Previous Article | Next Article 
Molecular and Cellular Biology, March 2001, p. 2118-2132, Vol. 21, No. 6
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.6.2118-2132.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
3A-Integrin Downregulates the Urokinase-Type
Plasminogen Activator Receptor (u-PAR) through a
PEA3/ets Transcriptional Silencing Element
in the u-PAR Promoter
Sandra
Hapke,1
Meinrad
Gawaz,2
Kerstin
Dehne,1
Jenny
Köhler,1
John F.
Marshall,3
Henner
Graeff,1
Manfred
Schmitt,1
Ute
Reuning,1 and
Ernst
Lengyel1,*
Department of Obstetrics and
Gynecology1 and Department of Internal
Medicine I, Deutsches Herzzentrum,2
Technische Universität München, Klinikum rechts der
Isar, D-81675 Munich, Germany, and Richard Dimbleby
Department of Cancer Research, ICRF Laboratory, St. Thomas's
Hospital, London SE1 7EH, United Kingdom3
Received 15 February 2000/Returned for modification 18 April
2000/Accepted 8 December 2000
 |
ABSTRACT |
Migration of cells requires interactions with the extracellular
matrix mediated, in part, by integrins, proteases, and their receptors. Previous studies have shown that
3-integrin
interacts with the urokinase-type plasminogen activator receptor
(u-PAR) at the cell surface. Since integrins mediate signaling into the cell, the current study was undertaken to determine if in addition
3-integrin regulates u-PAR expression.
Overexpression of
3-integrin in CHO cells, which are
avid expressers of the receptor, downregulated u-PAR protein and mRNA
expression. The u-PAR promoter (
1,469 bp) that is normally
constitutively active in CHO cells was downregulated by induced
3-integrin expression. A region between
398 and
197 bp of the u-PAR promoter was critical for
3-integrin-induced downregulation of u-PAR promoter
activity. Deletion of the PEA3/ets motif at
248 bp
substantially impaired the ability of
3-integrin to
downregulate the u-PAR promoter, suggesting that the
PEA3/ets site acts as a silencing element. An expression
vector encoding the transcription factor PEA3 caused inhibition of the
wild-type but not the PEA3/ets-deleted u-PAR promoter.
The PEA3/ets site bound nuclear factors from CHO cells
specifically, but binding was enhanced when
3-integrin
was overexpressed. A PEA3 antibody inhibited DNA-protein complex
formation, indicating the presence of PEA3. Downregulation of the u-PAR
promoter was achieved by the
3A-integrin isoform but not
by other
3-integrin isoforms and required the
cytoplasmic membrane NITY759 motif. Moreover,
overexpression of the short but not the long isoform of the
3-integrin adapter protein
3-endonexin
blocked u-PAR promoter activity through the PEA3/ets
binding site. Thus, besides the physical interaction of
3-integrin and u-PAR at the cell surface,
3 signaling is implicated in the regulation of u-PAR
gene transcription, suggesting a mutual regulation of adhesion and
proteolysis receptors.
 |
INTRODUCTION |
Invasion and metastasis of tumor
cells require a complex regulation of different cell surface-associated
proteins (4, 53, 55) that facilitate proteolysis and
adhesion of cells to the basement membrane and the extracellular matrix
(ECM). The invasive process starts with the attachment of cells to the
ECM, followed by degradation of various ECM components through
proteases, subsequent cell detachment, and migration (5).
One important protease involved in these processes is the serine
protease urokinase-type plasminogen activator (urokinase) which
is bound to a specific receptor (u-PAR). Urokinase converts
plasminogen to plasmin, a serine protease with broad substrate
specificity for several components of the ECM, including vitronectin,
laminin, and fibronectin (5, 27, 43). Together, these
adhesive and proteolytic functions of tumor cells facilitate their
migration through the basement membrane and the ECM.
Urokinase binds with high affinity to its heavily glycosylated
receptor, u-PAR (33, 35), which is composed of three
similar protein domains and is linked through a
glycosylphosphatidylinositol anchor to the plasma membrane. The
amino-terminal domain I of u-PAR interacts with urokinase while the
other two domains bind vitronectin (43), a major component
of the ECM and an integrin-binding ligand. Binding of urokinase to
u-PAR increases the rate of plasmin formation at the plasma membrane
(13) and focuses the proteolytic activity onto the leading
edge of tumor cells (5). Besides its role in proteolysis,
u-PAR is a multifunctional receptor that is involved in chemotaxis,
angiogenesis, signal transduction, migration, and adhesion of cells
(5, 36).
Expression of u-PAR is controlled mainly at the transcriptional level
(26, 29, 48), but posttranscriptional regulation (46) and recycling of u-PAR to the cell membrane
(10) represent additional levels of regulation.
Transcription of the u-PAR gene gives rise to a 1.4-kb mRNA or an
alternatively spliced variant that lacks the carboxy-terminal membrane
attachment peptide sequence (37). The importance of
transcriptional regulation of the u-PAR promoter by activator protein 1 (AP-1), AP-2, and Sp-1 transcription factors and their corresponding
binding sites in the 5'-flanking site of the u-PAR gene have been
recently defined (2, 26, 48). However, the
aforementioned transcription factor binding sites mediate
constitutive and inducible activation of the u-PAR gene, and a negative
regulatory element has so far not been characterized. In consideration
of the importance of u-PAR for several biological processes, the
existence of such a site could be hypothesized.
Recently, proteolysis and adhesion were functionally linked after it
had been found that u-PAR binds to vitronectin and is associated with
different members of the integrin family (7, 36, 52).
Integrins are cell surface heterodimeric transmembrane glycoproteins
consisting of
and
subunits that mediate cell-cell and cell-ECM
interactions. Each subunit encompasses a large extracellular domain, a
membrane-spanning domain, and a short cytoplasmic tail. Most integrins
interact with components of the ECM (e.g., vitronectin, fibronectin,
and collagen) or blood (e.g., fibrinogen). These integrin ligands
cross-link or cluster integrins on the cell surface by binding to
adjacent integrin molecules, leading to the formation of focal adhesion
contacts, thus activating intracellular signaling pathways
("outside-in signaling") (9). Integrins are implicated in various biological processes including angiogenesis, wound healing,
tumor cell invasion, and metastasis (30, 53), but the
specificity and mechanisms by which all these functions are regulated
are not fully understood. However, there is increasing evidence that
the cytoplasmic domain of the integrin
subunits plays a major
regulatory role in these processes (24, 40, 44). u-PAR
physically interacts on leukocytes with
2-integrin as shown by colocalization and
immunoprecipitation studies (6) and on fibrosarcoma
cells with
1- and
3-integrins (58). The direct
interaction between u-PAR and integrins plays a role in the binding
affinity of integrins toward their ligands and might be important for
urokinase-mediated signal transduction (47). Although
these studies demonstrated that u-PAR physically interacts with
-integrins, they do not address the consequence of
3-integrin expression for u-PAR regulation.
Taking into consideration that u-PAR expression is regulated
mainly at the transcriptional level (26) and that
integrins regulate gene expression via outside-in signaling
(39), we undertook a study with the following objectives: (i) to determine if
3-integrin regulates u-PAR
gene activity and (ii) to elucidate the molecular mechanisms by which
this occurs. We show for the first time that overexpression of
3A-integrin downregulates u-PAR transcription
via a PEA3/ets binding site in the u-PAR promoter, involving
the
3A-integrin cytoplasmic domain and the
adapter protein
3-endonexin short.
(This study was performed in partial fulfillment of the Ph.D. thesis of
S. Hapke.)
 |
MATERIALS AND METHODS |
Cell culture.
CHO cells were obtained from the American Type
Culture Collection (CRL 9096). The stable CHO cell clone A5 expresses a
high level of
IIb
3-integrin
(15) and was generously supplied by Mark Ginsberg, The
Scripps Research Institute, La Jolla, Calif. The cells were cultivated
in MEM alpha medium supplemented with L-glutamine and 10%
fetal calf serum (FCS; all from GIBCO, Life Technologies, Grand Island,
N.Y.).
Vectors.
The
v- and
3-integrin expression vector constructs
(28), a friendly gift from J. Loftus, Mayo Clinic,
Scottsdale, Ariz., were cloned into the SalI site of the
pBabe Puro plasmid (31). To study the role of the three
known
3-integrin cytoplasmic isoforms on the
u-PAR promoter, we used single-chain chimeric receptors which bear CH2
and CH3 portions of human immunoglobulin G1 (IgG1) at the cell surface,
the transmembrane domain of CD7, and the full-length cytoplasmic
domains of
3-A-,
3-B-, and
3-C-integrins (see Fig. 7A). All constructs were based
on previously described chimeric receptors and are in the context of
the P5C7 vector, cloned into the MluI/NotI site
(23).
1-integrin NITY and
3-integrin NPKY are a swap of the cytoplasmic
domain of
1-integrin with the cytoplasmic
domain of
3 and vice versa (see Fig. 7A). A
full-length polyomavirus enhancer activator 3 (PEA3) cDNA
(56) was inserted between the HindIII and
BamHI cloning sites of the cytomegalovirus promoter-driven
pcDNA3.1 expression vector (Invitrogen, Leek, The Netherlands).
The u-PAR chloramphenicol acetyltransferase (CAT) reporter
(25) consists of 449 bp of sequence, stretching from
398
to + 51 bp, cloned into the XbaI site of the pCAT-basic
vector (Promega, Mannheim, Germany); it was a kind gift of D. Boyd,
M. D. Anderson Cancer Center, Houston, Tex. Site-directed
mutagenesis of the u-PAR promoter (26) was performed,
using the Transformer kit from Clontech (Heidelberg, Germany). The
u-PAR firefly luciferase reporter (
1,469,
398, and
197 bp) was
generated by cloning the human u-PAR promoter into the SmaI
site of pGL3 (Promega). Four different deletion constructs (see Fig.
4D) were made within the full-length
1,469-bp u-PAR luciferase
promoter between
402 and
203 bp using the QuickChange site-directed
mutagenesis kit from Stratagene (Amsterdam, The Netherlands). u-PAR del
1 (
402/
350) was made using the primer
5'-TTTCAGGATGCATCT|AAATCCTGTTAGCCA-3', u-PAR del 2 (
349/
300) was made using the primer
5'-TGACAAAACTAACAA|TTTATCCTCATTTTA-3', u-PAR del 3 (
299/
260) was made using the primer
5'-TTTACCGTCAAAGTT|GTCCCACTTTAGGAA-3', and u-PAR del
4 (
237/
203) was made using the primer
5'-TTTAGGAAGAGAGAG|GCTGTGATCACAACT-3'.
Both isoforms of
3-endonexin were cloned from
a natural killer cell cDNA library through amplification by PCR, using
the
primer
5'-GGGGCGACGCGTATGATGCCTGTTAAAAGATCACTGAAGTTGGATGGTCTG-3'
(fw)/5'- GGGGCGGCGGCCGCTTCACAGAGGTTGTGACATCTGAGGCTGACC TTTGTG-3'
(rev) (
3-endonexin long) or
5'-GGGGCGACGCGTATGATGCCTGTTAAAAGATCACTGAAGTTGGATGGTCTG-3'
(fw)
/5'-GGGGCGG CGGCCGCTTCACTGTATACTACTTAAATTTTGCATTATCTCCAT-3'
(rev)
(
3-endonexin short). The resulting PCR
fragments were fused
to the respective 3' termini of an enhanced
green fluorescent
protein cloning cassette
(Clontech).
All constructs were identified by restriction digestion and verified by
DNA sequencing, and at least two different DNA preparations
were used
for transient
transfections.
Confocal laser scanning microscopy.
For immunofluorescence,
50,000 untransfected CHO cells or stable
3-expressing A5 cells were seeded into each
well of a four-well chamber slide (Nunc Lab-Tek, Naperville, Ill.). CHO
cells were transfected with
3-integrin or the
vector (pBabe Puro) control (31) with TransFast
transfection reagent (Promega). At 48 h posttransfection, viable
cells were collected, washed briefly in phosphate-buffered saline
(PBS), and incubated with a mouse polyclonal antibody against u-PAR
(0.75 µg/ml; HD 13.1; a kind gift of M. Kramer, University of
Heidelberg, Heidelberg, Germany) or monoclonal antibody against
3-integrin (0.1 µg/ml; CD61-UNLB; Southern
Biotechnology Associates, Birmingham, United Kingdom) in PBS at
4°C for 2 h. After three washes in PBS-2% bovine serum albumin
(5 min each), the cells were incubated with 50 ng of Alexa 488-conjugated goat anti-mouse IgG (Molecular Probes, Eugene, Oreg.)
secondary antibody/ml for 1 h at room temperature in PBS. Cells
were washed three times with PBS (10 min each), and coverslips were
examined with a Zeiss Axiovert 35 microscope (Zeiss, Heidelberg, Germany) attached to a laser scanning detection unit (Leica, Bensheim, Germany). For
3-integrin and u-PAR double
staining (see Fig. 2), a
3-integrin antibody
that was coupled with Alexa 488 was used and u-PAR was detected with HD
13.1 followed by the secondary antibody Alexa 568 (goat anti-mouse IgG;
Molecular Probes). The monoclonal antibody LM609 against
v
v-integrin was
supplied by Chemicon (Hofheim, Germany).
Northern blotting.
The levels of steady-state u-PAR
transcripts were determined by Northern blot analysis
(42). Total RNA was extracted from cells with TRIzol
(GIBCO), and 15 µg of RNA was electrophoresed in a 1.5% agarose
formaldehyde gel and transferred to a positively charged nylon membrane
by capillary action, using 10× SSC (1× SSC is 0.15 M NaCl plus 15 mM
sodium citrate, pH 7.4). The Northern blot was probed at 65°C with a
randomly primed, 32P-labeled cDNA specific for
u-PAR mRNA (14) and subsequently washed at 62°C, using
2× SSC in the presence of 1.0% sodium dodecyl sulfate. Loading
efficiencies were checked by reprobing the blot with a radioactive cDNA
which hybridizes with the 18S rRNA.
Western blot analysis.
Cells were lysed in a buffer
containing 50 mM HEPES (pH 7.5), 150 mM NaCl, 1 mM EDTA, 10% glycerol,
1% Triton X-100, 10 mM sodium fluoride, 1 mM sodium orthovanadate, 10 µg of aprotinin/ml, and 1 mM phenylmethylsulfonyl fluoride; cleared
by centrifugation; and electrophoresed by sodium dodecyl sulfate-10%
polyacrylamide gel electrophoresis under reducing conditions
(38). The resolved proteins were transferred to a
nitrocellulose membrane (BA-S85; Schleicher & Schuell, Dassel,
Germany); the filter was subjected for 1 h to a buffer containing 150 mM NaCl, 5 mM EDTA, 50 mM Tris HCl, 0.25% (wt/vol) gelatin, and 0.5%
(vol/vol) Triton X-100; and the filter was incubated
sequentially with a rabbit polyclonal antibody directed against u-PAR
(40 ng/ml; American Diagnostica no. 3931; Greenwich, Conn.), followed
by a mouse horseradish peroxidase-conjugated anti-rabbit IgG. Reactive
proteins were visualized by ECL as directed by the manufacturer
(Amersham Pharmacia Biotech, Little Chalfont, United Kingdom).
Transfections.
Reporter plasmids were transfected with
SuperFect transfection reagent (Qiagen, Hilden, Germany) with 3 × 105 CHO cells seeded overnight into six-well
plates. The transfection efficiency for CHO cells was about 75% as
determined by
-galactosidase staining. For the CAT assays, all
transient transfections were performed in the presence of 1 µg of
u-PAR-CAT reporter constructs, 1 µg of a luciferase expression
vector, and, where indicated, 3 µg of an expression plasmid coding
for
3-integrin or equimolar amounts of the
control vector. After 3 h, the cells were rinsed twice with PBS,
changed to 10% FCS-containing medium, and cultured for another 45 h. The cells were harvested and then lysed by repeated freeze-thaw
cycles in 0.25 M Tris-HCl, pH 7.8. Transfection efficiencies were
determined by the luciferase activity assay. After normalization for
transfection efficiency, CAT activity was measured by incubation of
cell lysates at 37°C with 4 µM
[14C]chloramphenicol and 1 mg of acetyl
coenzyme A/ml. The mixture was separated by extraction with ethyl
acetate, and acetylated products were separated on thin-layer
chromatography plates using chloroform-methanol as the mobile phase.
The radioactive dots were visualized by autoradiography,
and radioactivity was quantified using a Molecular Dynamics 445 SI PhosphorImager (26, 38).
For luciferase assays, transient transfections were performed in the
presence of 1 µg of the u-PAR luciferase reporter construct
and 10 ng
of a
Renilla luciferase pRL-SV40 plasmid (Promega) as
an
internal control together with 3 µg of an expression plasmid
coding
for
3-integrin or the control vector. After
transfection,
cells were cultured for 3 h in serum-free medium,
followed by
cultivation in 10% FCS for a further 45 h. Firefly
luciferase
activities were standardized for
Renilla
luciferase activity,
which was used as an internal
control.
Mobility shift assays.
Nuclear extracts were prepared from
CHO cells at 80% confluency as described elsewhere (49).
Nuclear extracts (7.5 µg) were incubated in a buffer containing 25 mM
HEPES (pH 7.5), 0.5 mM EDTA, 0.2 mM dithiothreitol, 100 mM NaCl, 4%
glycerol, and 2 µg of poly(dI/dC). Five femtomoles of a Klenow
end-labeled ([
-32P]ATP) oligonucleotide
(u-PAR PEA3,
5'-TTGGGTCCCACGTTAGGAAGAGAGAGAACTGGG-3') was
added to each reaction mixture in the absence or presence of a 100-fold
excess of the wild-type (wt) or mutated (mt) competitor sequence
(underlined), and binding was allowed at room temperature for 25 min.
Subsequently, 1 µg of PEA3 antibody (sc-113X; Santa Cruz Inc., Santa
Cruz, Calif.) was added, and incubation was continued at 4°C for
2 h. The reaction mixture was electrophoresed in a 5%
polyacrylamide gel, using 0.5× TBE (89 mM Tris, 89 mM boric acid, 1 mM
EDTA) running buffer. The gel was dried and exposed to X-ray film
overnight at
80°C (26).
 |
RESULTS |
3-integrin downregulates u-PAR.
To define the
role of
3- integrin for u-PAR regulation, we
utilized a CHO cell line that does not express the endogenous
3-integrin subunit (40). As shown
in Fig. 1A by Western
blot analysis and in Fig. 1B and D by immunofluorescent staining with an antibody directed to the
3-integrin
subunit, CHO cells express no detectable
3-
integrin. However, upon transient (Fig. 1C) and stable (Fig. 1E)
transfection of a
3-integrin expression construct into CHO cells, the
3-integrin
subunit can be readily detected by immunofluorescence. As parent CHO
cells have been reported to express endogenous
v-integrin (40), we were
interested to know if this endogenous
v-integrin subunit is recruited by exogenous
3-integrin into a correctly assembled
v
3-integrin heterodimer complex. Indeed, immunofluorescence studies with the monoclonal antibody LM609, which recognizes the complexed integrin subunits (
v
3), showed
that expression of
3-integrin leads to the
surface expression of an
v
3-integrin
heterodimer (Fig. 1F) in CHO cells. In contrast, no
v
3-integrin could be
detected in the vector-transfected CHO cells (Fig. 1G).



