Previous Article | Next Article 
Molecular and Cellular Biology, April 2001, p. 2349-2358, Vol. 21, No. 7
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.7.2349-2358.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Novel Function of Rad27 (FEN-1) in
Restricting Short-Sequence Recombination
M. Cristina
Negritto,1
Junzhuan
Qiu,2
Dawn O.
Ratay,1
Binghui
Shen,2 and
Adam M.
Bailis1,*
Department of Molecular Biology, Beckman
Research Institute,1 and Department
of Cell and Tumor Biology, City of Hope National Medical
Center,2 Duarte, California 91010-0269
Received 1 December 2000/Returned for modification 6 January
2001/Accepted 15 January 2001
 |
ABSTRACT |
Saccharomyces cerevisiae mutants lacking the
structure-specific nuclease Rad27 display an enhancement in
recombination that increases as sequence length decreases, suggesting
that Rad27 preferentially restricts recombination between short
sequences. Since wild-type alleles of both RAD27 and its
human homologue FEN1 complement the elevated short-sequence
recombination (SSR) phenotype of a rad27-null mutant, this
function may be conserved from yeast to humans. Furthermore, mutant
Rad27 and FEN-1 enzymes with partial flap endonuclease activity but
without nick-specific exonuclease activity partially complement the SSR
phenotype of the rad27-null mutant. This suggests that the
endonuclease activity of Rad27 (FEN-1) plays a role in limiting
recombination between short sequences in eukaryotic cells.
 |
INTRODUCTION |
Dispersed, short (less than 300 bp),
repetitive DNA sequences are a dominant feature of all eukaryotic
genomes (8). Recombination between these sequences creates
a variety of genome rearrangements (45, 61) and can cause
disease in humans (12). Discouraging recombination between
short sequences enhances genome stability by reducing the incidence of
these rearrangements.
In Saccharomyces cerevisiae and mammalian cells, short
repeats recombine less frequently per unit length than longer sequences (25, 46, 57), while sequences below 30 bp recombine
extremely poorly (35). Recent discoveries suggest a
genetic basis for the limitation of short-sequence recombination (SSR)
in yeast. Novel mutations in the RAD3, SSL1, and
SSL2 genes, which encode components of the nucleotide
excision repair (NER) apparatus and transcription factor TFIIH
(14, 69), disrupt the control of SSR and increase genome
rearrangement (2, 3, 29, 34). Genome instability may be
due to slow removal of sequences at the ends of broken DNA molecules by
an unidentified nuclease or nucleases. The persistence of these
sequences increases the likelihood that they will recombine with other
sequences in the genome. Interestingly, these factors also influence
Ty1 retrotransposition, which gives rise to distinct genome
rearrangements (28, 29).
A search for nucleases that affect SSR led us to examine the effects of
null alleles of several structurally related nuclease genes in yeast.
Previously, it was shown that Rad2, a NER endonuclease (13,
20), does not play a role in SSR (2). Similarly, in this report we describe evidence that Exo1, a 5'-3' double-stranded exonuclease that plays a role in homologous recombination, mismatch repair, and the repair of UV-damaged DNA (16, 41, 54, 63, 66), and Din7, a mitochondrial protein that affects
mitochondrial DNA stability (15), do not significantly
affect SSR.
Rad27, a fourth, related protein, is a structure-specific endo- and
exonuclease homologous to the human FEN-1 enzyme (5, 21, 31, 42,
51, 55, 71). Yeast cells carrying a null allele of the
RAD27 gene display a broad array of defects in genome stability, including an elevated spontaneous mutation rate
(64), expansion and contraction of micro- and
minisatellite sequences (19, 26, 27, 48, 56), telomeric
repeat fluctuation (40), increased spontaneous
recombination (19, 32, 55, 64, 67), and increased
chromosome breakage (19, 67). These are attributed to a
failure in the removal of RNA residues from the 5' ends of Okazaki
fragments during lagging-strand DNA synthesis (19, 64, 67). Importantly, this biochemical defect also affects the
repair of DNA double-strand breaks (DSBs) by homologous recombination (22).
Interestingly, a variety of genome rearrangements involving very short
(3 to 12 bp) repeats have been observed in rad27-null mutant
cells but not in wild-type cells (10, 64). These
rearrangements could result from aberrant repair of DSBs by homologous
recombination. The lethal effect of blocking homologous recombination
in rad27 mutant cells indicates that DSB repair is critical
for their survival (59, 64).
In this report we show that Rad27 inhibits the insertion of DNA
fragments into the genome, a model for the repair of broken chromosomes
(36, 43). Similar to recombination in the rad3, ssl1, and ssl2 mutants described previously (2,
3, 29, 34), SSR was stimulated severalfold in the
rad27-null mutant, while recombination between long
sequences was unaffected.
Complementation of the elevated SSR phenotype by FEN1
suggests that this function may be conserved from yeast to humans.
Interestingly, mutant alleles of FEN1 and RAD27
that encode proteins with partial endonuclease activity but no
exonuclease activity partially complement the elevated SSR of the
rad27 mutant, indicating that endonuclease activity is
required to limit SSR. Further, we show that Rad27 is required to
insert DNA fragments with nonhomologous sequences at their ends into
genomic sequences by SSR, suggesting that Rad27 plays a role in
processing recombining molecules. These results suggest that Rad27 may
play a role in maintaining genome stability by cleaving and
destabilizing intermediates that are important determinants of the
efficiency of SSR.
 |
MATERIALS AND METHODS |
Yeast strains and plasmids.
Plasmids used in this study were
constructed using established methods (47) and are listed
in Table 1. Plasmids and DNA fragments
were introduced into yeast by electroporation. All yeast strains used
in this study were isogenic with W303-1A (62) and are
listed in Table 2. The
rad5-535 allele was found to have no effect on the
recombination assays performed in this study (unpublished data). Strain
construction and maintenance followed established procedures
(52). The construction of the
rad27::LEU2 allele was described previously
(18). The LEU2 marker in this allele was
replaced (44) with the
hisG::URA3::hisG universal disruptor (1) by transforming the strain IC2-1
(18) with a 4.9-kb XhoI/SalI
leu2::hisG::URA3::hisG
fragment from pLAY266. Ura+ Leu
transformants
were plated on 5-fluoroorotic acid medium (7) to create
the rad27::leu2::hisG allele,
which was confirmed on Southern blots (unpublished data). The
exol::hisG::URA3::hisG allele was constructed by transforming W961-5A (34) with a
4.6-kb XhoI/XbaI
exo1::hisG::URA3::hisG
fragment from pLAY281. The exo1::hisG allele
was obtained by 5-fluoroorotic acid selection and confirmed by Southern
blot (unpublished data). The din7::KAN-MX
allele was constructed by transforming W1011-3B to G418 resistance (200 µg/ml) with a PCR-generated DNA fragment carrying the
KAN-MX gene (68) bordered by DIN7
sequences. The primers
5'-CAATTAAAGAGAATTCAAAAACAGGTG TCCCTGAAAAAATACATGTATCAAACACGTACGCTGCAGGTCGA C-3'
and
5'-CTCCCTCTCCGATAACACGTCCTGCGTATCCACTAGCGGTTGCTCCACTTTCTTATCGATCAATTCGAGCTCG-3' were used to amplify KAN-MX sequences from
pFA6a-kanMX4 (68). To construct the
his3::ura3::LEU2 allele, a
2.0-kb HpaI/SmaI LEU2 clone was
inserted into StuI- and ApaI-digested pLAY144
(2), bisecting the URA3 gene in the
his3::URA3 segment and creating pLAY315. A
3.2-kb HindIII fragment from pLAY315 containing the his3::ura3::LEU2 segment was
used to transform W961-5A to leucine prototrophy. Leu+
His
transformants were confirmed to have replaced the
wild-type HIS3 allele with the
his3::ura3::LEU2 allele by
Southern blotting (unpublished data). The
sam2::his3::TRP1 allele was
generated by transforming W961-5A to tryptophan prototrophy with a
PCR-generated DNA fragment carrying the TRP1 gene flanked by
91 and 36 bp of HIS3 coding sequence bordered on both sides
by 45 bp of the SAM2 coding sequence. The oligonucleotides
5'-GGTCCTCAAGGTGACGCTGGTTTGACCGTAGAAAGATTATTGTCAAGCTTTTAAA ATAGGCCC-3'
and
5'-GGAGAAGGCACCACCACCGACGGATGAGGCACCACCGTAAGCGTCAAGCTTTCAAGAAAATGC-3' were used to amplify the his3::TRP1
sequence from pLAY365. Trp+ transformants were confirmed to
have the sam2::his3::TRP1
allele by Southern blotting (unpublished data).
