Previous Article | Next Article 
Molecular and Cellular Biology, April 2001, p. 2467-2474, Vol. 21, No. 7
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.7.2467-2474.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Are All DNA Binding and Transcription
Regulation by an Activator Physiologically Relevant?
Qiming
Li and
Stephen Albert
Johnston*
Department of Internal Medicine and
Biochemistry, University of Texas-Southwestern Medical Center,
Dallas, Texas 75390-8573
Received 13 September 2000/Returned for modification 11 October
2000/Accepted 9 January 2001
 |
ABSTRACT |
Understanding how a regulatory protein occupies its sites in vivo
is central to understanding gene regulation. Using the yeast Gal4
protein as a model for such studies, we have found 239 potential Gal4
binding sites in the yeast genome, 186 of which are in open reading
frames (ORFs). This raises the questions of whether these sites are
occupied by Gal4 and, if so, to what effect. We have analyzed the
Saccharomyces cerevisiae ACC1 gene (encoding
acetyl-coenzyme A carboxylase), which has three Gal4 binding sites in
its ORF. The plasmid titration assay has demonstrated that Gal4
occupies these sites in the context of an active ACC1
gene. We also find that the expression of the ACC1 is
reduced fourfold in galactose medium and that this reduction is
dependent on the Gal4 binding sites, suggesting that Gal4 bound to the
ORF sites affects transcription of ACC1. Interestingly,
removal of the Gal4 binding sites has no obvious effect on the growth
in galactose under laboratory conditions. In addition, though the
sequence of the ACC1 gene is highly conserved among
yeast species, these Gal4 binding sites are not present in the
Kluyveromyces lactis ACC1 gene. We suggest that the
occurrence of these sites may not be related to galactose regulation
and a manifestation of the "noise" in the occurrence of Gal4
binding sites.
 |
INTRODUCTION |
Yeast cells grown in
galactose medium express a set of genes (GAL genes) in order
to utilize galactose (15). The activation of the
GAL genes is effected by a powerful transcription activator, Gal4, which recognizes one or several upstream activating sequences (UASs) in the promoters of Gal4-regulated genes through its N-terminal DNA binding domain (DBD). Understanding how a regulatory protein such
as Gal4 occupies its sites in vivo and the consequences of occupancy is
central to understanding gene regulation. We have previously identified
239 putative Gal4 binding sites in the yeast genome using a
computational approach (Q. Li and S. A. Johnston, submitted for
publication). Among them, 29 novel Gal4 binding sites in the promoters
have been intensively studied and new genes regulated by Gal4 have been
identified. It is notable that 186 Gal4 binding sites are located in
the open reading frames (ORFs) of genes, but there are only about 60 Gal4 dimers per yeast cell (E. H. Xu, Q. Li, A. Vonica, and
S. A. Johnston, unpublished data). This raises the interesting
questions of whether these binding sites in ORFs compete with the
promoter sites for occupancy by Gal4 protein and whether occupancy
confers regulation. Here we examine the specific question of whether
Gal4 protein occupies sites in the ACC1 gene and, if so,
what the consequences are. The results of this analysis may have
implications for interpreting genome-wide expression patterns.
Gal4 binding to its putative sites in the ORFs has not been
investigated. UASGAL sites in promoters tend to
be nucleosome free (25, 36). It is quite possible that
Gal4 sites in ORFs are nucleosome covered and that this may block Gal4
occupancy. However, it has been noted that, at least in vitro, Gal4
protein can effectively compete with nucleosomes for binding
UASGAL sites (38, 39). Gal4 may also
affect nucleosome stability through recruitment of remodeling complexes
(4, 31, 40).
Even if Gal4p does occupy sites in ORFs, it may or may not affect
transcription. There have been several reports of other putative
regulatory protein binding sites in the ORFs of genes in yeast.
