Previous Article | Next Article 
Molecular and Cellular Biology, March 2001, p. 2154-2164, Vol. 21, No. 6
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.6.2154-2164.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Interaction with Protein Phosphatase 1 Is Essential
for bifocal Function during the Morphogenesis of the
Drosophila Compound Eye
Nicholas R.
Helps,1
Patricia T. W.
Cohen,1,*
Sami M.
Bahri,2
William
Chia,2 and
Kavita
Babu2
Medical Research Council Protein
Phosphorylation Unit, Department of Biochemistry, University of
Dundee, Dundee DD1 5EH, Scotland, United
Kingdom,1 and Institute of Molecular
and Cell Biology, Singapore 117609, Singapore2
Received 8 September 2000/Returned for modification 25 October
2000/Accepted 20 December 2000
 |
ABSTRACT |
The gene bifocal (bif), required for photoreceptor
morphogenesis in the Drosophila compound eye, encodes a
protein that is shown to interact with protein phosphatase 1 (PP1)
using the yeast two-hybrid system. Complex formation between Bif and
PP1 is supported by coprecipitation of the two proteins. Residues 992 to 995 (RVQF) in the carboxy-terminal region of Bif, which conform to
the consensus PP1-binding motif, are shown to be essential for the
interaction of Bif with PP1. The interaction of PP1 with bacterially
expressed and endogenous Bif can be disrupted by a synthetic peptide
known to block interaction of other regulatory subunits with PP1. Null bif mutants exhibit a rough eye phenotype, disorganized
rhabdomeres (light-gathering rhodopsin-rich microvillar membrane
structures in the photoreceptor cells) and alterations in the actin
cytoskeleton. Expression of wild-type bif transgenes
resulted in significant rescue of these abnormalities. In contrast,
expression of transgenes encoding the Bif F995A mutant, which disrupts
binding to PP1, was unable to rescue any aspect of the bif
phenotype. The results indicate that the PP1-Bif interaction is
critical for the rescue and that a major function of Bif is to target
PP1c to a specific subcellular location. The role of the PP1-Bif
complex in modulating the organization of the actin cytoskeleton
underlying the rhabdomeres is discussed.
 |
INTRODUCTION |
Reversible protein phosphorylation
catalyzed by protein kinases and protein phosphatases regulates the
majority of cellular functions and therefore might also be predicted to
play key roles in the regulation of many developmental processes. One
of the most abundant eukaryotic protein phosphatases that
dephosphorylate serine and threonine residues is protein phosphatase 1 (PP1), which exhibits pleiotropic functions (8, 11, 38).
The known diverse actions of PP1 reside in the ability of the catalytic subunit of PP1 (PP1c) to associate with different regulatory subunits in vivo, which may target the catalytic subunit to specific subcellular locations and often modify its substrate specificity. The activities of
the various PP1 complexes may thus be regulated differentially by
intra- and extracellular signals acting upon the different subunits.
Over 25 different regulatory subunits of PP1c have now been identified.
For example, in mammals, glycogen binding subunits target PP1c to
regulate the enzymes of glycogen metabolism and myosin binding subunits
enable PP1c to regulate myofibrillar contractility (26, 27,
40). Binding of PP1c to scaffold proteins may modulate ion
channel activity (44), while at neuronal synapses,
neurabins I and II (also termed spinophilin) localize PP1c to the actin cytoskeleton at the plasma membrane (1, 32, 33, 37). Interaction of subunits with PP1c is mutually exclusive, an observation explained by the discovery that a short
motif
(R/K)(V/I)X(F/W)
present in the majority (but not in all) of
these subunits is sufficient for binding to PP1c (18, 27,
47). PP1c also binds to a number of small cytosolic inhibitor
proteins, including inhibitor 1 (I-1) and I-2, which inhibit PP1c
activity at nanomolar concentrations (reviewed in references 11
and 43). In Drosophila melanogaster, a widely
distributed I-2 protein, as well as a testis-specific I-2-like protein,
has been identified (7, 22, 25). A further PP1c-associated
protein, KLP38B, a mitotic kinesin-related protein which plays a role
in mitotic chromosome condensation in proliferating cells, has also
been reported in this species (2), although it does not
have a discernible PP1c-binding motif.
Four isoforms of PP1c exist in D. melanogaster (14,
16). They are encoded at chromosomal loci 87B, 96A, 9C, and 13C.
PP1-87B null mutants exhibit a lethal phenotype at the
larval stage, failing to exit mitosis and showing overcondensed
chromatin (4, 13), while PP1-87B mutants with
some residual activity are viable and exhibit dominant suppression of
position effect variegation, indicating that PP1-87B also
modulates chromosome condensation in interphase (6, 15).
In contrast, PP1-9C (flapwing) mutants are viable but
flightless due to defects in indirect flight muscles (35). These diverse phenotypes suggest that PP1c in D. melanogaster will be regulated by a variety of regulatory subunits
comparable to those identified in mammals. In this communication we
identify D. melanogaster Bifocal (Bif), required for the
normal morphogenesis of the Drosophila compound eye, as a
protein that interacts with PP1-87B via a PP1 consensus binding motif.
The D. melanogaster eye is an excellent model system for
study of the developmental processes at the cellular and subcellular levels. The adult compound eye comprises ~800 repeats of a basic unit
referred to as an ommatidium, each of which contains eight photoreceptor neurons (R cells) and an invariant array of nonneuronal accessory cells. R-cell development begins in the third-instar larval
eye disc and is completed by the end of the third-instar larval stage
(36). In the midpupal stage (~48 h post-puparium formation), each R cell projects to the center of an ommatidium, a
microvillar stack of membranes rich in rhodopsin (called the rhabdomere). The position of each rhabdomere depends on the class of R
cell from which it is produced (45). R7 projects to the center of the ommatidium and contacts surrounding rhabdomeres of other
R cells. R3 builds its rhabdomere against the stalk of R2 and R4,
whereas R4 forms contacts with the rhabdomeres of R2 and R7. Rhabdomere
development is essentially completed at 110 h of pupation
(prior to eclosion), by which stage the rhabdomeres retract from the
center of the retina, leaving behind an interretinal space
(45). At the subcellular level, the rhabdomeral microvilli are supported by an axial actin cytoskeleton comprising at least two
actin filaments per microvillus (3). The barbed ends of the actin filaments are located at the distal ends of the microvilli, and the pointed ends project into the cytoplasm of the R cells.
The gene bifocal (bif) at chromosomal locus 10D
was previously identified in a P-element transposition screen; null
mutations in bif give rise to a rough eye phenotype in the
adult (5). Externally, bif mutant eyes exhibit
occasional fusion of adjacent ommatidia and loss or duplication of
bristles. More detailed examination revealed alterations in normal
rhabdomere development; they become enlarged and frequently split. At
the subcellular level, disorganization of the actin cytoskeleton was
evident; actin staining becomes disordered and defective and the
interretinal space is absent. In this paper, we show that an intact
PP1c-binding site in Bif is required for rescue of the bif
null mutant phenotypes, demonstrating a role for PP1 in regulating the
organization of the actin cytoskeleton and the morphology of the
rhabdomeres during development of the eye.
 |
MATERIALS AND METHODS |
General methods and the yeast two-hybrid analysis.