Cloning and in vitro mutagenesis of RAD27 and
FEN1.
The RAD27 coding sequence was
amplified by PCR from yeast genomic DNA using the oligonucleotides
5'-CCCCGGGCCCGCGGCCGCATGGGTATTAAAGGTTTG-3' and
5'-CCCCGGGCCCGCGGCCGCTCATCTTCTTCCCTTTGT-3'.
These primers include NotI (underlined) sequences for
cloning. The 1.2-kb RAD27 PCR product was digested with
NotI and inserted in place of the FEN1 gene in
pLAY298 to create pLAY327 for expression in yeast. This plasmid puts
RAD27 under the control of the ADH1 promoter and
terminator and possesses a centromere and a TRP1 selectable marker. RAD27 was also amplified using the oligonucleotides
5'-ACAGCACGCGGCCGCCATGGGTATTAAAGGTTTGA-3' and
5'-ACCTAGGAGCGGCCGCTTACTCGAGTCTTCTTCCCTTTGTGACT-3', which include NotI (underlined) and NcoI or
XhoI (in boldface) sequences. NcoI- and
XhoI-digested RAD27 PCR product was cloned into
NcoI- and XhoI-digested pET28b and pBluescript to
create pET-RAD27 for overexpression in Escherichia coli and
pBS-RAD27 for in vitro mutagenesis. pBS-RAD27 was mutagenized using the RAPID PCR site-directed mutagenesis kit (Stratagene, La Jolla, Calif.)
and the oligonucleotides
5'-CCAACGGAAGCTGATGCTCAATGTGC-3' and
5'-GCACATTGAGCATCAGCTTCCGTTGG-3' (substituted
codon in bold). The rad27-E158D mutation was verified by DNA
sequencing. A 1.2-kb NcoI/XhoI
rad27-E158D fragment was cloned into pET28b to make
pET-rad27-E158D and to express Rad27-E158D in E. coli. A
710-bp ClaI/BstXI rad27-E158D fragment
was swapped with wild-type sequences in pLAY327 to make pLAY362 and to
express Rad27-E158D in yeast. Wild-type FEN-1 was overexpressed in
E. coli cells from the plasmid pET-FEN-1 (18).
pET-fen-1-E160D (18) was used for the overexpression
of FEN-1-E160D. Wild-type and mutant FEN1 genes under the
control of the ADH1 promoter and terminator from pDB20-FEN-1
and pDB20-FEN-1-E160D (18) were inserted into pRS414 to
create pLAY298 and pLAY303 and to express the proteins in yeast.
Measurement of flap endonuclease and nick exonuclease activities,
enzyme kinetics, and substrate flap-length effects of wild-type and
mutant proteins.
Protein overexpression and purification from
E. coli extracts were carried out as described previously
(18, 49, 50). Purity of the preparations was assessed on
Coomassie blue-stained sodium dodecyl sulfate-polyacrylamide gradient
gels. 5' flap and nicked double-strand substrates were prepared as
described in Hosfield et al. (23). Flap endonuclease
assays were performed in a volume of 13 µl with 0.5 to 25.0 pmol of
32P-labeled flap substrate, TM buffer (10 mM Tris [pH
8.0], 10 mM MgCl2), and 5 to 40 nmol of wild-type or
mutant enzyme. The substrates for the flap-length dependence assay are
described in Fig. 3. Substrates were synthesized by the DNA synthesis
center of the City of Hope National Medical Center and purified on 15%
acrylamide gels as described by Frank et al. (18).
Seventy-five nanomoles of FEN-1 was used for all of the flap-length
dependence assays. All reactions were incubated at 30°C for 10 min
and then quenched with an equal volume of stop solution (U.S.
Biochemical Corp., Cleveland, Ohio). The products were resolved on
denaturing 15% acrylamide gels and visualized by autoradiography. The
percentage of substrate cleaved was determined using the IPLabGel
program and was converted to substrate concentration cleaved per unit time as described previously (18).
Vmax and Km values were
determined from double-reciprocal plots of product formed versus
substrate concentration (data not shown).
DNA fragment insertion assay.
DNA fragments with different
lengths of HIS3 sequence flanking the URA3 gene
were prepared by restriction endonuclease digestion of pLAY144
(2) or by PCR. Phenol-extracted and gel-purified DNA
fragments were used to transform diploid cells by electroporation, selecting for expression of URA3. Transformation efficiency
differed by less than 3.5-fold in wild-type and rad27 mutant cells.
Recombination between the
his3::
URA3
fragments and several different genomic sequences (Fig.
1) was distinguished by replica
plating
to appropriate drop-out media and confirmed by Southern
blotting DNA
from selected transformants (unpublished data). Recombination
at the
HIS3 allele replaces 60 bp of
HIS3 coding
sequence with
the 1.1-kb
URA3 marker and results in
His

Leu
+ Ura
+ transformants.
Recombination at the
his3::
ura3::
LEU2 allele
replaces
a 2-kb
LEU2 marker with 60 bp of
URA3
coding sequence and results
in His
+ Leu

Ura
+ transformants. Recombination at either of the
ura3-1 alleles
replaces a point mutation in the
URA3 coding sequence by gene
conversion and results in
His
+ Leu
+ Ura
+ transformants. The
fraction of transformants that were due to
gene conversion at the
ura3-1 alleles remained between 50 and
60% in both the wild
type and the
rad27 mutant, regardless of
the DNA fragment
used. However, the ratio of recombination events
at the
HIS3
allele versus the
his3::
ura3::
LEU2 allele varied
significantly
with changes in the length of the
HIS3
sequences on the DNA fragments.
The mean ratio of insertions at
HIS3 versus
his3::
ura3::
LEU2
(H

/L

) for each strain was determined from
at least five trials. Each
trial consisted of a minimum of 400 Ura
+ transformants.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1.
DNA fragment insertion into the genomes of wild-type and
rad27-null mutant cells. (A) DNA fragment insertion assay.
DNA fragments containing a 1.1-kb URA3 clone flanked by
various lengths of HIS3 sequence
(his3::URA3) were electroporated into diploid
yeast cells. The two relevant recombination targets are a wild-type
HIS3 allele at the HIS3 locus on one copy of
chromosome XV and a
his3::ura3::LEU2 allele at the
HIS3 locus on the homologue. Alignment of the
his3::URA3 fragment with the wild-type
HIS3 allele involves only the terminal HIS3
sequences, whereas alignment with the
his3::ura3::LEU2 allele
involves all of the fragment. Insertion of the fragment into the
HIS3 allele by recombination replaces 60 bp of the
HIS3 coding sequence with the 1.1-kb URA3 marker,
resulting in a cell that is His Leu+
Ura+, whereas insertion into the
his3::ura3::LEU2 allele
replaces a 2.0-kb LEU2 marker with 60 bp of URA3
sequence that results in a His+ Leu
Ura+ cell. (B) DNA fragments used in the insertion assay.
The three his3::URA3 DNA fragments used in
the experiments are depicted. The HIS3 sequences at the ends
of the fragments are depicted as shaded boxes with sequence lengths
marked above in base pairs. The URA3 sequence in each
fragment is 1,071 bp long. (C) A plot of the ratio of DNA fragment
insertions of each his3::URA3 fragment into
the HIS3 and
his3::ura3::LEU2 targets in
wild-type and rad27 mutant diploids. The three different
his3::URA3 fragments were separately
electroporated into wild-type (ABX367) and rad27 homozygous
(ABX382) diploids. Ura+ transformants were replica plated
to medium lacking His or Leu to determine which transformants were due
to insertion into the HIS3 or
his3::ura3::LEU2 alleles. The
mean ratios of His Leu+ Ura+ to
His+ Leu Ura+ transformants
(H /L ) obtained with the three DNA fragments
were determined from a minimum of 10 independent trials with each
fragment in each strain. Log10 values of the mean
ratios ± two standard errors were plotted for each of the
fragments.
|
|
The ratios of DNA fragment insertion into the
HIS3 and
his3::
ura3::
LEU2 alleles were
not significantly influenced by the lengths
of DNA being deleted from
or transplaced into the genome during
recombination. Very similar
ratios were obtained when the smallest
his3::
URA3 fragment was inserted into the
HIS3 allele, which requires
deletion of 60 bp (Fig.
