Molecular and Cellular Biology, March 2001, p. 2107-2117, Vol. 21, No. 6
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.6.2107-2117.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Banting and Best Department of Medical Research1 and Department of Molecular and Medical Genetics,2 University of Toronto, Toronto, Ontario M5G 1X5, and MDS Proteomics, Inc., Toronto, Ontario M5G 1V2,3 Canada
Received 3 October 2000/Returned for modification 20 November 2000/Accepted 13 December 2000
| |
ABSTRACT |
|---|
|
|
|---|
Ras is a small GTPase that is activated by upstream guanine nucleotide exchange factors, one of which is Ras-GRF2. GRF2 is a widely expressed protein with several recognizable sequence motifs, including a Ras exchanger motif (REM), a PEST region containing a destruction box (DB), and a Cdc25 domain. The Cdc25 domain possesses guanine nucleotide exchange factor activity and interacts with Ras. Herein we examine if the DB motif in GRF2 results in proteolysis via the ubiquitin pathway. Based on the solved structure of the REM and Cdc25 regions of the Son-of-sevenless (Sos) protein, the REM may stabilize the Cdc25 domain during Ras binding. The DB motif of GRF2 is situated between the REM and the Cdc25 domains, tempting speculation that it may be exposed to ubiquitination machinery upon Ras binding. GRF2 protein levels decrease dramatically upon activation of GRF2, and dominant-negative Ras induces degradation of GRF2, demonstrating that signaling downstream of Ras is not required for the destruction of GRF2 and that binding to Ras is important for degradation. GRF2 is ubiquitinated in vivo, and this can be detected using mass spectrometry. In the presence of proteasome inhibitors, Ras-GRF2 accumulates as a high-molecular-weight conjugate, suggesting that GRF2 is destroyed by the 26S proteasome. Deleting the DB reduces the ubiquitination of GRF2. GRF2 lacking the Cdc25 domain is not ubiquitinated, suggesting that a protein that cannot bind Ras cannot be properly targeted for destruction. Point mutations within the Cdc25 domain that eliminate Ras binding also eliminate ubiquitination, demonstrating that binding to Ras is necessary for ubiquitination of GRF2. We conclude that conformational changes induced by GTPase binding expose the DB and thereby target GRF2 for destruction.
| |
INTRODUCTION |
|---|
|
|
|---|
The Ras proto-oncogenes encode low-molecular-weight, membrane-bound GTPases that play a central role in ensuring an appropriate cellular response to growth and differentiation factors by transducing and integrating extracellular signals (4, 27). Despite this pivotal role, little is known about how Ras is regulated. Ras acts as a critical intermediate in the transduction of signals from membrane receptors by acting as a molecular switch, transmitting signals to downstream components only when in an active GTP-bound form. Cycling of Ras between the inactive GDP-bound form and the active GTP-bound conformation is regulated by the opposing actions of guanine nucleotide exchange factors (GEFs) and GTPase-activating proteins (GAPs).
Ras-GRF2 (GRF2) is a widely expressed GEF which catalyzes nucleotide exchange on Ras through its Cdc25 domain (7, 14). GRF2 is a bifunctional GEF; in addition to having activity on Ras, GRF2 is capable of binding to another small G protein, Rac1, through its Dbl homology (DH) domain. Through its interaction with Ras and Rac, GRF2 is capable of activating both the extracellular signal-regulated kinase (ERK) and the stress-activated protein kinase-mitogen-activated protein kinase (MAPK) cascades (14, 15). GRF2 is a modular protein containing a number of protein motifs in addition to the Cdc25 and DH domains. It contains, in amino-to-carboxy-terminal order, a pleckstrin homology (PH) domain, coiled-coil motif, ilimaquinone motif, DH domain, a second PH domain, a Ras exchanger motif (REM), a PEST-like region (rich in proline, glutamic acid, serine, and threonine) that contains a candidate destruction box (DB), and, finally, the Cdc25 domain (14). PH domains in other proteins are involved in protein-protein or protein-lipid interactions; the ilimaquinone motif in GRF2 appears to be important for allowing activated Ras to couple to the MAPK pathway (11); the REM in a related exchange factor, Son-of-sevenless (Sos), has been implicated in stabilizing the structure of the Cdc25 domain (5). Between the REM and the Cdc25 domains of GRF2 is a motif similar to the DB of B-type cyclins, as well as a stretch of amino acids C-terminal to the DB that is rich in proline, glutamate, serine, and threonine (PEST sequences). Both motifs have been implicated in targeting proteins for ubiquitination and subsequent degradation via the 26S proteasome.
The ubiquitin system is a highly conserved method of protein degradation which involves the posttranslational modification of proteins by the small protein ubiquitin and delivery of these modified proteins to the 26S proteasome for degradation (reviewed in reference 24). The attachment of ubiquitin to a protein occurs via a biochemical "bucket-brigade" of enzyme activity. First, free ubiquitin is activated by an E1 enzyme and is then transferred to an E2 enzyme which, in cooperation with an E3 ubiquitin ligase protein (or protein complex), covalently links ubiquitin to a lysine residue on the target protein. The process can be repeated to add an additional ubiquitin to the previous one, commonly on Lys48 of ubiquitin. Ubiquitin conjugation continues, resulting in a high-molecular-weight complex containing a polyubiquitin chain that is essential for recognition and degradation by the 26S proteasome with concomitant recycling of ubiquitin. Recently, a fourth component, called E4, that is required for ubiquitin chain elongation was cloned (23).
Various signals can target proteins for ubiquitination. The DB, first found in mitotic cyclins, is a 9-amino-acid motif that targets proteins for ubiquitination usually in a cell cycle-specific manner, through the anaphase-promoting complex (APC), an E3 ligase (8). Another signal, the KEN box, targets a subset of proteins different from those targeted by the APC (36). A third putative signal is a PEST sequence; G1 cyclins are an example of proteins that contain this signal (47). The E3 ligase involved in degrading these substrates is the SCF protein complex, which consists of the following proteins: a cullin family member, Skp1; Rbx1 (also called Roc1); and an F-box protein which binds the targeted substrate (9). A requirement for phosphorylation of the substrate prior to recognition by the SCF complex appears to be common to all SCF-substrate interactions.
Given the presence of the putative ubiquitination signals in GRF2, we have chosen to study the targeting of GRF2 by the ubiquitination system. The location of the REM in the crystal structure of Sos bound to Ras suggests that the two domains of Sos, REM and Cdc25, interact with each other during binding to Ras (5). In Sos, the REM and Cdc25 domain are situated in close proximity to one another, whereas in GRF2 there is a large block of intervening sequence. Interestingly, it is this stretch of amino acids in GRF2 that contains the PEST region and the DB. It is possible, therefore, that, upon the binding of GRF2 to Ras, the DB is exposed to the ubiquitination machinery, resulting in the ubiquitination of GRF2. Here, we show that GRF2 contains a targeting signal for ubiquitination and that GRF2 is ubiquitinated following binding to Ras.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of plasmids.
