Department of Molecular Biology, The Lerner
Research Institute, The Cleveland Clinic Foundation, Cleveland,
Ohio 44195
Received 18 October 2000/Returned for modification 22 November
2000/Accepted 13 December 2000
U12-dependent introns containing alterations of the 3' splice site
AC dinucleotide or alterations in the spacing between the branch site
and the 3' splice site were examined for their effects on splice site
selection in vivo and in vitro. Using an intron with a 5' splice site
AU dinucleotide, any nucleotide could serve as the 3'-terminal
nucleotide, although a C residue was most active, while a U residue was
least active. The penultimate A residue, by contrast, was essential for
3' splice site function. A branch site-to-3' splice site spacing of
less than 10 or more than 20 nucleotides strongly activated alternative
3' splice sites. A strong preference for a spacing of about 12 nucleotides was observed. The combined in vivo and in vitro results
suggest that the branch site is recognized in the absence of an active
3' splice site but that formation of the prespliceosomal complex A
requires an active 3' splice site. Furthermore, the U12-type
spliceosome appears to be unable to scan for a distal 3' splice site.
 |
INTRODUCTION |
Two types of spliceosomal introns
are known to exist in higher eukaryotic plants and animals (see
reference 6 for a recent review). The major class, termed
here the U2-dependent class, has been the subject of a great deal of
investigation for many years. The minor or U12-dependent class has been
recognized only relatively recently. Many genes contain both types of
introns in an interspersed pattern, requiring cooperation between the two splicing systems to properly identify the exons. The size distributions of introns and the adjacent exons are similar for both
classes of introns. This suggests that the process of splice site
recognition for both classes must contend with similar problems of
distinguishing correct splice sites amidst the often many tens or
hundreds of thousands of nucleotides in a pre-mRNA.
The information needed to specify the sites of splicing of both classes
of introns is largely located at or near the 5' and 3' splice sites.
These regions contain conserved sequences that interact with the
splicing machinery to promote the assembly of the spliceosome and to
specify and activate the chemical cleavage and ligation reactions which
lead to the production of spliced RNA. The 3' splice site region
contains two nucleotides that must be precisely located and activated
for the two chemical steps in the splicing reaction: the branch site
adenosine, with its associated 2' hydroxyl group, which is the
nucleophile in the first step of splicing, and the 3' splice site
residue, which lies immediately adjacent to the phosphodiester bond
that is transesterified in the second step of splicing. The 3' splice
site is physically separate from the branch site residue and is not
involved in the chemistry of the first-step reaction. Indeed, several
studies have shown that the first splicing step can occur in vitro on RNA molecules in which no active 3' splice site is present due to
either truncation of the substrate RNA (1, 13, 33) or mutation of the 3' splice site AG (15, 31, 39).
In U2-dependent introns, the branch site adenosine and the 3' splice
site are generally separated by 11 to 40 nucleotides, although cases
are known where they can be over 100 nucleotides apart (18,
37). Positioned between the branch site and the 3' splice site
is a pyrimidine-rich region that appears to be a major recognition
element for the 3' end of an intron. Over the years, much effort has
gone into the analysis of these sequence elements to determine the
spliceosomal components with which they interact and the role that each
plays in specifying the final site of splicing (See references
24 and 30 for recent reviews).
Many studies suggest that 3' splice site selection is largely governed
by a 5'-to-3' scanning mechanism from an independently recognized
branch site. Natural introns use the first AG downstream of the branch
site as the 3' splice site (25, 26). This model is also
supported by evidence that 3' splice sites can be located over 100 nucleotides from the branch site (18, 37). This implies that there is no strict limit on how far a 3' splice site can be from
the branch site. Recent in vitro studies using an artificial two-piece
trans-splicing system in which the 3' splice site is supplied on a separate piece of RNA support a model of strict scanning,
with the first AG dinucleotide being selected (1, 2, 8).
However, other studies have shown that potential 3' splice sites can
compete with one another, suggesting either that scanning is
"leaky" or that distal sites can be more active than proximal sites
due to distance or sequence preferences (10, 23, 38). A
recent study of splicing in the absence of the second-step factor hSlu7
showed that 3' splice sites both upstream and downstream of the normal
3' splice site could be used in vitro in the second-step reaction
(10). These authors suggest that the normal 3' splice site
is selected but its use is suppressed in the absence of hSlu7. A
concomitant effect is that the 5' exon is more loosely bound to the
spliceosome, allowing it to react with normally cryptic 3' splice sites.
The many different systems and organisms used in these studies over the
years make it difficult to establish a single mechanistic picture of 3'
splice site selection. It may be that more than one mechanism can be
used and the rate-determining step may differ for different introns and
for different organisms. For example, similar constructs containing
multiple AGs show competition in Saccharomyces cerevisiae
(23) but not in mammalian in vitro systems
(8). At one extreme are AG-independent introns
(31), in which the first splicing step can occur in the
absence of a 3' splice site. In this type of intron, a simple scanning
mechanism may suffice. In AG-dependent introns, the 3' splice site is
required for spliceosome formation and the first step of splicing.
Here, the 3' splice site is recognized at least once early in the
splicing pathway and then again for the chemical event of the second
step. The precise AGs used for the different recognition events may not
be the same (47), and likewise, the specific factors and mechanisms of recognition may also differ.
Recent results have shown that the small subunit of U2AF interacts with
the 3' splice site AG (23, 46, 48). The role of the small
subunit appears to be more significant when the polypyrimidine tract,
which interacts with the large subunit, is short or less pyrimidine
rich (46). These also appear to be situations in which
introns are AG dependent (31). In such circumstances, a
strong preference for a 3' splice site within a preferred distance of
the branch site and adjacent to the polypyrimidine tract might be
predicted, and indeed, there is evidence of such a constraint (46). AG-independent introns, on the other hand, may not
require the small subunit of U2AF to stabilize binding of the large
subunit to the polypyrimidine tract, thus allowing spliceosome
formation and the first step of splicing to take place without prior
selection of a 3' splice site. In this circumstance, most readily seen
in the trans-splicing assay (8), a simple
scanning mechanism might then select the 3' splice site without a
strong distance constraint.
A distinctly different sequence arrangement is seen in the minor
U12-dependent class of introns. These introns lack a polypyrimidine tract and have a highly conserved branch site consensus sequence that
appears to be the major recognition element for the 3' splice site
(6, 16, 43). Another characteristic of this class of
introns is that the distance between the branch site and the 3' splice
site is short and relatively consistent. An analysis of the information
content of U12-dependent 3' splice sites showed that the branch site
consensus contained too little information to uniquely specify a 3'
splice site (6). To further constrain 3' splice site
selection, it would be useful to be able to use the existence of an
appropriate 3' splice site within a set distance of the branch site as
an additional recognition element. This requires, however, that the 3'
splice site be recognized along with the branch site element during
spliceosome formation. In a recent study, Frilander and Steitz showed
that U12-dependent prespliceosome complex formation required the
participation of both the 5' splice site and the branch site
(14). They also showed that an RNA which was truncated
between the branch site and the 3' splice site was still competent to
form complexes. One interpretation of this finding is that the 3'
splice site does not play a role in the early steps of U12-dependent splicing.