Microbial
strains and methods for the yeast two-hybrid screen using human PP1
1
have been described (17, 24, 25). In order to isolate
proteins capable of interacting with PP1, the yeast strain Y190
containing a pAS2-PP1
1 plasmid was transformed with DNA from a
D. melanogaster third-instar larval cDNA library in pACT.
Ten colonies (representing 0.008% of the cells transformed) were
obtained on selective media, from which pACT plasmids were recovered
into Escherichia coli, and their cDNA inserts were sequenced.
Oligonucleotides were synthesized by Audrey Gough (University of
Dundee) on an Applied Biosystems model 394 DNA synthesizer. DNA
sequencing was performed using Taq dye terminator cycle
sequencing on PE Biosystems automated DNA sequencers.
Bacterial expression of Bif fused to glutathione
S-transferase (GST) or maltose binding protein.
To
construct the GST-Bif fusion vector, a 1,931-bp BglII
fragment from the pACT-D2 construct, encoding residues 761 to 1235 of
the Bif protein, was ligated into the BamHI site of the
vector pGEX-3X (Pharmacia). The construct was verified by DNA
sequencing and was then transformed into E. coli BL21(DE3)
(pLysS) for expression. A 500-ml culture of E. coli
containing the pGEX-Bif expression construct was grown at 37°C to an
A600 of 0.5 and was then induced with a final
concentration of 100 µM
isopropyl-
-D-thiogalactopyranoside (IPTG) for 3 h
at 37°C. The cells were harvested by centrifugation, resuspended in
25 ml of ice-cold lysis buffer (50 mM Tris-HCl [pH 7.5], 0.1 mM EGTA,
0.1% [vol/vol] 2-mercaptoethanol, 0.02% [wt/vol] Brij 35, 5%
[vol/vol] glycerol, 1 mM EDTA, 200 mM NaCl) containing 0.1 mM
phenylmethylsulfonyl fluoride and 1 mM benzamidine, and lysed by
sonication. The lysate was centrifuged at 45,000 × g
for 20 min, and the supernatant was added to 3 ml of
glutathione-Sepharose (Pharmacia) equilibrated in lysis buffer. After
incubation with mixing at 4°C for 1 h, the resin was washed
three times with 20 ml of lysis buffer and was then transferred to an
Econopac (Bio-Rad) column. Following further washing, the bound GST-Bif
protein was eluted from the column with lysis buffer containing 20 mM
free reduced glutathione. The peak protein fractions were pooled,
concentrated by centrifugation through a Centricon 30 device (Amicon
Inc.), and stored in aliquots at
80°C.
To construct the MBP-Bif fusion vector, the pACT-D2
BglII
fragment (see above) was cloned into the
BamHI site of
plasmid pMAL-HA
(plasmid pMAL-c2 [New England Biolabs, Inc.] modified
to contain
a hemagglutinin tag and additional restriction sites). After
DNA
sequencing, the plasmid was transformed into
E. coli
BL21(DE3)
(pLysS) for expression. Expression and purification were
performed
as for the pGEX-Bif construct (see above), except that
amylose
resin was used and elution was performed with 20 mM
maltose.
Mutagenesis of the Bif protein.
The pGEX-Bif construct was
mutated to encode GST-Bif in which F995 was replaced by A using the
Quickchange mutagenesis system (Stratagene) and the complementary
oligonucleotides CCGCGTGCAGGCTAACGACACGC and
GCGTGTCGTTAGCCTGCACGCGG (mutated codon in
boldface). After verification that the sequence was correct, the
mutated GST-Bif protein was expressed and purified as described above for the wild-type (wt) protein.
Production of antibodies.
Antisera were raised against the
GST-Bif(761-1235) protein and bacterially expressed PP1-87B
(25) in sheep at Diagnostics Scotland (Carluke,
Lanarkshire, United Kingdom). Anti-GST-Bif antibodies were affinity
purified on a column matrix of MBP-Bif(761-1235) linked to
CNBr-Sepharose (Pharmacia, Uppsala, Sweden) and were then coupled to
protein G-Sepharose (1 mg of immunoglobulin G [IgG] per ml of resin)
using dimethylpimelimidate (19). Anti-PP1-87B antibodies
were similarly affinity purified on a column matrix of PP1-87B and
coupled to protein G-Sepharose.
Immunoprecipitation and glutathione-Sepharose sedimentation.
Mixed male and female D. melanogaster adults were
homogenized in lysis buffer (detailed above) containing complete
protease inhibitor cocktail (Roche Diagnostics). After centrifugation
at 15,000 × g for 10 min, the lysate was diluted to 1 mg/ml and precleared with preimmune IgG coupled to protein G-Sepharose
for 1 h at 4°C. The supernatant was then incubated for 1 h
at 4°C with anti-Bif IgG coupled to protein G-Sepharose. The
immunoprecipitates were washed three times with lysis buffer and were
then either subjected to sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) or washed once with protein phosphatase
assay buffer and used in protein phosphatase assays. For SDS-PAGE, 100 µg of extract was used with 10 µl of beads for each
immunoprecipitate. For assays, 30 µg of extract was used with 5 µl
of beads for each immunoprecipitate.
Glutathione-Sepharose sedimentation experiments were performed in a
manner similar to that for immunoprecipitations using
purified proteins
in lysis buffer containing 0.1 mg of bovine
serum albumin (BSA)/ml to
limit nonspecific
interactions.
Protein phosphatase assays.
32P-labeled rabbit
skeletal muscle glycogen phosphorylase was prepared by H. Y. L. Tung. Phosphatase assays were performed in the presence of 0.5 mM
Mn2+ (PP1
1 and PP1-87B) or in the absence of
divalent cations (endogenous PP1) as previously described
(12).
Immunoprecipitation-phosphatase assays were performed in a similar
manner, except that a shaking incubator was used. One unit
of
phosphatase activity was that amount of enzyme that catalyzed
the
release of 1 µmol of [
32P]phosphate/min from
[
32P]phosphorylase
a in the
assay.
Transgenic flies and fly stocks.
In order to produce
transgenic flies, full-length bif cDNAs were cloned into the
pUAST vector (9) and injected into embryos using standard
procedures. F0 flies were crossed to yw flies, and w+ transformant progeny were collected and
balanced. To ensure that these transgenes are capable of producing a
Bif protein, several bif transformant lines were tested for
expression by crossing to a mesodermal driver line, 24B-GAL4. The line
24B-GAL4 drives expression in the muscles where Bif is not normally
expressed. Bif expression in embryos was visualized using anti-Bif
antibody raised in sheep followed by a secondary antibody conjugated to horseradish peroxidase. To drive Bif expression in the eye, the pGMR-GAL4 driver, which allows Bif expression in many of the different cell types of the eye (20), was used. In our experiments,
the strain used for expression of the transgenes contains the
bif R47 allele (5). This allele possesses an
internal deletion that deletes 3 kb from coding exon 3, resulting in
the absence of detectable Bif protein expression with anti-Bif antibody.
