Previous Article | Next Article 
Molecular and Cellular Biology, March 2001, p. 1833-1840, Vol. 21, No. 5
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.5.1833-1840.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
c-myc Internal Ribosome Entry Site
Activity Is Developmentally Controlled and Subjected to a Strong
Translational Repression in Adult Transgenic Mice
Laurent
Créancier,1
Pascale
Mercier,2
Anne-Catherine
Prats,1,* and
Dominique
Morello3
Institut National de la Santé et de la
Recherche Médicale U397, Endocrinologie et Communication
Cellulaire, Institut Fédératif de Recherche Louis Bugnard,
C.H.U. Rangueil, 31403 Toulouse Cedex 04,1
Centre de Biologie du Développement, UMR 5547,
Université Paul Sabatier, 31062 Toulouse Cedex
04,3 and Institut de Pharmacologie
et Biologie Structurale du Centre National de la Recherche
Scientifique, 31077 Toulouse Cedex 04,2 France
Received 11 September 2000/Returned for modification 6 November
2000/Accepted 5 December 2000
 |
ABSTRACT |
The expression of c-myc proto-oncogene, a key regulator
of cell proliferation and apoptosis, is controlled at different
transcriptional and posttranscriptional levels. In particular, the
c-myc mRNA contains an internal ribosome entry site (IRES)
able to promote translation initiation independently from the classical
cap-dependent mechanism. We analyzed the variations of
c-myc IRES activity ex vivo in different proliferating cell
types, and in vivo in transgenic mice expressing a bicistronic dual
luciferase construct. c-myc IRES efficiency was compared to
that of encephalomyocarditis virus (EMCV) IRES under the same
conditions. The c-myc IRES was active but with variable
efficiency in all transiently transfected cell types; it was also
active in the 11-day- old (E11) embryo and in some tissues of the E16
embryo. Strikingly, its activity was undetected or very low in all
adult organs tested. In contrast, EMCV IRES was very active in most
cell types ex vivo, as well as in embryonic and adult tissues. These
data suggest a crucial role of IRES in the control of c-myc
gene expression throughout development, either during embryogenesis
where its activity might participate in cell proliferation or later on,
where its silencing could contribute to the downregulation of
c-myc expression, whose deregulation leads to tumor formation.
 |
INTRODUCTION |
c-myc is a proto-oncogene
playing a dual role in the control of cell
proliferation-differentiation and apoptosis. Its overexpression contributes to oncogenic transformation of various cell tissues, leading to multiple neoplasms, in particular to hematopoietic tumors in
humans and mice (5, 25). Several mechanisms have been
shown to generate c-myc activation, including gene
amplification, chromosomal translocation, proviral insertion, and
retroviral transduction (for reviews see references 25 and
31). However, the correlation between tumor occurrence and
increased transcription, marked mRNA stabilization, or elevated level
of c-Myc proteins is far from clear. Although it is classically assumed
that c-Myc protein abundance is determined by transcriptional control,
it has been shown that the c-myc gene is strongly subjected
to posttranscriptional regulation (reviewed in reference
12). Numerous studies have demonstrated the role of
c-myc mRNA stability in the control of gene expression (for
review, see reference 30), and instability determinants
have been identified in their 3' untranslated region (3' UTR [3,
20, 33]) as well as in coding exons (23, 43, 44).
Translational control also plays an important role: the
c-myc 5' UTR has been proposed to be a modulator of
translational efficiency (28, 32). It has been recently
shown to contain an internal ribosome entry site (IRES) capable of
directing the internal initiation of protein synthesis in a
cap-independent manner (27, 36). In the human
c-myc gene, the IRES lies in the 408 nucleotides (nt)
upstream from the AUG start codon of the major c-Myc protein (c-Myc2).
It is thus present in the c-myc transcripts initiated from
either the P0, P1, or P2 promoter and is able to promote the
cap-independent synthesis of the two c-Myc proteins c-Myc1 and c-Myc2,
initiated at the two alternative CUG and AUG codons, respectively
(15, 27). Various pathologies, including breast cancer
(11) and multiple myeloma (41), have been
correlated to c-myc aberrant translational upregulation, which is proposed to result from overexpression or activation of the
cap-binding protein eIF-4E. Overexpression of this protein
relieves the translational repression imposed by highly structured 5'
UTRs (22). However, c-Myc overexpression, at least in
multiple myeloma, is clearly eIF-4E independent and would
thus most probably result from aberrant activation of the
c-myc IRES.
To date, several IRESs have been discovered in cellular mRNAs, most of
them encoding proteins that are involved in the control of cell growth
and/or apoptosis (1, 16-18, 27, 34, 36, 39). It has been
suggested recently that the presence of the IRES might allow
translation of these cellular mRNAs in situations where the
cap-dependent translation machinery is inactive, for instance in
response to stress (34, 40) and apoptosis (16, 17,
35) and during cell cycle G2-to-M transition
(6, 29). However, these experiments have mostly been
performed with transformed or immortalized cell lines where IRES could
be aberrantly upregulated (13, 41), thus precluding a
knowledge of their possible regulatory role in physiological conditions.
We have investigated this question by analyzing the activity of
c-myc IRES in view of its possible involvement in the
well-known role of c-myc in controlling cell proliferation
and tumorigenesis. Using the bicistronic vector strategy, we compared
activities of c-myc and encephalomyocarditis virus (EMCV)
IRESs in various transiently transfected cell lines and transgenic mice
during embryogenesis and in adult tissues. Our results revealed that the c-myc IRES was active in all the transiently transfected
cells and was subjected to strong developmental control in transgenic mice.
 |
MATERIALS AND METHODS |
Plasmid construction.
The bicistronic vectors of the MyCAT
and NuCAT series were constructed from the previously described
plasmids pCVC and pHCVC (containing a hairpin) which have two tandem
chloramphenicol acetyltransferase (CAT) genes (18). Part
of the c-myc cDNA (551 nt corresponding to the 408 nt of the
myc P2 5' UTR plus the 143 nt downstream from the AUG codon)
was introduced into the intercistronic region between the two CAT
genes. The two resulting plasmids were called pBI-MyCAT and pHP-MyCAT
(Fig. 1A). Two other plasmids were
constructed to determine the 3' border of the IRES. These plasmids
contained the myc P2 5' UTR (408 nt), in which the AUG codon
of myc was directly fused to a coding part of the nucleolin
gene, resulting in a chimeric NuCAT gene (pSVNC83) (9).