In this report, we investigate the nucleotide requirements for a
functional U12-dependent 3' splice site and the consequences of
altering the spacing between the branch site and the 3' splice site
both in vivo and in vitro. Our goal was to determine if this distance
is mechanistically constrained to the limited range observed so far in
native U12-dependent introns and to determine the consequences on
splicing and spliceosome formation of violating these constraints. The
results suggest that the recognition of the 3' splice site in
U12-dependent introns differs substantially from the process in
U2-dependent introns.
 |
MATERIALS AND METHODS |
DNA constructs.
The four-exon, three-intron P120 intron F
minigene construct and mutants derived from it have been described
(11, 17, 19). Mutations used in this study were introduced
by PCR methods using pairs of oligonucleotides containing the desired
mutations. All mutations were confirmed by DNA sequencing.
Analysis of in vivo splicing.
Transient transfection of the
P120 minigene plasmids into cultured CHO cells was done as described
(17, 19). For these experiments, 1 µg of P120 plasmid
and 9 µg of pUC19 carrier DNA were added to 106 cells.
Total RNA was isolated from cells 48 h after transfection, treated
with DNase I, reverse transcribed using a vector-specific primer, and
amplified by PCR using P120 exon 6- and 7-specific primers as described
(11, 19). For high-resolution mapping, the exon 7 primer
was 5'-end labeled with 32P, and the PCR products were
analyzed by electrophoresis in 8% polyacrylamide gels containing 7 M
urea and 40% formamide. To verify the sites of splicing used in the
various mutants, PCR products were separated on agarose or
nondenaturing polyacrylamide gels. Bands were excised, reamplified,
purified by gel electrophoresis, and sequenced. For Fig. 5, the exon 7 primer (TCAGACAGAGGGAAGAGGTCCATGAG) was located at the 3'
end of the exon. The PCR products were analyzed by agarose gel
electrophoresis and visualized using ethidium bromide.
In vitro splicing and spliceosome formation.
DNA templates
for in vitro transcription were prepared by PCR amplification using the
minigene constructs with 3' splice site sequences shown in Fig. 2 as
described (11). RNA was synthesized from these templates
using T7 RNA polymerase and gel purified, and equal amounts of each RNA
were spliced in vitro for 3 h in the presence of an antisense
2'-O-methyl oligonucleotide directed against U2 snRNA as
described (11). An antisense 2'-O-methyl oligonucleotide against U12 snRNA was included where indicated. RNA
from splicing reactions was separated on 8% polyacrylamide gels under
denaturing conditions and detected with a Molecular Dynamics PhosphorImager.
For the spliceosome formation assay, splicing reactions were assembled
under conditions identical to those of the splicing assays and included
the antisense 2'-O-methyl oligonucleotide directed against
U2 snRNA. After 30 and 90 min of incubation at 30°C, aliquots were
removed and heparin was added to a concentration of 250 µg/ml
(40, 41). Following 15 min on ice, the samples were loaded
onto 4% polyacrylamide (80:1, acrylamide-bisacrylamide)-Tris-glycine native gels (20). The gels were run for 3 h at 5 W
and dried, and the RNA was detected with a Molecular Dynamics
PhosphorImager. For the adenovirus major late intron precursor control
reaction, the anti-U2 oligonucleotide was omitted and incubation was
for 15 min.
 |
RESULTS |
Natural distribution of branch site to 3' splice site
distances.
At the time that we first described the conserved
branch site element in U12-dependent introns, we noted that the
distance between this element and the 3' splice site was short compared to U2-dependent introns and varied in our limited sample of introns over only a few nucleotides (16). Subsequently, we have
greatly expanded the list of putative U12-dependent introns by searches through the genomic databases (5).
The observed distribution of distances from an all-phylum collection is
shown in Fig. 1. The distribution shows
clear limits of 10 nucleotides at the minimum and 20 nucleotides at the
maximum. Within this collection, only the plant and mammal phylogenetic subgroups contained enough introns to compare, and these two subgroups showed no significant differences in mean distance or limits. The other
subgroup comparison we made was between U12-dependent introns that have
AU and AC terminal dinucleotides and those that have GU and AG termini.
The AU-AC subgroup contained introns with distances from 10 to 16, with
a peak at 12, while the GU-AG subgroup had distances between 11 and 20 nucleotides, with a broad peak between 12 and 16. It is not clear if
this difference is functionally significant. In this report we have
used the human nucleolar protein P120 intron F, which is a member of
the AU-AC subgroup with a wild-type spacing of 10 nucleotides.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 1.
Distribution of branch site-to-3' splice site distances
in putative U12-dependent introns. The data are from the compilation of
putative U12-dependent introns in Burge et al. (5). The
solid line shows the distribution for all introns, while the black and
grey bars show the distribution of distances in the AU-AC and GU-AG
subclasses of U12-dependent introns, respectively. The branch site is
assumed to be the position of the second adenosine in the branch site
consensus sequence UCCUUAAC. All branch sites could be
aligned with the consensus without ambiguity. In a few cases, the
presumed branch site was a G residue.
|
|
Nucleotide requirements for 3' splice site function in vivo.
In order to manipulate the location of the 3' splice site of the P120
intron F, we needed to determine the sequence requirements for
efficient 3' splice site function in vivo. While most U12-dependent introns that begin with AU end in AC, examples of AU-AG and AU-AA introns have been found (5, 11, 43). To clarify the roles of the last and penultimate nucleotides of this intron, we tested single mutations of these positions in vivo. All mutations were made in
the four-exon, three-intron minigene construct described previously
(17, 19). The constructs were transfected into CHO cells,
and RNA was harvested after 48 h. The splicing pattern of the
transfected P120 intron F was determined by reverse transcription (RT)
of the RNA using a minigene-specific primer and PCR amplification of
the products using primers in the flanking exons 6 and 7. Figure 2 shows the sequences of the mutants and
indicates the sites of in vivo splicing used in each case.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 2.
Sequences of the 3' splice site mutants used in this
study. The common 5' splice site is shown at the left. The 3' splice
sites are shown at the right. The common branch site is shown in bold,
and the mutated positions are underlined. The sites of in vivo splicing
for each construct are indicated by the arrows. Major sites are
indicated by dark arrowheads, and minor sites are indicated by light
arrowheads. The numbers at the top refer to the distance in nucleotides
between the branch site adenosine and the dashed lines.
|
|
The RT-PCR results for mutations in the 3' splice site terminal AC
dinucleotide (residues A98 and C99) are shown in Fig.
