Molecular and Cellular Biology, March 2001, p. 2118-2132, Vol. 21, No. 6
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.6.2118-2132.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
3A-Integrin Downregulates the Urokinase-Type
Plasminogen Activator Receptor (u-PAR) through a
PEA3/ets Transcriptional Silencing Element
in the u-PAR Promoter
Department of Obstetrics and Gynecology1 and Department of Internal Medicine I, Deutsches Herzzentrum,2 Technische Universität München, Klinikum rechts der Isar, D-81675 Munich, Germany, and Richard Dimbleby Department of Cancer Research, ICRF Laboratory, St. Thomas's Hospital, London SE1 7EH, United Kingdom3
Received 15 February 2000/Returned for modification 18 April 2000/Accepted 8 December 2000
| |
ABSTRACT |
|---|
|
|
|---|
Migration of cells requires interactions with the extracellular
matrix mediated, in part, by integrins, proteases, and their receptors. Previous studies have shown that
3-integrin
interacts with the urokinase-type plasminogen activator receptor
(u-PAR) at the cell surface. Since integrins mediate signaling into the cell, the current study was undertaken to determine if in addition
3-integrin regulates u-PAR expression.
Overexpression of
3-integrin in CHO cells, which are
avid expressers of the receptor, downregulated u-PAR protein and mRNA
expression. The u-PAR promoter (
1,469 bp) that is normally
constitutively active in CHO cells was downregulated by induced
3-integrin expression. A region between
398 and
197 bp of the u-PAR promoter was critical for
3-integrin-induced downregulation of u-PAR promoter
activity. Deletion of the PEA3/ets motif at
248 bp
substantially impaired the ability of
3-integrin to
downregulate the u-PAR promoter, suggesting that the
PEA3/ets site acts as a silencing element. An expression
vector encoding the transcription factor PEA3 caused inhibition of the
wild-type but not the PEA3/ets-deleted u-PAR promoter.
The PEA3/ets site bound nuclear factors from CHO cells
specifically, but binding was enhanced when
3-integrin
was overexpressed. A PEA3 antibody inhibited DNA-protein complex
formation, indicating the presence of PEA3. Downregulation of the u-PAR
promoter was achieved by the
3A-integrin isoform but not
by other
3-integrin isoforms and required the
cytoplasmic membrane NITY759 motif. Moreover,
overexpression of the short but not the long isoform of the
3-integrin adapter protein
3-endonexin
blocked u-PAR promoter activity through the PEA3/ets
binding site. Thus, besides the physical interaction of
3-integrin and u-PAR at the cell surface,
3 signaling is implicated in the regulation of u-PAR
gene transcription, suggesting a mutual regulation of adhesion and
proteolysis receptors.
| |
INTRODUCTION |
|---|
|
|
|---|
Invasion and metastasis of tumor cells require a complex regulation of different cell surface-associated proteins (4, 53, 55) that facilitate proteolysis and adhesion of cells to the basement membrane and the extracellular matrix (ECM). The invasive process starts with the attachment of cells to the ECM, followed by degradation of various ECM components through proteases, subsequent cell detachment, and migration (5). One important protease involved in these processes is the serine protease urokinase-type plasminogen activator (urokinase) which is bound to a specific receptor (u-PAR). Urokinase converts plasminogen to plasmin, a serine protease with broad substrate specificity for several components of the ECM, including vitronectin, laminin, and fibronectin (5, 27, 43). Together, these adhesive and proteolytic functions of tumor cells facilitate their migration through the basement membrane and the ECM.
Urokinase binds with high affinity to its heavily glycosylated receptor, u-PAR (33, 35), which is composed of three similar protein domains and is linked through a glycosylphosphatidylinositol anchor to the plasma membrane. The amino-terminal domain I of u-PAR interacts with urokinase while the other two domains bind vitronectin (43), a major component of the ECM and an integrin-binding ligand. Binding of urokinase to u-PAR increases the rate of plasmin formation at the plasma membrane (13) and focuses the proteolytic activity onto the leading edge of tumor cells (5). Besides its role in proteolysis, u-PAR is a multifunctional receptor that is involved in chemotaxis, angiogenesis, signal transduction, migration, and adhesion of cells (5, 36).
Expression of u-PAR is controlled mainly at the transcriptional level (26, 29, 48), but posttranscriptional regulation (46) and recycling of u-PAR to the cell membrane (10) represent additional levels of regulation. Transcription of the u-PAR gene gives rise to a 1.4-kb mRNA or an alternatively spliced variant that lacks the carboxy-terminal membrane attachment peptide sequence (37). The importance of transcriptional regulation of the u-PAR promoter by activator protein 1 (AP-1), AP-2, and Sp-1 transcription factors and their corresponding binding sites in the 5'-flanking site of the u-PAR gene have been recently defined (2, 26, 48). However, the aforementioned transcription factor binding sites mediate constitutive and inducible activation of the u-PAR gene, and a negative regulatory element has so far not been characterized. In consideration of the importance of u-PAR for several biological processes, the existence of such a site could be hypothesized.
Recently, proteolysis and adhesion were functionally linked after it
had been found that u-PAR binds to vitronectin and is associated with
different members of the integrin family (7, 36, 52).
