In the absence of RAD51, the recombination events between Y' elements cannot be carried out.

RAD59 and the establishment of type II survivors. RAD59 is involved in a RAD51-independent mitotic recombination pathway mediating recombination between intrachromosomal inverted repeats (1). Consistent with this, we found that RAD59 plays a role in a RAD51-independent pathway in the generation of tlc1 survivors. In the absence of RAD59, all survivors were type I, indicating that RAD59 promotes the generation of type II survivors. These survivors likely arise via a recombination mechanism that is initiated within the TG1-3 repeats themselves. This recombination event could be initiated through either an interchromosomal invasion and copying of the TG1-3 repeats or perhaps intrachromosomal copying of a telomere that is looped back on itself (Fig. 7B). There is evidence that mammalian telomeres form t-loops, in which the telomere sequences are looped back on themselves and the 3' G-rich overhang is base paired with a duplex region of repeats forming a D-loop (9). A D-loop resembles half of a replication fork and may be able to prime DNA polymerization. Perhaps such a structure would become deregulated upon telomere shortening and serve as the substrate for the generation of type II survivors (Fig. 7B).

RAD50 is required for maintenance of type II survivors. rad50 mutants can initially generate type II survivors at a low rate, but these survivors are not maintained over time (Table 2 and Fig. 3) (15). Recently it was found that Rad50 protein is bound to human telomeres, and it was proposed that Rad50 is involved in the establishment of the t-loop structure (30). The initial appearance and subsequent loss of type II survivors in tlc1 rad50 mutants is consistent with rad50 playing a role in the efficient establishment of t-loops. If t-loops form in rad50 cells but at a lower rate than usual, those cells that were able to establish t-loops could initially generate type II survivors via priming from the 3' end in the t-loop. However, in the absence of telomerase, there is strong pressure to maintain telomere length since many cells in the culture stop dividing when telomeres become short; perhaps the impaired t-loop formation in rad50 mutants cannot keep up. Thus the type I survivors in the culture are able to take over and become the dominant survivor type.

Break-induced replication and survivors arise through a similar mechanism. The mechanisms outlined in Fig. 7 by which survivors are generated in the absence of telomerase may be similar to BIR. BIR is one mechanism by which a double strand break can be healed. If there is sequence homology on one side of a break and not on the other, the homologous region can invade, pair with, and copy an entire chromosome arm (20). The mechanisms proposed for the generation of survivors (5) (reviewed in references 13, 19, and 29) are very similar to that proposed for BIR. Recent experiments indicate that the genetic requirements for BIR are similar to those for survivor generation. There is a RAD51-independent BIR pathway involving RAD59 and the RAD50-MRE11-XRS2 complex (Signon et al., unpublished data). rad51 or rad50 single mutants do not eliminate BIR, but rad51 rad50 double mutants dramatically reduce BIR. Similarly, rad59 single mutants have little effect on BIR, yet rad51 rad59 double mutants reduce BIR significantly. These genetic requirements could reflect the two mechanisms outlined in Fig. 7 for the two genetic pathways that allow generation of survivors.


    ACKNOWLEDGMENTS

This work was supported by a grant from the NIH, GM43080, to C.W.G.

We thank Anna Malkova for testing MMS sensitivity. We thank Siyuan Le, Jennifer Hackett, and Kay Keyer-Opperman for critical reading of the manuscript. We thank James Haber for sharing data before publication and for helpful discussions.


    ADDENDUM IN PROOF

While this paper was under review, Teng et al. published a paper that also showed a requirement for RAD50 for type II survivors (S. Teng, J. Chang, B. McCowan, and V. A. Zakian, Mol. Cell 6:947-952, 2000).


    FOOTNOTES

* Corresponding author. Mailing address: Department of Molecular Biology and Genetics, Johns Hopkins University School of Medicine, 617 Hunterian, 725 N. Wolfe St., Baltimore, MD 21205. Phone: (410) 614-6506. Fax: (410) 614-2987. E-mail: cgreider{at}jhmi.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Bai, Y., and L. S. Symington. 1996. A Rad52 homologue is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae. Genes Dev. 10:2025-2037[Abstract/Free Full Text].