The 5' UTR-NuCAT fusion was obtained by PCR amplification using
oligonucleotides T7 and 5' TTTCCATGGTCGCGGGAGGCTGCTGC 3' on
plasmid pSCT-MyCAT-P2 (27). This PCR fragment was digested
at the NcoI site and was fused to the CAT open reading frame
in pBI-MyCAT and pHP-MyCAT (in place of MyCAT fusion). These
CAT-myc-NuCAT-containing plasmids were called pBI-NuCAT and pHP-NuCAT,
respectively (Fig. 1A).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
Transfection of COS-7 cells with tandem CAT bicistronic
vectors. (A) Schematic representation of the tandem CAT bicistronic
vectors. The CMV promoter is represented by an arrow, the tandem CAT
genes are represented by black boxes, the c-myc sequence
fused to CAT is represented by a grey box, and the nucleolin sequence
fused to CAT is represented by a white box. The line between the boxes
corresponds to the c-myc 5' UTR (containing the IRES). In
the plasmids pHP-MyCAT and pHP-NuCAT, the 5' hairpin is represented
between the intron (broken line) and the first-cistron CAT (left black
box). The line between the boxes corresponds to the c-myc 5'
UTR (containing the IRES and the two initiation codons C [CUG] and A
[AUG]). (B) Western immunoblotting of transiently transfected COS-7
cells. COS-7 cells were transiently transfected by the bicistronic
plasmids described for panel A, and cell extracts were analyzed by
Western immunoblotting with anti-CAT antibody as previously described
(27). Lane ct corresponds to mock-transfected cells. Lane
1, pBI-MyCAT; lane 2, pHP-MyCAT; lane 3, pBI-NuCAT; lane 4, pHP-NuCAT.
The first cistron (CAT) and the second cistron (MyCAT or NuCAT) are
indicated by arrows. MyCAT and NuCAT appear as a doublet which
corresponds to the initiation of translation at the CUG and AUG codons
of the c-myc mRNA, the location of which is shown in panel
A.
|
|
The plasmids pCRHL and pCREL have already been described
(18). The two luciferase genes, Renilla
luciferase (LucR) and firefly luciferase (LucF), are under the control
of the cytomegalovirus (CMV) promoter and are separated by either a
hairpin or the EMCV IRES for pCRHL or pCREL, respectively. The plasmid
pCRMyL was constructed by replacing the EMCV IRES with the
c-myc IRES between the two luciferase genes. In this
plasmid, the 5' 408 nt of the human c-myc cDNA are fused to
the LucF coding sequence.
Cell transfection.
Cell lines were obtained from the
American Type Culture Collection (ATCC) or European Collection of
Animal Cell Culture (ECACC). NIH 3T3 is a mouse immortalized fibroblast
cell line. C2C12 (ECACC no. 91031101) is a mouse muscle myoblast line.
ABAE is an adult bovine aortic endothelial primary cell line
(7). CHO is a Chinese hamster ovary carcinoma cell line.
HeLa (ATCC no. CCL2) is a human uterus carcinoma cell line of
epithelial origin. COS-7 (ATCC no. CRL 1654) is a monkey kidney cell
line transformed by the simian virus 40 large T antigen. Jurkat (ATCC
no. TIB-152) is a human acute leukemia T-cell line. Skin fibroblasts
come from a human primary culture cell line (38). ECV304
(ECACC no. 92091712) is a spontaneously transformed human endothelial
cell line. 293 (ATCC no. CRL-1573) is a human kidney epithelial cell
line transformed with adenovirus 5. SK-Hep-1 (ATCC no. HTB 52) is a
human liver adenocarcinoma cell line of endothelial origin; SK-N-AS
(ECACC no. 94092302) and SK-N-BE (ECACC no. 95011815) are human
neuroblastoma cell lines. Saos2 (ATCC no. HTB-85) is a
p53
/
human osteosarcoma cell line of epithelial origin.
Cells were cultivated according to ATCC or ECACC instructions.
The different cell types were transfected with 1 µg of plasmid and
Fugene 6 reagent (Boehringer-Roche) in 12-well petri dishes. Forty-eight hours after transfection, cell lysates were prepared for
luminescence activity as previously described (18).
Generation of transgenic mice.
REL and RMyL transgenic mice
were obtained by injecting fragments containing the CMV-LucR-EMCV
IRES-LucF and CMV-LucR-c-myc-IRES-LucF sequences,
respectively, into one of the pronuclei of (C57BL/6 × CBA)2 fertilized eggs (4). Transgenic embryos
and adult mice were identified by PCR and Southern blot analysis of
placental or tail DNA using a LucF 500-bp-long probe amplified with the
LucF-specific oligonucleotides 5'-CAGTATGAACATTTCGCAGCC-3'
and 5'-CTGAAGGGACTGTAAAAACAGC-3'. Stable lines were
maintained by successive crosses with (C57BL/6 × CBA)F1 mice. The transgene copy number was determined by
PhosphorImager scanning of Southern blots. The intensity of the bands
corresponding to tandem head-to-tail integration was expressed relative
to the intensity of the bands corresponding to 5' and 3' flanking regions.
Reverse transcription (RT)-PCR analysis.
The cDNAs were
synthesized as previously described, using 5 µg of DNase-treated
total RNA (38). The PCR was performed with a primer couple
(5'-GATTACCAGGGATTTCAGTCG-3' and
5'-CTGAAGGGACTGTAAAAACAGC-3' or
5'-CCACATATTGAGCCAGTAGC-3' and
5'-CCATGATAATGTTGGACGAC-3') to amplify the LucF or LucR DNA
sequence, respectively. The PCRs were carried out using 0.3 U of
Goldstar Taq DNA polymerase (Eurogentec) in a final volume
of 30 µl, with 1 µl of cDNA. The reaction was performed on a
Perkin-Elmer apparatus under the following conditions: 94°C for 3 min
and then 25 cycles at 94°C for 30 s, 58°C for 45 s,
72°C for 45 s, and finally 72°C for 5 min. Amplification
results (one-third of the reactions) were analyzed on 2% agarose gels (Tris-borate-EDTA), followed by ethidium bromide staining.
Luciferase activity analysis.
The two luciferase activities
were measured in cell or tissue extracts, and IRES activity was
determined by calculating the LucF-to-LucR ratios. The ratio of IRES
efficiency between different cell types was compared ex vivo by
calibrating the pCRMyL or pCREL (c-myc or EMCV IRES
activity, respectively)-to-pCRHL (background activity without an IRES)
ratio. For the in vivo analysis (i) 11-day-old (E11) embryos and
placenta; (ii) E16 heart, limb bud, tail, brain, liver, and placenta;
and (iii) adult tissue fragments were frozen in liquid nitrogen and
stored at
80°C. They were homogenized in 200 µl of passive lysis
buffer (Promega) using thurax and were centrifuged for 20 min at 4,500 rpm at 4°C (Biofuge Pico centrifuge; Heraeus). The supernatant was
centrifuged for 15 min at 13,000 rpm at 4°C, and the last supernatant
was used for luminescence dosage (30 µl). LucR and LucF activities
were measured using the Dual Luciferase kit from Promega.
 |
RESULTS |
c-myc IRES activity is not influenced by elements
located downstream from the AUG start codon.
In a previous report,
researchers characterized the human c-myc IRES as requiring
RNA elements located between nt
408 and
140 upstream from the
c-myc mRNA AUG codon (27). However, the different constructs used in that report contained, in addition to the
5' UTR, 143 nt of the translated region downstream from the AUG (Fig.