3. The results for mutations of C99 show
that any nucleotide can serve as the terminal residue, but there are
clear differences in the efficiency with which the different
nucleotides are used. Note that in each case, an AU dinucleotide is
present immediately following the normal 3' splice site at position +12
and an AG dinucleotide is present six nucleotides further downstream at +18. With the wild-type AC, only the +10 site is used to a detectable level. In the C99G mutant, in which the +10 splice site is AG, the AU
at +12 is not used but the AG at +18 is used to a small extent. In
addition, there is activation of a previously observed internal cryptic
U2-type intron with a 3' splice site at
6 (11, 40, 41).
In the C99A mutant, the majority of splicing is to the AA at +10, with
slight activation of the +12 AU and +18 AG. In the C99U mutant, the AUs
at both +10 and +12 are used, with the +12 position predominating. Some
use of the +18 AG is also apparent. This result suggests that the +12
position is favored over the +10 position. This is confirmed by the
results presented below.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 3.
Pattern of in vivo splicing of 3' splice site
dinucleotide mutants. The indicated minigene constructs were
transfected into CHO cells, and total RNA was prepared after 48 h.
The splicing pattern of the P120 intron F was determined by RT-PCR
amplification and seperation of the products on a denaturing gel. The
positions of spliced and unspliced PCR products are shown, as well as
the position of a U2-dependent cryptic splice that is activated in some
constructs. The numbers at the left indicate the distance in
nucleotides between the branch site and the 3' splice site in each
product.
|
|
To address the importance of the penultimate A residue at the 3' splice
site, A98 was mutated to U, G, or C and the mutants were tested in
vivo. Figure 3 (lanes 5 to 7) shows the splicing patterns of these
mutants. In all cases, the mutants showed no or very minimal splicing
to the +10 site. Instead, splicing occurred at the +12 AU and, to a
small extent, at the +18 AG site. From these results, we concluded that
a U12-dependent 3' splice could be inactivated by mutation of the
penultimate A residue. For the experiments below, we used A to U or A
to C mutations to achieve inactivation of the wild-type or potential
alternative 3' splice sites.
Spacing requirements for 3' splice site function in vivo.
To
investigate the functional constraints on the distance between the
branch site and 3' splice site in vivo, we varied this distance in the
P120 intron between 8 and 27 nucleotides. The natural sequence around
the wild-type AC 3' splice site was modified to create different
spacings. We also generated additional mutations to determine the
optimum spacing for this intron. The mutant constructs for these
experiments are shown in Fig. 2.
Figure 4 shows the RT-PCR results of in
vivo splicing of P120 introns with a variety of branch site-to-3'
splice site distances. The wild-type P120 intron has a distance of 10 nucleotides, the smallest distance seen in natural introns (see Fig.
1). As expected, all splicing was to the AC at the wild-type position
(Fig. 4, lane 1). When the AC dinucleotide was moved one nucleotide
upstream to a distance of 9 nucleotides (P120 +9 AC, lane 2), a small
amount of splicing occurred at the +9 site, but most splicing occurred at the AU dinucleotide at the +12 position. This is similar to the
activation of the same +12 AU in the A98 mutations described above. A
further translocation of the AC to the +8 position led to even more
splicing at the +12 position (lane 3; the band at the position of +10
was not reproducible). An additional effect seen in this mutant was the
activation of the cryptic U2-dependent splice sites (11).
Activation of these sites was previously observed in mutant introns
with debilitated 5' splice sites (19). The effects of
these mutations show that moving the 3' splice site even a single
nucleotide closer to the branch site from the observed natural limit of
10 nucleotides significantly weakens the 3' splice site.

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 4.
Pattern of in vivo splicing of 3' splice site spacing
mutants. The analysis and presentation are as in Fig. 3.
|
|
To test the functional upper limit of this spacing, we constructed
modified introns with AC dinucleotides at progressively larger
distances. When an AC was positioned 18 nucleotides from the branch
site, most splicing was to this position (Fig. 4, lane 5). A small
amount of splicing also occurred at the +12 position, where there was a
UU dinucleotide (location confirmed by sequencing). An AG dinucleotide
positioned at +18 gave similar results (lane 4). To inactivate the +18
splice site, the A at +17 was mutated to C. In this mutant, P120 +27
AC, the closest potential 3' splice sites become the AG at +25 and the
AC at +27 (Fig. 2). The +25 AG is preceded by a consensus C residue,
while the AC at +27 is preceded by a less common G residue. As shown in
Fig. 4, lane 6, no splicing was observed to either potential 3' splice
site; only splicing to the UU site at +12 was observed. In addition, levels of both the U2-dependent cryptic spliced product and unspliced RNA were increased in this mutant.
We next wanted to determine the preferred distance between the branch
site and the 3' splice site. For this, we inserted a sequence
containing five repetitions of AC into the 3' splice site region
so that potential 3' splice sites with the sequence CAC were available
at distances of 10, 12, 14, 16, and 18 residues from the
branch site adenosine (P120 oligo AC, Fig. 2). When this construct was
assayed in vivo, splicing occurred almost exclusively at the +12
position (Fig. 4, lane 7). Note that in this construct, a
completely wild-type CAC 3' splice site positioned 10 nucleotides from the branch site is ignored in favor of the site
located 12 nucleotides from the branch site. A similar result was
seen in the A99U mutant above, in which AU sites were present at +10
and +12.
Finally, to test the relative strengths of 3' splice sites located near
the limits of the natural distance window, we mutated G107 to C to
generate a new CAC 3' splice site located 18 nucleotides from the
branch site in the presence of the normal 3' splice site at a distance
of 10 nucleotides. Lane 8 in Fig. 4 shows that only a trace amount of
splicing to the +18 site was seen, with the vast majority of splicing
events using the site at +10. Thus, branch site-proximal AC
dinucleotides appear to be dominant over distal ones. However, this is
not a strict requirement, since a site at +12 is used preferentially
over a site at +10 in both the oligo AC and C99U constructs.
Spacing mutants do not activate cryptic branch sites.