1C), as
when it was inserted into the
sam2::
his3::
TRP1 allele (see
Fig.
3B), which requires deletion
of 1.5 kb. We also found that
inserting a 1.5-kb
TRP1 marker into
the
URA3
sequence of the smallest
his3::
URA3 fragment
did not
significantly affect the relative frequencies of recombination
with the
HIS3 and
his3::
ura3::
LEU2 genomic
targets (unpublished
data), indicating that transplacing 60 bp of DNA
into the
his3::
ura3::
LEU2 allele was equivalent to 1.5
kb.
Ectopic recombination between the
ura3-1 alleles at the
URA3 loci and the
his3::
ura3::
LEU2 allele at the
HIS3 locus occured
at a frequency of ~10
7
(
4), which is 10- to 100-fold lower in frequency than
fragment
insertion into the
his3::
ura3::
LEU2 allele and
indicates that
it does not interfere with the assay. Frequencies of
ectopic recombination
between the
leu2-3,112 alleles at the
LEU2 loci and the
his3::
ura3::
LEU2 allele should
occur at a similarly low frequency and should not
interfere with the
assay.
Nonhomologous ends assay.
his3::URA3 fragments with different lengths
of HIS3 sequence were obtained by PCR using pLAY144 as
template. The four primer pairs 5'-AAGCTTTTAAAGAGGCCC-3' and
5'-AAGCTTTCAAGAAAATGC-3', 5'-CTCTCGGTCAAGCTTTTA-3' and 5'-CTAGCCTCTGCAAAGCTT-3',
5'-GCGGGATTGCTCTCGGTC-3' and
5'-GGTAATTCTGCTAGCCTC-3', and 5'-ACTGAAGACTGCGGGATT-3'
and 5'-AACGTGGAGGGTAATTCT-3' were used to generate
his3::URA3 fragments with 91 and 36 bp, 101 and 46 bp, 111 and 56 bp, and 121 and 66 bp of HIS3 sequence
flanking the 1.1-kb URA3 marker, respectively. PCR products
were used to transform haploid wild-type and rad27 mutant
cells by electroporation, selecting for Ura+ recombinants.
As described above, recombination events at the different genomic
targets (see Fig.
3) are distinguishable by replica plating
to
appropriate drop-out media and were confirmed by Southern blot
(unpublished data). Just like the previous assay, recombination
with
the
his3::
ura3::
LEU2 allele at
the
HIS3 locus replaces a
2-kb
LEU2 marker with
60 bp of
URA3 coding sequence and results
in
Trp
+ Leu

Ura
+ transformants.
Recombination with the
sam2::
his3::
TRP1 allele
at the
SAM2 locus replaces 1.5 kb of
TRP1 coding
sequence with
the 1.1-kb
URA3 marker and results in
Trp

Leu
+ Ura
+ transformants. The
fragments can also recombine with the
ura3-1 allele at the
URA3 locus. Fragment recombination at the
URA3
locus
remained between 25 and 30% of the total, regardless of fragment
length or cell type. However, the ratio of insertions at the
sam2::
his3::
TRP1 and
his3::
ura3::
LEU2 targets changed
significantly depending on
the length of the
HIS3 sequences
on the fragment. The mean ratio
of insertions into the
sam2::
his3::
TRP1 and
his3::
ura3::
LEU2 targets
(T

/L

) was determined from at least five
trials. Each trial involved
a minimum of 400 Ura
+ transformants.
 |
RESULTS |
DNA fragment insertion assay.
We used the insertion of DNA
fragments into the genome to study the effect of DNA sequence length on
homologous recombination in wild-type and mutant yeast. This approach
was chosen because DNA fragment length can be readily changed and
because DNA fragment insertion is similar to the repair of broken
chromosomes by homologous recombination (30, 36, 38). In
this assay, homozygous wild-type and rad27 mutant diploids
were transformed with three different DNA fragments consisting of a
URA3 marker flanked by varying lengths of HIS3
sequence. The two relevant genomic targets for the
his3::URA3 fragments were a wild-type
HIS3 allele on one copy of chromosome XV and the
his3::ura3::LEU2 allele on the
other (Fig. 1A). Insertion of a fragment into the HIS3
allele is governed only by the short HIS3 sequences at its
ends, while insertion into the
his3::ura3::LEU2 allele
utilizes its entire length. The length of the terminal HIS3
sequences on the three fragments, and therefore homology to the
HIS3 allele, varies over 3.5-fold (Fig. 1B). However,
overall fragment length and homology to the
his3::ura3::LEU2 allele vary less than 21% (Fig. 1B). Since significant changes in terminal HIS3 sequence length have little effect on overall fragment
length, the three fragments should have a significantly different
propensity to recombine with the HIS3 allele but a similar
propensity to recombine with the
his3::ura3::LEU2 allele.
Therefore, the ratio of DNA fragment insertions into the
HIS3 allele versus the
his3::ura3::LEU2 allele
(H
/L
) indicates how well the cell can use
the terminal HIS3 sequences for recombination.
SSR is increased in rad27 but not exo1 or
din7 mutant cells.
It was previously shown that Rad2
does not play a role in the control of SSR (2). Here we
show that SSR was unaffected by the loss of the structurally similar
proteins Din7 and Exo1, as the H
/L
ratios
obtained with fragment 1 (Fig. 1B), which has the shortest HIS3 ends (127 bp total), were not significantly different
from that of the wild type in exo1- and din7-null
mutant cells (Table 3). In contrast, we
found that the H
/L
ratio in
rad27-null mutant cells was sevenfold higher than that of
the wild type, indicating that Rad27 suppresses recombination between
short sequences (Table 3). However, the stimulation was only threefold
with fragment 2, which has 250 bp of HIS3 sequence, and
nonexistent with fragment 3, which has 448 bp of HIS3
sequence (Fig. 1C). Therefore, in this assay rad27
stimulates recombination between short sequences but not long ones.
The flap endonuclease activities of Rad27 and FEN-1 are implicated
in the control of SSR.
Previous studies have shown that mutating a
conserved glutamate at residue 160 in the active site of human FEN-1
leads to marked changes in DNA binding and/or 5' flap cleavage
(18, 50). Substituting an aspartate for the glutamate
(E160D) has no effect on substrate binding but partially reduces 5'
flap cleavage efficiency (18). Here we show that
FEN-1-E160D and the analogous Rad27 mutant enzyme (E158D) possess
similar partial flap endonuclease activities (Table
4). The Kms of
FEN-1-E160D and Rad27-E158D for the 5' flap substrate were nearly
equivalent to that of the wild type, but the
Vmaxs of FEN-1-E160D and Rad27-E158D were only 59 and 69%, respectively, of that of the wild type. Neither mutant protein possessed any measurable capacity for exonucleolytic cleavage (Table 4). These results demonstrate that the enzymatic functions defined by these assays are separable.
View this table:
[in this window]
[in a new window]
|
TABLE 4.
5'-Flap endonuclease and 5'-nick-specific exonuclease
activities of wild-type and mutant FEN-1 and Rad27 enzymes
|
|
Recently, the human
FEN1 gene was shown to fully complement
the temperature-sensitive growth and methyl methanesulfonate
sensitivity
of the
rad27-null mutant, while the
fen1-E160D allele only partially
complemented it
(
18). These results suggest that the cellular
functions of
these proteins may be conserved and are linked to
flap endonuclease
activity. We tested whether
FEN1 also complements
the SSR
phenotype of the
rad27 mutant by comparing the
H

/L

ratio from
rad27 cells
containing
FEN1 on a plasmid to the wild-type
ratio. We
found that the ratios were not significantly different,
demonstrating
that
FEN1 complements the SSR phenotype of
rad27-null
mutant cells (Table
5). Interestingly, the ratios obtained
with
the
fen1-E160D and
rad27-E158D mutant
alleles were significantly
above those from cells containing wild-type
FEN1 and
RAD27 but
significantly below the ratio
obtained from cells containing an
empty plasmid (Table
5). Since the
intermediate level of complementation
by the
fen1-E160D and
rad27-E158D alleles matches the flap endonuclease
activity
data described above (Table
4) and since the levels
of Rad27 or FEN-1
protein are similar in cells containing either
the wild-type or mutant
alleles (data not shown), we suggest that
the effects of Rad27 and
FEN-1 on SSR are a function of their
flap endonuclease activities but
not their nick exonuclease activities.
In support of these results we
found that exonucleolytic degradation
at DSBs in
rad27 cells
was not significantly different from that
in wild-type cells (data not
shown).