Integrins are cell surface heterodimeric transmembrane glycoproteins
consisting of
and
subunits that mediate cell-cell and cell-ECM
interactions. Each subunit encompasses a large extracellular domain, a
membrane-spanning domain, and a short cytoplasmic tail. Most integrins
interact with components of the ECM (e.g., vitronectin, fibronectin,
and collagen) or blood (e.g., fibrinogen). These integrin ligands
cross-link or cluster integrins on the cell surface by binding to
adjacent integrin molecules, leading to the formation of focal adhesion
contacts, thus activating intracellular signaling pathways
("outside-in signaling") (9). Integrins are implicated in various biological processes including angiogenesis, wound healing,
tumor cell invasion, and metastasis (30, 53), but the
specificity and mechanisms by which all these functions are regulated
are not fully understood. However, there is increasing evidence that
the cytoplasmic domain of the integrin
subunits plays a major
regulatory role in these processes (24, 40, 44). u-PAR
physically interacts on leukocytes with
2-integrin as shown by colocalization and
immunoprecipitation studies (6) and on fibrosarcoma
cells with
1- and
3-integrins (58). The direct
interaction between u-PAR and integrins plays a role in the binding
affinity of integrins toward their ligands and might be important for
urokinase-mediated signal transduction (47). Although
these studies demonstrated that u-PAR physically interacts with
-integrins, they do not address the consequence of
3-integrin expression for u-PAR regulation.
Taking into consideration that u-PAR expression is regulated
mainly at the transcriptional level (26) and that
integrins regulate gene expression via outside-in signaling
(39), we undertook a study with the following objectives: (i) to determine if
3-integrin regulates u-PAR
gene activity and (ii) to elucidate the molecular mechanisms by which
this occurs. We show for the first time that overexpression of
3A-integrin downregulates u-PAR transcription
via a PEA3/ets binding site in the u-PAR promoter, involving
the
3A-integrin cytoplasmic domain and the
adapter protein
3-endonexin short.
(This study was performed in partial fulfillment of the Ph.D. thesis of S. Hapke.)
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture.
CHO cells were obtained from the American Type
Culture Collection (CRL 9096). The stable CHO cell clone A5 expresses a
high level of
IIb
3-integrin
(15) and was generously supplied by Mark Ginsberg, The
Scripps Research Institute, La Jolla, Calif. The cells were cultivated
in MEM alpha medium supplemented with L-glutamine and 10%
fetal calf serum (FCS; all from GIBCO, Life Technologies, Grand Island,
N.Y.).
Vectors.
The
v- and
3-integrin expression vector constructs
(28), a friendly gift from J. Loftus, Mayo Clinic,
Scottsdale, Ariz., were cloned into the SalI site of the
pBabe Puro plasmid (31). To study the role of the three
known
3-integrin cytoplasmic isoforms on the
u-PAR promoter, we used single-chain chimeric receptors which bear CH2
and CH3 portions of human immunoglobulin G1 (IgG1) at the cell surface,
the transmembrane domain of CD7, and the full-length cytoplasmic
domains of
3-A-,
3-B-, and
3-C-integrins (see Fig. 7A). All constructs were based
on previously described chimeric receptors and are in the context of
the P5C7 vector, cloned into the MluI/NotI site
(23).
1-integrin NITY and
3-integrin NPKY are a swap of the cytoplasmic
domain of
1-integrin with the cytoplasmic
domain of
3 and vice versa (see Fig. 7A). A
full-length polyomavirus enhancer activator 3 (PEA3) cDNA
(56) was inserted between the HindIII and
BamHI cloning sites of the cytomegalovirus promoter-driven
pcDNA3.1 expression vector (Invitrogen, Leek, The Netherlands).
398
to + 51 bp, cloned into the XbaI site of the pCAT-basic
vector (Promega, Mannheim, Germany); it was a kind gift of D. Boyd,
M. D. Anderson Cancer Center, Houston, Tex. Site-directed
mutagenesis of the u-PAR promoter (26) was performed,
using the Transformer kit from Clontech (Heidelberg, Germany). The
u-PAR firefly luciferase reporter (
1,469,
398, and
197 bp) was
generated by cloning the human u-PAR promoter into the SmaI
site of pGL3 (Promega). Four different deletion constructs (see Fig.
4D) were made within the full-length
1,469-bp u-PAR luciferase
promoter between
402 and
203 bp using the QuickChange site-directed
mutagenesis kit from Stratagene (Amsterdam, The Netherlands). u-PAR del
1 (
402/
350) was made using the primer
5'-TTTCAGGATGCATCT|AAATCCTGTTAGCCA-3', u-PAR del 2 (
349/
300) was made using the primer
5'-TGACAAAACTAACAA|TTTATCCTCATTTTA-3', u-PAR del 3 (
299/
260) was made using the primer
5'-TTTACCGTCAAAGTT|GTCCCACTTTAGGAA-3', and u-PAR del
4 (
237/
203) was made using the primer
5'-TTTAGGAAGAGAGAG|GCTGTGATCACAACT-3'.
Both isoforms of
3-endonexin were cloned from
a natural killer cell cDNA library through amplification by PCR, using
the primer
5'-GGGGCGACGCGTATGATGCCTGTTAAAAGATCACTGAAGTTGGATGGTCTG-3' (fw)/5'- GGGGCGGCGGCCGCTTCACAGAGGTTGTGACATCTGAGGCTGACC TTTGTG-3' (rev) (
3-endonexin long) or
5'-GGGGCGACGCGTATGATGCCTGTTAAAAGATCACTGAAGTTGGATGGTCTG-3' (fw)/5'-GGGGCGG CGGCCGCTTCACTGTATACTACTTAAATTTTGCATTATCTCCAT-3' (rev)
(
3-endonexin short). The resulting PCR
fragments were fused to the respective 3' termini of an enhanced
green fluorescent protein cloning cassette (Clontech).
All constructs were identified by restriction digestion and verified by
DNA sequencing, and at least two different DNA preparations were used
for transient transfections.