1A, pBI-MyCAT). To evaluate their possible role in the IRES activity, a
bicistronic construct with two tandem CAT genes was designed in which
the 143 nt of the c-myc coding sequence were replaced by 280 nt from the nucleolin coding sequence (Fig. 1A, pBI-NuCAT). These
bicistronic constructs and their counterparts bearing a 5' hairpin
(pHP-MyCAT and pHP-NuCAT) were used for transient transfection of COS-7
cells and expression of the first and second cistrons analyzed by
Western immunoblotting with anti-CAT antibodies (Fig. 1B). The results
clearly showed that the second cistron was expressed just as
efficiently from the constructs pMyCAT and pNuCAT, demonstrating that
the coding sequence downstream from the c-myc AUG start
codon was not involved in the activity of the c-myc IRES.
c-myc IRES is active in tissue culture cells with
varying efficacy.
To test the activity of the c-myc
IRES in different cell types, we used a bicistronic vector expressing
two highly sensitive luciferases, LucR and LucF, under the control of
the cytomegalovirus (CMV) promoter. This vector was successfully used
in a previous report to demonstrate the existence of the two vascular
endothelial growth factor IRESs (18). The human
c-myc IRES (the 408-nt-long fragment upstream from the AUG
codon) was inserted between the two Luc genes (pCRMyL, Fig.
2A). LucR, the first cistron, provides the level of cap-dependent translation; it is expected to reflect the
activity of CMV sequences in the transfected cells and thus to be
proportional to the amount of bicistronic mRNA. LucF, the second
cistron, is expressed proportionally to the IRES activity. The use of
such an assay, based on dual highly sensitive reporters, allows rapid
and concomitant quantitation of both reporter gene activities. As
positive or negative control, we used similar vectors containing either
the EMCV IRES (pCREL) or a hairpin (pCRHL) between the luciferase
genes, respectively (18).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Analysis of FGF-2 IRES activity in transiently
transfected cells. (A) Schematic representation of the bicistronic
LucR-I-LucF vectors. Plasmid construction is described in Materials and
Methods. They contain a CMV promoter controlling the expression of a
bicistronic LucR-LucF mRNA. A synthetic intron is present 5' of LucR,
and a poly(A) site is present 3' of LucF (18). In the
construct pCRMyL, the complete c-myc P2 leader (408 nt) has
been fused to the AUG codon of the LucF open reading frame. In the
construct pCRHL, a hairpin has been introduced between the two
luciferase genes. The construct pCREL contains the EMCV IRES between
the two luciferase genes. (B) Fourteen different cell types were
transiently transfected with pCRMyL, pCRHL, or pCREL DNA. Cells were
harvested 48 h after transfection, and luciferase activities
present in cell extracts were measured. c-myc IRES activity
was obtained by calculating the ratio 100 × (LucF/LucR). To
calibrate the data from the different cell types, the LucF/LucR ratio
of pCRMyL was divided by the ratio of the negative control pCRHL.
Experiments were repeated three to six times, and results are expressed
as means ± standard error (SE). The names of the different cell
types (described in Materials and Methods) are indicated. Fib.,
fibroblast.
|
|
Fourteen different cell types of human, monkey, bovine, hamster, or
mouse origin were transiently transfected with these constructs. The
LucF/LucR ratios obtained in the different cell types for the three
constructs pCRMyL, pCREL, and pCRHL are reported in Table
1. As shown by the values obtained using
the control without the IRES (pCRHL), the leakage of second-cistron
expression strongly varied according to the cell type, indicating that
the direct LucF/LucR values were not directly usable for comparing IRES
activities from one cell type to the other. Thus, the direct comparison
of IRES activity between different cell types was obtained by dividing the LucF/LucR ratios obtained with pCREL and pCRMyL by the LucF/LucR ratios obtained with the negative control pCRHL (Fig. 2B).
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Measurements of the ratios of LucF to LucR (100 × LucF/LucR) obtained by transient transfection of different cell types
with the constructs pCRHL, pCRMyL, and pCREL (Fig.
2A)a
|
|
Both c-myc and EMCV IRESs exhibited a broad spectrum of
activity, since they were active in all the different mammalian cell types tested, whatever their origin. However, c-myc IRES
activity was globally lower than that of the EMCV IRES. Both IRESs were subjected to cell type-specific regulations, since factors of 11 and 14 were observed between the highest and lowest activities for
c-myc and EMCV IRESs, respectively. c-myc IRES
activity was high (>20 arbitrary units [AU]) in the two
neuroblastoma cell lines SK-N-BE and SK-N-AS and was intermediate (>10
AU) in three other human transformed cell lines originating from
osteosarcoma (Saos2), leukemia (Jurkat), or endothelial tumor (ECV304).
Low activity was observed in all the nontransformed cells,
independently of their origin: murine (3T3 and C2C12), bovine (ABAE),
or human (skin fibroblasts). EMCV IRES activity in contrast was very
high or high (>50 AU) in most cells, whether transformed or not. The only cell line showing low activity (<10 AU) was HeLa, in which the
c-myc IRES is also very weak.
Generation of transgenic mice expressing bicistronic LucR-IRES-LucF
constructs.
To determine the tissue specificity of the
c-myc IRES in the absence of any bias due to cell
transformation or cell culture conditions, we decided to study the
expression of the LucR-Myc-IRES-LucF construct in vivo. For that
purpose, transgenic mice were produced that contained the
LucR-IRES-LucF DNA fragment (Fig. 2A, CRMyL, and Materials and
Methods). Two independent lines (RMyL-22 and RMyL-28) were established.
Southern blots showed that these transgenic lines contained 1 or 2 and
28 to 35 copies of the transgene, respectively (Fig. 3A and B, lanes 5 and 6 and 7 and 8). Two other transgenic lines were derived in parallel, which contained the construct with the
viral EMCV IRES in place of c-myc IRES (Fig. 2A, CREL). These two lines, RELA and RELB, both contained 12 to 15 copies of the
construct (Fig. 3B, lanes 1 and 2 and 3 and 4).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
Southern blotting analysis. (A) Schema of the tandem
repeat insertion of the bicistronic constructs in the mouse genome. The
complete digestion of genomic DNA with the EcoRI enzyme
(unique site in the transgene) generates a 4.3-kb (RMyL) or 4.7-kb
(REL) fragment corresponding to the complete tandem repeat (N copies)
and two fragments of unknown sizes (both hybridizing with the probe
which encompasses the EcoRI site) corresponding to the 5'
and 3' flanking regions. The number of tandem copies has been evaluated
by calibrating the signal given by the complete tandem repeat to the
signals given by the flanking regions. (B) Twenty micrograms of genomic
DNA was digested with the EcoRI enzyme and was hybridized to
a LucR-specific PCR fragment (see Materials and Methods). Two offspring
of each different strain (RELA and RELB; RMyL-22 and RMyL-28) were
tested in parallel. (Only 10 µg of sample 5 was digested.) Arrows
indicate the complete tandem repeat fragments corresponding to the CREL
and CRMyL transgenes. The flanking region fragments are indicated by
asterisks. Other bands of higher molecular weight correspond to
partially digested DNA. The intensity of the bands was measured with a
phosphorimager, and the copy number of the transgene was evaluated as
explained for panel A.
|
|
c-myc IRES is active in transgenic embryos but silent
in adult tissues.