2. Brachmann, C. B., A. Davies, G. J. Cost, E. Caputo, J. Li, P. Hieter, and J. D. Boeke. 1998. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14:115-132[CrossRef][Medline].
3. Chan, C. S. M., and B. Tye. 1983. Organization of DNA sequences and replication origins at yeast telomeres. Cell 33:563-573[CrossRef][Medline].
4. Chen, W., and S. Jinks-Robertson. 1999. The role of the mismatch repair machinery in regulating mitotic and meiotic recombination between diverged sequences in yeast. Genetics 151:1299-1313[Abstract/Free Full Text].
5. Dunn, B., P. Szauter, M. L. Pardue, and J. W. Szostak. 1985. Transfer of yeast telomeres to linear plasmids by recombination. Cell 39:191-201.
6. Fang, G., and T. R. Cech. 1995. Telomere proteins, p. 69-105. In E. H. Blackburn, and C. W. Greider (ed.), Telomeres. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
7. Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13[CrossRef][Medline].
8. Greider, C. W., and E. H. Blackburn. 1985. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 43:405-413[CrossRef][Medline].
9. Griffith, J. D., L. Comeau, S. Rosenfield, R. M. Stansel, A. Bianchi, H. Moss, and T. de Lange. 1999. Mammalian telomeres end in a large duplex loop. Cell 97:503-514[CrossRef][Medline].
10. Haber, J. E. 1998. The many interfaces of Mre11. Cell 95:583-586[CrossRef][Medline].
11. Hays, S. L., A. A. Firmenich, and P. Berg. 1995. Complex formation in yeast double-strand break repair: participation of Rad51, Rad52, Rad55, and Rad57 proteins. Proc. Natl. Acad. Sci. USA 92:6925-6929[Abstract/Free Full Text].
12. Holmes, A. M., and J. E. Haber. 1999. Double-strand break repair in yeast requires both leading and lagging strand DNA polymerases. Cell 96:415-424[CrossRef][Medline].
13. Kass-Eisler, A., and C. W. Greider. 2000. Recombination in telomere-length maintenance. Trends Biochem. Sci. 25:200-204[CrossRef][Medline].
14. Kironmai, K. M., and K. Muniyappa. 1997. Alteration of telomeric sequences and senescence caused by mutations in RAD50 of Saccharomyces cerevisiae. Genes Cells 2:443-455[Abstract].
15. Le, S., J. K. Moore, J. E. Haber, and C. W. Greider. 1999. RAD51 and RAD50 define two pathways that collaborate to maintain telomeres in the absence of telomerase. Genetics 152:143-152[Abstract/Free Full Text].
16. Lingner, J., T. R. Hughes, A. Shevchenko, M. Mann, V. Lundblad, and T. R. Cech. 1997. Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 276:561-567[Abstract/Free Full Text].
17. Louis, E. J., and J. E. Haber. 1992. The structure and evolution of subtelomeric Y' repeats in Saccharomyces cerevisiae. Genetics 131:559-574[Abstract].
18. Louis, E. J., and J. E. Haber. 1990. The subtelomeric Y' repeat family in Saccharomyces cerevisiae: an experimental system for repeated sequence evolution. Genetics 124:533-545[Abstract].
19. Lundblad, V., and E. H. Blackburn. 1993. An alternative pathway for yeast telomere maintenance rescues est1- senescence. Cell 73:347-360[CrossRef][Medline].
20. Malkova, A., E. L. Ivanov, and J. E. Haber. 1996. Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced DNA replication. Proc. Natl. Acad. Sci. USA 93:7131-7136[Abstract/Free Full Text].
21. McEachern, M. J., and E. H. Blackburn. 1995. Runaway telomere elongation caused by telomerase RNA gene mutations. Nature 376:403-409[CrossRef][Medline].
22. Moore, J. K., and J. E. Haber. 1996. Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:2164-2173[Abstract].
23. Morrow, D. M., C. Connelly, and P. Hieter. 1997. "Break copy" duplication: a model for chromosome fragment formation in Saccharomyces cerevisiae. Genetics 147:371-382[Abstract].
24. Schiestl, R. H., and R. D. Gietz. 1989. High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet. 16:339-346[CrossRef][Medline].