View larger version (158K):
[in this window]
[in a new window]
|
FIG. 1.
Detection of 3-integrin in CHO cells. (A)
Western blot. Cell lysates were resolved on a 10% polyacrylamide gel,
and 3-integrin was detected by Western blot analysis
using an antibody to 3- integrin. The band at ~120 kDa
represents 3-integrin. The
3-integrin-expressing ovarian cancer cell line OVMZ-6
served as a positive control. The experiment was repeated twice. (B to
G) Immunofluorescence. Untransfected CHO cells (B), CHO cells
transiently transfected with 3-integrin (C and F) or the
3-integrin vector (D and G), or a stable
3-integrin-expressing CHO cell clone, A5 (E), was plated
on chamber slides and stained by indirect immunofluorescence. CHO cells
were incubated with either a monoclonal antibody against
3- integrin (B to E) or an antibody against
v 3-integrin (F and G) followed by an
Alexa 488-conjugated goat anti-mouse secondary antibody. The experiment
was repeated twice.
|
|
Untransfected CHO cells display a high level of u-PAR as shown by
immunofluorescence (Fig.
2A). Upon
transient overexpression
of
3-integrin in CHO
cells, u-PAR expression is downregulated.
As exemplified in Fig.
2B,
the cell overexpressing
3-integrin
is not
expressing u-PAR while the adjacent
non-
3-transfected
cell (the
transient-transfection efficiency of CHO cells is about
75%) is still
expressing u-PAR. The reduction of u-PAR could not
be accounted for by
a vector effect, since the same amount of
the pBabe Puro expression
vector did not reduce u-PAR protein
expression (Fig.
2C). In
summarizing five transient transfections,
we found that 89% of
untransfected CHO cells showed u-PAR expression,
in contrast to 15%
when
3-integrin was transiently overexpressed.
Eighty-five percent of
3-integrin-expressing CHO cells showed
no u-PAR expression. This indicates that in transient
transfections
u-PAR is downregulated in most
3-integrin-expressing cells. In
contrast, in
the stable
3-integrin-expressing A5 CHO cell
clone
all cells showed
3-integrin expression
and a complete absence
of u-PAR protein (Fig.
2D).