Confocal laser scanning microscopy.
For immunofluorescence,
50,000 untransfected CHO cells or stable
3-expressing A5 cells were seeded into each
well of a four-well chamber slide (Nunc Lab-Tek, Naperville, Ill.). CHO
cells were transfected with
3-integrin or the
vector (pBabe Puro) control (31) with TransFast
transfection reagent (Promega). At 48 h posttransfection, viable
cells were collected, washed briefly in phosphate-buffered saline
(PBS), and incubated with a mouse polyclonal antibody against u-PAR
(0.75 µg/ml; HD 13.1; a kind gift of M. Kramer, University of
Heidelberg, Heidelberg, Germany) or monoclonal antibody against
3-integrin (0.1 µg/ml; CD61-UNLB; Southern
Biotechnology Associates, Birmingham, United Kingdom) in PBS at
4°C for 2 h. After three washes in PBS-2% bovine serum albumin
(5 min each), the cells were incubated with 50 ng of Alexa 488-conjugated goat anti-mouse IgG (Molecular Probes, Eugene, Oreg.)
secondary antibody/ml for 1 h at room temperature in PBS. Cells
were washed three times with PBS (10 min each), and coverslips were
examined with a Zeiss Axiovert 35 microscope (Zeiss, Heidelberg, Germany) attached to a laser scanning detection unit (Leica, Bensheim, Germany). For
3-integrin and u-PAR double
staining (see Fig. 2), a
3-integrin antibody
that was coupled with Alexa 488 was used and u-PAR was detected with HD
13.1 followed by the secondary antibody Alexa 568 (goat anti-mouse IgG;
Molecular Probes). The monoclonal antibody LM609 against
v
v-integrin was
supplied by Chemicon (Hofheim, Germany).
Northern blotting. The levels of steady-state u-PAR transcripts were determined by Northern blot analysis (42). Total RNA was extracted from cells with TRIzol (GIBCO), and 15 µg of RNA was electrophoresed in a 1.5% agarose formaldehyde gel and transferred to a positively charged nylon membrane by capillary action, using 10× SSC (1× SSC is 0.15 M NaCl plus 15 mM sodium citrate, pH 7.4). The Northern blot was probed at 65°C with a randomly primed, 32P-labeled cDNA specific for u-PAR mRNA (14) and subsequently washed at 62°C, using 2× SSC in the presence of 1.0% sodium dodecyl sulfate. Loading efficiencies were checked by reprobing the blot with a radioactive cDNA which hybridizes with the 18S rRNA.
Western blot analysis. Cells were lysed in a buffer containing 50 mM HEPES (pH 7.5), 150 mM NaCl, 1 mM EDTA, 10% glycerol, 1% Triton X-100, 10 mM sodium fluoride, 1 mM sodium orthovanadate, 10 µg of aprotinin/ml, and 1 mM phenylmethylsulfonyl fluoride; cleared by centrifugation; and electrophoresed by sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis under reducing conditions (38). The resolved proteins were transferred to a nitrocellulose membrane (BA-S85; Schleicher & Schuell, Dassel, Germany); the filter was subjected for 1 h to a buffer containing 150 mM NaCl, 5 mM EDTA, 50 mM Tris HCl, 0.25% (wt/vol) gelatin, and 0.5% (vol/vol) Triton X-100; and the filter was incubated sequentially with a rabbit polyclonal antibody directed against u-PAR (40 ng/ml; American Diagnostica no. 3931; Greenwich, Conn.), followed by a mouse horseradish peroxidase-conjugated anti-rabbit IgG. Reactive proteins were visualized by ECL as directed by the manufacturer (Amersham Pharmacia Biotech, Little Chalfont, United Kingdom).
Transfections.
Reporter plasmids were transfected with
SuperFect transfection reagent (Qiagen, Hilden, Germany) with 3 × 105 CHO cells seeded overnight into six-well
plates. The transfection efficiency for CHO cells was about 75% as
determined by
-galactosidase staining. For the CAT assays, all
transient transfections were performed in the presence of 1 µg of
u-PAR-CAT reporter constructs, 1 µg of a luciferase expression
vector, and, where indicated, 3 µg of an expression plasmid coding
for
3-integrin or equimolar amounts of the
control vector. After 3 h, the cells were rinsed twice with PBS,
changed to 10% FCS-containing medium, and cultured for another 45 h. The cells were harvested and then lysed by repeated freeze-thaw
cycles in 0.25 M Tris-HCl, pH 7.8. Transfection efficiencies were
determined by the luciferase activity assay. After normalization for
transfection efficiency, CAT activity was measured by incubation of
cell lysates at 37°C with 4 µM
[14C]chloramphenicol and 1 mg of acetyl
coenzyme A/ml. The mixture was separated by extraction with ethyl
acetate, and acetylated products were separated on thin-layer
chromatography plates using chloroform-methanol as the mobile phase.
The radioactive dots were visualized by autoradiography,
and radioactivity was quantified using a Molecular Dynamics 445 SI PhosphorImager (26, 38).
3-integrin or the control vector. After
transfection, cells were cultured for 3 h in serum-free medium,
followed by cultivation in 10% FCS for a further 45 h. Firefly
luciferase activities were standardized for Renilla
luciferase activity, which was used as an internal control.
Mobility shift assays.
Nuclear extracts were prepared from
CHO cells at 80% confluency as described elsewhere (49).