Immunostaining of eye discs and electron microscopy.
Larval
eye discs were dissected in accordance with previously published
protocols with slight modifications (46). Wandering third-instar larval eye discs were dissected in phosphate-buffered saline and fixed in 4% paraformaldehyde for 30 min on ice. The dissected discs were then washed, blocked with BSA, stained with anti-Bif primary antibody, and then treated with fluorescein
isothiocyanate-labeled anti-sheep secondary antibody. The larval eye
discs were mounted in Vecta-shield and were visualized using confocal
microscopy. Pupal eye discs were dissected as previously described
(10) and were fixed with 4% paraformaldehyde for 30 min
on ice. The dissected discs were then washed and stained with
tetramethyl rhodamine isothiocyanate-phalloidin and mounted in
Vecta-shield medium for confocal microscopy. A Bio-Rad 1024 confocal
microscope was used to visualize the images. For transmission electron
microscopy, adult heads were embedded in Epon resin and processed in
accordance with published protocols (41), and ultrathin
sections were counterstained with lead citrate and uranyl acetate. The
sections were then visualized under a transmission electron microscope.
For scanning of adult eyes, the heads were fixed, washed, and
dehydrated with ethanol in accordance with the protocol described in
reference 28 with minor modifications. These fly eyes were
then visualized under a scanning electron microscope.
 |
RESULTS |
Identification of Bif as a PP1-binding protein.
In order to
identify proteins capable of interacting with PP1, a yeast two-hybrid
screen of a D. melanogaster third-instar larval library was
performed with human PP1
1 as bait (24). Ten
clones, able to activate transcription of both the his3 gene (permitting auxotrophic selection) and the lacZ reporter
gene in the presence of the bait, were identified (25).
One of these contained a cDNA, termed PP1D2, that encoded the 474 carboxy-terminal amino acids of the protein Bif (5).
Residues 992 to 995 (RVQF) of Bif were seen to conform to the consensus
PP1-binding motif of -(R/K)(V/I)XF- found in many regulatory subunits
of PP1 (18). We therefore decided to test whether the
protein encoded by the PP1D2 clone could bind the major form of
D. melanogaster PP1 encoded at locus 87B in vitro. Figure
1A shows that a GST-Bif(761-1235) fusion
protein is capable of interacting with D. melanogaster PP1-87B in the gluthione-Sepharose sedimentation assay. The interaction is stable to 1 M salt (Fig. 1C) and is not seen with GST alone (data
not shown) or mutated GST-Bif (Fig. 1B; see description below). To
investigate the PP1-Bif(761-1235) complex formation further, we
utilized the synthetic peptide SP294, which comprises residues 773 to
810 of the human 53BP2 protein. This peptide contains the PP1-binding
site of 53BP2 (18, 21) and has previously been shown to
disrupt the interaction of PP1c with a number of its regulatory
subunits (18, 22, 23, 29). The peptide was capable of
dissociating GST-Bif(761-1235) from PP1-87B (Fig. 1D). SP294 at a
concentration of 100 nM in the assay considerably reduced interaction,
and 1 µM SP294 completely blocked interaction.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 1.
Glutathione-Sepharose sedimentation experiments. PP1-87B
catalytic subunit was incubated with either GST-Bif(761-1235) or
GST-Bif(761-1235; F995A) and 5 µl of glutathione-Sepharose in 100 µl of lysis buffer (containing 0.1 mg of BSA/ml) at 4°C with
shaking for 1 h. Following washing with lysis buffer (three times,
1 ml), the entire pellet fraction and 1/10 of the supernatant (S/N)
fraction were separated by SDS-PAGE (10%) and the proteins were
visualized with Coomassie blue (R250) stain. (A) Two micrograms
(approximately 1 µg of nondegraded protein) of GST-Bif(761-1235) was
incubated with 0, 1, or 5 µg of PP1-87B catalytic subunit. (B) The
procedure described for panel A was followed, except that
GST-Bif(761-1235; F995A) was used. (C) Two micrograms (approximately 1 µg of nondegraded protein) of GST-Bif(761-1235) was incubated with 1 µg of PP1-87B catalytic subunit in lysis buffer containing 150 (standard lysis buffer), 250, 500, 750, or 1,000 mM NaCl. Washes also
contained these concentrations of NaCl. (D) The procedure described for
panel C was followed, except that the standard lysis buffer contained 0 nM, 1 nM, 100 nM, 100 nM, 1 µM, or 10 µM peptide 294. Washes did
not contain peptide. Marker proteins are in the first lane of each gel,
and sizes are shown in kilodaltons.
|
|
To determine if the interaction was occurring through the consensus
PP1-binding sequence within Bif, we mutated F995 to A.
The analogous
mutation has previously been shown to abrogate binding
of other
PP1-interacting proteins to PP1c (
18,
22,
23,
42)
and, as
expected, mutation of F995 in the Bif protein completely
blocked
binding of GST-Bif(761-1235) to PP1-87B (Fig.
1B). To
analyze the
interaction further, we performed a digoxigenin (DIG)-labeled
PP1
1 overlay of GST-Bif variants. Figure
2A shows that wild-type
GST-Bif(761-1235)
is able to bind DIG-PP1
1 exceedingly well,
whereas the
ability of GST-Bif(761-1235; F995A) to bind DIG-PP1
1 is
much reduced. GST-53BP2(715-1005) and GST-G
L(1-257) also
bind
DIG-PP1
1 well, whereas GST-G
L(94-257),
which does not contain
its PP1-binding site, is unable to bind to
DIG-PP1
1. When higher
amounts are loaded on the gel,
GST-Bif(761-1235; F995A) can be
observed to retain weak PP1-binding
capacity in the overlay assay
(data not shown), which may be explained
by the very strong interaction
of the wt GST-Bif(761-1235) with PP1.
This strong complex formation
is consistent with residues other than
F995, probably in or near
the consensus PP1 motif of Bif, contributing
to the overall binding.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 2.
Interaction of GST-Bif proteins with DIG-labeled
PP1-87B. GST-Bif(761-1235) (0.5 µg), GST-Bif(761-1235; F995A) (0.5 µg), GST-53BP2(715-1005) (1 µg), GST-GL(1-257) (1 µg), and GST-GL(94-257) (1 µg) were separated on
duplicate SDS-12.5% PAGE gels. One gel was transferred to
nitrocellulose membrane and processed to identify proteins capable of
interacting with DIG-labeled PP1-87B (A). The other gel was stained
with Coomassie blue (R250) to visualize all the proteins (B). Marker
sizes are in kilodaltons. WT, wild type.
|
|
The Bif protein modulates PP1 phosphatase activity in vitro.
Demonstration of an interaction of D. melanogaster Bif
protein with PP1c raised the question of whether Bif would affect the activity of PP1c. Since human PP1
1 was used to isolate
the Bif protein in the yeast two-hybrid screen, we used both D. melanogaster PP1-87B and human PP1
1 to perform the
assays. Wild-type GST-Bif(761-1235) dramatically inhibits the
phosphorylase phosphatase activity of both PP1-87B (Fig.