View larger version (210K):
[in this window]
[in a new window]
|
FIG. 2.
Transfection of 3-integrin reduces u-PAR
protein levels. Immunofluorescence assays were performed.
Untransfected CHO cells (A), CHO cells transiently transfected with
3-integrin (B) or the 3-integrin vector
(C), or a stable 3-integrin-expressing CHO cell clone,
A5 (D), was plated on chamber slides. For panels E and F, first chamber
slides were coated with antibody LM609 and then untransfected CHO cells
(E) or CHO cells transiently transfected with 3-integrin
(F) were plated. For panels G and H, untransfected CHO cells (G) or CHO
cells transiently transfected with 3-integrin (H) were
plated on chamber slides coated with vitronectin. For panels A to D,
cells were double stained: integrin was detected with a monoclonal
3-integrin antibody coupled with Alexa 488, and u-PAR
was detected with a polyclonal antibody followed by an Alexa
568-conjugated secondary antibody. For panels E to H, cells were
stained by incubating them with an antibody against u-PAR, followed by
an Alexa 488-conjugated secondary antibody. The experiments were
repeated three to five times.
|
|
v
3-integrin occupancy
by ligand is important for several
v
3-integrin
functions, including adhesion, migration, and outside-in
signal
transduction (
61). In order to establish if this also
is
important for
3-integrin-mediated u-PAR
regulation, we studied
the effect of antibody-mediated (LM609)
clustering of
v
3-integrin
and
integrin ligation (immobilized vitronectin) on u-PAR expression.
Plating of
3-integrin-transfected CHO cells on
vitronectin or
on LM609 completely abolished u-PAR expression in the
cells (Fig.
2E to H). This repression was reproducibly stronger than
that
in cells which had been transfected with
3-integrin but then
plated on plastic alone.
These data indicate that downregulation
of u-PAR expression requires
the intact assembled
v
3-complex
and can be
increased by integrin clustering or ligand
occupancy.
The immunofluorescence data were corroborated by Western blotting with
a u-PAR antibody (Fig.
3A) revealing high
u-PAR levels
in the parental cell and significantly lower u-PAR antigen
concentrations
in the transiently and the stably
3-integrin-expressing CHO A5
cell
clone. The transient

3-integrin-transfected CHO cells still
showed
residual u-PAR protein expression, probably because their
transfection
efficiency was only about 75%. Therefore, their u-PAR
protein
expression was probably due to u-PAR expression of the
untransfected
CHO cells.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 3.
Downregulation of u-PAR by 3-integrin on
the protein and mRNA levels (A) Western blot. Cell lysates from
untransfected and transiently and stably
3-integrin-transfected CHO cells were electrophoresed in
a 10% acrylamide gel, and u-PAR was detected by Western blot analysis
with a polyclonal antibody to u-PAR. (B) Northern blot analysis of
u-PAR mRNA. mRNA was extracted from untransfected and
transiently and stably 3-integrin-transfected CHO cells,
electrophoresed in a 1.5% formaldehyde-agarose gel, and subsequently
transferred to a nylon filter. The filter was probed with cDNAs
specific for u-PAR and 18S rRNA transcripts.
|
|
For determining if u-PAR protein data are mirrored by a decrease in
steady-state u-PAR mRNA, Northern blotting was performed
after RNA
extraction and purification (Fig.
3B). Untransfected
CHO cells
contained significantly more u-PAR mRNA than did cells
transiently
overexpressing
3-integrin or the A5 cell
clone, which
stably expresses
3-integrin.
Altogether, the data shown in Fig.
2 and
3 demonstrate that
overexpression of
3-integrin in CHO
cells
downregulates u-PAR protein and mRNA
expression.
Analysis of u-PAR gene transcription by
3-integrin.
The
3-integrin
subfamily includes
IIb
3- and
v
3-integrin. While
the expression of
IIb
3-integrin is
largely confined to cells of the megakaryocytic lineage and is required
for platelet aggregation (12, 60),
v
3-integrin is
expressed more widely, including in fibroblasts, smooth muscle cells,
and endothelial cells. To study the effect of
v- and
3-integrin on
u-PAR promoter activity, we transiently cotransfected CHO cells with a
CAT reporter driven by 398 bp of 5'-flanking sequence of the u-PAR
promoter. Transient expression of both
v- and
3-integrin subunits together with the u-PAR
promoter resulted in a reduction of u-PAR promoter activity (Fig.
4A). This reduction was brought about by
the
3-integrin expression construct because
transfection of
v-integrin alone did not show
any effect on the u-PAR promoter. Lysates of CHO cells transfected
with the u-PAR promoter-CAT reporter and the
3-integrin expression vector resulted in 18%
[14C]chloramphenicol conversion, compared to
87% in the absence of
3-integrin. By
contrast, expression of the same amount of
v-integrin showed no effect on the high
constitutive activity of the u-PAR promoter. This indicates that the
u-PAR promoter contains a transcription factor binding site that might
account for the
3-integrin-mediated repression
of u-PAR gene transcription in CHO cells. Dose-response studies
demonstrated that
3-integrin expression
resulted in a potent inhibition of u-PAR promoter activity (Fig. 4B). A
significant reduction of promoter activity was observed upon
transfection with 0.5 to 5 µg of
3-integrin
expression vector, whereas an equimolar amount of the empty expression
construct (pBabe Puro) had a minimal effect on reporter activity.
Cotransfection of 2 µg of
3-integrin caused
an 80% reduction of u-PAR promoter activity, which, however, could not
be further decreased, not even with 5 µg of
3-expression plasmid. To exclude the
possibility that the effect of
3-integrin is
due to a general inhibition of transcriptional activity, we performed a
control experiment with the
-actin promoter. Compared with the
effect of
3-integrin transfection on a
luciferase promoter regulated either by u-PAR or by
-actin, the
activity of
-actin was not affected by the expression of
3-integrin while the u-PAR promoter activity
was inhibited (data not shown).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
3-integrin downregulates u-PAR promoter
activity. (A) CHO cells, at 70% confluency, were transiently
transfected with 1 µg of a CAT reporter driven by the u-PAR promoter
(u-PAR-CAT), a firefly luciferase vector, and the indicated amounts of
v and 3-integrin expression vectors.
After 3 h, the medium was changed and the cells were cultured for
a further 45 h. The cells were lysed, harvested, and assayed for
luciferase activity. Cell extracts corrected for differences in
transfection efficiency were incubated with
[14C]chloramphenicol, and after extraction with ethyl
acetate, they were subjected to thin-layer chromatography. The
conversion of [14C]chloramphenicol to acetylated
derivatives was determined, using a PhosphorImager. The data shown
represent the average values and standard deviations for five
independent experiments. (B) CHO cells were transiently transfected
with 1 µg of bp 398 u-PAR promoter luciferase construct and the
indicated amounts of 3-integrin. Luciferase activity was
analyzed 48 h after transfection and standardized for
Renilla luciferase activity. The data shown represent
the average values and the standard deviations for five independent
experiments.
|
|
Inhibition of the u-PAR promoter activity by
3-integrin requires a binding site for
PEA3/ets.
For localization of the region of the
u-PAR promoter responsible for
3-integrin-mediated inhibition of u-PAR
promoter activity, CHO cells were cotransfected with a luciferase
reporter driven by 5'-deletion fragments of the u-PAR promoter and the
3-integrin expression vector (Fig.
5A). A dramatic inhibition of the u-PAR promoter was evident with the
1,469-bp and
398-bp u-PAR promoter construct when cotransfected with
3-integrin
while the
197-bp luciferase reporter was not affected by the
3-integrin. The u-PAR
197 promoter had a low
constitutive activity that could not be further downregulated by
3- integrin. These data suggest that a
sequence residing between
398 and
197 bp is critical for the reducing effect of
3- integrin on u-PAR
promoter activity.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 5.
The inhibition of the u-PAR promoter by
3-integrin requires a PEA3/ets binding
site in the 5'-flanking sequence of the u-PAR gene. (A) CHO cells were
transiently transfected with 1 µg of u-PAR promoter luciferase
constructs of different lengths and were indicated with 3 µg of
3-integrin or the control vector. Luciferase activity
was analyzed 48 h after transfection and standardized for
Renilla luciferase activity. The data shown represent
the average values and standard deviations for five independent
experiments. (B) CHO cells were transiently cotransfected with 1 µg
of a luciferase reporter driven by the 1469 u-PAR promoter or the
indicated deletions and mutations (in the context of 1469 u-PAR) with
or without 3 µg of 3-integrin or the empty expression
vector alone. The data shown represent the average values and the
standard deviations for four independent experiments.
|
|
Since the u-PAR promoter region from

398 to

197 bp was associated
with a reduction of u-PAR by
3-integrin, we
reasoned
that transcription factor binding sites in this part of the
promoter
were required for silencing of the u-PAR transcription by
3-integrin.
A computer search of this part of
the sequence (
48) indicated
the presence of a previously
uncharacterized
PEA3/ets binding
site (