Nuclear extracts (7.5 µg) were incubated in a buffer containing 25 mM
HEPES (pH 7.5), 0.5 mM EDTA, 0.2 mM dithiothreitol, 100 mM NaCl, 4%
glycerol, and 2 µg of poly(dI/dC). Five femtomoles of a Klenow
end-labeled ([
-32P]ATP) oligonucleotide
(u-PAR PEA3,
5'-TTGGGTCCCACGTTAGGAAGAGAGAGAACTGGG-3') was
added to each reaction mixture in the absence or presence of a 100-fold
excess of the wild-type (wt) or mutated (mt) competitor sequence
(underlined), and binding was allowed at room temperature for 25 min.
Subsequently, 1 µg of PEA3 antibody (sc-113X; Santa Cruz Inc., Santa
Cruz, Calif.) was added, and incubation was continued at 4°C for
2 h. The reaction mixture was electrophoresed in a 5%
polyacrylamide gel, using 0.5× TBE (89 mM Tris, 89 mM boric acid, 1 mM
EDTA) running buffer. The gel was dried and exposed to X-ray film
overnight at
80°C (26).
| |
RESULTS |
|---|
|
|
|---|
3-integrin downregulates u-PAR.
To define the
role of
3- integrin for u-PAR regulation, we
utilized a CHO cell line that does not express the endogenous
3-integrin subunit (40). As shown
in Fig. 1A by Western
blot analysis and in Fig. 1B and D by immunofluorescent staining with an antibody directed to the
3-integrin
subunit, CHO cells express no detectable
3-
integrin. However, upon transient (Fig. 1C) and stable (Fig. 1E)
transfection of a
3-integrin expression construct into CHO cells, the
3-integrin
subunit can be readily detected by immunofluorescence. As parent CHO
cells have been reported to express endogenous
v-integrin (40), we were
interested to know if this endogenous
v-integrin subunit is recruited by exogenous
3-integrin into a correctly assembled
v
3-integrin heterodimer complex. Indeed, immunofluorescence studies with the monoclonal antibody LM609, which recognizes the complexed integrin subunits (
v
3), showed
that expression of
3-integrin leads to the
surface expression of an
v
3-integrin
heterodimer (Fig. 1F) in CHO cells. In contrast, no
v
3-integrin could be
detected in the vector-transfected CHO cells (Fig. 1G).
|
3-integrin in CHO
cells, u-PAR expression is downregulated. As exemplified in Fig. 2B,
the cell overexpressing
3-integrin is not
expressing u-PAR while the adjacent
non-
3-transfected cell (the
transient-transfection efficiency of CHO cells is about 75%) is still
expressing u-PAR. The reduction of u-PAR could not be accounted for by
a vector effect, since the same amount of the pBabe Puro expression
vector did not reduce u-PAR protein expression (Fig. 2C). In
summarizing five transient transfections, we found that 89% of
untransfected CHO cells showed u-PAR expression, in contrast to 15%
when
3-integrin was transiently overexpressed. Eighty-five percent of
3-integrin-expressing CHO cells showed no u-PAR expression. This indicates that in transient
transfections u-PAR is downregulated in most
3-integrin-expressing cells. In contrast, in
the stable
3-integrin-expressing A5 CHO cell
clone all cells showed
3-integrin expression
and a complete absence of u-PAR protein (Fig. 2D).
|
v
3-integrin occupancy
by ligand is important for several
v
3-integrin
functions, including adhesion, migration, and outside-in signal
transduction (61). In order to establish if this also is
important for
3-integrin-mediated u-PAR
regulation, we studied the effect of antibody-mediated (LM609)
clustering of
v
3-integrin and
integrin ligation (immobilized vitronectin) on u-PAR expression. Plating of
3-integrin-transfected CHO cells on
vitronectin or on LM609 completely abolished u-PAR expression in the
cells (Fig. 2E to H). This repression was reproducibly stronger than
that in cells which had been transfected with
3-integrin but then plated on plastic alone.
These data indicate that downregulation of u-PAR expression requires
the intact assembled
v
3-complex and can be
increased by integrin clustering or ligand occupancy.
The immunofluorescence data were corroborated by Western blotting with
a u-PAR antibody (Fig. 3A) revealing high
u-PAR levels in the parental cell and significantly lower u-PAR antigen
concentrations in the transiently and the stably
3-integrin-expressing CHO A5 cell
clone. The transient
3-integrin-transfected CHO cells still showed
residual u-PAR protein expression, probably because their transfection
efficiency was only about 75%. Therefore, their u-PAR protein
expression was probably due to u-PAR expression of the untransfected
CHO cells.
|
3-integrin or the A5 cell
clone, which stably expresses
3-integrin.
Altogether, the data shown in Fig. 2 and 3 demonstrate that
overexpression of
3-integrin in CHO cells
downregulates u-PAR protein and mRNA expression.
Analysis of u-PAR gene transcription by
3-integrin.
The
3-integrin
subfamily includes
IIb
3- and
v
3-integrin. While
the expression of
IIb
3-integrin is
largely confined to cells of the megakaryocytic lineage and is required
for platelet aggregation (12, 60),
v
3-integrin is
expressed more widely, including in fibroblasts, smooth muscle cells,
and endothelial cells. To study the effect of
v- and
3-integrin on
u-PAR promoter activity, we transiently cotransfected CHO cells with a
CAT reporter driven by 398 bp of 5'-flanking sequence of the u-PAR
promoter. Transient expression of both
v- and
3-integrin subunits together with the u-PAR
promoter resulted in a reduction of u-PAR promoter activity (Fig.