The cloning of the
DH and the
Cdc25 GRF2 deletions has been previously described
(15).
REM construct, in which
GRF2 codons 638 to 686 were deleted, was obtained by doing two rounds
of PCR. The first two reactions used the following primers: (i) a 5'
primer flanking the unique BamHI site in GRF2 and a 3'
primer that deletes the above-named codons and (ii) a 5' primer from
which the above codons were deleted and a 3' primer that flanks the
unique XhoI site in GRF2. These two PCR products were mixed
and used as a template for a second round of PCR using the
BamHI- and XhoI-flanking primers, resulting in a
PCR product with codons 638 to 686 deleted. The PCR product was
digested with BamHI and XhoI and subcloned into
BamHI and XhoI-digested pcDNA3-Flag-GRF2.
The
DB construct, with codons 742 to 751 deleted, was obtained using
the same method. Reaction 1 used a 5' primer starting at codon 541 and
a 3' primer with the above-named codons deleted. Reaction 2 used a 5'
primer with the above-named codons deleted and a 3' primer that flanks
the SacI site in the pcDNA3 multiple cloning site. These two
PCR products were mixed and used as a template for a second round of
PCR using the outside flanking primers, resulting in a PCR product with
codons 742 to 751 deleted. This PCR product was digested with
EcoRI, and the 1,763-bp fragment was used to replace the
1,793-bp fragment from pcDNA3-Flag-GRF2.
The point mutations R1022E and R1092A were constructed using a
Transformer site-directed mutagenesis kit (Stratagene). Amino acid 1022 of full-length GRF2 was changed from arginine to glutamic acid by
changing the codon from CTG to GAG using the following primer: 5'
GCCGACATCAGCTCCGAGCCCAACGCCATTGAGAAG 3'. The changing of amino
acid 1092 of full-length GRF2 from arginine to alanine was performed in
the same manner, by changing the codon from TGC to GCC using the
following primer: 5' GGAAGATTTAAAAACCTCGCCGAGACTCTCAAAAAC 3'.
pcDNA3-Flag-Cdc25 was used as a template for both reactions. Automated cycle sequencing was used to confirm the codon changes, and
an EcoRV fragment containing the mutation was isolated and used to replace the wild-type (WT) EcoRV fragment in
full-length pcDNA3-Flag-GRF2.
Construction of pcDNA3-GAP KT3 (human p120GAP) was
performed as follows: pECE-GAP KT3 was digested with SacI
and SmaI and treated with the Klenow fragment. pcDNA3 was
digested with EcoR1, treated with the Klenow fragment and
then calf intestinal phosphatase. The two products were then ligated
together using T4 DNA ligase.
pMAL-Flag-RACK1 was digested with EcoRI and
HindIII and treated with the Klenow fragment to produce
blunt ends pcDNA3 previously digested with NotI and
XbaI and treated with the Klenow fragment and calf
intestinal phosphatase was ligated with the EcoRI- and HindIII-digested fragment. A Kozak sequence and start codon
was introduced by PCR using the upstream primer
5'CCGGAATTCCGGGCCGCCACCATGGACTACAAGGACGACGATG 3' and a
downstream primer, 6 5'AAGAGCACGTTGTGGTATGC 3', using pMAL-Flag-RACK1 as a template. The PCR product was digested with EcoRI and XhoI and used to replace the
EcoRI-NotI fragment in previously constructed
pcDNA3-Flag-RACK1.
Sequencing of all of the above-described constructs was performed (York
University Core Molecular Biology Facility) to verify the integrity of
the final product.
Cell culture and transfections. HEK 293T (293T) and HEK 293 (293) cells were maintained in Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum, 4.5 g of L-glutamine per liter, 10 µM nonessential amino acids, 100 U of penicillin per ml, and 100 µg of streptomycin per ml. All supplements were purchased from Gibco/BRL. 293 or 293T cells grown in 10-cm-diameter dishes were transiently transfected by calcium phosphate coprecipitation as described previously (41).
Stimulation and destruction. 293 cells (clone 13) stably expressing low levels of Flag-tagged Ras-GRF2 (14) at 90% confluence were serum starved for 20 h and then stimulated with 4 µM ionomycin (Calbiochem) for 5 min at 37°C; the ionomycin medium was removed, and serum-free DMEM was added. Cells were placed at 37°C and harvested immediately (5-min sample) and 25, 55, and 175 min later. Cells were washed in phosphate-buffered saline (PBS) and then lysed in NP-40 lysis buffer (20 mM Tris-HCl [pH 7.5], 50 mM NaCl, 1% NP-40, 50 mM NaF, 10 mM sodium pyrophosphate, 1 mM sodium orthovanadate, 10 µg of aprotinin per ml, 0.1 mM AEBSF, and 10 µg of leupeptin per ml). Lysates were clarified, and a Coomassie Plus Bradford assay (Pierce) was performed to determine protein concentration. Sixty micrograms of total protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotted with anti-Flag (M2) monoclonal antibody (Kodak) and anti-actin monoclonal antibody (Oncogene Sciences). All quantitations of Western blots shown in this paper were generated as follows: goat anti-mouse immunoglobulin G (IgG) or goat anti-rabbit IgG secondary antibodies conjugated to horseradish peroxidase (Bio-Rad) were used for Western blots. The 0.45-µm-pore-size nitrocellulose membrane was processed for chemiluminescence using the substrate Supersignal (Pierce) and then exposed to a chemiluminescence-sensitive storage-phosphor screen (Bio-Rad). The screen was scanned by a Bio-Rad GS250 phosphorimager, and data were quantitated using Molecular Analyst software.
N17-induced destruction.
293 cells were transiently
cotransfected with 8 µg of pcDNA3-Flag-GRF2 or pcDNA3-Flag-GRF2
DB,
as well as 3 µg of pcDNA3-N17 Ras and 1 µg of pCMV
(encoding
-galactosidase, from Clontech) as indicated in the figures. After
48 h, the cells were serum starved in DMEM for 18 h, washed
in PBS, and then lysed in NP-40 lysis buffer. Lysates were clarified,
and a Bradford assay was performed to determine protein concentration.