Luciferase activities were measured in total E11
embryos and placenta of the 4 transgenic lines, in 5 E16 tissues and
placenta, and in 13 adult organs. As shown in Fig.
4 and Table
2, where the values correspond to
representative experiments obtained in the two transgenic lines, the
activity of c-myc IRES was high in the E11 embryo, whereas
it was hardly detectable in the placenta. In contrast the activity of
EMCV IRES was high in both the E11 placenta and embryo (Fig. 4A).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 4.
Activities of c-myc and EMCV IRESs in
transgenic embryos. Embryos from the different transgenic lines were
prepared for E11 (A) and E16 (B) embryos, and luciferase activities
were measured in different tissues (named on the left), as described in
Materials and Methods. IRES activities were measured by calculating the
ratios [100 × (LucF/LucR)] and are represented by histograms
(black boxes for RMyL-28 and -22 and white boxes for RELB and -A). For
values, see Table 2 and reference 8. Experiments were
repeated at least three times, and results are expressed as means ± SE. Abbreviations: nd, not determined (the experiment was not
performed); ud, undetected activity (LucR activity was not superior to
three times the background value in the corresponding organ).
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Measurement of LucR and LucF activities in whole E11
embryos and in embryonic (E16) and adult tissues of RMyL-22 and RMyL-28
transgenic micea
|
|
For E16 embryos, c-myc IRES was still inactive in
extraembryonic tissues. It showed a strong tissue specificity in the
embryonic tissues, being active in brain and heart and completely
inactive in tail, liver, and limb bud (Fig. 4B). Again, this variation of IRES activity was not observed for EMCV IRES which was very efficient in placenta, tail, heart, and brain. The only organ in which
EMCV IRES activity was not detected was the liver.
EMCV IRES exhibited a very broad spectrum of activity in the adult,
since 12 out of the 13 tissues tested showed significant IRES activity
(Fig. 5). However, as was observed in the
tissue-cultured cell lines, there was clear tissue specificity: the
highest activities (in AU) (>80) were observed in lung, testis, and
skin, and the lowest (<10) were in muscle and liver. The other organs
showed high (>40) (tongue, thymus, ovary), moderate (25) (brain), or rather low (<20) (intestine, heart, stomach, and kidney) activity.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 5.
c-myc and EMCV IRES activities in transgenic
adult tissues. Different organs (named on the left) were prepared from
adult transgenic mice, and luciferase activities were measured as
described for Fig. 4. IRES activities are represented by histograms
corresponding to the equation 100 × (LucF/LucR) (Table 2). These
values correspond to representative experiments that were repeated at
least three times on the two independent lines expressing each
bicistronic construct, pCRMyL (c-myc) and pCREL (EMCV).
Abbreviations: nd, not done; ud, undetectable LucR activity.
|
|
In contrast to the broad spectrum of activity of EMCV IRES, the
c-myc IRES was completely inactive or showed very low
activity in all adult organs. In total, the c-myc IRES
activity varied from 0.1 AU (most organs) to 5 AU (brain and stomach),
whereas that of EMCV IRES varied from 6 to 173 AU (Fig. 5).
To check that the absence of LucF activity observed with
c-myc IRES and not with EMCV IRES was only due to a lack of
IRES activity and not to any aberrant event, comparative RT-PCR was used to measure the relative levels of LucF and LucR cistrons. As shown
in Fig. 6, the ratio of LucF RNA cistrons
to LucR RNA cistrons was similar in RMyL-22 and RELA organs, thus
showing that the integrity of the bicistronic mRNAs was comparable in the c-myc IRES and EMCV IRES transgenic mice.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 6.
Detection of the bicistronic Luc mRNA in transgenic
adult tissues. Total RNA was extracted from RMyL-22 or RELA transgenic
brain (B) or testis (Te), and the level of LucF and LucR cistrons was
analyzed by RT-PCR (as described in Materials and Methods). The
negative control (C ) corresponds to a PCR experiment performed using
RNA from the brain of a nontransgenic mouse. The positive control (C+)
was performed with an in vitro-transcribed bicistronic REL mRNA. The
bands corresponding to amplification of LucR (465 nt) and LucF (366 nt)
cDNAs are indicated by arrows. This experiment enabled us to check the
LucF/LucR ratios at the RNA level in the different organs and to show
that they are similar in REL and RMyL transgenic mice.
|
|
In summary, these data indicated that, in contrast to EMCV IRES, which
is highly efficient in both embryonic and adult mice, the
c-myc IRES is active in E11 embryo and tissue specific in E16 embryo, whereas it is strongly silenced in adult tissues.
 |
DISCUSSION |
We report here that the IRES of a proto-oncogene,
c-myc, is repressed in vivo in adult transgenic mice. In
contrast it is active in E11 and E16 embryos (with a strong tissue
specificity for E16 embryos) and in all the cultured, proliferating
cells tested. Strikingly, the EMCV IRES, albeit with different
efficiencies, exhibits similar levels of activity both ex vivo and in
vivo in embryos and adult mice. The IRES silencing observed in vivo is thus specific to c-myc IRES and points to a physiological
role of this IRES, which, if deregulated, might contribute to tumorigenesis.
We provide here a direct comparison of activities of c-myc
and EMCV IRESs in human and nonhuman cell types in a highly calibrated quantitation system. Two previous studies have separately reported cell
type-specific variations of these two IRESs (2, 37). First, Borman et al. compared the behavior of seven picornaviral IRESs,
either from type I or type II (19), in six primate or nonprimate cell lines (2). The cells could be divided
broadly into two groups: cells including HeLa, FRhK4, and SK-HepG2,
which were permissive to all the picornaviral IRESs; and cells
corresponding to SK-N-BE, BHK21, and Neuro-2A, which were permissive
for type II IRESs (such as EMCV) but were refractory to translation
from type I IRESs. Accordingly, we have also found that the EMCV IRES is active in both HeLa and SK-N-BE cells. The apparent differences observed between Borman's experiments and ours reflect only the different methods used to measure IRES-dependent translation: whereas
in Borman's study, the IRES activities are expressed relative to the
cell type in which the IRES is the most efficient (taken as 100%), we
calibrate the IRES activity in a certain cell type relative to the
background value given by a bicistronic construct devoid of an IRES
between the two cistrons.