The
RT-PCR assay used above to analyze the splicing products of the various
mutants detects only spliced RNAs which contain most of exons 6 and 7. Spliced products resulting from splicing to more distal cryptic splice
sites would be missed. Our previous experiments with mutations in the
branch site region of intron F demonstrated that splicing to the normal
3' splice site was abolished (17). Subsequent work has
shown that the effect of branch site mutations is to shift 3' splice
site usage to a cryptic U12-dependent 3' splice site 124 nucleotides
downstream of the wild-type 3' splice site (R. A. Dietrich,
A. S. Seyboldt, and R. A. Padgett, submitted for publication).
To determine if such alternative splicing events were being activated
in the mutant constructs discussed above, an RT-PCR analysis using a
downstream distal primer was performed. Figure 5 shows that while the branch site
element mutant P120 TC84/85AG (lane 2) activated splicing to the +124
cryptic 3' splice site, none of the spacing mutants used in this study
significantly activated this cryptic 3' splice site. In particular, the
+27 AC construct, which is unable to splice using the normal branch
site, was also unable to use the +124 cryptic branch site.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 5.
Cryptic U12-dependent 3' splice site usage in branch and
3' splice site mutants. The indicated minigene constructs were
transfected and assayed as in Fig. 3 except that a primer at the 3' end
of exon 7 was used in the PCR amplification and the products were
seperated on an agarose gel. Lane 2 shows the activation of the cryptic
U12-dependent 3' splice site at position 124 of exon 7 when the branch
site is mutated from the consensus sequence UCUUAAC to
AGUUAAC. Lane 10 is 50-bp ladder molecular size markers
(Life Technologies).
|
|
In vitro effects of alterations of the 3' splice site.
The in
vivo splice site selection experiments discussed above defined the
range of distances between the branch site and the 3' splice site that
are compatible with U12-dependent splicing. Since such experiments only
assay the final sites of splicing, however, they cannot determine the
effects of splice site alterations on spliceosome formation or the
individual steps of splicing.
To investigate the effects of 3' splice site alterations on individual
splicing and spliceosome assembly steps, we prepared in vitro RNA
transcripts of the P120 intron F and portions of the adjacent exons
from the wild-type and mutant constructs used above. These RNAs were
spliced in an in vitro HeLa cell nuclear extract system in the presence
of an antisense 2'-O-methyl oligonucleotide against U2
snRNA. This reagent blocks the activity of the U2-dependent splicing
system and activates the U12-dependent splicing system on this
precursor RNA (11, 41).
Figure 6 shows the pattern of spliced RNA
after 3 h of reaction. Three RNA products of U12-dependent
splicing can be seen: the spliced exons and the excised lariat intron,
which are the products of the second step of splicing, and the 5' exon
intermediate RNA produced by the first step of splicing. The appearance
of all these RNAs is sensitive to the addition of an antisense
oligonucleotide against U12 snRNA (even-numbered lanes). The other
product of the first step of splicing, the lariat intron-exon 2 RNA, is
obscured due to comigration with another band.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 6.
In vitro splicing patterns of 3' splice site constructs.
Templates for in vitro transcription of the indicated 3' splice site
constructs were produced by PCR amplification from the minigene
constructs tested in vivo. Equal amounts of transcribed precursor RNAs
were spliced in vitro. All reactions contained an anti-U2 snRNA
2'-O-methyl oligonucleotide which inhibits U2-dependent
splicing. An anti-U12 snRNA 2'-O-methyl oligonucleotide was
also added to even-numbered lanes to inhibit U12-dependent splicing.
The structures of the various RNA products are shown on the left and
correspond, from top to bottom, to the unspliced precursor, spliced
exon product, the exon 1 intermediate generated by the first step of
splicing, and the excised lariat intron generated by the second step of
splicing. The lariat introns from different constructs migrate
differently due to the varying length of RNA 3' of the branch. A
degradation product which migrates below the position of spliced exons
is labeled with an asterisk. The splicing reactions shown in lanes 17 and 18 used a truncated precursor RNA that terminated 7 nucleotides 3'
of the branch site and thus was missing the 3' splice site and the
downstream exon.
|
|
As shown in Fig. 6, the in vitro splicing activity of the spacing
mutants is similar to that observed in vivo. The Oligo AC and G107C
mutants spliced with similar efficiency to the wild type, while the +18
AG and +18 AC mutants were slightly impaired. In contrast, the +27 AC
mutant was inactive for both steps of splicing.
An interesting result was observed with the +9 AC and +8 AC mutant
RNAs. These could proceed through the first step of splicing to produce
the 5' exon intermediate RNA but were partially blocked prior to the
second step of splicing, as indicated by the decreased abundance of the
lariat intron and spliced exon product RNAs. This second-step defect
could be due either to the AC's being too close to the branch site or
to the use of the AU 3' splice site. To differentiate between these
possibilities, the splicing abilities of the C99U and A98U mutants were
also tested. These mutants showed an even more pronounced defect in the
second step of splicing than the +9 AC and +8 AC mutants, suggesting
that an AU 3' splice site is a poor substrate for attack by the
upstream exon in U12-dependent splicing.
To ensure that these mutant RNAs were using the same 3' splice sites in
vitro as we observed in vivo, splicing reactions similar to those in
Fig. 6 were analyzed by RT-PCR (Fig. 7).
In all cases, the major spliced products were the same as seen in the
in vivo analysis shown in Fig. 4.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 7.
RT-PCR analysis of the products of in vitro splicing.
RNA was isolated from the position of spliced exons in a preparative
version of the experiment shown in Fig. 6, reverse transcribed using a
primer near the 3' end of the precursor, and PCR amplified using a
nested 3' primer and a 5' primer in the first exon, followed by
denaturing gel electrophoresis to determine the sites of splicing. Due
to differences in RNA recovery and amplification, differences in band
intensities between lanes are not quantitatively meaningful.
|
|
These precursor RNAs were also assayed for their ability to form
spliceosomal complexes using non denaturing gel electrophoresis. Two
splicing-specific complexes are resolved in this system: complex A
represents an early-forming prespliceosome containing U11 and U12
snRNPs, while complex B is the product of the further addition of
U4atac/U6atac and U5 snRNPs and the concomitant loss of the U11 snRNP
(40, 41). As shown in Fig.
8, both splicing complexes formed on all
the RNAs except the +27 AC mutant. The +18 AG and +18 AC mutant RNAs
formed a smaller amount of both complexes than the wild type,
consistent with their somewhat diminished splicing activity in vitro.
The Oligo AC construct appeared to form complex A more efficiently than
the wild type, but neither complex B formation nor splicing was
stimulated. The +27 AC mutant RNA did not form either complex to a
detectable degree.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 8.
Spliceosome formation activity of 3' splice site
constructs. Equal amounts of the in vitro-transcribed RNA used in Fig.
6 were incubated under U12-dependent splicing conditions for the times
indicated, treated with heparin, and separated on nondenaturing gels.