248 bp) identical
with the canonical binding sequence (AGGAAG).
Since this motif has been
shown elsewhere to be responsible for
the basal and inducible
regulation of many genes, including those
for several matrix
metalloproteinases (MMPs) as well as urokinase
(
34,
54),
we investigated the possible role of this motif
in the regulation of
the u-PAR promoter by
3-integrin. Mutation
of
the
PEA3/ets binding site at

248 bp induced the
constitutive
activity of the u-PAR promoter by 20% compared to the wt
promoter,
which indicates that this sites acts as a (weak) silencing
element
in the u-PAR promoter. Cotransfection of the

1469 u-PAR
PEA3/ets mutant with
3-integrin did
not further lower u-PAR promoter activity,
which implies that the
PEA3/ets transcription factor binding site
is important for
downregulation of the u-PAR promoter by
3-integrin
(Fig.
5B). To investigate if other
transcription factor binding
sites in the 200-bp region of the u-PAR
promoter between

398
bp and

197 bp are involved in repression of
u-PAR by
3-integrin,
we performed further
deletion analyses. Deletion of four different
regions around the
PEA3/ets site of the u-PAR promoter in the

1469 u-PAR
promoter did not affect the reduction of the u-PAR
promoter by
3-integrin (Fig.
5B). However, both deletion 1 (u-PAR
del 1

402/

350) and deletion 2 (u-PAR del 2

349/

300)
showed
only 60% of the constitutive activity of the wt

1469 u-PAR
luciferase
promoter, which implies positive regulatory elements that
are
important for the basal promoter activity between

402 and

300
bp of the u-PAR
promoter.
Because the constitutive activity of the u-PAR promoter is driven at
least in part through an AP-1 binding site (
26) and
transcription factors of the AP-1 family have been shown to cooperate
with Ets family members, we were interested in the role of the
AP-1
site in the regulation of the u-PAR promoter. Mutation of
the AP-1
binding site at

184 bp in the

1,469-bp u-PAR luciferase
construct
reduced the high constitutive promoter activity in CHO
cells by 75%
(Fig.
5B). Cotransfection of the
3-integrin
expression
plasmid with the mutated u-PAR promoter had no further
impact
on the already low u-PAR promoter activity, implying that the
AP-1 site is not involved in the regulation of the u-PAR promoter
by
3-integrin.
The observation that a deletion of the
PEA3-ets site at

248 bp impaired the reduction of the u-PAR promoter activity by
3-integrin
suggests that this transcription
factor binding site mediates,
at least in part, the reduction by the
3-integrin. To further
investigate this
possibility, we determined whether expression
of the PEA3 transcription
factor itself could downregulate the
u-PAR promoter (Fig.
6). CHO cells were
cotransfected with the
u-PAR promoter-driven CAT reporter (u-PAR-CAT)
and an expression
vector that encoded the PEA3 transcription factor
(pcDNA3 PEA3).
Expression of 3 µg of PEA3 reduced the constitutive
activity of
the u-PAR promoter from an average conversion of
[
14C]chloramphenicol of 89% to 15%. By
contrast, expression of the
vector lacking the coding sequence for PEA3
(pcDNA3) had no effect
on the u-PAR promoter activity. Deletion of the
PEA3/ets site
at

248 bp (u-PAR PEA3 mt

248) in the u-PAR
promoter prevented
a reduction of u-PAR promoter activity by the Ets
family member
(Fig.
6B). These data indicate that PEA3 is a
transrepressor of
the u-PAR promoter.





View larger version (264K):
[in this window]
[in a new window]
|
FIG. 6.
Downregulation of the u-PAR promoter by
3-integrin is mediated by the transcription factor PEA3.
(A and B) CHO cells were transiently transfected with the 398 u-PAR
promoter (u-PAR CAT) (A) or the same promoter with a deletion of the
PEA3/ets site at 248 (u-PAR PEA3 mt 248), a
luciferase vector for normalization, and expression vectors encoding
PEA3 (3 µg) or 3-integrin (3 µg) in equimolar
concentrations (B). For panels A and B, the medium was changed 3 h
after transfection, and the cells were cultured for a further 45 h. The cells were harvested and assayed for luciferase activity. Cell
extracts corrected for differences in transfection efficiency were
incubated with [14C]chloramphenicol and, after extraction
with ethyl acetate, subjected to thin-layer chromatography. The
conversion of [14C]chloramphenicol to acetylated
derivatives was determined by using a PhosphorImager. The data shown
represent the average values for two to four independent
experiments. (C) Induction of PEA3 DNA-binding activity by
3-integrin. Gel shift assays were performed. Nuclear
extracts (n.e.) from CHO cells transfected with
3-integrin or the empty expression vector were incubated
with 2 × 104 cpm of a Klenow
-32P-end-labeled oligonucleotide spanning the
PEA3 site of the u-PAR promoter at 248 bp in the
absence or presence of a 100-fold excess of the indicated competitors
and electrophoresed in a 5% polyacrylamide gel. The PEA3 mt competitor
oligonucleotide has point mutations in the PEA3 site.
The arrow indicates a retarded complex of CHO
3-integrin-transfected cells; the asterisks indicate
unspecific binding. (D) Nuclear extracts (n.e.) were prepared from the
CHO 3-integrin-transfected cells and incubated with a
Klenow -32P-end-labeled oligonucleotide spanning the
PEA3 site of the urokinase receptor promoter. After 15 min, antibody to PEA3 was added, and the reaction mixture was
subsequently subjected to gel electrophoresis. The data are
representative of three experiments. (E and F) Immunofluorescence. CHO
cells transiently transfected with PEA3 (E) or untransfected (F) were
plated on chamber slides. For panels E and F, CHO cells were incubated
with a polyclonal antibody against u-PAR, followed by an Alexa
488-conjugated goat anti-mouse secondary antibody. The experiment was
repeated three times. (G) Transfection. CHO cells were
transiently transfected with 1 µg of the 398 u-PAR promoter
(u-PAR-CAT), a firefly luciferase vector, 1 µg of
3-integrin, and the indicated amounts of PEA3 expression
vector. The conversion of [14C]chloramphenicol to
acetylated derivatives was determined by using a PhosphorImager.
The data shown represent the values for two independent experiments.
|
|
In consideration of the presence of the
PEA3/ets site at

248 bp, which is required for the reduction of u-PAR by
3-integrin,
we carried out electrophoretic
mobility shift assays. Nuclear
extracts from parental and
3-integrin-transfected CHO cells were
prepared
and incubated with an end-labeled 31-bp oligonucleotide
spanning the
PEA3 site at

248 bp (see Materials and Methods for
sequence). A retarded complex (Fig.
6C, arrow) was apparent with
nuclear extract from parental and
3-integrin-transfected cells.
However, the
intensity of the retarded band was higher in
3-integrin-transfected
cells than it was in
the parental cell line. The binding of the
factor(s) to the
oligonucleotide was specific, since a 100-fold
excess of wt
oligonucleotide, but not the oligonucleotide which
had been mutated in
the
PEA3/ets motif, competed for the binding.
A
PEA3-specific antibody substantially counteracted the binding
of
transcription factors to the PEA3 binding site, which indicates
that
PEA3 is a major component of the DNA-binding complex (Fig.
6D). These
data suggest that the downregulation of the u-PAR promoter
by
3-integrin is mediated, at least in part,
through a previously
unrecognized
PEA3/ets site located at