4A). This reduction was brought about by
the
3-integrin expression construct because
transfection of
v-integrin alone did not show
any effect on the u-PAR promoter. Lysates of CHO cells transfected
with the u-PAR promoter-CAT reporter and the
3-integrin expression vector resulted in 18%
[14C]chloramphenicol conversion, compared to
87% in the absence of
3-integrin. By
contrast, expression of the same amount of
v-integrin showed no effect on the high
constitutive activity of the u-PAR promoter. This indicates that the
u-PAR promoter contains a transcription factor binding site that might
account for the
3-integrin-mediated repression
of u-PAR gene transcription in CHO cells. Dose-response studies
demonstrated that
3-integrin expression
resulted in a potent inhibition of u-PAR promoter activity (Fig. 4B). A
significant reduction of promoter activity was observed upon
transfection with 0.5 to 5 µg of
3-integrin
expression vector, whereas an equimolar amount of the empty expression
construct (pBabe Puro) had a minimal effect on reporter activity.
Cotransfection of 2 µg of
3-integrin caused
an 80% reduction of u-PAR promoter activity, which, however, could not
be further decreased, not even with 5 µg of
3-expression plasmid. To exclude the
possibility that the effect of
3-integrin is
due to a general inhibition of transcriptional activity, we performed a
control experiment with the
-actin promoter. Compared with the
effect of
3-integrin transfection on a
luciferase promoter regulated either by u-PAR or by
-actin, the
activity of
-actin was not affected by the expression of
3-integrin while the u-PAR promoter activity
was inhibited (data not shown).
|
Inhibition of the u-PAR promoter activity by
3-integrin requires a binding site for
PEA3/ets.
For localization of the region of the
u-PAR promoter responsible for
3-integrin-mediated inhibition of u-PAR
promoter activity, CHO cells were cotransfected with a luciferase
reporter driven by 5'-deletion fragments of the u-PAR promoter and the
3-integrin expression vector (Fig.
5A). A dramatic inhibition of the u-PAR promoter was evident with the
1,469-bp and
398-bp u-PAR promoter construct when cotransfected with
3-integrin
while the
197-bp luciferase reporter was not affected by the
3-integrin. The u-PAR
197 promoter had a low
constitutive activity that could not be further downregulated by
3- integrin. These data suggest that a
sequence residing between
398 and
197 bp is critical for the reducing effect of
3- integrin on u-PAR
promoter activity.
|
398 to
197 bp was associated
with a reduction of u-PAR by
3-integrin, we
reasoned that transcription factor binding sites in this part of the
promoter were required for silencing of the u-PAR transcription by
3-integrin. A computer search of this part of
the sequence (48) indicated the presence of a previously
uncharacterized PEA3/ets binding site (
248 bp) identical
with the canonical binding sequence (AGGAAG). Since this motif has been
shown elsewhere to be responsible for the basal and inducible
regulation of many genes, including those for several matrix
metalloproteinases (MMPs) as well as urokinase (34, 54),
we investigated the possible role of this motif in the regulation of
the u-PAR promoter by
3-integrin. Mutation of
the PEA3/ets binding site at
248 bp induced the
constitutive activity of the u-PAR promoter by 20% compared to the wt
promoter, which indicates that this sites acts as a (weak) silencing
element in the u-PAR promoter. Cotransfection of the
1469 u-PAR
PEA3/ets mutant with
3-integrin did
not further lower u-PAR promoter activity, which implies that the
PEA3/ets transcription factor binding site is important for
downregulation of the u-PAR promoter by
3-integrin (Fig. 5B). To investigate if other
transcription factor binding sites in the 200-bp region of the u-PAR
promoter between
398 bp and
197 bp are involved in repression of
u-PAR by
3-integrin, we performed further
deletion analyses. Deletion of four different regions around the
PEA3/ets site of the u-PAR promoter in the
1469 u-PAR
promoter did not affect the reduction of the u-PAR promoter by
3-integrin (Fig. 5B). However, both deletion 1 (u-PAR del 1
402/
350) and deletion 2 (u-PAR del 2
349/
300)
showed only 60% of the constitutive activity of the wt
1469 u-PAR
luciferase promoter, which implies positive regulatory elements that
are important for the basal promoter activity between
402 and
300 bp of the u-PAR promoter.
Because the constitutive activity of the u-PAR promoter is driven at
least in part through an AP-1 binding site (26) and transcription factors of the AP-1 family have been shown to cooperate with Ets family members, we were interested in the role of the AP-1
site in the regulation of the u-PAR promoter. Mutation of the AP-1
binding site at
184 bp in the
1,469-bp u-PAR luciferase construct
reduced the high constitutive promoter activity in CHO cells by 75%
(Fig. 5B). Cotransfection of the
3-integrin
expression plasmid with the mutated u-PAR promoter had no further
impact on the already low u-PAR promoter activity, implying that the AP-1 site is not involved in the regulation of the u-PAR promoter by
3-integrin.
The observation that a deletion of the PEA3-ets site at
248 bp impaired the reduction of the u-PAR promoter activity by
3-integrin suggests that this transcription
factor binding site mediates, at least in part, the reduction by the
3-integrin. To further investigate this
possibility, we determined whether expression of the PEA3 transcription
factor itself could downregulate the u-PAR promoter (Fig.