The splicing-specific complexes A and B are well resolved from the
nonspecific complex H. Lane 1 shows complexes formed on a U2-dependent
adenovirus major late intron precursor incubated in the absence of the
anti-U2 snRNA oligonucleotide.
|
|
The lack of spliceosome formation activity of the +27 mutant was
surprising, since Frilander and Steitz (14) have reported that an in vitro transcript which was truncated between the branch site
and the 3' splice site was able to form both A and B complexes. We
repeated this spliceosome complex result (P120 3' Trunc; Fig. 8, lanes
22 and 23) and also confirmed that this RNA was unable to carry out the
first step of splicing to a detectable level (Fig. 6, lane 17). Thus,
this truncated RNA, which is missing sequences downstream of the branch
site, can still form spliceosome complexes, while the +27 AC mutant
RNA, which has RNA but no functional splice sites downstream of the
branch site, could not.
 |
DISCUSSION |
Any nucleotide can function at a U12-dependent 3' splice site.
U12-type introns that begin with the dinucleotide AU usually end with
the dinucleotide AC. In a few cases, AA and AG can also serve as 3'
splice sites. When we experimentally mutated the 3' nucleotide of an
AU-AC intron, any nucleotide could function at the end of the intron in
vivo. From the pattern of use of other nearby sites, a rough idea of
the strength of the various sites can be deduced. The normal AC site
and the AA mutant site were used preferentially over all other sites,
including the AU and AG dinucleotides located two and eight nucleotides
downstream, respectively. When the normal AC was mutated to AG, the AG
at +18 was also used to a detectable level, while the AU was not. Finally, when the normal site was changed to AU, the downstream AU was
used significantly more than the AU at the normal site. This preference
for a 3' splice site close to the +12 position was also demonstrated in
the Oligo AC construct. Thus, the in vivo data suggest that while any
nucleotide can serve as the 3' end of a U12-type AU intron, there is a
preference, with the order AC
AA > AG > AU. This
order is supported by the in vitro splicing data showing that splicing
to an AU 3' splice site causes a defect in the second step of splicing.
In contrast to the 3'-terminal nucleotide, the penultimate A residue
appears to play a major role in specifying the 3' splice site. When
this residue was mutated to any other nucleotide, an alternative AU 3'
splice site was selected. Mutation of the A residues at the alternative
3' splice sites likewise inactivated them.
The ability of the U12-dependent splicing system to use any nucleotide
at the 3' splice site contrasts sharply with the very strong
requirement for a G residue at the 3' splice site seen in U2-dependent
introns. In mammalian U2-type introns, it appears that this requirement
is due to at least two types of interactions. First, the small subunit
of U2AF has been shown to bind to the 3' splice site AG but not to an
AC mutant (46). Second, selection of the 3' splice site in
the in vitro trans-splicing reaction, in which the first
step of splicing takes place in the absence of a 3' splice site, also
shows a strong bias to AG 3' splice sites (2). This second
type of selection could be due to interactions with the 5' splice site
G residue, as seen in both the yeast (7, 29) and mammalian
(36) U2-dependent systems.
In U12-type introns of the AU-AC class used here, it seems unlikely
that either subunit of U2AF is involved in 3' splice site selection or
activation. The absence of a polypyrimidine tract between the branch
site and the 3' splice site suggests that the large subunit does not
bind to this region, and the demonstrated inability of the small
subunit to bind to AC sequences suggests that it is not involved either
(46, 48). However, biochemical attempts to address this
question directly have so far been unsuccessful (44;
unpublished results).
The differences in efficiency seen with different 3' splice site
nucleotides in the U12-dependent system imply that there is some
specificity in its selection. Both earlier data (11) and
work to be published elsewhere shows that in the U12-type as in the
U2-type splicing system, the identity of the first intron nucleotide
influences the choice of the last nucleotide. For instance, in both
splicing systems, an AU-AC pairing is functional, while a GU-AC pairing
is not (7, 11, 29, 36). The data here show that a first
intron nucleotide A residue, while most active with a terminal C
residue, can functionally splice to any residue in U12-dependent
introns. For U2-type introns in both the yeast (7, 29) and
mammalian (36) systems, only an AU-AC pairing is active.
In agreement with this, all of the recently identified natural U2-type
introns which begin with AU also end with AC (11, 43, 45).
Thus, while both splicing systems have similar preferences for pairs of
first and last nucleotides, the U12-dependent system appears to be more
flexible in its choice of a 3' splice site than the U2-dependent system.
Branch site-to-3' splice site distance is functionally constrained
in U12-type introns.
U12-dependent introns appear to be very
dependent on a properly situated 3' splice site for activity. The
branch site-to-3' splice site distances of natural introns fall in the
range of 10 to 20 nucleotides. When we reduced the distance from the 10 nucleotides found in the wild-type human P120 intron F to either 9 or 8 nucleotides, we found that splicing in vivo occurred instead at a
cryptic AU 3' splice site at the +12 position. In vitro, these mutants
showed only weak splicing to any 3' splice sites but were able to form
spliceosomes with close to wild-type efficiency and progressed through
the first step of splicing. The second step of splicing was
significantly inhibited in these mutants, probably due to the use of a
3' splice site U residue, since the same second-step defect was seen
with the C99U and A98U mutants. These results show that 10 nucleotides
represents a significant functional minimum for the branch site-to-3'
splice site distance in U12-dependent introns, consistent with the data
on natural introns.
When we moved the 3' splice site to 18 nucleotides from the branch
site, we observed that this weakened use of the 3' splice site. In
vivo, a 3' splice site at +18 activated use of a cryptic UU 3' splice
site located at +12. In vitro, the +18 3' splice site mutants formed
spliceosomes less efficiently than wild-type RNA and were less
efficiently spliced. When placed in competition with the wild-type AC
at +10, an AC at +18 was inactive in vivo and in vitro. These results
suggest that moving the 3' splice site to near the 20-nucleotide
maximum observed in normal introns causes significant defects in splice
site function.
Finally, when we moved the first available 3' splice site beyond the
20-nucleotide limit, no U12-dependent splicing was observed either in
vivo or in vitro. Furthermore, this mutant was unable to form
spliceosome complexes in vitro. From these results, it appears that
there is a maximum functional limit for the branch site-to-3' splice
site of between 18 and 27 nucleotides.
3' splice sites at a spacing of 12 to 13 nucleotides are highly
preferred over proximal and distal sites.
To determine the optimal
distance between the branch site and the 3' splice site, we constructed
an intron in which CAC motifs were located at 10, 12, 14, 16, and 18 nucleotides and tested it in vivo and in vitro. The clear result was
that over 90% of splicing was to the AC at a spacing of 12 nucleotides. Similarly, in the C99U construct with AU dinucleotides at
+10 and +12, most splicing events used the +12 position. These results
establish that the optimal spacing is about 12 nucleotides.