248 bp upstream of the
transcriptional start site of the u-PAR gene.
The data in Fig.
5A to D characterize only the transcriptional
regulation of the
u-PAR promoter by
PEA3. To strengthen the
notion that PEA3 can
also downregulate u-PAR protein expression, we
transfected PEA3
in the CHO parental cell line (Fig.
6E and F). Indeed,
overexpression
of PEA3 alone without
3-integrin almost completely abolished
u-PAR
protein expression, as is shown by immunofluorescence, which
implies
that the transcriptional downregulation of the u-PAR promoter
is
paralleled by a reduction in u-PAR
protein.
To investigate if
3-integrin and PEA3
cooperate to regulate u-PAR,
3-integrin and
PEA3 were cotransfected. For this experiment,
a
3-integrin expression vector was expressed in
a concentration
(1 µg) that leads to only a partial reduction of
u-PAR promoter
activity and, where indicated, PEA3 was cotransfected
(Fig.
6G).
In this case, a 1-µg concentration of PEA3 expression
vector is
sufficient to downregulate the u-PAR promoter to a level that
is achieved only with 3 µg of PEA3 when no
3-integrin is cotransfected
(cf. Fig.
6A and
G). Thus, the ability of PEA3 to inhibit the
u-PAR promoter is enhanced
in
3-integrin-overexpressing cells.
Cotransfection of 2 and 3 µg of PEA3 with
3-integrin abolished
u-PAR promoter activity
completely, but this level of downregulation
could never be achieved
with PEA3 alone. This suggests that transcription
factors other than
PEA3 are necessary to mediate the effect of
3-integrin.
Regulation of the u-PAR promoter by the cytoplasmic domain of
3-integrin.
The analysis of the regulatory role of
3-integrin cytoplasmic domains in multiple
cellular functions has recently acquired a new level of complexity with
the identification of variants of
3-integrin
(50). There are three
3-integrin isoforms
(
3A-,
3B-, and
3C-integrin) which result from alternative
splicing and differ from one another by their cytoplasmic sequence
(Fig. 7A) (21, 60). For a
further evaluation of the mechanism of integrin-dependent u-PAR
regulation, we created single-chain chimeric receptors (15a) which bear
the full-length cytoplasmic domain of
3-integrin fused to an Ig tag
(23) (Fig. 7A). CHO cells were transiently
cotransfected with the u-PAR-CAT reporter and the different
3-integrin isoforms (Fig. 7B). The high
constitutive activity of the u-PAR promoter in CHO cells could be
downregulated almost completely by the
3A-integrin while the
3B-integrin and the IgG1 vector had no effect
on the u-PAR promoter activity. Conversion of
[14C]chloramphenicol was reduced from 83%,
which mirrors the constitutive activity of the u-PAR promoter, to 10%
in cells cotransfected with the
3A-integrin.
The
3C-integrin isoform reduced the u-PAR promoter activity by 39%.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 7.
Regulation of the u-PAR promoter by the cytoplasmic
domain of 3-integrin. (A) Schematic outline of the
chimeric receptors used in this study. The amino acid sequences of the
cytoplasmic domains of integrin isoforms 3A,
3B, 3C, and 1A and the
mutated 3A- and 1A- integrins are shown.
Wild-type and mutant intracellular domains of -integrins were
expressed in the context of single-chain chimeric receptors, fused to
heterologous extracellular and transmembrane domains corresponding to
the CH2 and CH3 domains of human IgG1 and the CD7 antigen,
respectively. Mutated amino sequences are shown in boldface and
underlined. (B) CHO cells were transfected with the indicated wt or
mutated integrin isoforms or the appropriate control vector (IgG1).
After 3 h, the medium was changed, and the cells were cultivated
for a further 45 h. The cells were harvested, lysed, and assayed
for CAT activity. The conversion of [14C]chloramphenicol
to acetylated derivatives was determined by using a
PhosphorImager. The data shown represent the average values and the
standard deviations for three independent experiments.
|
|
The cytoplasmic domain of
3-integrin interacts
with certain proteins whose binding is crucial for the signaling
function
of
3-integrin (
21,
60).
One motif which has been shown to
be important for the
3A-integrin function and is present only
in
this isoform is the NITY
759 motif in the
cytoplasmic region. Therefore, we asked whether
a mutation of this
motif affects the u-PAR promoter regulation
by
3A-integrin. CHO cells were cotransfected with
the u-PAR promoter
and a
3A-integrin
expression plasmid which has a substitution
in the distal cytoplasmic
membrane NITY
759 motif. The
NITYRGT
762 domain in
3A-integrin was replaced with the
NPKYEGK
778 of the
1A-integrin, yielding a chimeric construct
(Fig.
7A).
The chimeric
3A-integrin
(
3A NPKY) could not reduce u-PAR promoter
activity, compared with its wt form (Fig.
7B). In the opposite
experiment, we replaced seven amino acids in the cytoplasmic domain
of
a
1-integrin expression plasmid with the
NITYRGT
762 motif of
3A-integrin (Fig.
7A) and cotransfected it
with the
u-PAR promoter (Fig.
7B). This construct did not show any
effect
on u-PAR promoter activity, which indicates that the
NITYRGT
762 motif of
3A-integrin is necessary but not sufficient
for the
downregulation of u-PAR promoter activity by
3A-integrin.
3-endonexin short downregulates u-PAR promoter
activity.
Previous studies have shown that the short form of a
cytoplasmic protein called
3-endonexin binds
to the NITY759 motif within the cytoplasmic
domain of the
3A-integrin (12, 45). This interaction is specific because
1- and
2-integrins do
not interact with
3-endonexin. Two isoforms of
3-endonexin have been discovered, but only the
short form interacts with the cytoplasmic domain of
3A-integrin (22). Since we have
shown that the NITY759 motif in the cytoplasmic
domain of
3A-integrin is necessary for
regulating the u-PAR promoter, we tested whether
3-endonexin short or its longer isoform is
involved in this regulation. CHO cells were cotransfected with the
u-PAR promoter-driven CAT reporter along with various amounts of an
expression vector that encoded
3-endonexin
short or
3-endonexin long (Fig.
8A). CAT activity was inhibited
almost completely by the short form of
3-endonexin while the empty expression vector
had no effect. An input of the short form of
3-endonexin diminished the u-PAR promoter
activity by 87%. By contrast, the
3-endonexin
long form induced u-PAR promoter activity by 32%. When both
3-endonexin isoforms were cotransfected
with the u-PAR promoter mutated in the PEA3/ets site (u-PAR
PEA3 mt
248 bp), the expression of the short form of
3-endonexin did not reduce the u-PAR promoter
activity any further (Fig. 8B). Evidently, the short isoform of
3-endonexin downregulates the u-PAR gene at
least in part through the PEA3/ets site in the u-PAR
promoter.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 8.
3-Endonexin short downregulates the u-PAR
promoter. CHO cells were transiently transfected, using 1 µg of a CAT
reporter driven either by the wt u-PAR promoter (u-PAR CAT) (A) or by
the same promoter with a deletion of the PEA3/ets site
at 248 (u-PAR PEA3 mt 248), expression vectors encoding the short
or long forms of 3-endonexin short, or the empty
expression vector (pEGFN1) (B) . Cell extracts normalized for
luciferase activity were incubated with
[14C]chloramphenicol, extracted with ethyl acetate, and
subjected to thin-layer chromatography. The conversion of
[14C]chloramphenicol to acetylated derivatives was
determined by using a PhosphorImager. The data shown represent the
average values and the standard deviations for three (A) or two (B)
independent experiments.
|
|
 |
DISCUSSION |
Cell migration depends on the coordinated regulation of
proteolysis and adhesion at the cell surface and is tightly regulated in several physiologic and pathological conditions. Thus, it is critical to understand how these processes affect each other. In the
present study, we provide evidence that overexpression of the adhesion
receptor
3-integrin downregulates the protease receptor, u-PAR. Furthermore, we have demonstrated that this
downregulation is mediated, at least in part, through a
PEA3/ets site in the u-PAR promoter and involves a
NITY759 motif in the cytoplasmic domain of the
3-integrin subunit and the adapter protein
3-endonexin.
Several of our observations suggest a pivotal role for
3- integrin in regulating u-PAR. The
introduction of
3-integrin into CHO cells
which have a high constitutive u-PAR expression blocks u-PAR protein
expression, as is shown by Western blot analysis and
immunofluorescence. Equally important, overexpression of
3-integrin also downregulates u-PAR mRNA
and, in both transient and stable transfections, also
downregulates u-PAR promoter activity. In contrast,
v-integrin and
1-
integrin alone have no influence on u-PAR regulation. However, upon
overexpression of
3-integrin,
v-integrin is recruited into an
v
3-integrin complex,
as is evidenced by our immunofluorescence results with an antibody
recognizing the ECM ligand binding site of the heterodimer
v
3. Clustering of
v
3-integrin, which
was achieved after ligation with immobilized vitronectin or the
antibody LM609, even enhanced the repression of u-PAR in CHO cells.
This indicates that the
v
3-integrin complex and its ligation (outside-in signaling) and not the single
3-integrin subunit is required for u-PAR
regulation. Thus, besides its involvement in adhesion, migration, and
signal transduction (61),
v
3-integrin can also
inhibit u-PAR transcription.
u-PAR is a multifunctional receptor and not only focuses urokinase
enzymatic activity onto the cell surface but is also associated with
and modulates the function of
1-,
2-, and
3- integrins (16, 52, 58, 59). It is presently known that u-PAR and integrins coassemble within the plasma membrane and modulate the adhesive and migratory functions of cells. Wei et al. (52)
showed that a complex of u-PAR,