Length dependence of 5' flap cleavage.
Bambara and colleagues
showed that 5' flap cleavage by FEN-1 requires that the flap remain
single stranded until its junction with duplex DNA (37).
This implies that the enzyme must slide unimpeded from the 5' end of
the flap to the junction with duplex DNA. We examined the capacity of
FEN-1 to cleave flaps of various lengths (Fig.
2). The flaps were comprised of different
lengths of oligodeoxythymidine in order to minimize secondary structure formation (11). We found that flap cleavage efficiency
decreased markedly with increasing flap length, from 80% cleavage with
a 20-bp flap to 28% with a 120-bp flap. Given the very similar in vitro activities of FEN-1 and Rad27 (see Fig. 4), we expect that Rad27
would display similar characteristics. As discussed below, the
diminished capacity of FEN-1 and Rad27 to cleave long flaps might in
part explain why losing Rad27 preferentially affects SSR.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of DNA flap length on FEN-1 activity. (A) DNA
substrates. The substrate consists of three DNA strands.
(Tn) indicates the number of T residues
(0, 20, 60, or 100) in the substrate strand. This
corresponds to total flap lengths of 20, 40, 80, and 120 nucleotides.
The asterisk denotes the location of the 32P label. (B)
Plot of flap endonuclease activities with different flap lengths. Five
picomoles of 32P-labeled flap substrate was incubated with
75 nmol of FEN-1, and reaction products were run on analytical gels and
autoradiographed. Substrate and product levels were quantitated by
densitometry and converted to cleavage efficiencies by dividing product
signals by the total of the substrate and product signals and
multiplying by 100. nt, nucleotides.
|
|
Rad27 is required for removal of nonhomologous ends during
SSR.
Previously, Fishman-Lobell and Haber (17) found
that a null mutation in the RAD1 gene blocks recombination
when sequences at the ends of DSBs obscure homology with a
recombination partner. Subsequently, it was shown that Rad1- Rad10 is a
structure-specific endonuclease (58, 65) that can cleave
terminal 3' single strands displaced when adjacent sequences pair with
homologous sequences on another DNA molecule (6). Rad1 may
cleave other intermediates during several different types of
recombination events (2, 60).
Since Rad27 cleaves 5' single strands at the junction with
double-stranded DNA (
31), a second DNA fragment insertion
assay
was designed to test whether it also plays a role in removing
nonhomologous sequences from the ends of DNA molecules undergoing
homologous recombination (Fig.
3A),
perhaps implying a role in
the processing of other recombination
intermediates. Four different
DNA fragments consisting of a
URA3 marker bordered by varying
lengths of
HIS3
sequence were used to transform haploid wild-type
and
rad27-null mutant cells. One recombination target is the
his3::
ura3::
LEU2 allele
described above (Fig.
1A). All of the fragments are homologous
to this
target along their entire length. The other relevant target,
sam2::
his3::
TRP1, consists of
a
TRP1 marker bordered by 36- and
91-bp
HIS3
segments at the
SAM2 locus on chromosome IV. The smallest
his3::
URA3 fragment has the same
HIS3 sequences as the
sam2::
his3::
TRP1 target, while
the other fragments have 10, 20, or 30 bp of additional
HIS3
sequences at both ends. Recombination between the smallest
fragment and
sam2::
his3::
TRP1 is unblocked,
whereas insertion
of the other fragments into this target requires that
10, 20,
or 30 bp of terminal
HIS3 sequences be removed from
both ends.
The different
his3::
URA3 fragments
have the same length of homology
with the
sam2::
his3::
TRP1 target, and
their homology with the
his3::
ura3::
LEU2 target varies
very little (less than 5%). Since
there is little difference in the
lengths of homology shared by
the fragments and the targets, this
should have little effect
on the ratios of fragment insertion into the
two targets (T

/L

). Therefore, changes in
these ratios should indicate how well
the cell can remove any excess
HIS3 sequences from the ends of
a fragment during
recombination with the
sam2::
his3::
TRP1 target
(Fig.
4B).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
Relationship between length of nonhomologous DNA
sequences at ends of substrate DNA fragments and their integration into
genomes of wild-type and rad27-null mutant cells. (A) DNA
fragment insertion assay involving nonhomologous terminal sequences.
DNA fragments comprised of the URA3 gene bordered by various
lengths of HIS3 sequence were introduced into haploid cells
by electroporation. The two relevant recombination targets are the
previously described
his3::ura3::LEU2 allele at the
HIS3 locus on chromosome XV and the
sam2::his3::TRP1 allele at the
SAM2 locus on chromosome IV. All of the sequences on the
fragments can align with the
his3::ura3::LEU2 allele,
whereas only the HIS3 sequences can align with the
sam2::his3::TRP1 allele. All
of the HIS3 sequences on the smallest
his3::URA3 fragment (127 bp) can align with
the HIS3 sequences in the
sam2::his3::TRP1 allele (not
pictured), while the +10, +20, and +30 fragments have an additional 10, 20, or 30 bp of HIS3 sequence at both ends that cannot.
These nonhomologous ends must be removed for insertion into the
sam2::his3::TRP1 allele to
occur. Insertion into the
his3::ura3::LEU2 allele
deletes the 2.0-kb LEU2 sequence, which results in a
Trp+ Leu Ura+ cell, while
insertion into the
sam2::his3::TRP1 allele
deletes the 1.5-kb TRP1 sequence and creates a
Trp Leu+ Ura+ cell. (B) Plot of
the ratio of DNA fragment insertions into the
sam2::his3::TRP1 and
his3::ura3::LEU2 targets
versus length of terminal HIS3 sequence on the fragment that
is not homologous to
sam2::his3::TRP1 in wild-type
and rad27 mutant cells. The four different
his3::URA3 fragments were separately
introduced into wild-type (ABX457-2A) and rad27 mutant
(ABX457-1B) cells by electroporation. Ura+ transformants
were replica plated to media lacking tryptophan or leucine to determine
whether the fragments had inserted into the
sam2::his3::TRP1 allele or the
his3::ura3::LEU2 allele. The
mean ratios of Trp Leu+ Ura+ to
Trp+ Leu Ura+ transformants
(T /L ) obtained with the four DNA fragments
were determined from a minimum of five independent trials.
Log10 values of the mean ratios ± two standard errors
were plotted against the length of the nonhomologous sequences at the
ends of the fragment.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Models of how Rad27 and FEN-1 may limit recombination
between short sequences. (A) Single-strand assimilation. 1. A single
strand of the his3::URA3 fragment is pictured
with HIS3 genomic target sequences. HIS3
sequences are represented by black lines and URA3 sequences
are represented by a gray line. 2. A single strand of the
his3::URA3 fragment invades homologous
genomic sequences, creating a heteroduplex. 3. Short heteroduplexes may
be unwound by a helicase(s). The unannealed 5' single strand is a
substrate for endonucleolytic cleavage by Rad27. 4. Recombination is
aborted. (B) Break-induced repair. 1. A double-stranded
his3::URA3 fragment is pictured with
HIS3 genomic target sequences. HIS3 sequences are
represented by black lines and URA3 sequences are
represented by light gray lines. 2. The ends of the double-stranded
his3::URA3 fragment invade HIS3
genomic sequences, forming four-stranded heteroduplex intermediates. 3. The short heteroduplexes may be unwound by the advancing lagging-strand
polymerase or by a helicase(s), creating unannealed 5' single strands
that are cleaved by Rad27. 4. Recombination is aborted because the
unannealed 5' strands of the DNA fragment have been cleaved away,
leaving the newly synthesized Okazaki fragments unable to ligate onto
the ends of the fragment.
|
|
The results of these assays indicate that Rad27 plays an important role
in the removal of nonhomologous sequences from the
ends of recombining
DNA molecules. Each addition of 10 bp of nonhomologous
sequences onto
the ends of the DNA fragments decreased insertion
into the
sam2::
his3::
TRP1 target
relative to the
his3::
ura3::
LEU2 target
approximately twofold in
rad27 mutant cells (Fig.
3B).
The
nonhomologous sequences had much less of an impact on the
ratio of
insertion into the two targets in wild-type cells, as
the addition of
10 bp of nonhomologous sequences had no effect
and even of 30 bp had
little more than a twofold effect (Fig.