3A) and PP1
1 (data not
shown), with a 50% inhibitory concentration of approximately 1 nM.
Mutation of F995 to A within the consensus PP1-binding motif of Bif
totally abolishes this inhibition unless very high concentrations of
the protein are used (Fig. 3A), indicating that the inhibition is due
to Bif and not to a contaminating protein. Previous results have shown that the SP294 peptide can relieve inhibition of PP1c activity caused
by PP1-binding proteins (18, 22, 23, 29). We therefore examined the effect of SP294 peptide on the activity of the
PP1-GST-Bif(761-1235) complex. Figure 3B shows that the peptide
relieved the inhibition of PP1-87B caused by GST-Bif(761-1235) at a
peptide concentration similar to that found to relieve inhibition of
PP1c by other PP1-binding proteins under similar conditions. As
expected, the peptide has no effect on PP1-87B activity in the absence
of the GST-Bif(761-1235) protein (Fig. 3B). The inhibition of
PP1
1 by GST-Bif(761-1235) was similarly relieved by
peptide 294 (data not shown).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of GST-Bif and SP294 on phosphorylase phosphatase
activity of PP1-87B. (A) GST-Bif protein was included at the
concentrations shown in a standard phosphorylase phosphatase assay with
PP1-87B. Squares, GST-Bif(761-1235); triangles, GST-Bif(761-1235;
F995A). (B) Phosphorylase phosphatase assays were performed with
PP1-87B in the presence (squares) or absence (triangles) of 10 nM
GST-Bif(761-1235) and with the concentrations of peptide 294 shown. In
all assays the amount of PP1-87B was kept constant and such that (in
the absence of other factors) 10% of the counts were released from
phosphorylase during the assay. WT, wild type.
|
|
Interaction of endogenous Bif protein and PP1 in D. melanogaster extracts.
In order to be certain that
interaction of bacterially expressed PP1-87B with the GST fusion of the
carboxy-terminal half of the Bif protein was not an in vitro artifact,
we examined endogenous D. melanogaster proteins for the
presence of Bif. Figure 4A shows that the
anti-Bif antibody is capable of immunoprecipitating a band from embryo
D. melanogaster extracts that is the same size as the
PP1-87B catalytic subunit and is recognized by the anti-PP1-87B antibody. This band is only seen in the postimmune (anti-Bif IgG immunoprecipitate) track and is therefore highly likely to represent endogenous PP1c. The low abundance of the endogenous Bif protein in
D. melanogaster extracts made its detection difficult
following SDS-PAGE and necessitated the use of biotinylated anti-Bif
antibody followed by avidin-horseradish peroxidase. This method
visualizes endogenous Bif proteins migrating at approximately 150 kDa
in anti-Bif immunoprecipitates (Fig. 4B). In addition many smaller immunoreactive fragments are detected, suggesting that Bif is extensively degraded in anti-Bif immunoprecipitates, despite the presence of protease inhibitors. These immunoreactive bands are seen
only in the postimmune IgG (anti-Bif immunoprecipitate) and therefore
are very likely to represent endogenous Bif fragments. Note that the
bacterially expressed GST-Bif(761-1235) also contains some degraded
fragments.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Coimmunoprecipitation of PP1 with Bif from D. melanogaster extracts. Two hundred micrograms of D. melanogaster embryo extract was immunoprecipitated with either
preimmune IgG or anti-Bif IgG coupled to protein G-Sepharose and
separated by SDS-PAGE with 1 or 10 ng of the positive control proteins.
(A) Samples were separated by SDS-10% PAGE and were then transferred
to nitrocellulose membrane; the PP1-87B protein was visualized using
anti-PP1-87B antibody. Positive control protein is PP1-87B. (B) Samples
were separated by SDS-7.5% PAGE and transferred to nitrocellulose
membranes, and the Bif protein was visualized using anti-Bif antibody.
Positive control protein is GST-Bif(761-1235). Marker sizes are given
in kilodaltons, and arrows indicate the position of proteins of
interest. Note that the heavy and light IgG bands from the
immunoprecipitating antibody are seen in panel A (preimmune and
anti-Bif immunoprecipitates) and that the Bif protein undergoes
extensive degradation, resulting in many immunoreactive bands with
sizes below that of the full-length protein (B, anti-Bif
immunoprecipitate). IP, immunoprecipitate. +ve, positive. , blank
lane.
|
|
Further evidence that a complex is formed between endogenous Bif and
PP1 was obtained by assaying the protein phosphatase
activity
associated with Bif immunoprecipitates from
D. melanogaster extracts. Figure
5 shows that significant
phosphatase activity
is immunoprecipitated specifically from both
embryo and adult
D. melanogaster extracts with the anti-Bif
antibody but not with
the preimmune IgG. This activity is totally
inhibited by the PP1-specific
inhibitor I-2 protein, demonstrating that
the activity is due
to PP1 in the precipitate. Addition of peptide
SP294 substantially
increases the protein phosphatase activity detected
in the anti-Bif
immunoprecipitates but not in the preimmune IgG
immunoprecipitates.
The results indicate that endogenous Bif protein
and PP1c are
present in a complex in
D. melanogaster
extracts.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 5.
Coimmunoprecipitation assay of PP1 phosphatase activity
from D. melanogaster extracts. Fifteen micrograms of
D. melanogaster embryo or adult extract was
immunoprecipitated with either anti-Bif IgG or control (preimmune) IgG
coupled to protein G-Sepharose. After washing to remove unbound
proteins, phosphatase activity associated with the beads was determined
in a phosphatase assay using phosphorylase a as the
substrate and including 10 µM SP294 or 100 nM I-2 where indicated.
Con, control. +, presence of substance. , absence of substance.
|
|
Wild-type (wt) Bif but not mutated BifF995A can rescue
the eye phenotypes of bif null mutants.
Our in vitro
data and sedimentation assays have shown direct binding of Bif with
PP1-87B and indicated that Bif and PP1 are part of a complex in vivo.
To elucidate the functional significance of this interaction in vivo,
both wt bif+ and an F995A mutated form of
bif (bifF995A), which does not bind
PP1 in vitro, were introduced as transgenes in the pUAST vector
(9) under the control of the GAL4-UAS into bif mutant flies. Homozygous and hemizygous deletions of the
X-linked bif gene affect the morphology of the compound eye
in Drosophila (5). Externally, the wt eye is
comprised of ~800 ommatidia arranged in hexagonal shapes with
bristles projecting from alternate ommatidial vertices
(45) (Fig. 6A). In the
bifR47 null allele, which
deletes 3 kb from coding exon 3 of bif (5), adult eyes show bristles that are short, missing, or duplicated (Fig.
6B) and adjacent ommatidia show fusion at a low frequency. Expression
of a wt UAS-bif+ transgene in many of the cells
of the ommatidia, using the pGMR-GAL4 driver (20), rescues
this bif mutant phenotype (Fig. 6C); in contrast, expression
of the UAS-bifF995A in a bif null
mutant could not effect this rescue (Fig. 6D). In these experiments the
levels of the mutant and wt transgene expression are similar (compare
Fig. 6I and J).