25. Shampay, J., J. W. Szostak, and E. H. Blackburn. 1984. DNA sequences of telomeres maintained in yeast. Nature 310:154-157[CrossRef][Medline].
26. Sikorski, R. S., and P. Hieter. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27[Abstract/Free Full Text].
27. Singer, M. S., and D. E. Gottschling. 1994. TLC1: template RNA component of Saccharomyces cerevisiae telomerase. Science 266:404-409[Abstract/Free Full Text].
28. Sugawara, N., G. Ira, and J. E. Haber. 2000. DNA length dependence of the single-strand annealing pathway and the role of Saccharomyces cerevisiae RAD59 in double-strand break repair. Mol. Cell. Biol. 20:5300-5309[Abstract/Free Full Text].
29. Teng, S. C., and V. A. Zakian. 1999. Telomere-telomere recombination is an efficient bypass pathway for telomere maintenance in Saccharomyces cerevisiae. Mol. Cell. Biol. 19:8083-8093[Abstract/Free Full Text].
30. Zhu, X. D., B. Kuster, M. Mann, J. H. Petrini, and T. de Lange. 2000. Cell-cycle-regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat. Genet. 25:347-352[CrossRef][Medline].


Molecular and Cellular Biology, March 2001, p. 1819-1827, Vol. 21, No. 5
0270-7306/01/$04.00+0   DOI: 10.1128/MCB.21.5.1819-1827.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Basenko, E. Y., Cesare, A. J., Iyer, S., Griffith, J. D., McEachern, M. J. (2009). Telomeric circles are abundant in the stn1-M1 mutant that maintains its telomeres through recombination. Nucleic Acids Res 0: gkp814v1-gkp814 [Abstract] [Full Text]  
  • LeBel, C., Rosonina, E., Sealey, D. C. F., Pryde, F., Lydall, D., Maringele, L., Harrington, L. A. (2009). Telomere Maintenance and Survival in Saccharomyces cerevisiae in the Absence of Telomerase and RAD52. Genetics 182: 671-684 [Abstract] [Full Text]  
  • Grandin, N., Charbonneau, M. (2009). Telomerase- and Rad52-Independent Immortalization of Budding Yeast by an Inherited-Long-Telomere Pathway of Telomeric Repeat Amplification. Mol. Cell. Biol. 29: 965-985 [Abstract] [Full Text]  
  • Bechard, L. H., Butuner, B. D., Peterson, G. J., McRae, W., Topcu, Z., McEachern, M. J. (2009). Mutant Telomeric Repeats in Yeast Can Disrupt the Negative Regulation of Recombination-Mediated Telomere Maintenance and Create an Alternative Lengthening of Telomeres-Like Phenotype. Mol. Cell. Biol. 29: 626-639 [Abstract] [Full Text]  
  • Tomita, K., Cooper, J. P. (2008). Fission yeast Ccq1 is telomerase recruiter and local checkpoint controller. Genes Dev. 22: 3461-3474 [Abstract] [Full Text]  
  • Kirk, K. E., Christ, C., McGuire, J. M., Paul, A. G., Vahedi, M., Stuart, K. R., Cole, E. S. (2008). Abnormal Micronuclear Telomeres Lead to an Unusual Cell Cycle Checkpoint and Defects in Tetrahymena Oral Morphogenesis. Eukaryot Cell 7: 1712-1723 [Abstract] [Full Text]  
  • Maxwell, P. H., Curcio, M. J. (2008). Incorporation of Y'-Ty1 cDNA Destabilizes Telomeres in Saccharomyces cerevisiae Telomerase-Negative Mutants. Genetics 179: 2313-2317 [Abstract] [Full Text]  
  • Coic, E., Feldman, T., Landman, A. S., Haber, J. E. (2008). Mechanisms of Rad52-Independent Spontaneous and UV-Induced Mitotic Recombination in Saccharomyces cerevisiae. Genetics 179: 199-211 [Abstract] [Full Text]  