The idea of an optimal distance for the 3' splice site downstream from
the branch site led us to examine the 3' splice site regions of
U12-dependent introns for natural examples of such 3' splice site
choice. The mouse cdk5 gene contains an intron with good
matches to U12-dependent splice site sequences of the AU-AC class
(28). The 3' end of this intron contains the sequence GACAC/AC, where the slash denotes the 3' splice site located
13 nucleotides from the branch site. This intron has AC dinucleotides located at spacings of 11, 13, and 15 nucleotides but only uses the AC
at +13. This natural example differs slightly from our experimental
construct in that the AC at +11 is preceded by a G residue rather than
the consensus pyrimidine.
Another interesting example is provided by the human E2F1 intron 4, a
putative U12-dependent AU-AC intron which has a 3' splice site sequence
of GCCAAC/CC, with the 3' splice site located at a spacing
of 11 (28). In this case a CAA is located at +10, where it
was functional in the P120 C99A mutant but is skipped in favor of the
AAC located at +11. A final example is the sixth intron of the human
GT335 gene, a putative U12-dependent AU-AC intron which ends with the
sequence CACAC (21). The functional 3' splice site is
located at a spacing of 11, while a nonfunctional CAC sequence is at a
spacing of 9 nucleotides.
U12-dependent 3' splice sites are not selected by a simple scanning
mechanism.
The results discussed above suggest that 3' splice site
selection in the U12-dependent system is not dictated solely by a scanning mechanism. If a simple scanning mechanism were used, the CAC
located at a distance of 10 nucleotides in the Oligo AC construct would
have been used exclusively. In fact, the CAC at +12 was used in
preference to the +10 position. The combination of the small range of
acceptable distances, the pronounced preference for a spacing of about
12 nucleotides, and the selection of a downstream over an upstream 3'
splice site strongly argue against a scanning model for 3' splice site selection.
The data appear much more compatible with a model in which the pre-mRNA
is held into the spliceosome by interactions at the branch site at a
position near the active site for step two of splicing. The RNA
extending from the branch site must span this distance and present a
functional 3' splice site to the active site for step two of splicing.
If the distance is made too short, downstream cryptic splice sites
become active. If the distance is made too long, even highly
unfavorable sequences such as UU can be used as 3' splice sites if they
are located at the optimum distance. When the 3' splice site is moved
to 27 nucleotides, splicing to all sites is dramatically reduced. The
in vitro results show that this intron cannot form prespliceosomes or
spliceosomes, suggesting that proper 3' splice site spacing plays a
role in the early events of spliceosome formation as well as in the
final stages of splicing.
Interestingly, an example of a U2-type intron which appears to violate
the first AG rule came out of our analysis of U12-type introns. The
human cardiac beta myosin heavy chain (GenBank accession no. X52889)
intron 9 is a U2-type intron that is in an identical position to the
U12-type intron 5 in the smooth muscle homolog (GenBank accession no.
AF001548), a common finding in gene families that we have discussed
previously (5). In the cardiac U2-type intron, the 3' end
of the intron is TTCAGCAG/ATC, indicating that a
fully consensus CAG is skipped in favor of an immediately downstream
CAG. While the exact U2-type branch site cannot be determined, a 90%
pure pyrimidine region of about 35 nucleotides is located upstream of
this sequence. In addition, the 5' splice site is a U2-type
GTGAGT, and no U12-type branch site is present. A similar
result was obtained in an experimental intron with closely spaced AGs
(38). It appears, then, that a mechanism other than scanning for the first AG 3' of the branch site may apply in at least
some U2-type introns as well.
U12-type splicing complex formation requires an active 3' splice
site.
The results of in vitro spliceosome formation assays on the
various 3' splice site constructs shows that an active 3' splice site
is required for assembly of the A complex. When the 3' splice site is
moved to +18, spliceosome formation efficiency is reduced. When no 3'
splice site is available, as in the case of the +27 AC mutant, no
specific complexes form. However, the lack of complexes detectable with
the gel shift assay does not mean that the branch site is not being
recognized by the splicing machinery. Evidence that the branch site is
still active comes from the demonstration that the downstream cryptic
branch site-3' splice site at +124 is not used in any of the
constructs, even when no other 3' splice site is used. From this, it
appears that the wild-type branch site is recognized, possibly by U12
snRNP and other factors, in such a way as to limit the ability of the
5' splice site and its associated factors to interact with another
branch site-3' splice site. Nevertheless, this interaction with the
wild-type branch site is unable to proceed to the A complex without the
participation of a functional 3' splice site. Frilander and Steitz
(14) showed that A complex formation in U12-dependent
introns required the participation of both the 5' splice site and the
branch site. Here we extend this result to show that A complex
formation is also dependent on a properly positioned 3' splice site.
In light of these results, an additional finding reported by Frilander
and Steitz (14) that an RNA truncated between the branch
site and the 3' splice site can form spliceosome-like complexes appears
to be in contradiction. These complexes, however, appeared to be unable
to carry out the first step of splicing. We have repeated these
experiments under our conditions and seen similar results. The
complexes migrate approximately the same as authentic A and B complexes
and form under the same conditions yet do not carry out the first step
of splicing to a detectable level. This is in contrast to the +27
mutant, which cannot form either A or B complexes. The apparent
difference between these two RNAs is that the +27 construct has
nucleotides in the region where a 3' splice site should be located,
while the truncated RNA has nothing.
A possible way to reconcile these results is to suggest that complexes
can form transiently at potential U12-dependent branch site sequences
but are destabilized by the absence of a properly positioned 3' splice
site. This destabilization could be an active proofreading function
which is not triggered in the case of the truncated RNA due to the
absence of enough RNA downstream of the branch site. In support of this
idea, the lack of activation of the +124 cryptic branch site-3' splice
site in the +27 mutant suggests that the normal branch site is still
being recognized in some manner and this is causing the sequestration
of the 5' splice site so that it cannot productively engage the +124
cryptic site.
For this mechanism to play a role in 3' splice site fidelity, there
must be evidence that an active branch site-3' splice site can compete
with an inactive one. We have shown elsewhere that the +124 cryptic
site can compete with the wild-type site when a single nonconsensus
nucleotide in the branch site upstream of +124 is corrected to the
consensus residue (Dietrich et al., submitted.). Therefore, a single 5'
splice site can productively interact with more than one potential 3'
splice site, implying that mechanisms must exist to choose the correct
site and discriminate against incorrect sites. We would argue that one
aspect of this discrimination is to check for the presence of a
functional 3' splice site within 10 to 20 nucleotides of a potential
branch site.
U12-type 3' splice site appears to be identified by a local
diffusion process.
An alternative to linear scanning is a process
in which the 3' splice site binds to a site on the forming spliceosome
that is located at a fixed distance from the branch site binding site. The pre-mRNA bound to the spliceosome through the U12 snRNP interaction at the branch site would encounter the 3' splice site binding site by
local diffusion. The physical properties of the surrounding structure
would then determine both the minimum distance that must be bridged to
bind both sites and the amount of extra RNA sequence that could fit.