3B). Therefore, the presence of
Rad27 facilitates the removal
of sequences that can otherwise inhibit
recombination. Since the
exonuclease activity of Rad27 appears to
play little, if any,
role in the control of SSR (Table
4; data not
shown), we conclude
that the 5' flap endonuclease of Rad27 can cleave
flaps that form
at the ends of recombining
molecules.
 |
DISCUSSION |
Previous work with several mutants demonstrated a correlation
between increased DSB stability and enhanced frequencies of SSR
(2, 3, 29, 34). This led to the investigation of how null
alleles of several nuclease genes affect SSR. A novel DNA fragment
insertion assay was used to show that the exo1 and din7 alleles have negligible effects on SSR (Table 3), while the rad27 allele confers a significant increase in SSR (Fig.
1). Combined with results previously obtained with a rad2
mutant (34), these data support the conclusion that
RAD27 is the only member of this group of genes that plays a
significant role in the control of SSR.
Our assay for his3::URA3 fragment
insertion into genomic HIS3 sequences does not require that
the recombination events perfectly conserve the homology between
the fragment and genomic sequences. Since rad27 mutants
accumulate mutations that appear to be due to imprecise recombination
(64), we examined the precision of fragment insertion
events in rad27 mutant cells. Analysis of the DNA sequences
of 40 independent insertions of the smallest
his3::URA3 fragment into the HIS3
allele of rad27 cells revealed no alterations of the
HIS3 sequences undergoing recombination (data not shown). In
combination with the observation that no fragment insertion is obtained
in cells lacking Rad52 (G. Manthey and A. Bailis, unpublished
observations), a central factor in homologous recombination (39), we suggest that the loss of Rad27 stimulates precise
recombination between short sequences by a Rad52-dependent mechanism.
The biological functions of FEN-1 and Rad27 may be conserved, since the
expression of human FEN1 in rad27 mutant yeast
cells complements their temperature-sensitive growth, methyl
methanesulfonate sensitivity, and elevated SSR (18) (Table
5). This apparent conservation is both structural and functional, as
changing conserved glutamate residues to aspartates in both proteins
leads to similar changes in enzymatic activity (Table 4). Since the
mutant alleles partially complement the rad27 SSR phenotype
(Table 5), we conclude that the endonuclease activities of Rad27 and
FEN-1 are important for SSR control in yeast and, perhaps, human cells.
While the effect of mutations in genes that encode TFIIH-NER core
proteins on SSR correlates with defects in DSB processing (2, 3, 29, 34), the loss of Rad27 has no impact on the exonucleolytic degradation of DSBs (data not shown). This suggests that Rad27 may
restrict SSR by a mechanism that is different from that of the
TFIIH-NER apparatus. We are currently testing this by epistasis analysis.
We found that Rad27 is needed for efficient SSR when the DNA fragment
has sequences at both ends that are not homologous to the genomic
target (Fig. 3), implying that Rad27 cleaves 5' overhangs that block
SSR. This is similar to the observation by Wu et al. (70)
that 5' overhang removal by Rad27 appears to be important in the
recovery of certain nonhomologous end-joining (NHEJ) products. Both
results imply that basepairing, or heteroduplex formation, precedes
trimming of 5' tails from recombining molecules. Therefore, unlike
recombination between long, homologous sequences, SSR does not seem to
require prior degradation of the 5' ends of DNA molecules (39). Interestingly, nonhomologous sequences at the ends
of DNA fragments that shared hundreds of base pairs of homology with their genomic targets had no effect on fragment insertion in wild-type or rad27 mutant cells (M. Navarro and A. Bailis, unpublished
observations). This implies that nonhomologous 5' tails can be removed
by a Rad27-independent mechanism during recombination between longer
sequences. We speculate that this process may remove RNA primer
residues from the 5' ends of newly synthesized DNA molecules in the
absence of Rad27.
Why is recombination between short sequences, but not long sequences,
increased in the rad27 mutant? Genomic DSB formation is
enhanced in rad27 mutants, which increases the incidence of many recombination events (10, 19, 64). In our assays, an increase in the frequency of DSBs at the genomic targets is just as
likely to increase recombination with the longer DNA fragments as with
the shorter DNA fragments. However, the genome-wide increase in DSBs in
rad27 mutant cells may deplete the factors that normally suppress the insertion of DNA fragments into the genome by SSR. Alternatively, the failure by rad27 cells to remove
nonhomologous sequences from the ends of recombining DNA molecules
(Fig. 4) suggests that Rad27 might restrict recombination at a stage
following the formation of DSBs. For example, following heteroduplex
formation, Rad27 might remove unannealed 5' single strands generated by
an advancing lagging-strand polymerase or helicase unwinding
(33). The TFIIH-NER helicases Rad3 and Ssl2, which play a
role in SSR control (2, 3, 29, 34), and Dna2, a helicase
that works in concert with Rad27 during DNA replication
(9), are potential candidates for this activity. If
unwinding is extensive, Rad27 could remove enough DNA to terminate
recombination as discussed below. Decreasing the length of the
sequences shared by the recombination partners would increase the
likelihood of complete heteroduplex unwinding, 5' flap cleavage (Fig.
2), or both.
Several existing models for DNA fragment insertion into the genome
(30, 36, 39, 43) were used to construct models for how
Rad27 may restrict SSR. The first model (Fig. 4A) is based on the
single-strand assimilation model of Leung et al. (30). Following formation of a heteroduplex between a single strand of the
DNA fragment and genomic sequences, helicase unwinding creates a 5'
flap that includes the selectable marker. Flap cleavage by Rad27 would
terminate recombination because the fragment containing the marker
would not have homology to the genomic target on both sides. An
important caveat limiting the attractiveness of this model is that the
5' flap would exceed 1 kb and be a poor substrate for Rad27 (Fig. 2).
We favor another model (Fig. 4B) based on the break-copy model of
Morrow et al. (36), which is similar to the break-induced
repair model for the repair of genomic DSBs (39).
Following heteroduplex formation between the ends of the DNA fragment
and the genomic target, the ends of the fragment simulate the ends of
broken chromosomes by copying genomic sequences. DNA fragment insertion
is concluded when the replication forks reach the centromere or the end
of the chromosome or by Holliday junction resolution at nicks or gaps.
Recombination could be impeded by unwinding the heteroduplex and
cleaving the resulting 5' flap before an Okazaki fragment can be
ligated onto the 5' strand. This would terminate fragment insertion
unless the lagging-strand polymerase switches from a chromosomal
template to the DNA fragment, which would be unlikely to occur if the
remaining heteroduplex between the 3' strand and the target is also unstable.
Kolodner and colleagues observed genome rearrangements involving very
short repeats in rad27 mutant cells that were not observed in wild-type cells (10, 64). We have observed that
deletions between 100-bp repeats are fourfold more stimulated in
rad27 mutant cells than deletions between 400-bp repeats
(unpublished data). These results suggest that Rad27 plays a role in
limiting recombination between an abundant class of genomic sequences
which could contribute to the etiology of cancer. Previously, it was
suggested that Rad27 limits recombination by limiting DSB formation
(19, 59, 64). In addition, the work described here
suggests that Rad27 and FEN-1 restrict SSR by processing recombination
intermediates. Armed with the evolving understanding of the
relationship between FEN-1 and its substrates at the atomic level
(23, 24), our future studies will continue to focus on the
molecular details of how Rad27 and FEN-1 maintain genome stability.
 |
ACKNOWLEDGMENTS |
This work was supported by U.S. Public Health Service grants
GM57484 to A.M.B. and CA73764 to B.S. and by an APRC suppplemental grant (CA85344) to B.S. and A.M.B. from the National Institutes of
Health, as well as by funds from the Beckman Research Institute of the
City of Hope and the City of Hope National Medical Center.
We thank J. McDonald for yeast strain W1011-3B and D. Garfinkel, J. Wilson, and several anonymous reviewers for comments on the manuscript.
We also thank J. Termini, T. Krontiris, R. J. Lin, J. Haber, D. Gordenin, S. Rosenberg, G. Smith, R. Rothstein, D. Botstein, and the
members of the Bailis and Shen laboratories for stimulating discussions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology, Beckman Institute of the City of Hope, 1450 E. Duarte Rd., Duarte, CA 91010-0269. Phone: (626) 359-8111, ext. 64031. Fax: (626) 301-8271. E-mail: abailis{at}coh.org.
 |
REFERENCES |
| 1.
|
Alani, E.,
L. Cao, and N. Kleckner.
1987.
A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.
Genetics
116:541-545[Abstract/Free Full Text].
|
| 2.
|
Bailis, A. M., and S. Maines.
1996.
Nucleotide excision repair gene function in short-sequence recombination.