Thirty micrograms of total protein was separated by SDS-PAGE,
transferred to nitrocellulose, and immunoblotted with anti-Flag (M2)
monoclonal antibody, anti-Ras (LAO45) monoclonal antibody, and an
anti-
-galactosidase polyclonal antibody (Cortex). The protein levels
were quantified using a Bio-Rad GS-250 phosphorimager.
Northern analysis.
RNA extraction was performed as described
previously (22). Northern analysis was performed as
follows: 20 µg of total RNA was separated on an agarose-formaldehyde
gel and transferred to a nylon filter. The filter was prehybridized in
FSB (100 mM NaH2PO4, 50 mM sodium
pyrophosphate, 7% SDS, 1 mM EDTA, 100 µg of denatured salmon sperm
DNA per milliliter) for 5 h at 68°C and then hybridized with a
random-prime synthesized probe overnight at 68°C. The probe used was
DNA corresponding to codons 686 to 933 of GRF2. The filter was washed
twice for 45 min each in FSB with SDS lowered to 1% and then exposed
to X-ray film. The blot was stripped and reprobed with a random-prime
synthesized probe corresponding to an internal fragment of a
housekeeping gene,
-actin. The Northern blot data were quantified
using a Bio-Rad GS-250 phosphorimager and Molecular Analyst software.
ERK 1 assay. 293T cells were transiently cotransfected with 3 µg of pJ3M-ERK1 (expressing Myc epitope-tagged ERK 1) and 5 µg of either the pcDNA3 vector or the pcDNA3-Flag-GRF2 constructs as indicated in the figures. After 48 h, the cells were serum starved for 18 h and then stimulated with 4 µM ionomycin for 5 min at 37°C, washed in PBS, and then lysed in NP-40 lysis buffer. A Bradford assay was performed using clarified lysates. Ten micrograms of lysate was separated by SDS-PAGE, transferred to nitrocellulose, and immunoblotted with anti-Flag, anti-Myc (9E10), anti-MAPK (New England Biolabs, Inc.), and anti-phospho-MAPK (New England Biolabs, Inc.) antibodies.
Ubiquitination assays. 293T cells were transiently transfected with 4 µg of the pcDNA3-Flag-GRF2 constructs as indicated in the figures, with or without 1 µg of pCMV-HA-Ubiquitin (44). After 48 h, cells were rinsed in PBS and lysed in NP-40 lysis buffer and the lysates were clarified. Lysates were precleared with anti-mouse IgG-agarose beads (Sigma), and then equal amounts of total protein were used to immunoprecipitate GRF2 using 2 µg of anti-Flag (M2) monoclonal antibody in the presence of 20 µl of anti-mouse IgG-agarose beads for 2 h at 4°C with gentle rotation. The immunoprecipitates (IPs) were washed three times in NP-40 lysis buffer and then resuspended and boiled in 20 µl of Laemmli loading buffer. The samples were then separated by SDS-PAGE, transferred to nitrocellulose, and immunoblotted with anti-Flag antibody to detect GRF2 and with anti-hemagglutinin (HA) antibody (12CA5; Boehringer) to detect ubiquitin. For Fig. 4B, 293T cells were transiently transfected with pECE-GAP-KT3 and HA-ubiquitin, and GAP was immunoprecipitated with anti-KT3 ascites fluid. For Fig. 4C, pcDNA3-Flag-RACK1 was expressed in 293T cells along with HA-ubiquitin and RACK1 was immunoprecipitated using anti-Flag monoclonal antibody.
To test if GRF2 is covalently linked to ubiquitin, IPs were obtained as described above, resuspended in 100 µl of SDS buffer (20 mM Tris [pH 7.5], 50 mM NaCl, 1% SDS), and heated to 95°C for 10 min. The IP was allowed to cool to room temperature, and any precipitated protein was spun out. The supernatant was diluted to 1.1 ml with TX-100 buffer (20 mM Tris [pH 7.5], 50 mM NaCl, 1% Triton X-100), and GRF2 was immunoprecipitated as described above. These IPs were washed three times in TX-100 buffer and then resuspended and boiled in 20 µl of Laemmli loading buffer. The samples were then separated by SDS-PAGE, transferred to nitrocellulose, and immunoblotted with anti-Flag antibody (M2) to detect GRF2 and with 12CA5 anti-HA antibody to detect ubiquitin. For proteasome inhibitor experiments, 293 cells stably expressing HA-ubiquitin and Flag-GRF2 at 85% confluence were treated for the times indicated in Fig. 4, with a solution containing 0.02% dimethyl sulfoxide (DMSO) as a carrier, 50 µM MG-132 (Calbiochem), 50 µM LLnL (Sigma), and 10 µM lactacystin (Calbiochem) before being lysed and processed as described above.GTPase interaction.
H-Ras, prepared as a glutathione
S-transferase (GST) fusion protein (19),
immobilized on glutathione-agarose beads (~1 mg of protein/ml of
resin) was rendered free of nucleotide by incubation for 20 min at
23°C in nucleotide exchange buffer (NEB; 20 mM Tris [pH 7.5]; 50 mM
NaCl; 5% glycerol, 1 mM dithiothreitol, 0.1% Triton X-100)
supplemented with 10 mM EDTA. Nucleotide-bound Ras was prepared by
incubating nucleotide-free protein for 15 min at 23°C in NEB
containing 10 mM MgCl2 plus 200 µM GDP or 20 µM
GTP
S. The proteins were resuspended in 500 µl of the same NEB
buffer used in their preparation and then combined with 2.5 mg of cell lysate. Lysates were prepared from 293T cells transfected with the
appropriate GRF2 protein and lysed in NP-40 lysis buffer. Following
incubation for 2 h at 4°C, beads were washed extensively with
their respective nucleotide depleting or binding buffer and then bound
GRF2 was measured by immunoblotting with M2 anti-Flag antibody.
MS. Lysates from control and GRF2-transfected 293T cells were immunoprecipitated with M2 anti-Flag antibody, and the isolated complexes were separated by SDS-PAGE as described above. The gel-separated proteins were visualized by silver staining, and the GRF2-specific bands were excised. The proteins were reduced, the free cysteine residues were alkylated with iodoacetamide, and the protein was then subjected to digestion by trypsin (Boehringer Mannheim) using the method of Shevchenko et al. (40). The extracted peptides were purified by C18 reverse-phase chromatography and resuspended in 5% methanol-5% formic acid prior to analysis. Mass spectrometry (MS) was carried out on a prototype quadrapole-time-of-flight hybrid mass spectrometer (Sciex) (39) equipped with a nanospray ion source (Protana). Each sample was introduced into a nanospray needle installed in front of the mass spectrometer orifice and continuously electrosprayed at a low flow rate as previously described (46). MS spectra were acquired to determine the m/z ratios of the peptides present in the proteolytic digest. Individual peptides were selected and fragmented by collision-induced dissociation, and the resulting fragments were separated, generating an MS-MS spectrum. For every MS-MS spectrum, a small stretch of the amino acid sequence was manually determined, generating a sequence tag, which was fed into a search engine (PeptideScan). The search engine was used to identify the provenance of the peptide with protein-DNA database searches. Every peptide identified was confirmed manually.
| |
RESULTS |
|---|
|
|
|---|
GRF2 contains a candidate DB.