View larger version (245K):
[in this window]
[in a new window]
|
FIG. 6.
Rescue of the adult eye phenotypes of bif
mutants. (A to D) Scanning micrographs of adult eyes show the
organization of ommatidia and bristles. (A) Region of a wt eye with its
normal ommatidial and bristle organization. (B) Homozygous mutant
bifR47 eye showing loss and multiplication of
bristle phenotypes. (C) Rescue of the bif bristle phenotype
when expression of a bif+ transgene is driven by
the pGMR-GAL4 driver in bifR47 mutant animals.
The expression of the bif+ transgene restored
the number of bristles in the mutant to near-wt levels. (D) Ectopic
expression of the F995A mutant form of bif under control of
the pGMR-GAL4 driver in the mutant flies. The
bifF995A mutant form of bif fails to
significantly rescue any of the bif bristle phenotypes; note
that although the ommatidial fusion phenotype is not seen in this
panel, it is still present at the same frequency as in the mutant. (E
to H) Electron micrographs of sections of adult eyes. A representative
ommatidium is shown in each panel. (E) Rhabdomeres of a wt ommatidium
with their normal roundness and ordered organization. (F) Mutant
ommatidium from homozygous bifR47 allele. Note
that essentially all bif mutant rhabdomeres have abnormal
shapes and that mutant ommatidia essentially all show irregular
patterns in the spatial organization of their rhabdomeres. (G) Rescue
of the bif mutant rhabdomere phenotype by expression of a
UAS-bif+ transgene with the pGMR-GAL4 driver;
the spatial organization of the mutant rhabdomeres within each mutant
ommatidium reverts to a near-wt pattern (in 29 of 30 ommatidia the
trapezoidal pattern of rhabdomeres is partially restored); in terms of
rhabdomere shape, only 20% of the rhabdomeres have obviously abnormal
shapes (n = 210). (H) Expression of the
bifF995A mutant form fails to rescue the
bif rhabdomere phenotypes (n = 210). Of the
rhabdomeres, 100% show defective shapes (n = 210),
while 97% of the ommatidia show defects in the pattern of their
rhabdomeres' spatial organization (n = 30). (I and J)
Expression of bif+ and
bifF995A transgenes driven by the pGMR-GAL4
driver in a bifR47 background. The panels show
regions of eye discs from wandering third-instar larvae, stained with
anti-Bif antibody (green) at the plane of some of the photoreceptor
preclusters. As can be seen, both transgenes express Bif protein of
similar levels. In this plane of section, Bif is expressed only in the
cells that also show Bif expression in the wt; Bif expression in other
regions, like the cone cells, is not shown in this figure.
|
|
Internally, the wt ommatidia contain eight photoreceptor cells (R1 to
R8), each of which projects into the center a light-gathering
organelle
called the rhabdomere. Rhabdomeres are round. The rhabdomeres
for R1 to
R7 are organized in an asymmetric trapezoidal pattern,
with the R7
rhabdomere located at the center; the R8 rhabdomere
lies under the R7
rhabdomere and is not visible at this plane
of section
(
45) (Fig.
6E). In
bif null mutants, the
majority
of rhabdomeres are elliptical; in addition, the trapezoidal
organization
is also disrupted (Fig.
6F). These defects could be
partially
rescued by pGMR-GAL4-driven expression of
UAS-bif+ (Fig.
6G), but pGMR-GAL4-mediated
expression of
UAS-bifF995A cannot rescue these
defects (Fig.
6H).
At the subcellular level,
bif mutations affect F-actin
localization, causing an abnormal pattern of F-actin distribution
(
5).
In wt ommatidia from 55-h pupal eye imaginal discs,
F-actin is
localized in a starlike pattern at the center of each
ommatidium,
with intense localization at the microvillar tips of the
rhabdomeres
facing the central space (
31) (Fig.
7A). In
bif null ommatidia
of
the same stage, the starlike pattern of F-actin becomes abnormal,
with
an elongated and fused central region and decreased spacing
in the
center of the eye (Fig.
7B). The pGMR-GAL4-mediated expression
of
UAS-bif+ can rescue this defect, whereas
expression of
UAS-bifF995A cannot (Fig.
7C and
D).

View larger version (103K):
[in this window]
[in a new window]
|
FIG. 7.
Rescue of the abnormal F-actin localization pattern of
bif pupal eye discs. (A to D) Each panel shows two ommatidia
from a 55-h pupal eye disc stained with tetramethyl rhodamine
isothiocyanate-labeled phalloidin. (A) A wt F-actin staining pattern
reveals the organization of rhabdomeres in the center of the eye. (B) A
homozygous bifR47 mutant shows disorganized
F-actin staining and merged rhabdomeres in the center of the eye, which
is seen at a frequency of 92% in the 100 ommatidia scored in pupae.
(C) Rescue of the bif pupal eye disc phenotype by
pGMR-driven expression of a bif+ transgene. The
expression of the wt UAS-bif transgene caused the defective
F-actin staining to revert to near-wt patterns, with only 16% of the
ommatidia retaining the mutant phenotype (n = 100). (D)
Expression of the bifF995A mediated by the
pGMR-GAL4 driver fails to rescue the defective F-actin distribution
pattern associated with bifR47 allele, as 86%
of the ommatidia scored retain the mutant phenotype (n = 100).
|
|
That the rescue of the various
bif mutant phenotypes by
expression of
UAS-bif+ driven by pGMR-GAL4 is
not always complete could be attributed
to several reasons. There are
several alternatively spliced transcripts
produced by the
bif locus and more than one isoform could be required
to
show complete rescue; it could also be due to differences between
wt
and pGMR-GAL4-driven levels and/or patterns of protein expression
in
the eye. Overall the levels of phenotypic rescue seen with
the
wt
bif transgene are high, whereas the
bifF995A mutant transgene, which encodes a
protein that cannot bind PP1
in vitro shows no obvious rescue (see
legends for Fig.
6 and
7).
Therefore, the in vivo results are
consistent with the in vitro
data and demonstrate that an intact in
vitro PP1-binding site
in Bif is essential for its function in
vivo.
 |
DISCUSSION |
We have identified the D. melanogaster protein Bif as a
PP1-binding protein using the yeast two-hybrid system. Although human PP1
1 was used to perform the screen, the high degree of
sequence identity between mammalian PP1c and D. melanogaster
PP1c should allow identification of true positives. Supporting this
view are previous studies using the same approach, which identified
D. melanogaster I-2 and a related testis-specific protein,
I-t, as PP1-binding proteins (22, 25). The interaction of
Bif with PP1 is likely to reflect an in vivo interaction for the
following reasons. We have shown that the carboxy-terminal 474 amino
acids of Bif identified in the two-hybrid screen interact with both mammalian PP1
1 and D. melanogaster PP1-87B in
vitro, as judged by several different techniques. This portion of Bif
contains a consensus PP1-binding site, RVQF, and mutation of F995
within this motif blocks interaction with both mammalian PP1c and
D. melanogaster PP1c in vitro. The analogous F residue in
the PP1 consensus binding site of other regulatory subunits has been
shown to make important hydrophobic contacts with PP1c that are
essential for binding (18). Immunoprecipitation of
endogenous Bif from adult and embryonic D. melanogaster
extracts coprecipitates PP1c, as judged by both immunoblotting and
protein phosphatase assays. In addition, interaction of PP1c with
bacterially expressed and endogenous Bif can be efficiently disrupted
by a synthetic peptide that is known to disrupt interaction of other
PP1-binding proteins with PP1c (18, 22, 23, 29).