Second, Stoneley et al., using bicistronic constructs, studied
c-myc IRES activity in HeLa cells (37). In
agreement with our study, they reported that Hela cells showed a high
level of IRES-dependent translation. Furthermore, by comparing CMV- or simian virus 40-initiated bicistronic transcripts, they demonstrated that the level of c-myc IRES activity was dependent upon the
amount of bicistronic mRNAs found in the cell: the more they were
expressed, the lower the IRES activity. This suggests that noncanonical
factors are required to activate IRES-dependent translation and that
they might be titrated by an excess of bicistronic mRNAs in the
transiently transfected cells.
We have shown by using a large variety of transiently transfected
cultured cells that EMCV and c-myc IRESs are both efficient in the five species tested (human, monkey, cow, hamster, and mouse). However, the EMCV IRES is globally more efficient than that of c-myc, with a maximum of 110 AU for EMCV versus 30 AU for
the c-myc IRES. This point is well illustrated by the
analysis of ABAE, 293, CHO, and 3T3 cell lines, where the EMCV IRES is
extremely potent while the c-myc IRES is weak. However, this
does not hold true for all cell lines, since in Jurkat lymphoma cells,
for instance, both IRESs present similar activities (around 14 AU).
These differences, obtained in conditions of mRNA overexpression,
reveal the cell types where the trans-acting factors
required by the c-myc IRES are the most limiting.
The different activities observed for EMCV and c-myc IRES
could rely on particular features due to their viral and cellular origins, respectively. This hypothesis is in agreement with a recent
analysis of the activity of another cellular IRES, that of fibroblast
growth factor 2 (FGF-2) (8). We found that within the same
cell lines, the FGF-2 IRES also presented a broad spectrum of activity,
with variations similar to those observed with the c-myc
IRES, ranging from 3 to 36 AU. However, the highest efficiency was
observed in the p53
/
osteosarcoma Saos2 cell line, in
which c-myc IRES was two times less active, and the lowest
efficiency was observed in Jurkat cells, where the c-myc
IRES was five times more efficient. Taken together, these data point
out the tissue specificity of each IRES under study. Strikingly, the
c-myc IRES is active in transformed cells and especially in
neuroblastoma and leukemia cell lines: as their normal nontransformed
counterparts express c-myc mRNA abundantly
(26), it is possible that an aberrant activity level of
the c-myc IRES in these cells contributes to their
progression towards tumorigenesis.
The c-myc IRES shows a much more drastic regulation of its
activity in vivo than ex vivo. This contrasts with the EMCV IRES: we
show that the viral IRES is active throughout development in the whole
E11 embryos as well as in most E16 embryonic and extraembryonic tissues, while c-myc IRES activity is restricted to the E11
embryo proper and to the E16 brain and heart. In adults, the
c-myc IRES is silenced, while the EMCV IRES is fully active
with a broad spectrum of activity. Whereas the wide activity of EMCV
IRES confirms previous data obtained with chicken embryos
(14) and transgenic mice (21), the
developmental regulation of c-myc IRES activity extends the
conclusions reached from analysis of other cellular IRESs, such as the
FGF-2 IRES in transgenic mice (8) and
Antennapedia and Ultrabithorax IRESs in
Drosophila (42). FGF-2 IRES activity was low
but significant in most organs of adult transgenic mice and remarkably
high in their brains (8). This contrasts with the complete
silencing of the c-myc IRES observed in adult tissues and
highlights a specific regulatory mechanism for the c-myc
IRES. This regulation most probably relies on the presence of
spatiotemporally controlled trans-acting factors. Such
factors, which are not in limiting amount in vivo when present, since
we obtained similar results with two transgenic lines (RMyL-22 and
RMyL-28) that express very different levels of pCRMyl transcripts,
could be enhancers of IRES activity in embryonic tissues (37,
40). Alternatively, which is not exclusive, they could be
inhibitors of c-myc IRES activity in adult tissues.
What could be the physiological relevance of the c-myc IRES
regulation observed in vivo? c-myc is widely expressed
during mouse embryogenesis, where active cellular proliferation takes place. Its expression is required during development, since
c-myc gene invalidation causes lethality during the period
between 9.5 and 10.5 days of gestation in homozygotes
(10). Strikingly, the pathologic abnormalities include the
heart and the neural tube, two developing structures in which we have
shown the IRES to be active. Thus the regulation of IRES-dependent
translation might play an important role in the control of
c-myc expression during development.
c-myc gene expression, active in the embryo, is
downregulated in the adult, where most cells are in a nonproliferating
state. Aberrant c-myc overexpression in transgenic mice
leads to tumor formation (24). Previously, the
downregulation of c-myc expression, needed to prevent
abnormal cell proliferation and/or differentiation, has been shown to
take place mainly at the level of mRNA stability (30).
Such a mechanism involves elements located in both the coding and 3'
UTR of the c-myc mRNA sequences (3, 20, 23, 33, 43,
44). The results that we provide in this study indicate that the
5' UTR of this mRNA, in addition, plays a role in the regulation of
c-myc expression in vivo. The translational silencing mediated by the IRES (due to the absence of activating factors or the
presence of inhibiting factors) could ensure the complete repression of
c-myc expression in fully differentiated tissues. This
translational repression could result from the fact that differentiated
tissues have reduced levels of proteins required for cell proliferation
or increased levels (or activities) of proteins involved in cell growth
arrest; such proteins could be involved in the positive or negative
control of IRES-mediated translation. Physiologically, the transient
activation of the IRES (resulting from a change of IRES-regulating
factor activity) would allow quiescent cells to induce rapidly the
synthesis of c-Myc proteins in response to various signals inducing
proliferation, differentiation, or apoptosis, independently of an
increase in the level of mRNA. The transgenic mice that we have
described in this study represent a powerful tool to investigate such a hypothesis.
 |
ACKNOWLEDGMENTS |
We are grateful to J. Auriol for technical assistance and to D. Warwick for English proofreading. We thank Abderahim Mahfoudi, Cécile Orsini, and Hervé Prats for helpful discussions.
This work was supported by grants from the Association pour la
Recherche contre le Cancer, the Ligue Nationale contre le Cancer, the
Conseil Régional Midi-Pyrénées, the European
Commission BIOTECH program (contract 94199-181), and
Rhone-Poulenc-Rorer (now Aventis). L. Créancier was financed
first by the European Commission BIOTECH program and then by Retina France.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
National de la Santé et de la Recherche Médicale U397,
Endocrinologie et Communication Cellulaire, Institut
Fédératif de Recherche Louis Bugnard, C.H.U. Rangueil,
31403 Toulouse Cedex, France. Phone: 33 (5) 61 32 21 42. Fax: 33 (5) 61 32 21 41. E-mail: pratsac{at}rangueil.inserm.fr.
 |
REFERENCES |
| 1.
|
Bernstein, J.,
O. Sella,
S. Y. Le, and O. Elroy-Stein.
1997.
PDGF2/c-sis mRNA leader contains a differentiation-linked internal ribosome entry site (D-IRES).
J. Biol. Chem.
272:9356-9362[Abstract/Free Full Text].
|
| 2.
|
Borman, A. M.,
P. Le Mercier,
M. Girard, and K. M. Kean.
1997.