Sequence analysis revealed that
GRF2 contains a sequence with some similarity to one found in mitotic
cyclins and other unstable proteins (Fig.
1). The region in mitotic cyclins
required for ubiquitin-mediated proteolysis contains an amino acid
motif called the DB (18, 48). The consensus for this motif
is RXALGXIXN; the R and L residues are conserved in all the
DBs of A-and B-type cyclins, while the N residue is conserved only in
B-type cyclins (18). GRF2's PEST-rich region contains a
motif very similar to the DB of A-type cyclins. The Ras exchange factor
in Saccharomyces cerevisiae, Cdc25p, has been shown to
contain a functional DB with the sequence RSSLNSLGN
(21). It is interesting that GRF2's DB,
KLSLTSSLN, resembles the yeast exchange factor's DB more
closely than the DBs of mitotic cyclins.
|
GRF2 is an unstable protein in stimulated cells.
If GRF2 is a
protein that is targeted for destruction upon Ras binding, then one
predicts that activating GRF2 and therefore activating Ras would result
in a decrease in GRF2 protein levels. To test this, a 293 cell line
stably transfected with GRF2 and expressing low levels of the protein
was grown to 90% confluence and serum starved for 20 h. Cells
were then stimulated with ionomycin, a calcium ionophore that raises
intracellular calcium levels, leading to the activation of GRF2
(11, 14, 15). Cells were harvested at various time points,
and equal amounts of total protein were resolved by SDS-PAGE. GRF2 was
detected by Western blotting with M2 anti-Flag antibody, and the amount
of GRF2 present under each condition was quantified (Fig.
2). The steady-state levels of GRF2
decreased dramatically in stimulated cells, and it appears that the
total amount of GRF2 in the cells dropped by approximately 50% within
5 min (Fig. 2, lane 2). The steady-state levels of GRF2 continued to
drop until 1 h after stimulation and then began to rise again. As
a control, actin protein levels were assessed to ensure that the
decline in protein was specific to GRF2. As shown in the lower gel in
Fig. 2, actin protein levels remained relatively constant throughout
the experiment. This decline in GRF2 level suggests that the
disappearance of GRF2 is a signal-triggered event.
|
GRF2 destruction depends upon its DB motif.
In order to
determine if the DB motif is responsible for the instability of GRF2 in
lysates, a construct of GRF2 in which the DB was deleted was used. 293 cells were transiently transfected with GRF2 or the
DB construct,
with or without N17 Ras (Fig. 3). N17 Ras
displays a dominant-negative behavior as a consequence of its inability
to coordinate magnesium properly; it prevents activation of endogenous
Ras by sequestering exchange factors into dead-end complexes
(16). We have shown previously that this Ras mutation
prevents GRF2 from signaling to the MAPK pathway (15). By
sequestering exchange factors in this method, N17 Ras results in a
prolonged interaction between GRF2 and Ras rather than the usual,
presumably transient, interaction. As a control, the cells were also
cotransfected with a construct encoding
-galactosidase to ensure
that any effects seen were specific to GRF2 and not to other
transfected proteins. After equal amounts of protein were loaded on a
gel and immunoblotting for Flag-GRF2 was performed, the level of GRF2
protein was found to be reduced approximately 90% in the presence of
N17 Ras while the levels of the
DB construct were reduced only
slightly (Fig. 3A). The levels of
-galactosidase did not change. The
nitrocellulose membrane was exposed to a phosphorimager, and the image
and quantitation obtained from the scanned phosphorimager screen are
shown in Fig. 3B.
|
DB construct. This was not surprising, as N17 Ras has been shown
previously to globally reduce transcription (1).
To address the possibility that the
DB protein was more stable as a
result of its being misfolded or improperly localized, GRF2 or the DB
was cotransfected with myc-ERK and levels of MAPK activity were
assessed by using a phospho-specific antibody to MAPK (Fig. 3D). Both
WT GRF2 and the
DB protein signaled efficiently to the MAPK cascade,
suggesting that the differences seen in levels of destruction are not
because the deletion of the DB resulted in an unfolded protein that is
not targeted properly. We have found that the expression level of GRF2
influences the amount of degradation that can be observed in these
experiments in that a significant amount of overexpression of GRF2 can
result in the ubiquitination machinery responsible for its targeting
becoming saturated (data not shown), an effect that can also be seen in other systems (20). The high level of expression in 293T
cells in this experiment resulted in the ubiquitination pathway
becoming saturated so that no difference was seen when cells were
stimulated with ionomycin. These findings imply that the destruction of
GRF2 is dependent upon the presence of the DB and that the observed difference in protein levels is not a result of lower transcript levels. These data also suggest that activation of Ras and subsequent signaling are not required for the destruction of GRF2, as downstream signaling is blocked in the presence of N17 Ras.
GRF2 is ubiquitinated in vivo.
Because DBs in other proteins
target those proteins for destruction via the ubiquitin degradation
pathway, we wanted to determine if GRF2's DB motif targets it for
ubiquitination. To do this, GRF2 was transiently cotransfected with an
HA-tagged ubiquitin construct into 293T cells. GRF2 was
immunoprecipitated from cell lysates prepared from these cells and
blotted with 12CA5 anti-HA antibody to detect ubiquitin-conjugated GRF2
(Fig. 4A). A ladder of
high-molecular-weight ubiquitinated products was seen at even intervals, with weights starting slightly higher than that of GRF2
(Fig. 4A, lane 5). This ladder was not seen in vector-transfected control cells or in cells not expressing the ubiquitin construct (lane
4 and lanes 1 to 3, respectively). A
DH protein (lanes 2 and 6) was
used as a control in this experiment to show that an irrelevant
deletion does not cause a significant decrease in GRF2's
ubiquitination state. The
DH construct was ubiquitinated to a level
similar to that of WT GRF2, while ubiquitination of the
DB construct
was compromised.
|
GRF2-ubiquitin conjugates can be detected by MS.