A role for bif in the development of the eye was previously
described through the isolation and examination of mutations of the
bif locus (5). Null bif mutants
exhibited a rough eye phenotype at the morphological level,
disorganized rhabdomeres in the ommatidia at the cellular level, and
alterations in the actin cytoskeleton at the subcellular level. In
order to see whether the binding of PP1 to Bif was important for its
function, we decided to compare the effects of transforming a
bif null mutant line with wt Bif and Bif mutated in the
PP1-binding site at F995. Expression of wt bif transgenes
resulted in significant rescue of the rough eye defects, rhabdomeral
organization, and actin cytoskeleton abnormalities. The reason why
rescue is not always complete may be that the level of Bif expression
differs from the wt level; similarly, we cannot rule out the
possibility that the transgenes used for transformation do not contain
sites that would allow alternative splicing and the production of
transcripts that encode distinct Bif proteins. Nevertheless, clear
restoration towards the wt morphology for all of the phenotypes
associated with bif loss of function is seen when the wt
transgene is expressed in bif mutants. In contrast,
expression of transgenes encoding the Bif F995A mutant protein, which
disrupts binding to PP1, was unable to rescue any aspects of the mutant
phenotype, even though the expression level of the transcript was
similar to that in the wt rescue. These results indicate that the
PP1-Bif interaction is critical for the rescue (and therefore
function). Although it is possible that the F995A mutant causes a
conformational change in Bif, this is unlikely because some weak
binding of BifF995A to PP1 is observed, consistent with residues
surrounding the PP1-binding motif still being in the correct
orientation to contribute their normal interactions. The latter in the
presence of F995 are likely to account for the very tight binding of wt
Bif to PP1 that is observed.
The studies presented here indicate that the normal morphology of the
adult eye is dependent on the interaction of Bif with PP1 and suggest
that a major function of Bif is to target PP1c to a specific
subcellular location to regulate the normal developmental pattern of
the eye. At the molecular level, the organization of the actin
cytoskeleton is dependent on the Bif-PP1 interaction, suggesting that
PP1 may influence actin movement or operate in a pathway that regulates
actin distribution within the cell. Although the actin cytoskeleton is
a highly ordered structure, it is very dynamic, undergoing changes that
affect cell shape, motility, and adhesion. Bif does not possess a known
actin-binding motif, but its subcellular location within the eye is
consistent with its playing a role in actin function and possibly
binding to some component of the actin cytoskeleton (5).
Recently two novel actin-binding proteins found in mammalian neurons,
neurabin I and II, have been shown to bind PP1c (1, 32, 33,
37). Neurabin I was highly concentrated at the synapse of
developed neurons and in the lamellopodia of the growth cone during the development of neurons, suggesting that it is required in synapse function and formation (34). Suppression of endogenous
neurabin I expression with antisense oligonucleotides in hippocampal
neurons inhibited neurite outgrowth. Neurabin II is ubiquitously
expressed but is enriched in the postsynaptic density fraction of the
brain (37). The presence of a PDZ domain that might bind
to a transmembrane protein and their localization make it likely that
neurabins I and II bind at the plasma membrane. The neurabins have
therefore been suggested to serve as linkers between the actin
cytoskeleton and the plasma membrane at cadherin-based cell-cell
adhesion sites (37) and to localize PP1c to the plasma
membrane in dendritic spines of neurons, where the complexes may
modulate synaptic transmission (1). Both neurabins I and
II show F-actin cross-linking activity, as do the
-actinin-spectrin
family of actin-binding proteins. However, the actin-binding sites on
the neurabins are distinct from other known actin-binding sites. Bif
does not appear to be a Drosophila homologue of the
mammalian neurabins, because it has no sequence similarity to these
proteins and its tissue localization is distinct, In addition, there is
a gene (CG16757) located at 62E6-8 in the Drosophila genome
that encodes a putative neurabin homologue. However, the Bif-PP1c
complex may serve functions in the photoreceptor cells of the eye
analogous to those of the neurabin-PP1c complexes in other tissues,
transmitting or modulating signals, possibly from cell-cell contacts,
which cause a rearrangement of the actin cytoskeleton. This suggests
that PP1c may play a general role in modulating the actin cytoskeleton.
We have shown that Bif inhibits the phosphorylase phosphatase activity
of PP1c, similarly to a number of other PP1c-binding proteins, such as
the myosin binding subunits (27) and 53BP2 (21). Neurabins I and II also inhibit the phosphorylase
phosphatase activity of PP1c (1, 32, 33). Neurabin I has
been shown to be phosphorylated in vitro by protein kinase A (PKA),
which decreases its binding to PP1c (33). In addition,
mutation of the phosphorylatable serine to glutamic acid reduces the
inhibitory activity of neurabin, suggesting that the complex
participates in a cyclic AMP-PKA signaling mechanism. Bif has several
potential Ser/Thr phosphorylation sites; in the vicinity of the
PP1-binding motif, the carboxy-terminal sequence of Bif, RRSSTIM, could
serve as a potential phosphorylation site for PKA (as well as for a number of other kinases). Phosphorylation of Bif could affect PP1c
binding and/or activity, allowing the Bif-PP1c complex to modulate
signaling processes. Alternately or in addition, the Bif-PP1c
complex might be required to dephosphorylate proteins associated
with actin. Actin-binding proteins can bind to actin monomers,
cross-link actin filaments into bundles or gels, sever actin
filaments, or cap their growing ends. Some, such as myosin II
(39) and cofilin (30), are known to undergo
phosphorylation. Dephosphorylation of such proteins, possibly by PP1c
complexes, may effect a redistribution of the actin cytoskeleton.
 |
ACKNOWLEDGMENTS |
We thank Heinrich Horstmann and Ng Chee Peng for assistance with
electron microscopy and Steve Elledge for the yeast two-hybrid system.
The work was supported by the Medical Research Council, London, United
Kingdom, and the Institute of Molecular and Cell Biology, Singapore.
N. R. Helps and K. Babu made equally important contributions to this
study. N. R. Helps performed the two-hybrid screen and analyzed the
PP1-Bif interaction. K. Babu produced and examined the bif
transgenic flies.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: MRC Protein
Phosphorylation Unit, Department of Biochemistry, MSI/WTB Complex,
University of Dundee, Dow St., Dundee DD1 5EH, Scotland, United
Kingdom. Phone: 44 1382 344240. Fax: 44 1382 223778. E-mail:
p.t.w.cohen{at}dundee.ac.uk.
 |
REFERENCES |
| 1.
|
Allen, P. B.,
Y.-G. Kwon,
A. C. Nairn, and P. Greengard.
1998.
Isolation and characterization of PNUTS, a putative protein phosphatase 1 nuclear targeting subunit.