J. Bacteriol.
173:2136-2140.
|
| 3.
|
Bailis, A. M.,
S. Maines, and M. C. Negritto.
1995.
The essential helicase gene RAD3 suppresses short-sequence recombination in Saccharomyces cerevisiae.
Mol. Cell. Biol.
15:3998-4008[Abstract].
|
| 4.
|
Bailis, A. M., and R. Rothstein.
1990.
A defect in mismatch repair in Saccharomyces cerevisiae stimulates ectopic recombination between homologous genes by an excision repair dependent process.
Genetics
126:535-547[Abstract].
|
| 5.
|
Bambara, R. A.,
R. S. Murante, and R. A. Henricksen.
1997.
Enzymes and reactions at the eukaryotic DNA replication fork.
J. Biol. Chem.
272:4647-4650[Free Full Text].
|
| 6.
|
Bardwell, A. J.,
L. Bardwell,
A. E. Tomkinson, and E. C. Friedberg.
1994.
Specific cleavage of model recombination and repair intermediates by the yeast Rad1-Rad10 DNA endonuclease.
Science
265:2062-2065.
|
| 7.
|
Boeke, J. D.,
F. LaCroute, and G. R. Fink.
1984.
A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance.
Mol. Gen. Genet.
197:345-346[CrossRef][Medline].
|
| 8.
|
Britten, R. J., and D. E. Kohne.
1968.
Repeated sequences in DNA. Hundreds of thousands of copies of DNA sequences have been incorporated into the genomes of higher organisms.
Science
161:529-540[Free Full Text].
|
| 9.
|
Budd, M. E., and J. L. Campbell.
1997.
A yeast replicative helicase, Dna2 helicase, interacts with yeast FEN-1 nuclease in carrying out its essential function.
Mol. Cell. Biol.
17:2136-2142[Abstract].
|
| 10.
|
Chen, C., and R. D. Kolodner.
1999.
Gross chromosomal rearrangements in Saccharomyces cerevisiae replication and recombination deficient mutants.
Nat. Genet.
23:81-85[Medline].
|
| 11.
|
Cheng, D. M.,
M. M. Dhingra, and R. H. Sarma.
1978.
Spatial configuration of deoxyribotrinucleoside diphosphate in aqueous solution.
Nucleic Acids Res.
5:4399-4416[Abstract/Free Full Text].
|
| 12.
|
Deininger, P. L., and M. A. Batzer.
1999.
Alu repeats and human disease.
Mol. Genet. Metab.
68:183-193.
|
| 13.
|
de Laat, W. L.,
N. G. J. Jaspers, and J. H. J. Hoeijmakers.
1999.
Molecular mechanism of nucleotide excision repair.
Genes Dev.
13:768-785[Free Full Text].
|
| 14.
|
Feaver, W. J.,
J. Q. Svejstrup,
L. Bardwell,
A. J. Bardwell,
S. Buratowski,
K. D. Gulyas,
T. F. Donahue,
E. C. Friedberg, and R. D. Kornberg.
1993.
Dual roles of a multiprotein complex from Saccharomyces cerevisiae in transcription and DNA repair.
Cell
75:1379-1387[CrossRef][Medline].
|
| 15.
|
Fikus, M. U.,
P. A. Mieczkowski,
P. Koprowski,
J. Rytka,
E. Sledziewska-Gojska, and Z. Ciesla.
2000.
The product of the DNA damage-inducible gene of Saccharomyces cerevisiae, DIN7, specifically functions in mitochondria.
Genetics
154:73-81[Abstract/Free Full Text].
|
| 16.
|
Fiorentini, P.,
K. N. Huang,
D. X. Tishkoff,
R. D. Kolodner, and L. S. Symington.
1997.
Exonuclease I of Saccharomyces cerevisiae functions in mitotic recombination in vivo and in vitro.
Mol. Cell. Biol.
17:2764-2773[Abstract].
|
| 17.
|
Fishman-Lobell, J., and J. E. Haber.
1992.
Removal of nonhomologous DNA ends in double-strand break recombination: the role of the yeast ultraviolet repair gene RAD1.
Science
258:480-484[Abstract/Free Full Text].
|
| 18.
|
Frank, G.,
J. Qiu,
M. Somsouk,
Y. Weng,
L. Somsouk,
J. P. Nolan, and B. Shen.
1998.
Partial functional deficiency of E160D flap endonuclease-1 mutant in vitro and in vivo is due to defective cleavage of DNA substrates.
J. Biol. Chem.
273:33064-33072[Abstract/Free Full Text].
|
| 19.
|
Freudenreich, C. H.,
S. M. Kantrow, and V. A. Zakian.
1998.
Expansion and length-dependent fragility of CTG repeats in yeast.
Science
279:853-856[Abstract/Free Full Text].
|
| 20.
|
Habraken, Y.,
P. Sung,
L. Prakash, and S. Prakash.
1993.
Yeast excision repair gene RAD2 encodes a single-stranded DNA endonuclease.
Nature
366:365-368[CrossRef][Medline].
|
| 21.
|
Harrington, J. J., and M. R. Lieber.
1994.
The characterization of a mammalian DNA structure-specific endonuclease.
EMBO J.
13:1235-1246[Medline].
|
| 22.
|
Holmes, A., and J. E. Haber.
1999.
Double-strand break repair requires both leading and lagging strand DNA polymerases.
Cell
96:415-424[CrossRef][Medline].
|
| 23.
|
Hosfield, D. J.,
C. D. Mol,
B. Shen, and J. A. Tainer.
1998.
Structure of the DNA repair and replication endonuclease and exonuclease FEN-1: coupling DNA and PCNA binding to FEN-1 activity.
Cell
95:135-146[CrossRef][Medline].
|
| 24.
|
Hwang, Y. H.,
K. Baek,
H.-Y. Kim, and Y. Cho.
1998.
The crystal structure of flap endonuclease-1 from Methanococcus jannaschii.
Nat. Struct. Biol.
5:707-713[CrossRef][Medline].
|
| 25.
|
Jinks-Robertson, S.,
M. Michelitch, and S. Ramcharan.
1993.
Substrate length requirements for efficient mitotic recombination in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:3937-3950[Abstract/Free Full Text].
|
| 26.
|
Johnson, R. E.,
G. K. Kovvali,
L. Prakash, and S. Prakash.
1998.
Requirement of the yeast Rth1 5' to 3' exonuclease for the stability of simple repetitive DNA.
Science
269:238-239.
|
| 27.
|
Kokoska, R. J.,
L. Stefanovic,
H. T. Tran,
M. A. Resnick,
D. A. Gordenin, and T. Petes.
1998.
Destabilization of yeast micro- and minisatellite DNA sequences by mutations affecting a nuclease involved in Okazaki fragment processing (rad27) and DNA polymerase (pol3-t).
Mol. Cell. Biol.
18:2779-2788[Abstract/Free Full Text].
|
| 28.
|
Lee, B.-S.,
C. P. Lichtenstein,
B. Faiola,
L. A. Rinckel,
W. Wysock,
M. J. Curcio, and D. J. Garfinkel.
1998.
Posttranslational inhibition of Ty1 retrotransposition by nucleotide excision repair/transcription factor TFIIH subunits Ssl2p and Rad3p.
Genetics
148:1743-1761[Abstract/Free Full Text].
|
| 29.
|
Lee, B.-S.,
L. Bi,
D. J. Garfinkel, and A. M. Bailis.
2000.
Nucleotide excision repair/TFIIH helicases Rad3 and Ssl2 inhibit short-sequence recombination and Ty1 retrotransposition by similar mechanisms.
Mol. Cell. Biol.
20:2436-2445[Abstract/Free Full Text].
|
| 30.
|
Leung, K. Y.,
A. Malkova, and J. E. Haber.
1997.
Gene targeting by linear duplex DNA frequently occurs by assimilation of a single strand that is subject to preferential mismatch correction.
Proc. Natl. Acad. Sci. USA
94:6851-6856[Abstract/Free Full Text].
|
| 31.
|
Lieber, M.
1997.
The FEN-1 family of structure-specific nucleases in eukaryotic DNA replication, recombination and repair.
Bioessays
19:233-240[CrossRef][Medline].
|
| 32.
|
Lobachev, K. S.,
J. E. Stenger,
O. G. Kozyreva,
J. Jurka,
D. A. Gordenin, and M. A. Resnick.
2000.
Inverted Alu repeats unstable in yeast are excluded from the human genome.
EMBO J.
19:3822-3830[CrossRef][Medline].
|
| 33.
|
Lovett, S. T., and V. A. Sutera, Jr.