Comparison of picornaviral IRES-driven internal initiation of translation in cultured cells of different origins.
Nucleic Acids Res.
25:925-932[Abstract/Free Full Text].
|
| 3.
|
Brewer, G., and J. Ross.
1989.
Regulation of c-myc mRNA stability in vitro by a labile destabilizer with an essential nucleic acid component.
Mol. Cell. Biol.
9:1996-2006[Abstract/Free Full Text].
|
| 4.
|
Brinster, R. L.,
H. Y. Chen,
M. E. Trumbauer,
M. K. Yagle, and R. D. Palmiter.
1985.
Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs.
Proc. Natl. Acad. Sci. USA
82:4438-4442[Abstract/Free Full Text].
|
| 5.
|
Cole, M. D.
1986.
The myc oncogene: its role in transformation and differentiation.
Annu. Rev. Genet.
20:361-384[CrossRef][Medline].
|
| 6.
|
Cornelis, S.,
Y. Bruynooghe,
G. Denecker,
S. Van Huffel,
S. Tinton, and R. Beyaert.
2000.
Identification and characterization of a novel cell cycle-regulated internal ribosome entry site.
Mol. Cell
5:597-605[CrossRef][Medline].
|
| 7.
|
Couderc, B.,
H. Prats,
F. Bayard, and F. Amalric.
1991.
Potential oncogenic effects of basic fibroblast growth factor requires cooperation between CUG and AUG-initiated forms.
Cell Regul.
2:709-718[Medline].
|
| 8.
|
Creancier, L.,
D. Morello,
P. Mercier, and A. C. Prats.
2000.
Fibroblast growth factor 2 internal ribosome entry site (IRES) activity ex vivo and in transgenic mice reveals a stringent tissue-specific regulation.
J. Cell Biol.
150:275-281[Abstract/Free Full Text].
|
| 9.
|
Creancier, L.,
H. Prats,
C. Zanibellato,
F. Amalric, and B. Bugler.
1993.
Determination of the functional domains involved in nucleolar targeting of nucleolin.
Mol. Biol. Cell
4:1239-1250[Abstract].
|
| 10.
|
Davis, A. C.,
M. Wims,
G. D. Spotts,
S. R. Hann, and A. Bradley.
1993.
A null c-myc mutation causes lethality before 10.5 days of gestation in homozygotes and reduced fertility in heterozygous female mice.
Genes Dev.
7:671-682[Abstract/Free Full Text].
|
| 11.
|
De Benedetti, A., and A. L. Harris.
1999.
eIF4E expression in tumors: its possible role in progression of malignancies.
Int. J. Biochem. Cell Biol.
31:59-72[CrossRef][Medline].
|
| 12.
|
DePinho, R. A.,
N. Schreiber-Agus, and F. W. Alt.
1991.
myc family oncogenes in the development of normal and neoplastic cells.
Adv. Cancer Res.
57:1-46[Medline].
|
| 13.
|
Galy, B.,
A. Maret,
A. C. Prats, and H. Prats.
1999.
Cell transformation results in the loss of the density-dependent translational regulation of the expression of fibroblast growth factor 2 isoforms.
Cancer Res.
59:165-171[Abstract/Free Full Text].
|
| 14.
|
Ghattas, I. R.,
J. R. Sanes, and J. E. Majors.
1991.
The encephalomyocarditis virus internal ribosome entry site allows efficient coexpression of two genes from a recombinant provirus in cultured cells and in embryos.
Mol. Cell. Biol.
11:5848-5859[Abstract/Free Full Text].
|
| 15.
|
Hann, S. R.,
M. W. King,
D. L. Bentley,
C. W. Anderson, and R. N. Eisenman.
1988.
A non-AUG translational initiation in c-myc exon 1 generates an N-terminally distinct protein whose synthesis is disrupted in Burkitt's lymphomas.
Cell
52:185-195[CrossRef][Medline].
|
| 16.
|
Henis-Korenblit, S.,
N. L. Strumpf,
D. Goldstaub, and A. Kimchi.
2000.
A novel form of DAP5 protein accumulates in apoptotic cells as a result of caspase cleavage and internal ribosome entry site-mediated translation.
Mol. Cell. Biol.
20:496-506[Abstract/Free Full Text].
|
| 17.
|
Holcik, M., and R. G. Korneluk.
2000.
Functional characterization of the X-linked inhibitor of apoptosis (XIAP) internal ribosome entry site element: role of La autoantigen in XIAP translation.
Mol. Cell. Biol.
20:4648-4657[Abstract/Free Full Text].
|
| 18.
|
Huez, I.,
L. Creancier,
S. Audigier,
M. C. Gensac,
A. C. Prats, and H. Prats.
1998.
Two independent internal ribosome entry sites are involved in translation initiation of vascular endothelial growth factor mRNA.
Mol. Cell. Biol.
18:6178-6190[Abstract/Free Full Text].
|
| 19.
|
Jackson, R. J., and A. Kaminski.
1995.
Internal initiation of translation in eukaryotes: the picornavirus paradigm and beyond.
RNA
1:985-1000[Medline].
|
| 20.
|
Jones, T. R., and M. D. Cole.
1987.
Rapid cytoplasmic turnover of c-myc mRNA: requirement of the 3' untranslated sequences.
Mol. Cell. Biol.
7:4513-4521[Abstract/Free Full Text].
|
| 21.
|
Kim, D. G.,
H. M. Kang,
S. K. Jang, and H. S. Shin.
1992.
Construction of a bifunctional mRNA in the mouse by using the internal ribosomal entry site of the encephalomyocarditis virus.
Mol. Cell. Biol.
12:3636-3643[Abstract/Free Full Text]. (Erratum, 12:4807.)
|
| 22.
|
Koromilas, A. E.,
A. Lazaris-Karatzas, and N. Sonenberg.
1992.
mRNAs containing extensive secondary structure in their 5' non-coding region translate efficiently in cells overexpressing initiation factor eIF-4E.
EMBO J.
11:4153-4158[Medline]. (Erratum, 11:5138.)
|
| 23.
|
Lavenu, A.,
S. Pistoi,
S. Pournin,
C. Babinet, and D. Morello.
1995.
Both coding exons of the c-myc gene contribute to its posttranscriptional regulation in the quiescent liver and regenerating liver and after protein synthesis inhibition.
Mol. Cell. Biol.
15:4410-4419[Abstract].
|
| 24.
|
Leder, A.,
P. K. Pattengale,
A. Kuo,
T. A. Stewart, and P. Leder.
1986.
Consequences of widespread deregulation of the c-myc gene in transgenic mice: multiple neoplasms and normal development.
Cell
45:485-495[CrossRef][Medline].
|
| 25.
|
Marcu, K. B.,
S. A. Bossone, and A. J. Patel.
1992.
myc function and regulation.
Annu. Rev. Biochem.
61:809-860[CrossRef][Medline].
|
| 26.
|
Morello, D.,
C. Asselin,
A. Lavenu,
K. B. Marcu, and C. Babinet.
1989.