Proc. Natl. Acad. Sci. USA
273:4089-4095.
|
| 2.
|
Alphey, L.,
L. Parker,
G. Hawcroft,
Y. Guo,
K. Kaiser, and G. Morgan.
1997.
KLP38B: a mitotic kinesin-related protein that binds PP1.
J. Cell Biol.
138:395-409[Abstract/Free Full Text].
|
| 3.
|
Arikawa, K.,
J. L. Hicks, and D. S. Williams.
1990.
Identification of actin filaments in the rhadhnomeral microvilli of Drosophila photoreceptors.
J. Cell Biol.
110:1993-1998[Abstract/Free Full Text].
|
| 4.
|
Axton, J. M.,
V. Dombrádi,
P. T. W. Cohen, and D. M. Glover.
1990.
One of the protein phosphatase 1 isoenzymes in Drosophila is essential for mitosis.
Cell
63:33-46[CrossRef][Medline].
|
| 5.
|
Bahri, S. M.,
X. Yang, and W. Chia.
1997.
The Drosophila bifocal gene encodes a novel protein which colocalizes with actin and is necessary for photoreceptor morphogenesis.
Mol. Cell. Biol.
17:5521-5529[Abstract].
|
| 6.
|
Baksa, K.,
H. Morawietz,
V. Dombrádi,
J. M. Axton,
H. Taubert,
G. Szabó,
I. Török,
A. Udvardy,
H. Gyurlovics,
B. Szöör,
D. M. Glover,
G. Reuter, and J. Gausz.
1993.
Mutations in the protein phosphatase 1 gene at 87B can differentially affect suppression of position-effect variegation and mitosis in Drosophila melanogaster.
Genetics
135:117-125[Abstract].
|
| 7.
|
Bennett, D.,
B. Szöör, and L. Alphey.
1999.
The chaperone-like properties of mammalian inhibitor-2 conserved in a Drosophila homologue.
Biochemistry
38:16276-16282[CrossRef][Medline].
|
| 8.
|
Bollen, M., and W. Stalmans.
1992.
The structure, role and regulation of type I protein phosphatases.
Crit. Rev. Biochem. Mol. Biol.
27:227-281[Medline].
|
| 9.
|
Brand, A. H., and N. Perrimon.
1993.
Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.
Development
118:401-415[Abstract].
|
| 10.
|
Cagan, R. L., and D. F. Ready.
1989.
The emergence of order in the Drosophila pupal retina.
Dev. Biol.
136:346-362[CrossRef][Medline].
|
| 11.
|
Cohen, P.
1989.
The structure and regulation of protein phosphatases.
Annu. Rev. Biochem.
58:453-508[CrossRef][Medline].
|
| 12.
|
Cohen, P.,
S. Alemany,
B. A. Hemmings,
T. J. Resink,
P. Stralfors, and H. Y. L. Tung.
1988.
Protein phosphatase-1 and protein phosphatase-2A from rabbit skeletal muscle.
Methods Enzymol.
159:390-408[Medline].
|
| 13.
|
Dombrádi, V.,
J. M. Axton,
H. M. Barker, and P. T. W. Cohen.
1990.
Protein phosphatase 1 activity in Drosophila mutants with abnormalities in mitosis and chromosome condensation.
FEBS Lett.
275:39-43[CrossRef][Medline].
|
| 14.
|
Dombr i, V.,
J. M. Axton,
N. D. Brewis,
E. F. da Cruz e Silva,
L. Alphey, and P. T. W. Cohen.
1990.
Drosophila contains three genes that encode distinct isoforms of protein phosphatase 1.
Eur. J. Biochem.
194:739-745[Medline].
|
| 15.
|
Dombrádi, V., and P. T. W. Cohen.
1992.
Protein phosphorylation is involved in the regulation of chromatin condensation during interphase.
FEBS Lett.
312:21-26[CrossRef][Medline].
|
| 16.
|
Dombrádi, V.,
D. J. Mann,
R. D. C. Saunders, and P. T. W. Cohen.
1993.
Cloning of the fourth functional gene for protein phosphatase 1 in Drosophila melanogaster from its chromosomal localisation.
Eur. J. Biochem.
212:177-183[Medline].
|
| 17.
|
Durfee, T.,
K. Becherer,
P.-L. Chen,
S.-H. Yeh,
Y. Yang,
A. E. Kilburn,
W.-H. Lee, and S. J. Elledge.
1993.
The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit.
Genes Dev.
7:555-569[Abstract/Free Full Text].
|
| 18.
|
Egloff, M.-P.,
F. Johnson,
G. Moorhead,
P. T. W. Cohen,
P. Cohen, and D. Barford.
1997.
Structural basis for the recognition of regulatory subunits by the catalytic subunit of protein phosphatase 1.
EMBO J.
16:1876-1887[CrossRef][Medline].
|
| 19.
|
Harlow, E., and D. Lane.
1988.
Antibodies: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 20.
|
Hay, B. A.,
T. Wolff, and G. M. Rubin.
1994.
Expression of baculovirus P35 prevents cell death in Drosophila.
Development
120:2121-2129[Abstract].
|
| 21.
|
Helps, N. R.,
H. M. Barker,
S. J. Elledge, and P. T. W. Cohen.
1995.
Protein phosphatase 1 interacts with p53BP2, a protein which binds to the tumour suppressor p53.
FEBS Lett.
377:295-300[CrossRef][Medline].
|
| 22.
|
Helps, N. R., and P. T. W. Cohen.
1999.
Drosophila melanogaster protein phosphatase inhibitor-2: identification of a site important for PP1 inhibition.
FEBS Lett.
463:72-76[CrossRef][Medline].
|
| 23.
|
Helps, N. R.,
X. Luo,
H. M. Barker, and P. T. W. Cohen.
2000.
NIMA related kinase 2 (Nek2), a cell cycle-regulated protein kinase localized to centrosomes, is complexed to protein phosphatase 1.
Biochem. J.
349:509-518[CrossRef][Medline].
|
| 24.
|
Helps, N. R.,
A. J. Street,
S. J. Elledge, and P. T. W. Cohen.
1994.
Cloning of the complete coding region for human protein phosphatase inhibitor 2 using the two hybrid system and expression of inhibitor 2 in E. coli.
FEBS Lett.
340:93-98[CrossRef][Medline].
|
| 25.
|
Helps, N. R.,
C. Vergidou,
T. Gaskell, and P. T. W. Cohen.
1998.
Characterisation of a novel Drosophila melanogaster testis specific PP1 inhibitor related to mammalian inhibitor-2: identification of the site of interaction with PP1.
FEBS Lett.
438:131-136[CrossRef][Medline].
|
| 26.
|
Hubbard, M. J., and P. Cohen.
1993.
On target with a new mechanism for the regulation of protein phosphorylation.
Trends Biochem. Sci.
18:172-177[CrossRef][Medline].
|
| 27.
|
Johnson, D. F.,
G. Moorhead,
F. B. Caudwell,
P. Cohen,
Y. H. Chen,
M. X. Chen, and P. T. W. Cohen.
1996.