6). CHO cells were
cotransfected with the u-PAR promoter-driven CAT reporter (u-PAR-CAT)
and an expression vector that encoded the PEA3 transcription factor
(pcDNA3 PEA3). Expression of 3 µg of PEA3 reduced the constitutive
activity of the u-PAR promoter from an average conversion of
[14C]chloramphenicol of 89% to 15%. By
contrast, expression of the vector lacking the coding sequence for PEA3
(pcDNA3) had no effect on the u-PAR promoter activity. Deletion of the
PEA3/ets site at
248 bp (u-PAR PEA3 mt
248) in the u-PAR
promoter prevented a reduction of u-PAR promoter activity by the Ets
family member (Fig. 6B). These data indicate that PEA3 is a
transrepressor of the u-PAR promoter.
|
248 bp, which is required for the reduction of u-PAR by
3-integrin, we carried out electrophoretic
mobility shift assays. Nuclear extracts from parental and
3-integrin-transfected CHO cells were prepared
and incubated with an end-labeled 31-bp oligonucleotide spanning the
PEA3 site at
248 bp (see Materials and Methods for sequence). A retarded complex (Fig. 6C, arrow) was apparent with nuclear extract from parental and
3-integrin-transfected cells. However, the
intensity of the retarded band was higher in
3-integrin-transfected cells than it was in
the parental cell line. The binding of the factor(s) to the
oligonucleotide was specific, since a 100-fold excess of wt
oligonucleotide, but not the oligonucleotide which had been mutated in
the PEA3/ets motif, competed for the binding. A
PEA3-specific antibody substantially counteracted the binding of
transcription factors to the PEA3 binding site, which indicates that
PEA3 is a major component of the DNA-binding complex (Fig. 6D). These
data suggest that the downregulation of the u-PAR promoter by
3-integrin is mediated, at least in part,
through a previously unrecognized PEA3/ets site located at
248 bp upstream of the transcriptional start site of the u-PAR gene.
The data in Fig. 5A to D characterize only the transcriptional
regulation of the u-PAR promoter by PEA3. To strengthen the
notion that PEA3 can also downregulate u-PAR protein expression, we
transfected PEA3 in the CHO parental cell line (Fig. 6E and F). Indeed,
overexpression of PEA3 alone without
3-integrin almost completely abolished u-PAR
protein expression, as is shown by immunofluorescence, which implies
that the transcriptional downregulation of the u-PAR promoter is
paralleled by a reduction in u-PAR protein.
To investigate if
3-integrin and PEA3
cooperate to regulate u-PAR,
3-integrin and
PEA3 were cotransfected. For this experiment, a
3-integrin expression vector was expressed in
a concentration (1 µg) that leads to only a partial reduction of
u-PAR promoter activity and, where indicated, PEA3 was cotransfected
(Fig. 6G). In this case, a 1-µg concentration of PEA3 expression
vector is sufficient to downregulate the u-PAR promoter to a level that is achieved only with 3 µg of PEA3 when no
3-integrin is cotransfected (cf. Fig. 6A and
G). Thus, the ability of PEA3 to inhibit the u-PAR promoter is enhanced
in
3-integrin-overexpressing cells. Cotransfection of 2 and 3 µg of PEA3 with
3-integrin abolished u-PAR promoter activity
completely, but this level of downregulation could never be achieved
with PEA3 alone. This suggests that transcription factors other than
PEA3 are necessary to mediate the effect of
3-integrin.
Regulation of the u-PAR promoter by the cytoplasmic domain of
3-integrin.
The analysis of the regulatory role of
3-integrin cytoplasmic domains in multiple
cellular functions has recently acquired a new level of complexity with
the identification of variants of
3-integrin
(50). There are three
3-integrin isoforms
(
3A-,
3B-, and
3C-integrin) which result from alternative
splicing and differ from one another by their cytoplasmic sequence
(Fig. 7A) (21, 60). For a
further evaluation of the mechanism of integrin-dependent u-PAR
regulation, we created single-chain chimeric receptors (15a) which bear
the full-length cytoplasmic domain of
3-integrin fused to an Ig tag
(23) (Fig. 7A). CHO cells were transiently
cotransfected with the u-PAR-CAT reporter and the different
3-integrin isoforms (Fig. 7B). The high
constitutive activity of the u-PAR promoter in CHO cells could be
downregulated almost completely by the
3A-integrin while the
3B-integrin and the IgG1 vector had no effect
on the u-PAR promoter activity. Conversion of
[14C]chloramphenicol was reduced from 83%,
which mirrors the constitutive activity of the u-PAR promoter, to 10%
in cells cotransfected with the
3A-integrin.
The
3C-integrin isoform reduced the u-PAR promoter activity by 39%.
|
3-integrin interacts
with certain proteins whose binding is crucial for the signaling
function of
3-integrin (21, 60).
One motif which has been shown to be important for the
3A-integrin function and is present only in
this isoform is the NITY759 motif in the
cytoplasmic region. Therefore, we asked whether a mutation of this
motif affects the u-PAR promoter regulation by
3A-integrin. CHO cells were cotransfected with
the u-PAR promoter and a
3A-integrin
expression plasmid which has a substitution in the distal cytoplasmic
membrane NITY759 motif. The
NITYRGT762 domain in
3A-integrin was replaced with the
NPKYEGK778 of the
1A-integrin, yielding a chimeric construct
(Fig. 7A). The chimeric
3A-integrin
(
3A NPKY) could not reduce u-PAR promoter activity, compared with its wt form (Fig. 7B). In the opposite experiment, we replaced seven amino acids in the cytoplasmic domain of
a
1-integrin expression plasmid with the
NITYRGT762 motif of
3A-integrin (Fig. 7A) and cotransfected it
with the u-PAR promoter (Fig. 7B). This construct did not show any
effect on u-PAR promoter activity, which indicates that the
NITYRGT762 motif of
3A-integrin is necessary but not sufficient
for the downregulation of u-PAR promoter activity by
3A-integrin.
3-endonexin short downregulates u-PAR promoter
activity.