MS analysis
detected peptides derived from GRF2 in tryptic digests of three
different bands present on a gel of GRF2-transfected cell lysate. In
particular, along with the predicted location of GRF2 at 135 kDa
(apparent molecular mass), two larger bands were identified at 175 and
200 kDa. All peptides located in these bands were identified as
originating from GRF2, with the exception of a doubly charged peptide
ion located at an m/z of 894.3. An MS-MS spectrum of
this ion revealed it to be the tryptic peptide TITLEVEPSDTIENVK
found only in ubiquitin (Fig. 5A,
lower panel). An MS-MS spectrum of a diagnostic peptide derived from
GRF2 is shown in Fig. 5A, upper panel. The abundance of the ubiquitin ion increased with the increasing molecular weight of the
GRF2-containing bands (Fig. 5B), and this effect was more pronounced
when its signal was normalized to one of the GRF2 peptide signals in
the same band. This evidence suggests that the increasing apparent molecular weight of the GRF2 protein is caused by an increasing load of
conjugated ubiquitin.
|
GRF2 accumulates as a ubiquitinated complex in the presence of
proteasome inhibitors.
In order to determine if the proteasome
plays a role in the destruction of GRF2, we looked at the
ubiquitination state of GRF2 in the presence of two proteasome
inhibitors, LLnL and MG-132 (10, 17, 25). A 293 cell line
stably expressing Flag-GRF2 and HA-ubiquitin was grown to 85%
confluence and then treated for various times with a carrier (DMSO), 50 µM LLnL, or 50 µM MG-132. Cells were then lysed, GRF2 was
immunoprecipitated, and its ubiquitination state was assessed by
immunoblotting for HA-tagged ubiquitin (Fig.
6). As the length of treatment with the
inhibitors increased, high-molecular-weight complexes of
GRF2-ubiquitin began to accumulate (lanes 7 to 9 and 12 to 14).
These complexes had barely exited the stacking gel and were
therefore very large (>200 kDa). Similar results were seen with
lactacystin, another proteasome inhibitor (data not shown). We have no
explanation as to why treatment with MG-132 increased the levels of
GRF2 whereas treatment with another proteasome inhibitor, LLnL, did
not. This was, however, a repeatable result. As the 26S
proteasome is known to degrade ubiquitinated proteins, this finding
indicates that GRF2 is likely destroyed by the 26S proteasome.
|
Cdc25 mutant proteins that cannot bind Ras are not
ubiquitinated.
Deletion of the Cdc25 domain severely reduced the
susceptibility of GRF2 to ubiquitination (Fig.
7C, lane 3). We have shown that the Cdc25
domain is required for interaction with Ras (15), so these
data suggest that the exchange factor's interaction with Ras is
important for targeting GRF2 for ubiquitination. However, as deleting
the Cdc25 domain removes 18 lysines from the protein, we could not
exclude the possibility that the reduced ubiquitination of the
Cdc25
protein was a result of the smaller number of lysines available for
attachment of ubiquitin moieties. To address this, point mutant
proteins were generated at conserved arginine residues in the Cdc25
domain at positions 1022 and 1092 (R1022E and R1092A); these mutations
have been shown in other Ras GEF proteins to abrogate binding to Ras
(6, 32, 35). These mutant GRF2 proteins should, therefore,
be unable to be ubiquitinated as a consequence of this diminished
binding.
|
S, was incubated
with lysate containing the indicated GRF2 protein, and the amount of
GRF2 bound to the fusion protein was assessed by Western blotting. A
common property of Cdc25 domains is their relatively high affinity for
the nucleotide-free form of Ras, likely reflecting their catalytic
mechanism of stabilizing an otherwise unfavorable nucleotide-free
intermediate state. WT GRF2 (lanes 7 to 9) was able to bind
specifically to nucleotide-free Ras, as previously shown
(15). The binding of the R1022E protein was barely
detectable (lanes 10 to 12); the binding of the R1092A protein was
severely reduced, to approximately 20% that of WT GRF2 (lanes 13 to 15).
To test whether this impaired binding translates into an inability to
signal to the MAPK cascade, phospho-MAPK immunoblotting was performed
(Fig. 7B). Lysates from cells expressing the indicated GRF2 protein
were immunoblotted with anti-Flag antibody to detect GRF2, anti-MAPK
antibody to detect ERK 1 and 2, and anti-phospho-MAPK antibody to
detect phosphorylated, activated ERK 1 and 2. GRF2 (lane 2)
significantly activated ERK compared to the level of activation in the
vector-alone control (lane 1). The R1022E protein activated ERK to a
level similar to that of the vector-alone control, and the R1092A
protein activated ERK slightly; these results correlate with the
proteins' limited ability to bind Ras.
In addition, the effect of reduced Ras binding and signaling on GRF2
ubiquitination was tested (Fig. 7C). Again, ability of the
Cdc25
protein to be ubiquitinated was remarkably decreased and the R1022E and
R1092A proteins were also severely impaired (lanes 4 to 5). This
finding strongly supports the notion that GRF2 must bind Ras in order
to be targeted for ubiquitination.
The
REM protein does not bind Ras and is not ubiquitinated.
The REM appears to be involved in stabilizing the structure of the
Cdc25 domain; it may orientate or stabilize a helical hairpin of the
Cdc25 domain so that, upon binding, the hairpin can alter the structure
of Ras to allow for nucleotide release (5). After deletion
of the REM, GRF2 lost its ability to bind to Ras as shown in Fig.
8A (lanes 9 to 11). Concomitant with
this, the
REM protein was severely impaired in ERK activation (Fig.
8B). Along with this inability to bind Ras, the
REM protein was also
no longer ubiquitinated (Fig. 8C), again implying that binding to Ras
is a necessary event in targeting GRF2 for ubiquitination.
|
Overexpressing Ras increases ubiquitination of GRF2.
If
binding to Ras is important for ubiquitination, then one can predict
that overexpression of Ras would have an effect on the ubiquitination
of GRF2. In Fig. 9, H-Ras was
overexpressed in 293 cells and the ubiquitination of GRF2 was assessed.
Increasing cellular Ras levels increased the ubiquitination of WT GRF2
(Fig. 9, lanes 2 and 3), as predicted. Interestingly, it also increased the amount of ubiquitination of the R1022E and R1092A proteins (Fig. 9,
lanes 4 and 5 and 6 and 7). Without overexpressing Ras, the R1022E and
R1092A proteins have barely detectable levels of ubiquitination;
increasing Ras levels presumably shifts the equilibrium to increase
binding between Ras and the mutant proteins, thereby increasing
ubiquitination.
|
GRF2 is phosphorylated near the DB.
GRF2 was analyzed for the
presence of phosphorylated residues by deconvolution of the mass
spectrum of a tryptic digest of the protein and searching for peptides
differing by a mass of 80 Da (neutral mass of HPO3) (Fig.