  • Cesare, A. J., Groff-Vindman, C., Compton, S. A., McEachern, M. J., Griffith, J. D. (2008). Telomere Loops and Homologous Recombination-Dependent Telomeric Circles in a Kluyveromyces lactis Telomere Mutant Strain. Mol. Cell. Biol. 28: 20-29 [Abstract] [Full Text]  
  • Makovets, S., Williams, T. L., Blackburn, E. H. (2008). The Telotype Defines the Telomere State in Saccharomyces cerevisiae and Is Inherited as a Dominant Non-Mendelian Characteristic in Cells Lacking Telomerase. Genetics 178: 245-257 [Abstract] [Full Text]  
  • Pike, B. L., Heierhorst, J. (2007). Mdt1 Facilitates Efficient Repair of Blocked DNA Double-Strand Breaks and Recombinational Maintenance of Telomeres. Mol. Cell. Biol. 27: 6532-6545 [Abstract] [Full Text]  
  • Grandin, N., Charbonneau, M. (2007). Control of the yeast telomeric senescence survival pathways of recombination by the Mec1 and Mec3 DNA damage sensors and RPA. Nucleic Acids Res 35: 822-838 [Abstract] [Full Text]  
  • Compton, S. A., Choi, J.-H., Cesare, A. J., Ozgur, S., Griffith, J. D. (2007). Xrcc3 and Nbs1 Are Required for the Production of Extrachromosomal Telomeric Circles in Human Alternative Lengthening of Telomere Cells. Cancer Res. 67: 1513-1519 [Abstract] [Full Text]  
  • Wu, Y., Siino, J. S., Sugiyama, T., Kowalczykowski, S. C. (2006). The DNA Binding Preference of RAD52 and RAD59 Proteins: IMPLICATIONS FOR RAD52 AND RAD59 PROTEIN FUNCTION IN HOMOLOGOUS RECOMBINATION. J. Biol. Chem. 281: 40001-40009 [Abstract] [Full Text]  
  • Akiyama, K., Yusa, K., Hashimoto, H., Poonepalli, A., Hande, M. P., Kakazu, N., Takeda, J., Tachibana, M., Shinkai, Y. (2006). Rad54 is dispensable for the ALT pathway. GENES CELLS 11: 1305-1315 [Abstract] [Full Text]  
  • Dreesen, O., Cross, G. A. M. (2006). Telomerase-Independent Stabilization of Short Telomeres in Trypanosoma brucei.. Mol. Cell. Biol. 26: 4911-4919 [Abstract] [Full Text]  
  • Tsai, H.-J., Huang, W.-H., Li, T.-K., Tsai, Y.-L., Wu, K.-J., Tseng, S.-F., Teng, S.-C. (2006). Involvement of Topoisomerase III in Telomere-Telomere Recombination. J. Biol. Chem. 281: 13717-13723 [Abstract] [Full Text]  
  • Brachner, A., Sasgary, S., Pirker, C., Rodgarkia, C., Mikula, M., Mikulits, W., Bergmeister, H., Setinek, U., Wieser, M., Chin, S.-F., Caldas, C., Micksche, M., Cerni, C., Berger, W. (2006). Telomerase- and Alternative Telomere Lengthening-Independent Telomere Stabilization in a Metastasis-Derived Human Non-Small Cell Lung Cancer Cell Line: Effect of Ectopic hTERT.. Cancer Res. 66: 3584-3592 [Abstract] [Full Text]  
  • Azam, M., Lee, J. Y., Abraham, V., Chanoux, R., Schoenly, K. A., Johnson, F. B. (2006). Evidence that the S.cerevisiae Sgs1 protein facilitates recombinational repair of telomeres during senescence. Nucleic Acids Res 34: 506-516 [Abstract] [Full Text]  
  • Yang, C.-P., Chen, Y.-B., Meng, F.-L., Zhou, J.-Q. (2006). Saccharomyces cerevisiae Est3p dimerizes in vitro and dimerization contributes to efficient telomere replication in vivo. Nucleic Acids Res 34: 407-416 [Abstract] [Full Text]  
  • Iyer, S., Chadha, A. D., McEachern, M. J. (2005). A Mutation in the STN1 Gene Triggers an Alternative Lengthening of Telomere-Like Runaway Recombinational Telomere Elongation and Rapid Deletion in Yeast. Mol. Cell. Biol. 25: 8064-8073 [Abstract] [Full Text]  
  • Putnam, C. D., Pennaneach, V., Kolodner, R. D. (2005). Saccharomyces cerevisiae as a Model System To Define the Chromosomal Instability Phenotype. Mol. Cell. Biol. 25: 7226-7238 [Abstract] [Full Text]  