1-integrin,
and caveolin affects the adhesive properties of embryonic kidney 293 cells. u-PAR inhibited cell adhesion on fibronectin but promoted cell
adhesion to vitronectin, which implies that one effect of the
association between u-PAR and integrins is to affect the ligand-binding
function of that integrin (7). In addition to the
already-described physical interaction between u-PAR and
3-integrin at the cell surface, we now report
that an increased level of
3-integrin
expression results in a reduced transcription of the u-PAR promoter and
thus reduced u-PAR protein expression. This helps us to understand how
integrins counteract u-PAR action at the cell surface and identifies a
new regulatory mechanism between
3-integrin
and the u-PAR. Our findings may explain the observations by Danen et
al. (11), who showed that stable overexpression of
3-integrin in the
3-negative human melanoma cell line MV3
strongly reduces invasion into Matrigel and also lung
colonization but not proliferation in nude mice. Since u-PAR is
involved in tumor cell invasion and metastasis, we speculate from our
data that the
3-mediated reduced expression of
u-PAR modulates the proteolytic potential of tumor cells required for
invasion and metastasis.
The cytoplasmic domain of integrins is fundamental for gene expression,
cell proliferation, and cell cycle regulation (9, 39). The
membrane-distal NXXY motif within the cytoplasmic domain is highly
conserved in
1-,
2-,
3-,
5-,
6-, and
7-integrins and plays a crucial role in integrin-mediated cell functions. For
3-integrin, this motif
(NITY759) is important for different functions,
including cell adhesion, focal contact formation, and FAK/paxillin
tyrosine phosphorylation (40). Our present results show
that the transfection of the cytoplasmic domain of
3-integrin is sufficient to reduce u-PAR gene
transcription. This effect was evident when the
3A-integrin isoform was used, but it was not
manifest with the
3B isoform. Because the
NITY759 motif is found exclusively within the
3A-isoform sequence and not in other
integrins, we evaluated the importance of the
NITY759 motif for u-PAR gene regulation and found
that deletion and substitution of the NITY759
motif through the cytoplasmic NPKY775 of
1-integrin abolish the inhibitory effect of
3A-integrin on u-PAR expression. However, the
NITY759 motif itself is necessary but not
sufficient to mediate the reduction of the u-PAR promoter activity,
because its integration into the
1-integrin
cytoplasmic domain did not inhibit the u-PAR transcription. Probably,
other parts of the
3-integrin cytoplasmic
domain in addition to this motif are involved in u-PAR downregulation.
This is also suggested by the ability of
3C-integrin to downregulate the u-PAR
promoter, albeit to a lower degree than
3A-integrin. The
3A-integrin isoform plays a role in signal
transduction and inside-out signaling (1), and now our
results point to an additional role as a regulator of u-PAR expression.
Because expression of
3-integrin isoforms
might be differentially regulated depending on the functional state of
the cell, a change in the pattern of
3-integrin isoforms might have an impact on
3-integrin-dependent u-PAR regulation.
The importance of the NITY759 motif for u-PAR
regulation is also emphasized by the fact that
3-endonexin, the binding of which relies on a
structurally intact NITY759 motif
(12) in the cytoplasmic domain of
3A-integrin, downregulates the u-PAR promoter.
The NITY759 motif is the binding site of
3A-integrin for its specific cytoplasmic protein
3-endonexin, which exists in a short
and a long isoform, the latter of which does not bind to the
cytoplasmic domain of
3-integrin
(45). We established that the short isoform of
3-endonexin downregulates u-PAR promoter
activity, indicating a role for
3-endonexin short in u-PAR regulation by binding to the cytoplasmic tail of
3-integrin. The specificity of this regulation
is emphasized by the inability of the long form of
3-endonexin to regulate u-PAR promoter
activity. Kashiwagi et al. (22) presented evidence of the
interaction of the short form of
3-endonexin
with the
3 cytoplasmic tail modulating the
affinity state of
IIb
3- integrin and
enhancing fibrinogen-dependent cell aggregation.
3-endonexin short increases the affinity of
individual
IIb
3-
heterodimers for specific ligands, which suggests inside-out signaling
with
3-endonexin affecting the affinity of
IIb
3 for certain
ligands (22). Besides these functions,
3-endonexin also participates in the
integrin-mediated gene regulation that starts with activation-binding of
3-integrin, results in
3-endonexin recruitment, and eventually affects u-PAR gene regulation via a PEA3/ets binding site in
the u-PAR promoter.
Cytoplasmic domains of
-integrins mediate downstream signaling
events and affect gene regulation. In untransformed cells, integrins
induce cell cycle progression via the Ras-mitogen-activated protein
kinase (MAPK) pathway (8, 24). Our previous studies indicated that the u-PAR promoter is regulated via a
MAPK-dependent signal transduction pathway (25),
raising the possibility that
3-integrin
uses this signal transduction pathway to regulate u-PAR
(19). However, we did not find any involvement of MAPK in
u-PAR gene regulation by
3-integrin, neither
by testing synthetic inhibitors nor with dominant-negative expression
vectors for Erk-, Jnk-, or p38-MAPK (data not shown). This implies that
integrin-dependent u-PAR gene regulation does not take place via
well-documented signaling pathways. Therefore, further studies will be
necessary to elucidate the signal transduction pathway(s) involved in
the regulation of u-PAR by
3-integrin and
3- endonexin.
The involvement of the transcription factor PEA3 in mediating the
reduction of the u-PAR promoter by
3-integrin
is supported by several experiments. First, the ability of
3-integrin to downregulate u-PAR promoter
activity is abolished by deletion of the PEA3/ets site at
248 bp. Second, an expression vector encoding the Ets family member
PEA3 was sufficient to reduce wt u-PAR promoter activity but not the
promoter with a mutation in this consensus sequence. Third,
overexpression of PEA3 reduced u-PAR protein expression. Fourth,
nuclear extracts of
3-integrin-overexpressing cells showed enhanced binding activity for the PEA3/ets
site, and the Ets family member PEA3 was identified within the
DNA-protein complex. Fifth,
3-endonexin short
downregulates only the wild type and not the
PEA3/ets-mutated u-PAR promoter. Thus, downregulation of the
u-PAR promoter by
3-integrin and the short
form of
3-endonexin is mediated at least in
part through a previously undescribed PEA3/ets silencer
region at
248 bp in the u-PAR promoter by PEA3.
Several positive regulatory elements, including AP-1, AP-2, and Sp-1,
have been identified in the u-PAR promoter (2, 26, 48),
most of them contained within the first 200 bp 5' of the transcriptional start site. We found now that additional positive regulatory elements are located between
400 and
300 bp of the u-PAR
promoter, because two deletions in this region (u-PAR del 1
402/
350
and u-PAR del 2
349/
300) reduced the constitutive activity
significantly. Within this region are putative transcription factor
binding sites for the transcription factors Sp-1, GATA-2, and NF-1, and
further analysis will be necessary to investigate their role in the
constitutive and inducible expression of the u-PAR promoter. Deletion
of this region had no effect on the regulation of u-PAR by
3-integrin. Even though the basal promoter
activity was lower than the wt u-PAR promoter activity, it could be
further reduced by
3- integrin.
Identification of the PEA3/ets motif represents the first
report on a silencing element in the u-PAR promoter. The
PEA3/ets site is an oncogene-regulated element and an
important positive regulator of gene expression for several
matrix-degrading proteolytic enzymes. The Ets family member PEA3, in
cooperation with an AP-1 family member, induces the transcription of
several MMPs and the serine protease urokinase (3, 20, 38,
51). While all these genes have juxtaposed
PEA3/ets-AP-1 elements in their promoters, the
PEA3/ets binding site in the u-PAR promoter has no adjacent AP-1 in its vicinity. Our data indicate that PEA3 is not only a
transcriptional activator but can also act as a transcriptional repressor, a feature that has not been reported for PEA3 before. However, while this paper was in review, Xing et al. (57)
showed that PEA3 can repress HER-2/neu
transcription through a PEA3/ets site in the
HER-2/neu promoter identical to the one in the
u-PAR promoter (5'-TTAGGAAG-3'). The PEA3/ets
site in the HER-2/neu promoter functions as a positive
regulatory element, because its mutation abrogates constitutive
HER-2/neu promoter activity. Therefore, the
authors speculate that overexpression of PEA3 displaces a transactivating factor(s) that binds to the PEA3/ets site
and then represses HER-2/neu
transcription. In contrast, the PEA3/ets site in the u-PAR
promoter acts as a weak negative regulatory element inducing
constitutive promoter activity when mutated but is crucial for the
inhibition of promoter activity by
3-integrin. The same PEA3/ets site is a positive regulatory element in
the HER-2/neu promoter and a negative regulatory
element in the u-PAR promoter. Probably, the promoter context is
important to define the role of this PEA3/ets motif in a
given promoter. PEA3 alone is not the only transcription factor
mediating the inhibitory effect of
3-integrin
at the u-PAR PEA3/ets site. While
3-integrin can abrogate u-PAR promoter
activity completely, even overexpression of a large amount of PEA3
could not achieve this, which suggests that another corepressor(s) is
also required for this regulation. It seems to be a feature of Ets