10A). Two phosphate-containing peptides
were located, and their sequences were confirmed by MS-MS. Both
peptides are located close to the DB and are within the PEST region of
GRF2. The peptide KFSSPPPLAVSR (residues 723 to 734 of
GRF2), located on the N-terminal side of the DB, was found to contain a
single phosphorylation site (Fig. 10B). The peptide IGALDLTNSSSSSSPTTTTHSPAASPPPHTAVLESAPADK (residues 754 to
793), located on the C-terminal side of the DB, was found to have four phosphorylated residues (data not shown). For both peptides, the mass
spectra did not provide enough information to determine the exact amino
acid(s) that is phosphorylated.
|
| |
DISCUSSION |
|---|
|
|
|---|
Here we have tested the role of the DB motif in the ubiquitination of GRF2 and whether conformational changes induced by GTPase binding expose the DB and thereby target GRF2 for destruction. In yeast, Cdc25p has been shown to have a functional destruction box that confers instability on the exchange factor; however, there does not appear to be any cell cycle regulation of this destruction and direct involvement of ubiquitin was not demonstrated (21). Kaplon and Jacquet (21) suggest that these factors indicate that regulation of Ras in yeast may be directly modulated by the cellular content of the exchange factor rather than variations in cellular localization or activity. In vitro-translated mouse Sos2 has been shown to be ubiquitinated, but the ubiquitination of Sos in vivo has not been explored (34). The data in this paper provide the first demonstration of the in vivo ubiquitination of an activator of Ras, as well as a model to explain how it is targeted for destruction.
We show that GRF2 is an unstable protein and that its destruction is
dependent upon the presence of its DB. The deletion of the DB did not
appear to result in a mislocalized or misfolded protein, as the
DB
protein was still fully functional in terms of its ability to activate
the MAPK pathway. N17 Ras induces degradation of GRF2, demonstrating
that signaling downstream of Ras is not required for the destruction of
GRF2. This result strongly indicates that binding to Ras is necessary
for degradation.
GRF2 is ubiquitinated in vivo, but it is not possible to see the GRF2-ubiquitin conjugates by Western blotting for GRF2, suggesting that only a small portion of GRF2 is ubiquitinated. The experiments assaying ubiquitination were done with exponentially growing cell cultures, so if ubiquitination of GRF2 is linked to cell cycle events, then only a small portion of the total cell culture would be in the correct phase. This may explain why we did not find a larger population of GRF2 becoming ubiquitinated. An equally plausible explanation may just be that the sensitivities of the antibodies used are not sufficient to detect the portion of GRF2 protein that is modified with ubiquitin. However, in a GRF2 IP from unsynchronized cells, ubiquitin peptides can be detected using MS techniques. Ubiquitin sequences can be found associated with GRF2 sequences in the absence of other proteins at apparent molecular weights much higher than that of GRF2 or ubiquitin alone. This circumstance is highly suggestive of a covalent interaction between the two proteins. Furthermore, if the mass spectrometer detector response of the identified ubiquitin peptide is normalized to any peptide from GRF2, a stoichiometric estimate can be made. From this, it is apparent that on an SDS-polyacrylamide gel the slower-migrating GRF2 is more highly ubiquitinated.
The
Cdc25 protein is not ubiquitinated, suggesting that a protein
that cannot bind Ras cannot be properly targeted for degradation. To
test this further, and to ensure that this effect was not due to the
removal of a large number of lysines, point mutant proteins that are
severely impaired in their ability to bind Ras were made. The point
mutations within the Cdc25 domain also eliminated ubiquitination, demonstrating that binding to Ras is required for ubiquitination of GRF2.
While the ubiquitination of the
DB protein is impaired, it is not
eliminated. It is possible that the DB is not the sole determinant for
ubiquitination of GRF2. As mentioned above, GRF2 also contains PEST
sequences that are thought to be signals for ubiquitination, and
perhaps these PEST sequences cooperate with the DB in targeting GRF2
for destruction. Preliminary observations suggest that this may be the
case. The DB, first found in mitotic cyclins, is a 9-amino-acid motif
that targets proteins for ubiquitination through the E3 ligase called
the APC, usually in a cell cycle-specific manner (48).
Substrate recognition by the APC is thought to require one of several
adapter proteins containing WD40 motifs. The known adapter proteins
responsible for degrading various proteins such as the mitotic cyclins
are Cdh1 and Cdc20, each of which appears to be responsible for
specific substrates (45). All known Cdc20 substrates
contain a DB, while Cdh1 substrates are recognized by the presence of a
DB or a KEN box (36). It is unknown at this point if GRF2
is ubiquitinated by the APC pathway with a specific adapter protein
that links it to the APC.
The APC is active from the end of mitosis and throughout G1 phase, according to literature that considers the proteolysis of G2 cyclins (2). Preliminary results suggest that GRF2 protein begins to be degraded at the end of G1 phase (C. L. de Hoog, unpublished observations). This finding suggests that either an unknown adapter protein for the APC regulates its destruction or GRF2's ubiquitination is actually regulated by the SCF complex. To date, all known SCF substrates are recognized in a strictly phosphorylation-dependent manner (9). Interestingly, GRF2 is phosphorylated on multiple residues within its PEST region, as shown by MS. We do not know the role these phosphorylation events play, but it is interesting that they fall within the PEST region of GRF2 as it is the PEST region in G1 cyclins that must be phosphorylated in order for them to be targeted for ubiquitination (9). It is also possible that the phosphorylation events are important in the activation of GRF2, as is the case for GRF1 (29-31).
The precedent has been set for proteins in the Ras pathway being destroyed by ubiquitin-mediated proteolysis, as evidenced by the destruction of tramtrack (Ttk), a transcriptional repressor in the Drosophila Ras signaling pathway that is required to specify R7 cell fate in the Drosophila eye (26, 42). The destruction of Ttk is dependent upon the presence of phyllopod (Phyl), which is induced by the Ras pathway downstream of the sevenless receptor tyrosine kinase. Phyl binds to a nuclear protein, seven in absentia (Sina), and this complex then binds Ttk, stimulating its ubiquitination and destruction. The Sina protein also binds to a ubiquitin-conjugating enzyme, Ubc9, which presumably contributes to the ubiquitination of Ttk (42).
There are other examples in the literature of a binding-triggered signal for ubiquitination. Human papillomavirus protein E6 binds the cellular factor E6-AP, and this pair associates with p53, whereupon p53 is targeted for destruction via the ubiquitin-mediated proteolytic pathway (38). An example of activation-triggered ubiquitination is found in a report regarding protein kinase C (PKC) (28). Treatment of cells with phorbol esters activates and then depletes some PKC isoforms. This depletion is a result of ubiquitination that is stimulated upon activation of PKC; blocking activation blocks ubiquitination (28). Lu et al. (28) speculate that activation of the ubiquitin-conjugating system is likely stimulated by a conformational change in PKC that occurs upon ATP binding or hydrolysis, resulting in a suicide model for PKC regulation.