  • Wang, Y., Erdmann, N., Giannone, R. J., Wu, J., Gomez, M., Liu, Y. (2005). An increase in telomere sister chromatid exchange in murine embryonic stem cells possessing critically shortened telomeres. Proc. Natl. Acad. Sci. USA 102: 10256-10260 [Abstract] [Full Text]  
  • Lillard-Wetherell, K., Combs, K. A., Groden, J. (2005). BLM Helicase Complements Disrupted Type II Telomere Lengthening in Telomerase-Negative sgs1 Yeast. Cancer Res. 65: 5520-5522 [Abstract] [Full Text]  
  • Jeyapalan, J. N., Varley, H., Foxon, J. L., Pollock, R. E., Jeffreys, A. J., Henson, J. D., Reddel, R. R., Royle, N. J. (2005). Activation of the ALT pathway for telomere maintenance can affect other sequences in the human genome. Hum Mol Genet 14: 1785-1794 [Abstract] [Full Text]  
  • Chen, Y.-B., Yang, C.-P., Li, R.-X., Zeng, R., Zhou, J.-Q. (2005). Def1p Is Involved in Telomere Maintenance in Budding Yeast. J. Biol. Chem. 280: 24784-24791 [Abstract] [Full Text]  
  • Groff-Vindman, C., Cesare, A. J., Natarajan, S., Griffith, J. D., McEachern, M. J. (2005). Recombination at Long Mutant Telomeres Produces Tiny Single- and Double-Stranded Telomeric Circles. Mol. Cell. Biol. 25: 4406-4412 [Abstract] [Full Text]  
  • Fasching, C. L., Bower, K., Reddel, R. R. (2005). Telomerase-Independent Telomere Length Maintenance in the Absence of Alternative Lengthening of Telomeres-Associated Promyelocytic Leukemia Bodies. Cancer Res. 65: 2722-2729 [Abstract] [Full Text]  
  • Marciniak, R. A., Cavazos, D., Montellano, R., Chen, Q., Guarente, L., Johnson, F. B. (2005). A Novel Telomere Structure in a Human Alternative Lengthening of Telomeres Cell Line. Cancer Res. 65: 2730-2737 [Abstract] [Full Text]  
  • Topcu, Z., Nickles, K., Davis, C., McEachern, M. J. (2005). Abrupt disruption of capping and a single source for recombinationally elongated telomeres in Kluyveromyces lactis. Proc. Natl. Acad. Sci. USA 102: 3348-3353 [Abstract] [Full Text]  
  • Lin, C.-Y., Chang, H.-H., Wu, K.-J., Tseng, S.-F., Lin, C.-C., Lin, C.-P., Teng, S.-C. (2005). Extrachromosomal Telomeric Circles Contribute to Rad52-, Rad50-, and Polymerase {delta}-Mediated Telomere-Telomere Recombination in Saccharomyces cerevisiae. Eukaryot Cell 4: 327-336 [Abstract] [Full Text]  
  • Maxwell, P. H., Coombes, C., Kenny, A. E., Lawler, J. F., Boeke, J. D., Curcio, M. J. (2004). Ty1 Mobilizes Subtelomeric Y' Elements in Telomerase-Negative Saccharomyces cerevisiae Survivors. Mol. Cell. Biol. 24: 9887-9898 [Abstract] [Full Text]  
  • d'Adda di Fagagna, F., Teo, S.-H., Jackson, S. P. (2004). Functional links between telomeres and proteins of the DNA-damage response. Genes Dev. 18: 1781-1799 [Abstract] [Full Text]  
  • Razak, Z. R. A., Varkonyi, R. J., Kulp-McEliece, M., Caslini, C., Testa, J. R., Murphy, M. E., Broccoli, D. (2004). p53 Differentially Inhibits Cell Growth Depending on the Mechanism of Telomere Maintenance. Mol. Cell. Biol. 24: 5967-5977 [Abstract] [Full Text]  
  • Torres, J. Z., Schnakenberg, S. L., Zakian, V. A. (2004). Saccharomyces cerevisiae Rrm3p DNA Helicase Promotes Genome Integrity by Preventing Replication Fork Stalling: Viability of rrm3 Cells Requires the Intra-S-Phase Checkpoint and Fork Restart Activities. Mol. Cell. Biol. 24: 3198-3212 [Abstract] [Full Text]  