1995.
Suppression of RecJ exonuclease mutant of Escherichia coli by alterations in DNA helicases II (uvrD) and IV (helD).
Genetics
140:27-45[Abstract].
|
| 34.
|
Maines, S.,
M. C. Negritto,
X. Wu,
G. M. Manthey, and A. M. Bailis.
1998.
Novel mutations in the RAD3 and SSL1 genes perturb genome stability by stimulating recombination between short repeats in Saccharomyces cerevisiae.
Genetics
150:963-976[Abstract/Free Full Text].
|
| 35.
|
Manivasakam, P.,
S. C. Weber,
J. McElver, and R. H. Schiestl.
1995.
Micro-homology mediated PCR targeting in Saccharomyces cerevisiae.
Nucleic Acids Res.
23:2799-2800[Free Full Text].
|
| 36.
|
Morrow, D. M.,
C. Connelly, and P. Hieter.
1997.
"Break copy" duplication a model for chromosome fragment formation in Saccharomyces cerevisiae.
Genetics
147:371-382[Abstract].
|
| 37.
|
Murante, R. S.,
L. Rust, and R. A. Bambara.
1995.
Calf 5' to 3' exo/endonuclease must slide from a 5' end of the substrate to perform structure-specific cleavage.
J. Biol. Chem.
270:30377-30383[Abstract/Free Full Text].
|
| 38.
|
Negritto, M. T.,
X. Wu,
T. Kuo,
S. Chu, and A. M. Bailis.
1997.
Influence of DNA sequence identity on efficiency of targeted gene replacement.
Mol. Cell. Biol.
17:278-286[Abstract].
|
| 39.
|
Paques, F., and J. E. Haber.
1999.
Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae.
Microbiol. Mol. Biol. Rev.
63:349-404[Abstract/Free Full Text].
|
| 40.
|
Parenteau, J., and R. J. Wellinger.
1999.
Accumulation of single-stranded DNA and destabilization of telomeric repeats in yeast mutant strains carrying a deletion of RAD27.
Mol. Cell. Biol.
19:4143-4152[Abstract/Free Full Text].
|
| 41.
|
Qiu, J.,
M. X. Guan,
A. M. Bailis, and B. Shen.
1998.
Saccharomyces cerevisiae exonuclease-1 plays a role in UV resistance that is distinct from nucleotide excision repair.
Nucleic Acids Res.
26:3077-3083[Abstract/Free Full Text].
|
| 42.
|
Reagan, M. S.,
C. Pittenger,
W. Siede, and E. C. Friedberg.
1995.
Characterization of a mutant strain of Saccharomyces cerevisiae with a deletion of the RAD27 gene, a structural homolog of the RAD2 nucleotide excision repair gene.
J. Bacteriol.
177:364-371[Abstract/Free Full Text].
|
| 43.
|
Rothstein, R.
1984.
Double-strand break repair, gene conversion, and postdivision segregation.
Cold Spring Harbor Symp. Quant. Biol.
49:629-638[Abstract/Free Full Text].
|
| 44.
|
Rothstein, R.
1991.
Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast.
Methods Enzymol.
194:281-301[CrossRef][Medline].
|
| 45.
|
Rothstein, R.,
C. Helms, and N. Rosenberg.
1987.
Concerted deletions and inversions are caused by mitotic recombination between delta sequences in Saccharomyces cerevisiae.
Mol. Cell. Biol.
7:1198-1207[Abstract/Free Full Text].
|
| 46.
|
Rubnitz, J., and S. Subramani.
1984.
The minimum amount of homology required for homologous recombination in mammalian cells.
Mol. Cell. Biol.
4:2253-2258[Abstract/Free Full Text].
|
| 47.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 48.
|
Schweitzer, J. K., and D. M. Livingston.
1998.
Expansions of CAG repeat tracts are frequent in a yeast mutant defective in Okazaki fragment maturation.
Hum. Mol. Genet.
7:69-74[Abstract/Free Full Text].
|
| 49.
|
Shen, B.,
J. P. Nolan,
L. A. Sklar, and M. S. Park.
1996.
Essential amino acids for substrate binding and catalysis of human flap endonuclease 1.
J. Biol. Chem.
271:9173-9176[Abstract/Free Full Text].
|
| 50.
|
Shen, B.,
J. P. Nolan,
L. A. Sklar, and M. S. Park.
1997.
Functional analysis of point mutations in human flap endonuclease-1 active site.
Nucleic Acids Res.
25:3332-3338[Abstract/Free Full Text].
|
| 51.
|
Shen, B.,
J. Qiu,
D. Hosfield, and J. A. Tainer.
1998.
Flap endonuclease homologs in archaebacteria exist as independent proteins.
Trends Biochem. Sci.
23:171-173[CrossRef][Medline].
|
| 52.
|
Sherman, F.,
G. R. Fink, and J. B. Hicks.
1987.
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 53.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 54.
|
Sokolsky, T., and E. Alani.
2000.
EXO1 and MSH6 are high-copy suppressors of conditional mutations in the MSH2 mismatch repair gene of Saccharomyces cerevisiae.
Genetics
155:589-599[Abstract/Free Full Text].
|
| 55.
|
Sommers, C. H.,
E. J. Miller,
B. Dujon,
S. Prakash, and L. Prakash.
1995.
Conditional lethality of null mutations in RTH1 that encodes the yeast counterpart of a mammalian 5' to 3' exonuclease required for lagging strand synthesis in reconstituted systems.
J. Biol. Chem.
270:4193-4196[Abstract/Free Full Text].
|
| 56.
|
Spiro, C.,
R. Pelletier,
M. L. Rolfsmeier,
M. J. Dixon,
R. S. Lahue,
G. Gupta,
M. S. Park,
X. Chen,
S. V. S. Mariappan, and C. T. McMurray.
1999.
Inhibition of FEN-1 processing by DNA secondary structure at trinucleotide repeats.
Mol. Cell
4:1079-1085[CrossRef][Medline].
|
| 57.
|
Sugawara, N., and J. E. Haber.
1992.
Characterization of double-strand-break-induced recombination: homology requirements and single-stranded DNA formation.
Mol. Cell. Biol.
12:563-575[Abstract/Free Full Text].
|
| 58.
|
Sung, P.,
P. Reynolds,
L. Prakash, and S. Prakash.
1993.
Purification and characterization of the Saccharomyces cerevisiae Rad1/Rad10 endonuclease.
J. Biol. Chem.
26:23691-23699.
|
| 59.
|
Symington, L. S.
1998.
Homologous recombination is required for the viability of rad27 mutants.
Nucleic Acids Res.
26:5589-5595[Abstract/Free Full Text].
|
| 60.
|
Symington, L. S.,
L. E. Kang, and S. Moreau.
2000.
Alteration of gene conversion tract length and associated crossing over during plasmid gap repair in nuclease-deficient strains of Saccharomyces cerevisiae.
Nucleic Acids Res.
28:4649-4656[Abstract/Free Full Text].
|
| 61.
|
Szankasi, P.,
C. Gysler,
U. Zehntner,
U. Leupold,
J. Kohli, and P. Munz.
1986.
Mitotic recombination between dispersed but related tRNA genes of S. pombe generates a reciprocal translocation.
Mol. Gen. Genet.
202:394-402[CrossRef].
|
| 62.
|
Thomas, B. J., and R. Rothstein.
1989.
The genetic control of direct-repeat recombination in Saccharomyces: the effect of rad52 and rad1 on mitotic recombination of a GAL10 transcriptionally regulated gene.
Genetics
123:725-738[Abstract/Free Full Text].
|
| 63.
|
Tishkoff, D. X.,
A. L. Boerger,
P. Bertrand,
N. Filosi,
G. M. Gaida,
M. F. Kane, and R. D. Kolodner.
1997.
Identification and characterization of Saccharomyces cerevisiae EXO1, a gene encoding an exonuclease that interacts with MSH2.
Proc. Natl. Acad. Sci. USA
94:7487-7492[Abstract/Free Full Text].
|
| 64.
|
Tishkoff, D. X.,
N. Filosi,
G. M. Gaida, and R. D. Kolodner.
1997.
A novel mutation avoidance mechanism dependent on S. cerevisiae RAD27 is distinct from DNA mismatch repair.
Cell
88:253-263[CrossRef][Medline].
|
| 65.
|
Tomkinson, A. E.,
A. J. Bardwell,
L. Bardwell,
N. J. Tappe, and E. C. Friedberg.
1993.