We propose that in an unstimulated cell, GRF2 is in an inactive complex
or conformation, perhaps involving intramolecular interactions or an
interaction with an unknown negative regulator. Upon stimulation of the
cell with an agent that causes an increase in intracellular calcium
levels, GRF2 is activated such that it is capable of binding to Ras. If
the REM of GRF2 is involved in the stabilization of the Cdc25 domain as
appears to be the case with Sos (5), this binding may
"loop" out the stretch of amino acids containing the DB. As a
consequence of the interaction with Ras, the intervening DB is placed
into an active state or conformation, causing the protein to be
targeted for destruction (Fig. 11).
Another Ras exchange factor, CNrasGEF, contains a PDZ domain between
its REM and Cdc25 domains (37), and it is tempting to
speculate that the activity of the PDZ domain is regulated by Ras
binding in a manner similar to that of the DB of GRF2.
|
One possible explanation for the existence of multiple Ras-dependent signaling systems is that different signals are required at specific stages of the cell cycle. In addition to being able to transform cells, Ras has been established as an important cell cycle regulator. Microinjection of activated Ras into quiescent fibroblasts drives entry into S phase. Moreover, in some cell types, injection of neutralizing antibodies to endogenous Ras results in the cell cycle arrest of cells growing in serum and the inability to progress through to S phase (12, 13, 33). More recently, use of a novel method for detecting Ras-GTP, which involves affinity precipitation of activated Ras using its binding partner Raf, allowed the activation state of Ras to be monitored throughout the cell cycle (43). Using this method, Taylor and Shalloway demonstrated that in quiescent HeLa cells treated with serum, activation of Ras is achieved immediately after serum addition. Four to 5 h later in mid G1 phase, there is a second, much stronger activation of Ras, which does not appear to involve tyrosine phosphorylation (and therefore Grb2-Sos complexes). The pattern of Ras activation is the same when cells are grown in the presence or absence of serum or in suspension or attached to a substratum. These results point to a mechanism of Ras activation that is integral to the cell cycle machinery and is not solely linked to receptor-tyrosine kinase activation. It is possible that this mid-G1-phase activation of Ras is stimulated by GRF2, making this event calcium dependent.
As other DB-containing proteins are regulated in a cell cycle-dependent manner, perhaps Ras-GRF2 is also regulated in this way. Protein destruction is an excellent way to drive a pathway in one direction, as evidenced by the numerous cell cycle regulatory proteins whose levels or activities are controlled in this manner. It is also a mechanism that can be utilized to prevent an event from occurring at an inopportune time, and it may be for this reason that GRF2 is destroyed: in order to prevent activation of Ras at an inappropriate time in the cell cycle, perhaps in G2/M phase, when calcium oscillations are observed (3). An equally plausible explanation is that this is a method of turning off the signal following Ras activation. This downregulation is presumably part of a complex series of signaling events occurring following stimulation of a cell in order to elicit the desired response, be it progression through the cell cycle or differentiation. In either case, the regulated destruction of an exchange factor is a unique method of regulation in the Ras pathway in mammalian cells.
| |
ACKNOWLEDGMENTS |
|---|
We thank Dirk Bohmann for the gift of the HA-ubiquitin cDNA; Daria Mochly-Rosen for the pMAL-Flag-RACK1 plasmid; Hui Chen for expert technical assistance; and W.-T. Fan, V. Simon, and M. Tyers for helpful discussions.
This work was supported by the Medical Research Council of Canada. C.L.D.H. is an M.R.C. student; M.D.G. is a research fellow of the National Cancer Institute of Canada, supported with funds provided by the Terry Fox Run; and M.F.M. is an M.R.C. scientist.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: MDS Proteomics, Inc., 480 University Ave., Toronto, ON M5G 1V2, Canada. Phone: (416) 644-5103. Fax: (416) 644-5111. E-mail: m.moran{at}mdsproteomics.com.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Abdellatif, M.,
W. R. MacLellan, and M. D. Schneider.
1994.
p21 Ras as a governor of global gene expression.
J. Biol. Chem.
269:15423-15426 |
| 2. | Amon, A., S. Irniger, and K. Nasmyth. 1994. Closing the cell cycle circle in yeast: G2 cyclin proteolysis initiated at mitosis persists until the activation of G1 cyclins in the next cycle. Cell 77:1037-1050[CrossRef][Medline]. |
| 3. | Berridge, M. J. 1995. Calcium signalling and cell proliferation. Bioessays 17:491-500[CrossRef][Medline]. |
| 4. | Boguski, M. S., and F. McCormick. 1993. Proteins regulating Ras and its relatives. Nature 366:643-654[CrossRef][Medline]. |
| 5. | Boriack-Sjodin, P. A., S. M. Margarit, D. Bar-Sagi, and J. Kuriyan. 1998. The structural basis of the activation of Ras by Sos. Nature 394:337-343[CrossRef][Medline]. |
| 6. | Camus, C., S. Hermann-Le Denmat, and M. Jacquet. 1995. Identification of guanine exchange factor key residues involved in exchange activity and Ras interaction. Oncogene 11:951-959[Medline]. |
| 7. | Chen, L., L. J. Zhang, P. Greer, P. S. Tung, and M. F. Moran. 1993. A murine CDC25/ras-GRF-related protein implicated in Ras regulation. Dev. Genet. 14:339-346[CrossRef][Medline]. |
| 8. | Ciechanover, A., A. Orian, and A. L. Schwartz. 2000. Ubiquitin-mediated proteolysis: biological regulation via destruction. Bioessays 22:442-451[CrossRef][Medline]. |
| 9. | Craig, K. L., and M. Tyers. 1999. The F-box: a new motif for ubiquitin dependent proteolysis in cell cycle regulation and signal transduction. Prog. Biophys. Mol. Biol. 72:299-328[CrossRef][Medline]. |
| 10. | Dahlmann, B., L. Kuehn, A. Grziwa, P. Zwickl, and W. Baumeister. 1992. Biochemical properties of the proteasome from Thermoplasma acidophilum. Eur. J. Biochem. 208:789-797[Medline]. |
| 11. |
de Hoog, C. L.,
W. T. Fan,
M. D. Goldstein,
M. F. Moran, and C. A. Koch.
2000.
Calmodulin-independent coordination of Ras and extracellular signal-regulated kinase activation by Ras-GRF2.