  • Underwood, D. H., Carroll, C., McEachern, M. J. (2004). Genetic Dissection of the Kluyveromyces lactis Telomere and Evidence for Telomere Capping Defects in TER1 Mutants with Long Telomeres. Eukaryot Cell 3: 369-384 [Abstract] [Full Text]  
  • Maringele, L., Lydall, D. (2004). EXO1 Plays a Role in Generating Type I and Type II Survivors in Budding Yeast. Genetics 166: 1641-1649 [Abstract] [Full Text]  
  • Bertuch, A. A., Lundblad, V. (2004). EXO1 Contributes to Telomere Maintenance in Both Telomerase-Proficient and Telomerase-Deficient Saccharomyces cerevisiae. Genetics 166: 1651-1659 [Abstract] [Full Text]  
  • Davis, A. P., Symington, L. S. (2004). RAD51-Dependent Break-Induced Replication in Yeast. Mol. Cell. Biol. 24: 2344-2351 [Abstract] [Full Text]  
  • Enomoto, S., Glowczewski, L., Lew-Smith, J., Berman, J. G. (2004). Telomere Cap Components Influence the Rate of Senescence in Telomerase-Deficient Yeast Cells. Mol. Cell. Biol. 24: 837-845 [Abstract] [Full Text]  
  • Grandin, N., Charbonneau, M. (2003). Mitotic Cyclins Regulate Telomeric Recombination in Telomerase-Deficient Yeast Cells. Mol. Cell. Biol. 23: 9162-9177 [Abstract] [Full Text]  
  • Tsukamoto, M., Yamashita, K., Miyazaki, T., Shinohara, M., Shinohara, A. (2003). The N-Terminal DNA-Binding Domain of Rad52 Promotes RAD51-Independent Recombination in Saccharomyces cerevisiae. Genetics 165: 1703-1715 [Abstract] [Full Text]  
  • Natarajan, S., Groff-Vindman, C., McEachern, M. J. (2003). Factors Influencing the Recombinational Expansion and Spread of Telomeric Tandem Arrays in Kluyveromyces lactis. Eukaryot Cell 2: 1115-1127 [Abstract] [Full Text]  
  • Grandin, N., Charbonneau, M. (2003). The Rad51 Pathway of Telomerase-Independent Maintenance of Telomeres Can Amplify TG1-3 Sequences in yku and cdc13 Mutants of Saccharomyces cerevisiae. Mol. Cell. Biol. 23: 3721-3734 [Abstract] [Full Text]  
  • Wu, G., Jiang, X., Lee, W.-H., Chen, P.-L. (2003). Assembly of Functional ALT-associated Promyelocytic Leukemia Bodies Requires Nijmegen Breakage Syndrome 1. Cancer Res. 63: 2589-2595 [Abstract] [Full Text]  
  • IJpma, A. S., Greider, C. W. (2003). Short Telomeres Induce a DNA Damage Response in Saccharomyces cerevisiae. Mol. Biol. Cell 14: 987-1001 [Abstract] [Full Text]  
  • Symington, L. S. (2002). Role of RAD52 Epistasis Group Genes in Homologous Recombination and Double-Strand Break Repair. Microbiol. Mol. Biol. Rev. 66: 630-670 [Abstract] [Full Text]  
  • Parenteau, J., Wellinger, R. J. (2002). Differential Processing of Leading- and Lagging-Strand Ends at Saccharomyces cerevisiae Telomeres Revealed by the Absence of Rad27p Nuclease. Genetics 162: 1583-1594 [Abstract] [Full Text]  
  • Shor, E., Gangloff, S., Wagner, M., Weinstein, J., Price, G., Rothstein, R. (2002). Mutations in Homologous Recombination Genes Rescue top3 Slow Growth in Saccharomyces cerevisiae. Genetics 162: 647-662 [Abstract] [Full Text]  
  • Ira, G., Haber, J. E. (2002). Characterization of RAD51-Independent Break-Induced Replication That Acts Preferentially with Short Homologous Sequences. Mol. Cell. Biol. 22: 6384-6392 [Abstract] [Full Text]  