Previous studies have shown that the short form of a
cytoplasmic protein called
3-endonexin binds
to the NITY759 motif within the cytoplasmic
domain of the
3A-integrin (12, 45). This interaction is specific because
1- and
2-integrins do
not interact with
3-endonexin. Two isoforms of
3-endonexin have been discovered, but only the
short form interacts with the cytoplasmic domain of
3A-integrin (22). Since we have
shown that the NITY759 motif in the cytoplasmic
domain of
3A-integrin is necessary for
regulating the u-PAR promoter, we tested whether
3-endonexin short or its longer isoform is
involved in this regulation. CHO cells were cotransfected with the
u-PAR promoter-driven CAT reporter along with various amounts of an
expression vector that encoded
3-endonexin
short or
3-endonexin long (Fig.
8A). CAT activity was inhibited
almost completely by the short form of
3-endonexin while the empty expression vector
had no effect. An input of the short form of
3-endonexin diminished the u-PAR promoter
activity by 87%. By contrast, the
3-endonexin
long form induced u-PAR promoter activity by 32%. When both
3-endonexin isoforms were cotransfected
with the u-PAR promoter mutated in the PEA3/ets site (u-PAR
PEA3 mt
248 bp), the expression of the short form of
3-endonexin did not reduce the u-PAR promoter
activity any further (Fig. 8B). Evidently, the short isoform of
3-endonexin downregulates the u-PAR gene at
least in part through the PEA3/ets site in the u-PAR
promoter.
|
| |
DISCUSSION |
|---|
|
|
|---|
Cell migration depends on the coordinated regulation of
proteolysis and adhesion at the cell surface and is tightly regulated in several physiologic and pathological conditions. Thus, it is critical to understand how these processes affect each other. In the
present study, we provide evidence that overexpression of the adhesion
receptor
3-integrin downregulates the protease receptor, u-PAR. Furthermore, we have demonstrated that this
downregulation is mediated, at least in part, through a
PEA3/ets site in the u-PAR promoter and involves a
NITY759 motif in the cytoplasmic domain of the
3-integrin subunit and the adapter protein
3-endonexin.
Several of our observations suggest a pivotal role for
3- integrin in regulating u-PAR. The
introduction of
3-integrin into CHO cells
which have a high constitutive u-PAR expression blocks u-PAR protein
expression, as is shown by Western blot analysis and
immunofluorescence. Equally important, overexpression of
3-integrin also downregulates u-PAR mRNA
and, in both transient and stable transfections, also
downregulates u-PAR promoter activity. In contrast,
v-integrin and
1-
integrin alone have no influence on u-PAR regulation. However, upon
overexpression of
3-integrin,
v-integrin is recruited into an
v
3-integrin complex,
as is evidenced by our immunofluorescence results with an antibody
recognizing the ECM ligand binding site of the heterodimer
v
3. Clustering of
v
3-integrin, which
was achieved after ligation with immobilized vitronectin or the
antibody LM609, even enhanced the repression of u-PAR in CHO cells.
This indicates that the
v
3-integrin complex and its ligation (outside-in signaling) and not the single
3-integrin subunit is required for u-PAR
regulation. Thus, besides its involvement in adhesion, migration, and
signal transduction (61),
v
3-integrin can also
inhibit u-PAR transcription.
u-PAR is a multifunctional receptor and not only focuses urokinase
enzymatic activity onto the cell surface but is also associated with
and modulates the function of
1-,
2-, and
3- integrins (16, 52, 58, 59). It is presently known that u-PAR and integrins coassemble within the plasma membrane and modulate the adhesive and migratory functions of cells. Wei et al. (52)
showed that a complex of u-PAR,
1-integrin,
and caveolin affects the adhesive properties of embryonic kidney 293 cells. u-PAR inhibited cell adhesion on fibronectin but promoted cell
adhesion to vitronectin, which implies that one effect of the
association between u-PAR and integrins is to affect the ligand-binding
function of that integrin (7). In addition to the
already-described physical interaction between u-PAR and
3-integrin at the cell surface, we now report
that an increased level of
3-integrin
expression results in a reduced transcription of the u-PAR promoter and
thus reduced u-PAR protein expression. This helps us to understand how
integrins counteract u-PAR action at the cell surface and identifies a
new regulatory mechanism between
3-integrin
and the u-PAR. Our findings may explain the observations by Danen et
al. (11), who showed that stable overexpression of
3-integrin in the
3-negative human melanoma cell line MV3
strongly reduces invasion into Matrigel and also lung
colonization but not proliferation in nude mice. Since u-PAR is
involved in tumor cell invasion and metastasis, we speculate from our
data that the
3-mediated reduced expression of
u-PAR modulates the proteolytic potential of tumor cells required for
invasion and metastasis.
The cytoplasmic domain of integrins is fundamental for gene expression,
cell proliferation, and cell cycle regulation (9, 39). The
membrane-distal NXXY motif within the cytoplasmic domain is highly
conserved in
1-,
2-,
3-,
5-,
6-, and
7-integrins and plays a crucial role in integrin-mediated cell functions. For
3-integrin, this motif
(NITY759) is important for different functions,
including cell adhesion, focal contact formation, and FAK/paxillin
tyrosine phosphorylation (40). Our present results show
that the transfection of the cytoplasmic domain of
3-integrin is sufficient to reduce u-PAR gene
transcription. This effect was evident when the
3A-integrin isoform was used, but it was not
manifest with the
3B isoform. Because the
NITY759 motif is found exclusively within the
3A-isoform sequence and not in other
integrins, we evaluated the importance of the
NITY759 motif for u-PAR gene regulation and found
that deletion and substitution of the NITY759
motif through the cytoplasmic NPKY775 of
1-integrin abolish the inhibitory effect of
3A-integrin on u-PAR expression. However, the
NITY759 motif itself is necessary but not
sufficient to mediate the reduction of the u-PAR promoter activity,
because its integration into the
1-integrin
cytoplasmic domain did not inhibit the u-PAR transcription. Probably,
other parts of the
3-integrin cytoplasmic
domain in addition to this motif are involved in u-PAR downregulation.