Mol. Cell. Biol.
20:2727-2733 |
| 12. |
Dobrowolski, S.,
M. Harter, and D. W. Stacey.
1994.
Cellular ras activity is required for passage through multiple points of the G0/1 phase in BALB/c 3T3 cells.
Mol. Cell. Biol.
14:5441-5449 |
| 13. |
Durkin, J. P., and J. F. Whitfield.
1986.
Characterization of G1 transit induced by the mitogenic-oncogenic viral Ki-ras gene product.
Mol. Cell. Biol.
6:1386-1392 |
| 14. | Fam, N. P., W. T. Fan, Z. Wang, L. J. Zhang, H. Chen, and M. F. Moran. 1997. Cloning and characterization of Ras-GRF2, a novel guanine nucleotide exchange factor for Ras. Mol. Cell. Biol. 17:1396-1406[Abstract]. |
| 15. | Fan, W. T., C. A. Koch, C. L. de Hoog, N. P. Fam, and M. F. Moran. 1998. The exchange factor Ras-GRF2 activates Ras-dependent and Rac-dependent mitogen-activated protein kinase pathways. Curr. Biol. 8:935-938[CrossRef][Medline]. |
| 16. |
Farnsworth, C. L., and L. A. Feig.
1991.
Dominant inhibitory mutations in the Mg2+-binding site of RasH prevent its activation by GTP.
Mol. Cell. Biol.
11:4822-4829 |
| 17. |
Fenteany, G.,
R. F. Standaert,
W. S. Lane,
S. Choi,
E. J. Corey, and S. L. Schreiber.
1995.
Inhibition of proteasome activities and subunit-specific amino-terminal threonine modification by lactacystin.
Science
268:726-731 |
| 18. | Glotzer, M., A. W. Murray, and M. W. Kirschner. 1991. Cyclin is degraded by the ubiquitin pathway. Nature 349:132-138[CrossRef][Medline]. |
| 19. | Hart, M., and S. Powers. 1995. Ras-Cdc25 and Rho-Dbl binding assays: complex formation in vitro. Methods Enzymol. 255:129-135[Medline]. |
| 20. | Holloway, S. L., M. Glotzer, R. W. King, and A. W. Murray. 1993. Anaphase is initiated by proteolysis rather than by the inactivation of maturation-promoting factor. Cell 73:1393-1402[CrossRef][Medline]. |
| 21. |
Kaplon, T., and M. Jacquet.
1995.
The cellular content of Cdc25p, the Ras exchange factor in Saccharomyces cerevisiae, is regulated by destabilization through a cyclin destruction box.
J. Biol. Chem.
270:20742-20747 |
| 22. | Kingston, R. E., P. Chomczynski, and N. Sacchi. 1996. Guanidine methods for total RNA preparation, p. 4.2.1-4.2.9. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology, vol. 1. John Wiley & Sons, Inc., New York, N.Y. |
| 23. | Koegl, M., T. Hoppe, S. Schlenker, H. D. Ulrich, T. U. Mayer, and S. Jentsch. 1999. A novel ubiquitination factor, E4, is involved in multiubiquitin chain assembly. Cell 96:635-644[CrossRef][Medline]. |
| 24. | Kornitzer, D., and A. Ciechanover. 2000. Modes of regulation of ubiquitin-mediated protein degradation. J. Cell. Physiol. 182:1-11[CrossRef][Medline]. |
| 25. |
Lee, D. H., and A. L. Goldberg.
1996.
Selective inhibitors of the proteasome-dependent and vacuolar pathways of protein degradation in Saccharomyces cerevisiae.
J. Biol. Chem.
271:27280-27284 |
| 26. | Li, S., Y. Li, R. W. Carthew, and Z. C. Lai. 1997. Photoreceptor cell differentiation requires regulated proteolysis of the transcriptional repressor Tramtrack. Cell 90:469-478[CrossRef][Medline]. |
| 27. | Lowy, D. R., and B. M. Willumsen. 1993. Function and regulation of ras. Annu. Rev. Biochem. 62:851-891[CrossRef][Medline]. |
| 28. |
Lu, Z.,
D. Liu,
A. Hornia,
W. Devonish,
M. Pagano, and D. A. Foster.
1998.
Activation of protein kinase C triggers its ubiquitination and degradation.
Mol. Cell. Biol.
18:839-845 |
| 29. |
Mattingly, R. R.
1999.
Phosphorylation of serine 916 of Ras-GRF1 contributes to the activation of exchange factor activity by muscarinic receptors.
J. Biol. Chem.
274:37379-37384 |
| 30. | Mattingly, R. R., and I. G. Macara. 1996. Phosphorylation-dependent activation of the Ras-GRF/CDC25Mm exchange factor by muscarinic receptors and G-protein beta gamma subunits. Nature 382:268-272[CrossRef][Medline]. |
| 31. | Mattingly, R. R., V. Saini, and I. G. Macara. 1999. Activation of the Ras-GRF/CDC25Mm exchange factor by lysophosphatidic acid. Cell. Signal. 11:603-610[CrossRef][Medline]. |
| 32. |
Mosteller, R. D.,
J. Han, and D. Broek.
1994.
Identification of residues of the H-ras protein critical for functional interaction with guanine nucleotide exchange factors.
Mol. Cell. Biol.
14:1104-1112 |
| 33. | Mulcahy, L. S., M. R. Smith, and D. W. Stacey. 1985. Requirement for ras proto-oncogene function during serum-stimulated growth of NIH 3T3 cells. Nature 313:241-243[CrossRef][Medline]. |
| 34. | Nielsen, K. H., A. G. Papageorge, W. C. Vass, B. M. Willumsen, and D. R. Lowy. 1997. The Ras-specific exchange factors mouse Sos1 (mSos1) and mSos2 are regulated differently: mSos2 contains ubiquitination signals absent in mSos1. Mol. Cell. Biol. 17:7132-7138[Abstract]. |
| 35. |
Park, W.,
R. D. Mosteller, and D. Broek.
1994.
Amino acid residues in the CDC25 guanine nucleotide exchange factor critical for interaction with Ras.
Mol. Cell. Biol.
14:8117-8122 |
| 36. |
Pfleger, C. M., and M. W. Kirschner.
2000.
The KEN box: an APC recognition signal distinct from the D box targeted by Cdh1.
Genes Dev.
14:655-665 |
| 37. | Pham, N., I. Cheglakov, C. A. Koch, C. L. de Hoog, M. F. Moran, and D. Rotin. 2000. The guanine nucleotide exchange factor CNrasGEF activates ras in response to cAMP and cGMP. Curr. Biol. 10:555-558[CrossRef][Medline] |