These structural constraints would then determine the minimum and
maximum distance between the branch site and the 3' splice site. The
sharp spacing optimum of about 12 residues could be interpreted as
supplying a distance measurement between the branch site adenosine and
the step-two active site within the spliceosome. This would correspond
to a distance of about 80 to 85 Å between these two points on the
U12-dependent spliceosome. This could be easily accommodated in the 40- to 60-nm U2-dependent spliceosome (32). Such a distance
would correspond to a mean or lowest energy state. Shorter and longer
distances could be accommodated by energetically costly deformations of the spliceosome or the pre-mRNA.
A rather similar distance for the mammalian U2-dependent spliceosome
can be inferred from studies which showed that an AG at +4 was inactive
but AGs at +12 and +19 could splice in vitro (38) or that
an AG at +11 was inactive but AGs at +15 to +24 were active
(10 and references therein). There is also evidence that
the S. cerevisiae U2 spliceosome can splice to 3' splice sites as few as 11 nucleotides from the branch site (12).
From the data presented here, it appears that the U12-dependent
spliceosome cannot scan for a 3' splice site over many tens of bases as
the U2-dependent spliceosome can. This might be reflected in the
absence from the U12 spliceosome of specific protein factors that
promote scanning in the U2 spliceosome. Candidate factors might
include the mammalian homologs of the yeast second-step splicing
factors Prp16, Prp17, Prp18, and Slu7 (42). In S. cerevisiae, Slu7 is thought to promote splicing to downstream AGs
(4, 12). However, so far there is no evidence that the
human homolog of Slu7 is dispensable for a subset of introns (9,
10).
| 1.
|
Anderson, K., and M. J. Moore.
1997.
Bimolecular exon ligation by the human spliceosome.
Science
276:1712-1716[Abstract/Free Full Text].
|
| 2.
|
Anderson, K., and M. J. Moore.
2000.
Bimolecular exon ligation by the human spliceosome bypasses early 3' splice site AG recognition and requires NTP hydrolysis.
RNA (NY)
6:16-25[Abstract].
|
| 3.
|
Boudvillain, M.,
A. de Lencastre, and A. M. Pyle.
2000.
A tertiary interaction that links active-site domains to the 5' splice site of a group II intron.
Nature
406:315-318[CrossRef][Medline].
|
| 4.
|
Brys, A., and B. Schwer.
1996.
Requirement for SLU7 in yeast pre-mRNA splicing is dictated by the distance between the branchpoint and the 3' splice site.
RNA (NY)
2:707-717[Abstract].
|
| 5.
|
Burge, C. B.,
R. A. Padgett, and P. A. Sharp.
1998.
Evolutionary fates and origins of U12-type introns.
Mol. Cell
2:773-785[CrossRef][Medline].
|
| 6.
|
Burge, C. B.,
T. Tuschl, and P. A. Sharp.
1999.
Splicing of precursors to mRNAs by the spliceosome, p. 525-560.
In
R. F. Gestland, T. Cech, and J. F. Atkins (ed.), The RNA world II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 7.
|
Chanfreau, G.,
P. Legrain,
B. Dujon, and A. Jacquier.
1994.
Interaction between the first and last nucleotides of pre-mRNA introns is a determinant of 3' splice site selection in S. cerevisiae.
Nucleic Acids Res.
22:1981-1987[Abstract/Free Full Text].
|
| 8.
|
Chen, S.,
K. Anderson, and M. J. Moore.
2000.
Evidence for a linear search in bimolecular 3' splice site AG selection.
Proc. Natl. Acad. Sci. USA
97:593-598[Abstract/Free Full Text].
|
| 9.
|
Chua, K., and R. Reed.
1999.
Human step II splicing factor hSlu7 functions in restructuring the spliceosome between the catalytic steps of splicing.
Genes Dev.
13:841-850[Abstract/Free Full Text].
|
| 10.
|
Chua, K., and R. Reed.
1999.
The RNA splicing factor hSlu7 is required for correct 3' splice-site choice.
Nature
402:207-210[CrossRef][Medline].
|
| 11.
|
Dietrich, R. C.,
R. Incoravia, and R. A. Padgett.
1997.
Terminal intron dinucleotide sequences do not distinguish between U2- and U12-dependent introns.
Mol. Cell
1:151-160[CrossRef][Medline].
|
| 12.
|
Frank, D., and C. Guthrie.
1992.
An essential splicing factor, SLU7, mediates 3' splice site choice in yeast.
Genes Dev.
6:2112-2124[Abstract/Free Full Text].
|
| 13.
|
Frendewey, D., and W. Keller.
1985.
Stepwise assembly of a pre-mRNA splicing complex requires U-snRNPs and specific intron sequences.
Cell
42:355-367[CrossRef][Medline].
|
| 14.
|
Frilander, M. J., and J. A. Steitz.
1999.
Initial recognition of U12-dependent introns requires both U11/5' splice-site and U12/branchpoint interactions.
Genes Dev.
13:851-863[Abstract/Free Full Text].
|
| 15.
|
Gozani, O.,
J. G. Patton, and R. Reed.
1994.
A novel set of spliceosome-associated proteins and the essential splicing factor PSF bind stably to pre-mRNA prior to catalytic step II of the splicing reaction.
EMBO J.
13:3356-3367[Medline].
|
| 16.
|
Hall, S. L., and R. A. Padgett.
1994.
Conserved sequences in a class of rare eukaryotic introns with non-consensus splice sites.
J. Mol. Biol.
239:357-365[CrossRef][Medline].
|
| 17.
|
Hall, S. L., and R. A. Padgett.
1996.
Requirement of U12 snRNA for the in vivo splicing of a minor class of eukaryotic nuclear pre-mRNA introns.
Science
271:1716-1718[Abstract].
|
| 18.
|
Helfman, D. M., and W. M. Ricci.
1989.
Branch point selection in alternative splicing of tropomyosin pre-mRNA.
Nucleic Acids Res.
17:5633-5650[Abstract/Free Full Text].
|
| 19.
|
Kolossova, I., and R. A. Padgett.
1997.
U11 snRNA interacts in vivo with the 5' splice site of U12-dependent (AU-AC) introns.
RNA (NY)
3:227-233[Abstract].
|
| 20.
|
Konarska, M. M.
1989.
Analysis of splicing complexes and small nuclear ribonucleoprotein particles by native gel electrophoresis.
Methods Enzymol.
180:442-453[Medline].
|
| 21.
|
Lafreniere, R. G.,
D. L. Rochefort,
Z. Kibar,
E. A. Fon,
F. Han,
J. Cochius,
X. Kang,
S. Baird,
R. G. Korneluk,
E. Andermann,
J. M. Rommens, and G. A. Rouleau.
1996.