This is also suggested by the ability of
3C-integrin to downregulate the u-PAR
promoter, albeit to a lower degree than
3A-integrin. The
3A-integrin isoform plays a role in signal
transduction and inside-out signaling (1), and now our
results point to an additional role as a regulator of u-PAR expression.
Because expression of
3-integrin isoforms
might be differentially regulated depending on the functional state of
the cell, a change in the pattern of
3-integrin isoforms might have an impact on
3-integrin-dependent u-PAR regulation.
The importance of the NITY759 motif for u-PAR
regulation is also emphasized by the fact that
3-endonexin, the binding of which relies on a
structurally intact NITY759 motif
(12) in the cytoplasmic domain of
3A-integrin, downregulates the u-PAR promoter.
The NITY759 motif is the binding site of
3A-integrin for its specific cytoplasmic protein
3-endonexin, which exists in a short
and a long isoform, the latter of which does not bind to the
cytoplasmic domain of
3-integrin
(45). We established that the short isoform of
3-endonexin downregulates u-PAR promoter
activity, indicating a role for
3-endonexin short in u-PAR regulation by binding to the cytoplasmic tail of
3-integrin. The specificity of this regulation
is emphasized by the inability of the long form of
3-endonexin to regulate u-PAR promoter
activity. Kashiwagi et al. (22) presented evidence of the
interaction of the short form of
3-endonexin
with the
3 cytoplasmic tail modulating the
affinity state of
IIb
3- integrin and
enhancing fibrinogen-dependent cell aggregation.
3-endonexin short increases the affinity of
individual
IIb
3-
heterodimers for specific ligands, which suggests inside-out signaling
with
3-endonexin affecting the affinity of
IIb
3 for certain
ligands (22). Besides these functions,
3-endonexin also participates in the
integrin-mediated gene regulation that starts with activation-binding of
3-integrin, results in
3-endonexin recruitment, and eventually affects u-PAR gene regulation via a PEA3/ets binding site in
the u-PAR promoter.
Cytoplasmic domains of
-integrins mediate downstream signaling
events and affect gene regulation. In untransformed cells, integrins
induce cell cycle progression via the Ras-mitogen-activated protein
kinase (MAPK) pathway (8, 24). Our previous studies indicated that the u-PAR promoter is regulated via a
MAPK-dependent signal transduction pathway (25),
raising the possibility that
3-integrin
uses this signal transduction pathway to regulate u-PAR
(19). However, we did not find any involvement of MAPK in
u-PAR gene regulation by
3-integrin, neither
by testing synthetic inhibitors nor with dominant-negative expression
vectors for Erk-, Jnk-, or p38-MAPK (data not shown). This implies that
integrin-dependent u-PAR gene regulation does not take place via
well-documented signaling pathways. Therefore, further studies will be
necessary to elucidate the signal transduction pathway(s) involved in
the regulation of u-PAR by
3-integrin and
3- endonexin.
The involvement of the transcription factor PEA3 in mediating the
reduction of the u-PAR promoter by
3-integrin
is supported by several experiments. First, the ability of
3-integrin to downregulate u-PAR promoter
activity is abolished by deletion of the PEA3/ets site at
248 bp. Second, an expression vector encoding the Ets family member
PEA3 was sufficient to reduce wt u-PAR promoter activity but not the
promoter with a mutation in this consensus sequence. Third,
overexpression of PEA3 reduced u-PAR protein expression. Fourth,
nuclear extracts of
3-integrin-overexpressing cells showed enhanced binding activity for the PEA3/ets
site, and the Ets family member PEA3 was identified within the
DNA-protein complex. Fifth,
3-endonexin short
downregulates only the wild type and not the
PEA3/ets-mutated u-PAR promoter. Thus, downregulation of the
u-PAR promoter by
3-integrin and the short
form of
3-endonexin is mediated at least in
part through a previously undescribed PEA3/ets silencer
region at
248 bp in the u-PAR promoter by PEA3.
Several positive regulatory elements, including AP-1, AP-2, and Sp-1,
have been identified in the u-PAR promoter (2, 26, 48),
most of them contained within the first 200 bp 5' of the transcriptional start site. We found now that additional positive regulatory elements are located between
400 and
300 bp of the u-PAR
promoter, because two deletions in this region (u-PAR del 1
402/
350
and u-PAR del 2
349/
300) reduced the constitutive activity
significantly. Within this region are putative transcription factor
binding sites for the transcription factors Sp-1, GATA-2, and NF-1, and
further analysis will be necessary to investigate their role in the
constitutive and inducible expression of the u-PAR promoter. Deletion
of this region had no effect on the regulation of u-PAR by
3-integrin. Even though the basal promoter
activity was lower than the wt u-PAR promoter activity, it could be
further reduced by
3- integrin.
Identification of the PEA3/ets motif represents the first report on a silencing element in the u-PAR promoter. The PEA3/ets site is an oncogene-regulated element and an important positive regulator of gene expression for several matrix-degrading proteolytic enzymes. The Ets family member PEA3, in cooperation with an AP-1 family member, induces the transcription of several MMPs and the serine protease urokinase (3, 20, 38, 51). While all these genes have juxtaposed PEA3/ets-AP-1 elements in thei