proteins to form complexes with other unrelated transcription factors,
thereby determining whether they have an activating or an inhibitory
effect on gene regulation.
Until recently, only a few Ets family members had been described as
transcriptional repressors, while an activating function had been
outlined in detail for many different Ets proteins (18). Schneikert et al. demonstrated that association of the androgen receptor with ERM, an Ets family member within the PEA3 group, downregulates the MMP-1 promoter activity (41). Goldberg
et al. (17) reported that c-Ets-1 can inhibit
tetradecanoyl phorbol acetate induction of a
PEA3/ets-AP-1 element as shown by in vitro transcription
and transient transfections. An inhibitory role for an Ets
transcription factor has also been described for Drosophila melanogaster (32). In response to the
activation of the epidermal growth factor (EGF) receptor pathway, the
Ets transcription factor homologue pointed is overexpressed
and an inhibitory signal is generated. pointed reduces the
expression of a dorsal follicle marker, rhomboid, that
controls patterning in the dorsal region. Our data together with the
study by Xing et al. (57) now show that PEA3 can also act
as a transcriptional repressor.
In conclusion, we have shown that overexpression of
3A- integrin downregulates u-PAR at the
transcriptional level through a PEA3/ets motif in the
u-PAR promoter. The
3-integrin-dependent downregulation is mediated through the NITY759
motif in the
3A-integrin and through the short
form of
3-endonexin. The negative regulatory
role of
3A-integrin in u-PAR transcription is
important in view of the poorly understood interaction and regulation
between adhesion and proteolysis. Besides the known physical
interaction between
3A-integrin and u-PAR,
data from this study support an additional mechanism in which the
activation of
3A-integrin downregulates the
receptor for urokinase at the transcriptional level. This additional
regulatory mechanism might be important for coordinating extracellular
proteolysis, adhesion, and cell migration at the right time and place.
The mutual regulation of both adhesion and proteolysis receptors at
different regulation levels may help to achieve this.
 |
ACKNOWLEDGMENTS |
We express our appreciation to Douglas Boyd (M. D. Anderson
Cancer Center, Department of Cancer Biology, Houston, Tex.) for his
critical appraisal of the manuscript. We are very grateful to M. Kramer
(Laboratory of Immunopathology, University of Heidelberg, Heidelberg,
Germany) for the u-PAR antibody HD 13.1. We thank L. Miles, The Scripps
Research Institute, La Jolla, Calif., for the u-PAR hamster cDNA; J. Loftus, Mayo Clinic, Scottsdale, Ariz., for
v and
3 expression constructs; and Mark Ginsberg, The Scripps Research Institute, for the
IIb
3-integrin-expressing A5 CHO cell
clone. We thank A. Kopp for critical reading of the manuscript.
This work was supported by the Deutsche Forschungsgemeinschaft (DFG Le
889-4/1 to E.L., M.G., and M.S.), Sanders Stiftung (M.G.), and the
Medical Faculty of the Technische Universität München
(KKF-8756155 to U.R., E.L., and M.S.).
 |
FOOTNOTES |
*
Corresponding author. Present address: University of
California, San Francisco, UCSF Comprehensive Cancer Center and
Cancer Research Institute, Department of Obstetrics, Gynecology
and Reproductive Sciences, 2340 Sutter St., San Francisco, CA
94143-0875. Phone: (415) 514-0231. Fax: (415) 514-0878. E-mail:
elengyel{at}cc.ucsf.edu.
 |
REFERENCES |
| 1.
|
Akiyama, S. K.,
S. S. Yamada,
K. M. Yamada, and S. E. La Flamme.
1999.
Transmembrane signal transduction by integrin cytoplasmic domains expressed in single-subunit chimeras.
J. Biol. Chem.
269:15961-15964[Abstract/Free Full Text].
|
| 2.
|
Allgayer, H.,
H. Wang,
Y. Wang,
M. M. Heiss,
R. Bauer,
O. Nyormoi, and D. Boyd.
1999.
Transactivation of the urokinase-type plasminogen activator receptor gene through a novel promoter motif bound with an activator protein-2 -related factor.
J. Biol. Chem.
274:4702-4714[Abstract/Free Full Text].
|
| 3.
|
Benbow, U., and C. E. Brinckerhoff.
1998.
The Ap-1 site and MMP gene regulation: what is all the fuss about?
Matrix Biol.
15:519-526.
|
| 4.
|
Bergers, G., and L. Coussens.
2000.
Extrinsic regulators of epithelial tumor progression: metalloproteinases.
Curr. Opin. Genet. Dev.
10:120-127[CrossRef][Medline].
|
| 5.
|
Blasi, F.
1999.
Proteolysis, cell adhesion, chemotaxis, and invasiveness are regulated by the u-PA-u-PAR-PAI-1 system.
Thromb. Haemostasis
82:298-304[Medline].
|
| 6.
|
Bohuslav, J.,
V. Horejsi,
C. Hansmann,
J. Stockl,
U. H. Weidle,
O. Majdic,
I. Bartke,
W. Knapp, and H. Stockinger.
1995.
Urokinase plasminogen activator receptor, 2-integrins, and src-kinases within a single receptor complex of human monocytes.
J. Exp. Med.
181:1381-1390[Abstract/Free Full Text].
|
| 7.
|
Chapman, H.
1997.
Plasminogen activators, integrins, and the coordinated regulation of cell adhesion and migration.
Curr. Opin. Cell Biol.
9:714-724[CrossRef][Medline].
|
| 8.
|
Chen, Q.,
M. S. Kinch,
T. H. Lin,
K. Burridge, and R. L. Juliano.
1994.
Integrin-mediated cell adhesion activates mitogen-activated protein kinases.
J. Biol. Chem
269:26602-26605[Abstract/Free Full Text].
|
| 9.
|
Clark, E. A., and J. S. Brugge.
1995.
Integrins and signal transduction pathways: the road taken.
Science
268:233-239[Abstract/Free Full Text].
|
| 10.
|
Conese, M.,
A. Nykjaer,
C. M. Petersen,
P. A. Andreasen,
J. Gliemann,
E. I. Christensen, and F. Blasi.
1995.
-2 Macroglobulin receptor/LDL receptor-related protein (Lrp)-dependent internalization of the urokinase receptor.
J. Cell Biol.
131:1609-1622[Abstract/Free Full Text].
|
| 11.
|
Danen, E. H. J.,
A. A. van Kraats,
I. M. H. A. Cornelissen,
D. J. Ruiter, and G. N. P. van Muijen.
1996.
Integrin 3 cDNA transfection into a highly metastatic v 3-negative human melanoma cell line inhibits invasion and experimental metastasis.
Biochem. Biophys. Res. Commun.
226:75-81[CrossRef][Medline].
|
| 12.
|
Eigenthaler, M.,
L. Höfferer,
S. J. Shattil, and M. H. Ginsberg.
1997.
A conserved sequence motif in the integrin 3 cytoplasmic domain is required for its specific interaction with 3-endonexin.
J. Biol. Chem.
272:7693-7698[Abstract/Free Full Text].
|
| 13.
|
Ellis, V.,
N. Behrendt, and K. Dano.
1991.
Plasminogen activation by receptor-bound urokinase.
J. Biol. Chem.
266:12752-12758[Abstract/Free Full Text].
|
| 14.
|
Fowler, B.,
N. Mackman,
R. J. Parmer, and L. A. Miles.
1998.
Binding of human single chain urokinase to chinese hamster ovary cells and cloning of hamster u-PAR.
Thromb. Haemostasis
80:148-154[Medline].
|
| 15.
|
Gawaz, M.,
B. Loftus,
M. L. Bajt,
M. M. Frojmovic,
E. F. Plow, and M. H. Ginsberg.
1991.
Ligand bridging mediates integrin IIb 3 (platelet GPIIB-IIIA) dependent homotypic and heterotypic cell-cell interactions.
J. Clin. Investig.
88:1128-1134.
|
| 15a.
| Gawaz, M., F. Besta, T. Knorr, H. Dierks, and W. Kolanus. The NITY motif of the beta-chain cytoplasmic domain is
involved in stimulated internalization of the 3-integrin A form. J. Cell Sci., in press.
|
| 16.
|
Ghiso, J. A.,
K. Kovalski, and L. Ossowski.
1999.
Tumor dormancy induced by downregulation of urokinase receptor in human carcinoma involves integrin and MAPK signaling.
J. Cell Biol.
147:89-103[Abstract/Free Full Text].
|
| 17.
|
Goldberg, Y.,
M. Treier,
J. Ghysdael, and D. Bohmann.
1994.
Repression of AP-1 stimulated transcription by c-Ets-1.
J. Biol. Chem.
269:16566-16573[Abstract/Free Full Text].
|
| 18.
|
Graves, B., and J. Petersen.
1998.
Specificity within the ets family of transcription factors.
Adv. Cancer Res.
75:1-55[Medline].
|
| 19.
|
Gum, R.,
C. Juarez,
H. Allgayer,
A. Mazar,
Y. Wang, and D. Boyd.
1998.
Stimulation of urokinase-type plasminogen activator receptor expression by PMA requires JNK1-dependent and -independent signaling modules.
Oncogene
17:213-225[CrossRef][Medline].
|
| 20.
|
Gum, R.,
E. Lengyel,
J. Juarez,
J. H. Chen,
H. Sato,
M. Seiki, and D. Boyd.
1996.
Stimulation of 92-kDA gelatinase B promoter activity by ras is mitogen-activated protein kinase kinase 1-independent and requires multiple transcription factor binding sites including closely spaced PEA3/ets and AP-1 sequences.
J. Biol. Chem.
271:10672-10680[Abstract/Free Full Text].
|
| 21.
|
Hemler, M. E.
1998.
Integrin associated proteins.
Curr. Opin. Cell Biol.
10:578-585[CrossRef][Medline].
|
| 22.
|
Kashiwagi, H.,
M. A. Schwartz,
M. Eigenthaler,
K. A. Davis,
M. H. Ginsberg, and S. J. Shattil.
1997.
Affinity modulation of platelet integrin IIb 3 by 3-endonexin, a selective binding partner of the 3 integrin cytoplasmic tail.
J. Cell Biol.
137:1433-1443[Abstract/Free Full Text].
|
| 23.
|
Kolanus, W.,
C. Romeo, and B. Seed.
1993.
T cell activation by clustered tyrosine kinases.
Cell
74:171-183[CrossRef][Medline].
|
| 24.
|
LaFlamme, S. E.,
S. M. Homan,
A. L. Bodeau, and M. Mastrangelo.
1997.
Integrin cytoplasmic domains as connectors to the cell's signal transduction apparatus.
Matrix Biol.
16:153-163[CrossRef][Medline].
|
| 25.
|
Lengyel, E.,
H. Wang,
R. Gum,
C. Simon,
Y. Wang, and D. Boyd.
1997.
Elevated urokinase-type plasminogen activator receptor expression in a colon cancer cell line is due to a constitutively activated extracellular-signal regulated kinase 1 dependent signaling cascade.
Oncogene
14:2563-2574[CrossRef][Medline].
|
| 26.
|
Lengyel, E.,
H. Wang,
E. Stepp,
J. Juarez,
Y. Wang,
W. F. Doe,
C. M. Pfarr, and D. Boyd.
1996.
Requirement of an upstream AP-1 motif for the constitutive and phorbol ester-inducible expression of the urokinase-type plasminogen activator receptor gene.
J. Biol. Chem.
271:23176-23184[Abstract/Free Full Text].
|
| 27.
|
Liotta, L.,
R. Goldfarb,
R. Brundage,
G. Siegel,
V. Terranova, and S. Garbisa.
1981.
Effect of plasminogen activator (urokinase), plasmin, and thrombin on glycoprotein and collagenous components of basement membrane.