Tissue-specific post-transcriptional regulation of c-myc expression in normal and H-2K/human c-myc transgenic mice.
Oncogene
4:955-961[Medline].
|
| 27.
|
Nanbru, C.,
I. Lafon,
S. Audigier,
M. C. Gensac,
S. Vagner,
G. Huez, and A. C. Prats.
1997.
Alternative translation of the proto-oncogene c-myc by an internal ribosome entry site.
J. Biol. Chem.
272:32061-32066[Abstract/Free Full Text].
|
| 28.
|
Parkin, N.,
A. Darveau,
R. Nicholson, and N. Sonenberg.
1988.
cis-acting translational effects of the 5' noncoding region of c-myc mRNA.
Mol. Cell. Biol.
8:2875-2883[Abstract/Free Full Text].
|
| 29.
|
Pyronnet, S.,
L. Pradayrol, and N. Sonenberg.
2000.
A cell cycle-dependent internal ribosome entry site.
Mol. Cell
5:607-616[CrossRef][Medline].
|
| 30.
|
Ross, J.
1995.
mRNA stability in mammalian cells.
Microbiol. Rev.
59:423-450[Abstract/Free Full Text].
|
| 31.
|
Ryan, K. M., and G. D. Birnie.
1996.
Myc oncogenes: the enigmatic family.
Biochem. J.
314:713-721.
|
| 32.
|
Saito, H.,
A. C. Hayday,
K. Wiman,
W. S. Hayward, and S. Tonegawa.
1983.
Activation of the c-myc gene by translocation: a model for translational control.
Proc. Natl. Acad. Sci. USA
80:7476-7480[Abstract/Free Full Text].
|
| 33.
|
Schiavi, S. C.,
J. G. Belasco, and M. E. Greenberg.
1992.
Regulation of proto-oncogene mRNA stability.
Biochim. Biophys. Acta
1114:95-106[Medline].
|
| 34.
|
Stein, I.,
A. Itin,
P. Einat,
R. Skaliter,
Z. Grossman, and E. Keshet.
1998.
Translation of vascular endothelial growth factor mRNA by internal ribosome entry: implications for translation under hypoxia.
Mol. Cell. Biol.
18:3112-3119[Abstract/Free Full Text].
|
| 35.
|
Stoneley, M.,
S. A. Chappell,
C. L. Jopling,
M. Dickens,
M. MacFarlane, and A. E. Willis.
2000.
c-Myc protein synthesis is initiated from the internal ribosome entry segment during apoptosis.
Mol. Cell. Biol.
20:1162-1169[Abstract/Free Full Text].
|
| 36.
|
Stoneley, M.,
F. E. Paulin,
J. P. Le Quesne,
S. A. Chappell, and A. E. Willis.
1998.
C-Myc 5' untranslated region contains an internal ribosome entry segment.
Oncogene
16:423-428[CrossRef][Medline].
|
| 37.
|
Stoneley, M.,
T. Subkhankulova,
J. P. Le Quesne,
M. J. Coldwell,
C. L. Jopling,
G. J. Belsham, and A. E. Willis.
2000.
Analysis of the c-myc IRES; a potential role for cell-type specific trans-acting factors and the nuclear compartment.
Nucleic Acids Res.
28:687-694[Abstract/Free Full Text].
|
| 38.
|
Touriol, C.,
A. Morillon,
M. C. Gensac,
H. Prats, and A. C. Prats.
1999.
Expression of human FGF-2 is post-transcriptionally controlled by a unique destabilization element present in the mRNA 3' untranslated region between alternative polyadenylation sites.
J. Biol. Chem.
274:21402-21408[Abstract/Free Full Text].
|
| 39.
|
Vagner, S.,
M. C. Gensac,
A. Maret,
F. Bayard,
F. Amalric,
H. Prats, and A. C. Prats.
1995.
Alternative translation of human fibroblast growth factor 2 mRNA occurs by internal entry of ribosomes.
Mol. Cell. Biol.
15:35-44[Abstract].
|
| 40.
|
Vagner, S.,
C. Touriol,
B. Galy,
S. Audigier,
M. C. Gensac,
F. Amalric,
F. Bayard,
H. Prats, and A. C. Prats.
1996.
Translation of CUG- but not AUG-initiated forms of human fibroblast growth factor 2 is activated in transformed and stressed cells.
J. Cell Biol.
135:1391-1402[Abstract/Free Full Text].
|
| 41.
|
West, M. J.,
N. F. Sullivan, and A. E. Willis.
1995.
Translational upregulation of the c-myc oncogene in Bloom's syndrome cell lines.
Oncogene
11:2515-2524[Medline].
|
| 42.
|
Ye, X.,
P. Fong,
N. Iizuka,
D. Choate, and D. R. Cavener.
1997.
Ultrabithorax and Antennapedia 5' untranslated regions promote developmentally regulated internal translation initiation.
Mol. Cell. Biol.
17:1714-1721[Abstract].
|
| 43.
|
Yeilding, N. M., and W. M. F. Lee.
1997.
Coding elements in exons 2 and 3 target c-myc mRNA downregulation during myogenic differentiation.
Mol. Cell. Biol.
17:2698-2707[Abstract].
|
| 44.
|
Yeilding, N. M.,
M. T. Rehman, and W. M. F. Lee.
1996.
Identification of sequences in c-myc mRNA that regulate its steady-state levels.
Mol. Cell. Biol.
16:3511-3522[Abstract].
|
Molecular and Cellular Biology, March 2001, p. 1833-1840, Vol. 21, No. 5
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.5.1833-1840.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Xu, C.-X., Jin, H., Lim, H.-T., Kim, J.-E., Shin, J.-Y., Lee, E.-S., Chung, Y.-S., Lee, Y.-S., Beck, G. Jr, Lee, K. H., Cho, M.-H.
(2008). High dietary inorganic phosphate enhances cap-dependent protein translation, cell-cycle progression, and angiogenesis in the livers of young mice. Am. J. Physiol. Gastrointest. Liver Physiol.
295: G654-G663
[Abstract]
[Full Text]
-
Audigier, S., Guiramand, J., Prado-Lourenco, L., Conte, C., Gonzalez-Herrera, I. G., Cohen-Solal, C., Recasens, M., Prats, A.-C.
(2008). Potent activation of FGF-2 IRES-dependent mechanism of translation during brain development. RNA
14: 1852-1864
[Abstract]
[Full Text]
-
Cobbold, L. C., Spriggs, K. A., Haines, S. J., Dobbyn, H. C., Hayes, C., de Moor, C. H., Lilley, K. S., Bushell, M., Willis, A. E.
(2008). Identification of Internal Ribosome Entry Segment (IRES)-trans-Acting Factors for the Myc Family of IRESs. Mol. Cell. Biol.