Isolation and characterization of GT335, a novel human gene conserved in Escherichia coli and mapping to 21q22.3.
Genomics
38:264-272[CrossRef][Medline].
|
| 22.
|
Luukkonen, B. G. M., and B. Seraphin.
1997.
The role of branchpoint-3' splice site spacing and interaction between intron terminal nucleotides in 3' splice site selection in Saccharomyces cerevisiae.
EMBO J.
16:779-792[CrossRef][Medline].
|
| 23.
|
Merendino, L.,
S. Guth,
D. Bilbao,
C. Martinez, and J. Valcarcel.
1999.
Inhibition of msl-2 splicing by sex-lethal reveals interaction between U2AF35 and the 3' splice site AG.
Nature
402:838-841[CrossRef][Medline].
|
| 24.
|
Moore, M. J.
2000.
Intron recognition comes of AGe.
Nat. Struct. Biol.
7:14-16[CrossRef][Medline].
|
| 25.
|
Mount, S. M.
1982.
A catalogue of splice junction sequences.
Nucleic Acids Res.
10:459-472[Abstract/Free Full Text].
|
| 26.
|
Nelson, K. K., and M. R. Green.
1989.
Mammalian U2 snRNP has a sequence-specific RNA-binding activity.
Genes Dev.
3:1562-1571[Abstract/Free Full Text].
|
| 27.
|
Neuman, E.,
W. R. Sellers,
J. A. McNeil,
J. B. Lawrence, and W. G. Kaelin, Jr.
1996.
Structure and partial genomic sequence of the human E2F1 gene.
Gene
173:163-169[CrossRef][Medline].
|
| 28.
|
Ohshima, T.,
J. W. Nagle,
H. C. Pant,
J. B. Joshi,
C. A. Kozak,
R. O. Brady, and A. B. Kulkarni.
1995.
Molecular cloning and chromosomal mapping of the mouse cyclin-dependent kinase 5 gene.
Genomics
28:585-588[CrossRef][Medline].
|
| 29.
|
Parker, R., and P. G. Siliciano.
1993.
Evidence for an essential non-Watson-Crick interaction between the first and last nucleotides of a nuclear pre-mRNA intron.
Nature
361:660-662[CrossRef][Medline].
|
| 30.
|
Reed, R.
2000.
Mechanisms of fidelity in pre-mRNA splicing.
Curr. Opin. Cell Biol.
12:340-345[CrossRef][Medline].
|
| 31.
|
Reed, R.
1989.
The organization of 3' splice-site sequences in mammalian introns.
Genes Dev.
3:2113-2123[Abstract/Free Full Text].
|
| 32.
|
Reed, R.,
J. Griffith, and T. Maniatis.
1988.
Purification and visualization of native spliceosomes.
Cell
53:949-961[CrossRef][Medline].
|
| 33.
|
Ruskin, B., and M. R. Green.
1985.
Role of the 3' splice site consensus sequence in mammalian pre-mRNA splicing.
Nature
317:732-734[CrossRef][Medline].
|
| 34.
|
Rymond, B. C., and M. Rosbash.
1985.
Cleavage of 5' splice site and lariat formation are independent of 3' splice site in yeast mRNA splicing.
Nature
317:735-737[CrossRef][Medline].
|
| 35.
|
Rymond, B. C., and M. Rosbash.
1992.
Yeast pre-mRNA splicing, p. 143-192.
In
E. W. Jones, J. R. Pringle, and J. R. Broach (ed.), The molecular and cellular biology of the yeast Saccharomyces: gene expression, vol. 2. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 36.
|
Scadden, A. D. J., and C. W. J. Smith.
1995.
Interactions between the terminal bases of mammalian introns are retained in inosine-containing pre-mRNAs.
EMBO J.
14:3236-3246[Medline].
|
| 37.
|
Smith, C. W., and B. Nadal-Ginard.
1989.
Mutually exclusive splicing of alpha-tropomyosin exons enforced by an unusual lariat branch point location: implications for constitutive splicing.
Cell
56:749-758[CrossRef][Medline].
|
| 38.
|
Smith, C. W. J.,
T. T. Chu, and B. Nadal-Ginard.
1993.
Scanning and competition between AGs are involved in 3' splice site selection in mammalian introns.
Mol. Cell. Biol.
13:4939-4952[Abstract/Free Full Text].
|
| 39.
|
Smith, C. W. J.,
E. B. Porro,
J. G. Patton, and B. Nadal-Ginard.
1989.
Scanning from an independently specified branch point defines the 3' splice site of mammalian introns.
Nature
342:243-247[CrossRef][Medline].
|
| 40.
|
Tarn, W.-Y., and J. A. Steitz.
1996.
Highly diverged U4 and U6 small nuclear RNAs required for splicing rare AT-AC introns.
Science
273:1824-1832[Free Full Text].
|
| 41.
|
Tarn, W.-Y., and J. A. Steitz.
1996.
A novel spliceosome containing U11, U12 and U5 snRNPs excises a minor class (AT-AC) intron in vitro.
Cell
84:801-811[CrossRef][Medline].
|
| 42.
|
Umen, J. G., and C. Guthrie.
1995.
The second catalytic step of pre-mRNA splicing.
RNA (NY)
1:869-885[Medline].
|
| 43.
|
Wu, Q., and A. R. Krainer.
1999.
AT-AC pre-mRNA splicing mechanisms and conservation of minor introns in voltage-gated ion channel genes.
Mol. Cell. Biol.
19:3225-3236[Free Full Text].
|
| 44.
|
Wu, Q., and A. R. Krainer.
1998.
Purine-rich enhancers function in the AT-AC pre-mRNA splicing pathway and do so independently of intact U1 snRNP.
RNA (NY)
4:1664-1674[Abstract].
|
| 45.
|
Wu, Q., and A. R. Krainer.
1997.
Splicing of a divergent subclass of AT-AC introns requires the major spliceosomal snRNAs.
RNA (NY)
3:586-601[Abstract].
|
| 46.
|
Wu, S.,
C. M. Romfo,
T. W. Nilsen, and M. R. Green.
1999.
Functional recognition of the 3' splice site AG by the splicing factor U2AF35.
Nature
402:832-835[CrossRef][Medline].
|
| 47.
|
Zhuang, Y., and A. M. Weiner.
1990.
The conserved dinucleotide AG of the 3' splice site may be recognized twice during in vitro splicing of mammalian mRNA precursors.
Gene
90:263-269[CrossRef][Medline].
|
| 48.
|
Zorio, D. A. R., and T. Blumenthal.
1999.
Both subunits of U2AF recognize the 3' splice site in Caenorhabditis elegans.
Nature
402:835-838[CrossRef][Medline].
|