  • Tsai, Y.-L., Tseng, S.-F., Chang, S.-H., Lin, C.-C., Teng, S.-C. (2002). Involvement of Replicative Polymerases, Tel1p, Mec1p, Cdc13p, and the Ku Complex in Telomere-Telomere Recombination. Mol. Cell. Biol. 22: 5679-5687 [Abstract] [Full Text]  
  • Enomoto, S., Glowczewski, L., Berman, J. (2002). MEC3, MEC1, and DDC2 Are Essential Components of a Telomere Checkpoint Pathway Required for Cell Cycle Arrest during Senescence in Saccharomyces cerevisiae. Mol. Biol. Cell 13: 2626-2638 [Abstract] [Full Text]  
  • Kolodner, R. D., Putnam, C. D., Myung, K. (2002). Maintenance of Genome Stability in Saccharomyces cerevisiae. Science 297: 552-557 [Abstract] [Full Text]  
  • Maser, R. S., DePinho, R. A. (2002). Connecting Chromosomes, Crisis, and Cancer. Science 297: 565-569 [Abstract] [Full Text]  
  • Nautiyal, S., DeRisi, J. L., Blackburn, E. H. (2002). The genome-wide expression response to telomerase deletion in Saccharomycescerevisiae. Proc. Natl. Acad. Sci. USA 99: 9316-9321 [Abstract] [Full Text]  
  • Natarajan, S., McEachern, M. J. (2002). Recombinational Telomere Elongation Promoted by DNA Circles. Mol. Cell. Biol. 22: 4512-4521 [Abstract] [Full Text]  
  • Wei, C., Skopp, R., Takata, M., Takeda, S., Price, C. M. (2002). Effects of double-strand break repair proteins on vertebrate telomere structure. Nucleic Acids Res 30: 2862-2870 [Abstract] [Full Text]  
  • van den Bosch, M., Zonneveld, J. B. M., Vreeken, K., de Vries, F. A. T., Lohman, P. H. M., Pastink, A. (2002). Differential expression and requirements for Schizosaccharomyces pombeRAD52 homologs in DNA repair and recombination. Nucleic Acids Res 30: 1316-1324 [Abstract] [Full Text]  
  • Grossi, S., Bianchi, A., Damay, P., Shore, D. (2001). Telomere Formation by Rap1p Binding Site Arrays Reveals End-Specific Length Regulation Requirements and Active Telomeric Recombination. Mol. Cell. Biol. 21: 8117-8128 [Abstract] [Full Text]  
  • Davis, A. P., Symington, L. S. (2001). The Yeast Recombinational Repair Protein Rad59 Interacts With Rad52 and Stimulates Single-Strand Annealing. Genetics 159: 515-525 [Abstract] [Full Text]  
  • Kraus, E., Leung, W.-Y., Haber, J. E. (2001). Break-induced replication: A review and an example in budding yeast. Proc. Natl. Acad. Sci. USA 98: 8255-8262 [Abstract] [Full Text]  
  • Leri, A., Barlucchi, L., Limana, F., Deptala, A., Darzynkiewicz, Z., Hintze, T. H., Kajstura, J., Nadal-Ginard, B., Anversa, P. (2001). Telomerase expression and activity are coupled with myocyte proliferation and preservation of telomeric length in the failing heart. Proc. Natl. Acad. Sci. USA 10.1073/pnas.151013298v1 [Abstract] [Full Text]  
  • Signon, L., Malkova, A., Naylor, M. L., Klein, H., Haber, J. E. (2001). Genetic Requirements for RAD51- and RAD54-Independent Break-Induced Replication Repair of a Chromosomal Double-Strand Break. Mol. Cell. Biol. 21: 2048-2056 [Abstract] [Full Text]  
  • Leri, A., Barlucchi, L., Limana, F., Deptala, A., Darzynkiewicz, Z., Hintze, T. H., Kajstura, J., Nadal-Ginard, B., Anversa, P. (2001). Telomerase expression and activity are coupled with myocyte proliferation and preservation of telomeric length in the failing heart. Proc. Natl. Acad. Sci. USA 98: 8626-8631 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, Q.
Right arrow Articles by Greider, C. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Q.
Right arrow Articles by Greider, C. W.