Identification of the protein phosphatase-1-binding domains on the glycogen and myofibrillar targetting subunits.
Eur. J. Biochem.
239:317-325[Medline].
|
| 28.
|
Kimmel, B. E.,
U. Heberlein, and G. M. Rubin.
1994.
The homeo domain protein rough is expressed in a subset of cells in the developing Drosophila eye where it can specify photoreceptor cell subtype.
Genes Dev.
4:712-727[Abstract/Free Full Text].
|
| 29.
|
Kreivi, J.-P.,
L. Trinkle-Mulcahy,
C. E. Lyon,
N. A. Morrice,
P. Cohen, and A. I. Lamond.
1997.
Purification and characterisation of p99, a nuclear modulator of protein phosphatase 1 activity.
FEBS Lett.
420:57-62[CrossRef][Medline].
|
| 30.
|
Lawler, S.
1999.
Regulation of actin dynamics: the LIM kinase connection.
Curr. Biol.
9:R800-R802[CrossRef][Medline].
|
| 31.
|
Longley, R. L. J., and D. F. Ready.
1995.
Integrins and the development of three-dimensional structure of the Drosophila compound eye.
Dev. Biol.
171:19.
|
| 32.
|
MacMillan, L. B.,
M. A. Bass,
N. Cheng,
E. F. Howard,
M. Tamura,
S. Strack,
B. E. Wadzinski, and R. J. Colbran.
1999.
Brain actin-associated protein phosphatase 1 holoenzymes containing spinophilin, neurabin and selected catalytic subunit isoforms.
J. Biol. Chem.
274:35845-35854[Abstract/Free Full Text].
|
| 33.
|
McAvoy, T.,
P. B. Allen,
H. Obaishi,
H. Nakanishi,
Y. Takai,
P. Greengard,
A. C. Nairn, and H. C. Hemmings.
1999.
Regulation of neurabin I interaction with protein phosphatase 1 by phosphorylation.
Biochemistry
38:12943-12949[CrossRef][Medline].
|
| 34.
|
Nakanishi, H.,
H. Obaishi,
A. Satoh,
M. Wada,
K. Mandai,
K. Satoh,
H. Nishioka,
Y. Matsuura,
A. Mizoguchi, and Y. Takai.
1997.
Neurabin: a novel neural tissue-specific actin filament-binding protein involved in neurite formation.
J. Cell Biol.
139:951-961[Abstract/Free Full Text].
|
| 35.
|
Raghavan, S.,
I. Williams,
H. Aslam,
D. Thomas,
G. Morgan,
J. Turner,
J. Fernandes,
K. Vijayraghavan, and L. Alphey.
2000.
Protein phosphatase 1 is required for the maintenance of muscle attachments.
Curr. Biol.
10:269-272[CrossRef][Medline].
|
| 36.
|
Ready, D. F.,
T. E. Hanson, and S. Benzer.
1976.
Development of the Drosophila retina, a neurocrystalline lattice.
Dev. Biol.
53:217-240[CrossRef][Medline].
|
| 37.
|
Satoh, A.,
H. Nakanishi,
H. Obaishi,
M. Wada,
K. Takashashi,
K. Satosh,
K. Hiron,
H. Nishioka,
Y. Hata,
A. Mizoguchi, and Y. Takai.
1998.
Neurabin-II/spinophilin. An actin filament-binding protein with one PDZ domain localized at cadherin-based cell-cell adhesion sites.
J. Biol. Chem.
273:3470-3475[Abstract/Free Full Text].
|
| 38.
|
Shenolikar, S.
1994.
Protein serine/threonine phosphatases new avenues for cell regulation.
Annu. Rev. Cell Biol.
10:55-86[CrossRef].
|
| 39.
|
Tan, J., L.,
S. Ravid, and J. A. Spudich.
1992.
Control of non-muscle myosins by phosphorylation.
Annu. Rev. Biochem.
61:721-759[CrossRef][Medline].
|
| 40.
|
Tanaka, J.,
M. Ito,
J. Feng,
K. Ichikawa,
T. Hamaguchi,
M. Nakamura,
D. J. Hartshorne, and T. Nakano.
1998.
Interaction of myosin phosphatase target subunit 1 with the catalytic subunit of type 1 protein phosphatase.
Biochemistry
37:16697-16703[CrossRef][Medline].
|
| 41.
|
Tomlinson, A., and D. F. Ready.
1987.
Neuronal differentiation in the Drosophila ommatidium.
Dev. Biol.
120:366-376[CrossRef][Medline].
|
| 42.
|
Trinkle-Mulcahy, L.,
P. Ajuh,
A. Prescott,
F. Claverie-Martin,
S. Cohen,
A. I. Lamond, and P. Cohen.
1999.
Nuclear organisation of NIPP1, a regulatory subunit of protein phosphatase 1 that associates with pre-mRNA splicing factors.
J. Cell Sci.
112:157-168[Abstract].
|
| 43.
|
Wera, S., and B. A. Hemmings.
1995.
Serine/threonine protein phosphatases.
Biochem. J.
311:17-29.
|
| 44.
|
Westphal, R. S.,
S. J. Tavalin,
J. W. Lin,
N. M. Alto,
I. D. C. Fraser,
L. K. Langeberg,
M. Sheng, and J. D. Scott.
1999.
Regulation of NMDA receptors by an associated phosphatase-kinase signaling complex.
Science
285:93-96[Abstract/Free Full Text].
|
| 45.
|
Wolff, T., and D. F. Ready.
1993.
Pattern formation in Drosophila retina, p. 1277-1325.
In
M. Bate, and A. Martinez-Arias (ed.), The development of Drosophila melanogaster, vol. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 46.
|
Wolff, T., and D. F. Ready.
1991.
The beginning of pattern formation in the Drosophila compound eye: the morphogenetic furrow and the second mitotic wave.
Development
113:841-850[Abstract].
|
| 47.
|
Zhao, S., and E. Y. C. Lee.
1997.
A protein phosphatase-1-binding motif identified by the panning of a random peptide display library.
J. Biol. Chem.
272:28368-28372[Abstract/Free Full Text].
|
Molecular and Cellular Biology, March 2001, p. 2154-2164, Vol. 21, No. 6
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.6.2154-2164.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tan, S., Lyulcheva, E., Dean, J., Bennett, D.
(2008). Mars promotes dTACC dephosphorylation on mitotic spindles to ensure spindle stability. JCB
182: 27-33
[Abstract]
[Full Text]
-
Babu, K., Cai, Y., Bahri, S., Yang, X., Chia, W.
(2004). Roles of Bifocal, Homer, and F-actin in anchoring Oskar to the posterior cortex of Drosophila oocytes. Genes Dev.
18: 138-143
[Abstract]
[Full Text]
-
CEULEMANS, H., BOLLEN, M.
(2004). Functional Diversity of Protein Phosphatase-1, a Cellular Economizer and Reset Button. Physiol. Rev.
84: 1-39
[Abstract]
[Full Text]
-
Cohen, P. T. W.
(2002). Protein phosphatase 1 - targeted in many directions. J. Cell Sci.
115: 241-256
[Abstract]
[Full Text]