Yeast DNA repair and recombination proteins Rad1 and Rad10 constitute a single-stranded-DNA endonuclease.
Nature
362:860-862[CrossRef][Medline].
|
| 66.
|
Tran, H. T.,
D. A. Gordenin, and M. A. Resnick.
1999.
The 3' 5' exonucleases of DNA polymerases and and the 5' 3' exonuclease Exo1 have major roles in postreplication mutation avoidance in Saccharomyces cerevisiae.
Mol. Cell. Biol.
19:2000-2007[Abstract/Free Full Text].
|
| 67.
|
Vallen, E. A., and F. R. Cross.
1995.
Mutations in RAD27 define a potential link between G1 cyclins and DNA replication.
Mol. Cell. Biol.
15:4291-4302[Abstract].
|
| 68.
|
Wach, A.,
A. Brachat,
R. Pohlmann, and P. Philippsen.
1994.
New heterologous modules for classical or PCR-based disruptions in Saccharomyces cerevisiae.
Yeast
10:1793-1808[CrossRef][Medline].
|
| 69.
|
Wang, Z.,
J. Q. Svejstrup,
W. J. Feaver,
X. Wu,
R. D. Kornberg, and E. C. Friedberg.
1994.
Transcription factor b (TFIIH) is required during nucleotide excision repair in yeast.
Nature
368:74-76[CrossRef][Medline].
|
| 70.
|
Wu, X.,
T. E. Wilson, and M. R. Lieber.
1999.
A role for FEN-1 in nonhomologous DNA end joining: the order of strand annealing and nucleolytic processing events.
Proc. Natl. Acad. Sci. USA
96:1303-1308[Abstract/Free Full Text].
|
| 71.
|
Zhu, F. X.,
E. E. Biswas, and S. B. Biswas.
1997.
Purification and characterization of the DNA polymerase associated exonuclease: the RTH1 gene product.
Biochemistry
36:5947-5954[CrossRef][Medline].
|
Molecular and Cellular Biology, April 2001, p. 2349-2358, Vol. 21, No. 7
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.7.2349-2358.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Cho, I.-t., Kim, D.-h., Kang, Y.-H., Lee, C.-H., Amangyelid, T., Nguyen, T. A., Hurwitz, J., Seo, Y.-S.
(2009). Human Replication Factor C Stimulates Flap Endonuclease 1. J. Biol. Chem.
284: 10387-10399
[Abstract]
[Full Text]
-
Navarro, M. S., Bi, L., Bailis, A. M.
(2007). A Mutant Allele of the Transcription Factor IIH Helicase Gene, RAD3, Promotes Loss of Heterozygosity in Response to a DNA Replication Defect in Saccharomyces cerevisiae. Genetics
176: 1391-1402
[Abstract]
[Full Text]
-
Singh, P., Zheng, L., Chavez, V., Qiu, J., Shen, B.
(2007). Concerted Action of Exonuclease and Gap-dependent Endonuclease Activities of FEN-1 Contributes to the Resolution of Triplet Repeat Sequences (CTG)n- and (GAA)n-derived Secondary Structures Formed during Maturation of Okazaki Fragments. J. Biol. Chem.
282: 3465-3477
[Abstract]
[Full Text]
-
Liu, R., Qiu, J., Finger, L. D., Zheng, L., Shen, B.
(2006). The DNA-protein interaction modes of FEN-1 with gap substrates and their implication in preventing duplication mutations.. Nucleic Acids Res
34: 1772-1784
[Abstract]
[Full Text]
-
Farah, J. A., Cromie, G., Davis, L., Steiner, W. W., Smith, G. R.
(2005). Activation of an Alternative, Rec12 (Spo11)-Independent Pathway of Fission Yeast Meiotic Recombination in the Absence of a DNA Flap Endonuclease. Genetics
171: 1499-1511
[Abstract]
[Full Text]
-
Kikuchi, K., Taniguchi, Y., Hatanaka, A., Sonoda, E., Hochegger, H., Adachi, N., Matsuzaki, Y., Koyama, H., van Gent, D. C., Jasin, M., Takeda, S.
(2005). Fen-1 Facilitates Homologous Recombination by Removing Divergent Sequences at DNA Break Ends. Mol. Cell. Biol.
25: 6948-6955
[Abstract]
[Full Text]
-
Wang, W., Bambara, R. A.
(2005). Human Bloom Protein Stimulates Flap Endonuclease 1 Activity by Resolving DNA Secondary Structure. J. Biol. Chem.
280: 5391-5399
[Abstract]
[Full Text]
-
Sharma, S., Sommers, J. A., Brosh, R. M. Jr
(2004). In vivo function of the conserved non-catalytic domain of Werner syndrome helicase in DNA replication. Hum Mol Genet
13: 2247-2261
[Abstract]
[Full Text]
-
Qiu, J., Liu, R., Chapados, B. R., Sherman, M., Tainer, J. A., Shen, B.
(2004). Interaction Interface of Human Flap Endonuclease-1 with Its DNA Substrates. J. Biol. Chem.
279: 24394-24402
[Abstract]
[Full Text]
-
Liu, Y., Zhang, H., Veeraraghavan, J., Bambara, R. A., Freudenreich, C. H.
(2004). Saccharomyces cerevisiae Flap Endonuclease 1 Uses Flap Equilibration To Maintain Triplet Repeat Stability. Mol. Cell. Biol.
24: 4049-4064
[Abstract]
[Full Text]
-
Sharma, S., Sommers, J. A., Wu, L., Bohr, V. A., Hickson, I. D., Brosh, R. M. Jr.
(2004). Stimulation of Flap Endonuclease-1 by the Bloom's Syndrome Protein. J. Biol. Chem.
279: 9847-9856
[Abstract]
[Full Text]
-
Sharma, S., Otterlei, M., Sommers, J. A., Driscoll, H. C., Dianov, G. L., Kao, H.-I, Bambara, R. A., Brosh, R. M. Jr.
(2004). WRN Helicase and FEN-1 Form a Complex upon Replication Arrest and Together Process Branchmigrating DNA Structures Associated with the Replication Fork. Mol. Biol. Cell
15: 734-750
[Abstract]
[Full Text]
-
Spiro, C., McMurray, C. T.
(2003). Nuclease-Deficient FEN-1 Blocks Rad51/BRCA1-Mediated Repair and Causes Trinucleotide Repeat Instability. Mol. Cell. Biol.
23: 6063-6074
[Abstract]
[Full Text]
-
Liu, Y., Bambara, R. A.
(2003). Analysis of Human Flap Endonuclease 1 Mutants Reveals a Mechanism to Prevent Triplet Repeat Expansion. J. Biol. Chem.
278: 13728-13739
[Abstract]
[Full Text]
-
Ayyagari, R., Gomes, X. V., Gordenin, D. A., Burgers, P. M. J.
(2003). Okazaki Fragment Maturation in Yeast. I. DISTRIBUTION OF FUNCTIONS BETWEEN FEN1 AND DNA2. J. Biol. Chem.
278: 1618-1625
[Abstract]
[Full Text]
-
Manthey, G. M., Bailis, A. M.
(2002). Multiple Pathways Promote Short-Sequence Recombination in Saccharomyces cerevisiae. Mol. Cell. Biol.
22: 5347-5356
[Abstract]
[Full Text]
-
Qiu, J., Bimston, D. N., Partikian, A., Shen, B.
(2002). Arginine Residues 47 and 70 of Human Flap Endonuclease-1 Are Involved in DNA Substrate Interactions and Cleavage Site Determination. J. Biol. Chem.
277: 24659-24666
[Abstract]
[Full Text]
-
Maga, G., Villani, G., Tillement, V., Stucki, M., Locatelli, G. A., Frouin, I., Spadari, S., Hubscher, U.
(2001). Okazaki fragment processing: Modulation of the strand displacement activity of DNA polymerase delta by the concerted action of replication protein A, proliferating cell nuclear antigen, and flap endonuclease-1. Proc. Natl. Acad. Sci. USA
10.1073/pnas.251193198v1
[Abstract]
[Full Text]
-
Maga, G., Villani, G., Tillement, V., Stucki, M., Locatelli, G. A., Frouin, I., Spadari, S., Hubscher, U.
(2001). Okazaki fragment processing: Modulation of the strand displacement activity of DNA polymerase delta by the concerted action of replication protein A, proliferating cell nuclear antigen, and flap endonuclease-1. Proc. Natl. Acad. Sci. USA
98: 14298-14303
[Abstract]
[Full Text]