Cancer Res.
41:4629-4636[Abstract/Free Full Text].
|
| 28.
|
Loftus, J. C.,
T. E. O'Toole,
E. Plow,
A. Glass,
A. L. Frelinger, and M. H. Ginsberg.
1990.
A 3 integrin mutation abolishes ligand binding and alters divalent cation-dependent conformation.
Science
249:915-918[Abstract/Free Full Text].
|
| 29.
|
Lund, L. R.,
V. Ellis,
E. Ronne,
C. Pyke, and K. Dano.
1995.
Transcriptional and post-transcriptional regulation of the receptor for urokinase-type plasminogen activator by cytokines and tumor promoters in the human lung carcinoma cell line A549.
Biochem. J.
310:345-352.
|
| 30.
|
Marshall, J. F., and I. R. Hart.
1996.
The role of v-integrins in tumour progression and metastasis.
Semin. Cancer Biol.
7:129-138[CrossRef][Medline].
|
| 31.
|
Morgenstern, J. P., and H. Land.
1990.
Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line.
Nucleic Acids Res.
18:3587-3596[Abstract/Free Full Text].
|
| 32.
|
Morimoto, A. M.,
K. C. Jordan,
K. Tietze,
J. S. Britton,
E. M. O'Neill, and H. Ruohola-Baker.
1995.
Pointed, an ETS domain transcription factor, negatively regulates the EGF receptor pathway in Drosophila oogenesis.
Development
122:3745-3754[Abstract].
|
| 33.
|
Needham, G. K.,
G. V. Sherbet,
J. R. Farndon, and A. L. Harris.
1986.
Binding of urokinase to specific receptor sites on human breast cancer membranes.
Br. J. Cancer
55:13-16.
|
| 34.
|
Nerlov, C.,
P. Rorth,
F. Blasi, and M. Johnsen.
1991.
Essential AP-1 and PEA3 binding elements in the human urokinase enhancer display cell type-specific activity.
Oncogene
6:1583-1593[Medline].
|
| 35.
|
Ploug, M.,
H. Rahbeck-Nielsen,
P. Nielsen,
P. Roepstorff, and K. Dano.
1998.
Glycosylation profile of a recombinant urokinase-type plasminogen activator expressed in chinese hamster ovary cells.
J. Biol. Chem.
273:13933-13943[Abstract/Free Full Text].
|
| 36.
|
Preissner, K. T.,
S. M. Kanse,
T. Chavakis, and A. E. May.
1999.
The dual role of the urokinase receptor system in pericellular proteolysis and cell adhesion: implications for cardiovascular function.
Basic Res. Cardiol.
94:315-319[CrossRef][Medline].
|
| 37.
|
Pyke, C.,
J. Eriksen,
H. Solberg,
B. Schnack,
S. Nielsen,
P. Kristensen,
L. R. Lund, and K. Dano.
1993.
An alternatively spliced variant of mRNA of the human receptor for urokinase plasminogen activator.
FEBS Lett.
326:69-74[CrossRef][Medline].
|
| 38.
|
Ried, S.,
C. Jäger,
G. F. Vande Woude,
H. Graeff,
M. Schmitt, and E. Lengyel.
1999.
Activation mechanisms of the urokinase-type plasminogen activator promoter by hepatocyte growth factor/scatter factor (HGF/SF).
J. Biol. Chem.
274:16377-16386[Abstract/Free Full Text].
|
| 39.
|
Riikonen, T.,
J. Westermarck,
L. Koivisto,
A. Broberg,
V.-M. Kähäri, and J. Heino.
1995.
Integrin 2 1 is a positive regulator of collagenase (MMP-1) and collagen 1(I) gene expression.
J. Biol. Chem.
270:13548-13552[Abstract/Free Full Text].
|
| 40.
|
Schaffner-Reckinger, E.,
V. Gouon,
C. Melchior,
S. Plançon, and N. Kieffer.
1998.
Distinct involvement of 3 integrin cytoplasmic domain tyrosine residues 747 and 759 in integrin-mediated cytoskeletal assembly and phosphotyrosine signaling.
J. Biol. Chem.
278:12623-12632.
|
| 41.
|
Schneikert, J.,
H. Peterziel,
P. A. Defossez,
H. Klocker,
Y. Launoit, and A. C. Cato.
1996.
Androgen receptor-Ets protein interaction is a novel mechanism for steroid hormone-mediated down-modulation of matrix metalloproteinase expression.
J. Biol. Chem.
271:23907-23913[Abstract/Free Full Text].
|
| 42.
|
Schnelzer, A.,
D. Prechtel,
U. Knaus,
K. Dehne,
M. Gerhard,
H. Graeff,
N. Harbeck,
M. Schmitt, and E. Lengyel.
2000.
Rac1 in human breast cancer: overexpression, mutation analysis, and characterization of a new isoform, Rac1b.
Oncogene
19:3013-3020[CrossRef][Medline].
|
| 43.
|
Schvartz, I.,
D. Seger, and S. Shaltiel.
1999.
Vitronectin.
Int. J. Biochem. Cell Biol.
31:539-544[CrossRef][Medline].
|
| 44.
|
Seftor, E. A.
1999.
Role of the 3 integrin subunit in human primary melanoma progression.
Am. J. Pathol.
153:1347-1351[Free Full Text].
|
| 45.
|
Shattil, S. J.,
T. O'Toole,
M. Eigenthaler,
V. Thon,
M. Williams,
B. M. Babior, and M. H. Ginsberg.
1995.
3-endonexin, a novel polypeptide that interacts specifically with the cytoplasmic tail of the integrin 3 subunit.
J. Cell Biol.
131:807-816[Abstract/Free Full Text].
|
| 46.
|
Sheety, S.,
A. Kumar, and S. Idell.
1997.
Posttranscriptional regulation of urokinase receptor mRNA: identification of a novel urokinase receptor mRNA binding protein in human mesothelioma cells.
Mol. Cell. Biol.
17:1075-1083[Abstract].
|
| 47.
|
Simon, D. I.,
N. K. Rao,
H. Xu,
Y. Wei,
O. Majdic,
E. Ronne,
L. Kobzik, and H. Chapman.
1996.
Mac-1 (CD11b/CD18) and the urokinase receptor (CD 87) form a functional unit on monocytic cells.
Blood
88:3185-3194[Abstract/Free Full Text].
|
| 48.
|
Soravia, E.,
A. Grebe,
P. De Luca,
K. Helin,
T. T. Suh,
J. L. Degen, and F. Blasi.
1995.
A conserved TATA-less proximal promoter drives basal transcription from the urokinase-type plasminogen activator receptor gene.
Blood
86:624-635[Abstract/Free Full Text].
|
| 49.
|
Turkson, J.,
T. Bowman,
R. Garcia,
E. Caldenhoven,
R. P. de Groot, and R. Jove.
1998.
Stat3 activation by Src induces specific gene regulation and is required for cell transformation.
Mol. Cell. Biol.
18:2545-2552[Abstract/Free Full Text].
|
| 50.
|
van Kuppevelt, T. H. S. M. M.,
L. R. Languino,
J. Gailit,
S. Suzuki, and E. Ruoslahti.
1989.
An alternative cytoplasmic domain of the integrin 3 subunit.
Proc. Natl. Acad. Sci. USA
86:5415-5418[Abstract/Free Full Text].
|
| 51.
|
Wasylyk, B.,
S. Hahn, and A. Giovane.
1993.
The Ets family of transcription factors.
Eur. J. Biochem.
211:7-18[Medline].
|
| 52.
|
Wei, Y.,
M. Lukashev,
D. I. Simon,
S. C. Bodary,
S. Rosenberg,
M. V. Doyle, and H. Chapman.
1996.
Regulation of integrin function by the urokinase receptor.
Science
273:1551-1555[Abstract].
|
| 53.
|
Werb, Z.
1997.
ECM and cell surface proteolysis: regulating cellular ecology.
Cell
91:439-442[CrossRef][Medline].
|
| 54.
|
Westermarck, J., and V.-M. Kähäri.
1999.
Regulation of matrix metalloproteinase expression in tumor invasion.
FASEB J.
13:781-792[Abstract/Free Full Text].
|
| 55.
|
Woodhouse, E. C.,
R. F. Chuaqui, and L. Liotta.
1997.
General mechanisms of metastasis.
Cancer
80:1529-1537[CrossRef][Medline].
|
| 56.
|
Xin, J.,
A. Cowie,
P. Lachance, and J. A. Hassell.
1992.
Molecular cloning and characterization of PEA3, a new member of the Ets oncogene family that is differentially expressed in mouse embryonic cells.
Genes Dev.
6:481-496[Abstract/Free Full Text].
|
| 57.
|
Xing, X.,
S. W. Wang,
W. Xia, et al.
2000.
The Ets protein PEA3 suppresses Her2/neu overexpression and inhibits tumorigenesis.
Nat. Med.
6:189-195[CrossRef][Medline].
|
| 58.
|
Xue, W.,
I. Mizukami,
R. F. Todd, and H. R. Petty.
1997.
Urokinase-type plasminogen activator receptors associate with 1 and 3 integrins of fibrosarcoma cells: dependence on extracellular matrix components.
Cancer Res.
57:1682-1689[Abstract/Free Full Text].
|
| 59.
|
Yebra, M.,
L. Goretzki,
M. Pfeifer, and B. Mueller.
1999.
Urokinase-type plasminogen activator binding to its receptor stimulates tumor cell migration by enhancing integrin-mediated signal transduction.
Exp. Cell Res.
250:231-240[CrossRef][Medline].
|
| 60.
|
Ylänne, J.
1999.
Conserved functions of the cytoplasmic domains of integrin beta subunits.
Front. Biosci.
3:877-886.
|
| 61.
|
Zheng, B., and R. D. Clemmons.
1998.
Blocking ligand occupancy of the v 3 integrin inhibits insulin-like growth factor I signaling in vascular smooth muscle cells.
Proc. Natl. Acad. Sci. USA
95:11217-11222[Abstract/Free Full Text].
|
Molecular and Cellular Biology, March 2001, p. 2118-2132, Vol. 21, No. 6
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.6.2118-2132.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kaur, S., Kenny, H. A., Jagadeeswaran, S., Zillhardt, M. R., Montag, A. G., Kistner, E., Yamada, S. D., Mitra, A. K., Lengyel, E.
(2009). {beta}3-Integrin Expression on Tumor Cells Inhibits Tumor Progression, Reduces Metastasis, and Is Associated with a Favorable Prognosis in Patients with Ovarian Cancer. Am. J. Pathol.
175: 2184-2196
[Abstract]
[Full Text]
-
Forsti, A., Lei, H., Tavelin, B., Enquist, K., Palmqvist, R., Altieri, A., Hallmans, G., Hemminki, K., Lenner, P.
(2007). Polymorphisms in the genes of the urokinase plasminogen activation system in relation to colorectal cancer. Ann Oncol
18: 1990-1994
[Abstract]
[Full Text]
-
Wang, H., Yang, L., Jamaluddin, Md. S., Boyd, D. D.
(2004). The Kruppel-like KLF4 Transcription Factor, a Novel Regulator of Urokinase Receptor Expression, Drives Synthesis of This Binding Site in Colonic Crypt Luminal Surface Epithelial Cells. J. Biol. Chem.
279: 22674-22683
[Abstract]
[Full Text]
-
Wang, H., Hicks, J., Khanbolooki, P., Kim, S.-J., Yan, C., Wang, Y., Boyd, D.
(2003). Transgenic Mice Demonstrate Novel Promoter Regions for Tissue-Specific Expression of the Urokinase Receptor Gene. Am. J. Pathol.
163: 453-464
[Abstract]
[Full Text]
-
Davidson, B., Goldberg, I., Gotlieb, W. H., Kopolovic, J., Ben-Baruch, G., Reich, R.
(2003). PEA3 Is the Second Ets Family Transcription Factor Involved in Tumor Progression in Ovarian Carcinoma. Clin. Cancer Res.
9: 1412-1419
[Abstract]
[Full Text]
-
Besta, F., Massberg, S., Brand, K., Muller, E., Page, S., Gruner, S., Lorenz, M., Sadoul, K., Kolanus, W., Lengyel, E., Gawaz, M.
(2002). Role of {beta}3-endonexin in the regulation of NF-{kappa}B-dependent expression of urokinase-type plasminogen activator receptor. J. Cell Sci.
115: 3879-3888
[Abstract]
[Full Text]
-
Hapke, S., Kessler, H., de Prada, N. A., Benge, A., Schmitt, M., Lengyel, E., Reuning, U.
(2001). Integrin alpha vbeta 3/Vitronectin Interaction Affects Expression of the Urokinase System in Human Ovarian Cancer Cells. J. Biol. Chem.
276: 26340-26348
[Abstract]
[Full Text]