28: 40-49
[Abstract]
[Full Text]
-
Jin, H., Chang, S.-H., Xu, C.-X., Shin, J.-Y., Chung, Y.-S., Park, S.-J., Lee, Y.-S., An, G.-H., Lee, K.-H., Cho, M.-H.
(2007). High Dietary Inorganic Phosphate Affects Lung through Altering Protein Translation, Cell Cycle, and Angiogenesis in Developing Mice. Toxicol Sci
100: 215-223
[Abstract]
[Full Text]
-
Bornes, S., Prado-Lourenco, L., Bastide, A., Zanibellato, C., Iacovoni, J. S., Lacazette, E., Prats, A.-C., Touriol, C., Prats, H.
(2007). Translational Induction of VEGF Internal Ribosome Entry Site Elements During the Early Response to Ischemic Stress. Circ. Res.
100: 305-308
[Abstract]
[Full Text]
-
Jin, H., Hwang, S.-K., Yu, K., Anderson, H. K., Lee, Y.-S., Lee, K. H., Prats, A.-C., Morello, D., Beck, G. R. Jr., Cho, M.-H.
(2006). A High Inorganic Phosphate Diet Perturbs Brain Growth, Alters Akt-ERK Signaling, and Results in Changes in Cap-Dependent Translation. Toxicol Sci
90: 221-229
[Abstract]
[Full Text]
-
Kozak, M.
(2005). A second look at cellular mRNA sequences said to function as internal ribosome entry sites. Nucleic Acids Res
33: 6593-6602
[Abstract]
[Full Text]
-
Cho, S., Kim, J. H., Back, S. H., Jang, S. K.
(2005). Polypyrimidine Tract-Binding Protein Enhances the Internal Ribosomal Entry Site-Dependent Translation of p27Kip1 mRNA and Modulates Transition from G1 to S Phase. Mol. Cell. Biol.
25: 1283-1297
[Abstract]
[Full Text]
-
Martineau, Y., Le Bec, C., Monbrun, L., Allo, V., Chiu, I.-M., Danos, O., Moine, H., Prats, H., Prats, A.-C.
(2004). Internal Ribosome Entry Site Structural Motifs Conserved among Mammalian Fibroblast Growth Factor 1 Alternatively Spliced mRNAs. Mol. Cell. Biol.
24: 7622-7635
[Abstract]
[Full Text]
-
Lam, N., Sandberg, M. L., Sugden, B.
(2004). High Physiological Levels of LMP1 Result in Phosphorylation of eIF2{alpha} in Epstein-Barr Virus-Infected Cells. J. Virol.
78: 1657-1664
[Abstract]
[Full Text]
-
Dobrikova, E., Florez, P., Bradrick, S., Gromeier, M.
(2003). Activity of a type 1 picornavirus internal ribosomal entry site is determined by sequences within the 3' nontranslated region. Proc. Natl. Acad. Sci. USA
100: 15125-15130
[Abstract]
[Full Text]
-
Meignin, C., Bailly, J.-L., Arnaud, F., Dastugue, B., Vaury, C.
(2003). The 5' Untranslated Region and Gag product of Idefix, a Long Terminal Repeat-Retrotransposon from Drosophila melanogaster, Act Together To Initiate a Switch between Translated and Untranslated States of the Genomic mRNA. Mol. Cell. Biol.
23: 8246-8254
[Abstract]
[Full Text]
-
De Pietri Tonelli, D., Mihailovich, M., Schnurbus, R., Pesole, G., Grohovaz, F., Zacchetti, D.
(2003). Translational control of Scamper expression via a cell-specific internal ribosome entry site. Nucleic Acids Res
31: 2508-2513
[Abstract]
[Full Text]
-
Chung, G. T. Y., Yamada, Y., Pannell, R., Forster, A., Rabbitts, T. H.
(2003). The hepatitis C virus internal ribosome entry site facilitates efficient protein synthesis in blood vessel endothelium during tumour angiogenesis. Nucleic Acids Res
31: e46-e46
[Abstract]
[Full Text]
-
Boussadia, O., Niepmann, M., Creancier, L., Prats, A.-C., Dautry, F., Jacquemin-Sablon, H.
(2003). Unr Is Required In Vivo for Efficient Initiation of Translation from the Internal Ribosome Entry Sites of both Rhinovirus and Poliovirus. J. Virol.
77: 3353-3359
[Abstract]
[Full Text]
-
He, Y., Yan, W., Coito, C., Li, Y., Gale, M. Jr, Katze, M. G.
(2003). The regulation of hepatitis C virus (HCV) internal ribosome-entry site-mediated translation by HCV replicons and nonstructural proteins. J. Gen. Virol.
84: 535-543
[Abstract]
[Full Text]
-
Nevins, T. A., Harder, Z. M., Korneluk, R. G., Holcik, M.
(2003). Distinct Regulation of Internal Ribosome Entry Site-mediated Translation following Cellular Stress Is Mediated by Apoptotic Fragments of eIF4G Translation Initiation Factor Family Members eIF4GI and p97/DAP5/NAT1. J. Biol. Chem.
278: 3572-3579
[Abstract]
[Full Text]
-
Pickering, B. M., Mitchell, S. A., Evans, J. R., Willis, A. E.
(2003). Polypyrimidine tract binding protein and poly r(C) binding protein 1 interact with the BAG-1 IRES and stimulate its activity in vitro and in vivo. Nucleic Acids Res
31: 639-646
[Abstract]
[Full Text]
-
Bonnal, S., Boutonnet, C., Prado-Lourenco, L., Vagner, S.
(2003). IRESdb: the Internal Ribosome Entry Site database. Nucleic Acids Res
31: 427-428
[Abstract]
[Full Text]
-
Shiroki, K., Ohsawa, C., Sugi, N., Wakiyama, M., Miura, K.-i., Watanabe, M., Suzuki, Y., Sugano, S.
(2002). Internal ribosome entry site-mediated translation of Smad5 in vivo: requirement for a nuclear event. Nucleic Acids Res
30: 2851-2861
[Abstract]
[Full Text]
-
Valet, P., Tavernier, G., Castan-Laurell, I., Saulnier-Blache, J. S., Langin, D.
(2002). Understanding adipose tissue development from transgenic animal models. J. Lipid Res.
43: 835-860
[Abstract]
[Full Text]
-
Schneider, R., Kozak, M.
(2001). New Ways of Initiating Translation in Eukaryotes?. Mol. Cell. Biol.
21: 8238-8246
[Full Text]
-
Huez, I., Bornes, S., Bresson, D., Creancier, L., Prats, H.
(2001). New Vascular Endothelial Growth Factor Isoform Generated by Internal Ribosome Entry Site-Driven CUG Translation Initiation. Mol. Endocrinol.
15: 2197-2210
[Abstract]
[Full Text]
-
Uhlmann-Schiffler, H., Rossler, O. G., Stahl, H.
(2002). The mRNA of DEAD Box Protein p72 Is Alternatively Translated into an 82-kDa RNA Helicase. J. Biol. Chem.
277: 1066-1075
[Abstract]
[Full Text]