Multiple downstream elements in the yeast transposons Ty1 and Ty2 have
been shown to either activate or repress transcription (7). The LPD1 gene, which encodes the lipoamide
dehydrogenase component (E3) of the pyruvate dehydrogenase, is also
regulated by elements in the ORFs. Two downstream activation sites and
two downstream repressor sites activate and repress the transcription of LPD1 genes, respectively (30). Similar
downstream regulatory elements have been observed in the
SRP1 (serine-rich protein 1) (6) and
PGK (phosphoglycerate kinase) genes (20). In
addition to these natural ORF sites, when three Leu3p binding sites
were introduced into a LacZ reporter its transcription was
down-regulated threefold (17).
We are interested in constructing a global picture of the occupancy of
Gal4 protein on the yeast genome. Since a large portion of the putative
Gal4p binding sites are in ORFs, it is important to make an assessment
of the potential of these sites to contribute to Gal4p binding. In this
report we focus on analysis of the UASGAL sites
in the ACC1 gene because it is the only ORF in the yeast genome with more than one binding site. We found that the three UASGAL sites in ACC1 are occupied by
Gal4p in vivo and that this leads to a novel form of regulation.
Disruption of these sites does relieve the ACC1 regulation
by Gal4p but has no effect on growth on galactose. These observations
suggest that the occurrence of these sites might be a by-product of the
random distribution of the sites in the genome and has implications for
interpretation of genome-wide expression analysis.
 |
MATERIALS AND METHODS |
Strains, media, and genetic methods.
Strain W303a (a
ade2-1 leu2-3,112 ura3-1
his3-115 trp1-1 can1-100) was
used as a parental strain throughout this study. Strain YJ0Z
(a
gal4
gal80 ura3-52
leu2-3,112 his3 ade1 trp1 MEL1) has an integrated LacZ
reporter gene controlled by the GAL1 promoter. Strain SC18
(a
gal80 ura3-52 leu2-3,112 his3 ade1 trp1 MEL1) was used in the plasmid titration assay. To
generate yeast strain SC785 with the two Gal4 binding sites removed
from the ACC1 ORF, the plasmid
YIP352-ACC1(
S2&S3) was cut with SpeI and
integrated into the ACC1 locus of W303a to create a
duplication. The integrated strain was then grown in yeast
extract-peptone-dextrose and plated on 5'-fluoroorotic
acid. Surviving colonies were picked. ACC1 DNA
covering these two sites was obtained by PCR and sequenced (Oligo184
[TCACTTGGAAGTTCAACTGC] and Oligo185
[CGACTTGTAATCTTGGGTTC]). Yeast cells were grown in
complete synthetic media with the addition of 2% glucose, raffinose,
or galactose unless described otherwise. Yeast transformation was
performed using the Saccharomyces cerevisiae EasyComp
transformation kit from Invitrogen.
Construction of plasmids. (i)
pMEL-
-gal(ACC1-S2&S3).
Briefly, a 0.75-kb
fragment containing the MEL1 promoter was fused to
lacZ, and the natural UASMEL in the
promoter was deleted and replaced with a unique XhoI site.
The reporter gene was inserted into PRS316 (29). The
158-bp PCR product containing sites 2 and 3 from ACC1 was
digested with XhoI and ligated into the pMEL-
-gal plasmid
(Oligo176 [AAACTCGAGCGGTAGAGACTGTTCCGTTC] and Oligo177 [AAACTCGAGCGGCAAACTAGCCA]).
YEP351-ACC1 and PRS316-ACC1.
An approximately 9-kb SacI genomic fragment containing a
functional ACC1 gene was obtained from S. Kohlwein and
inserted into the multiple cloning sites of YEP351 and PRS316.
YIP352-ACC1 (
S2&S3).
A 5.4-kb
BamHI fragment which contains the 5' half of a functional
ACC1 gene was excised from PRS316-ACC1 and cloned
into YIP352. Site 2 and site 3 were replaced by making four point
mutations in the crucial CGG and CCG triplets. Site-directed
mutagenesis was performed using the QuickChange kit from Stratagene and
confirmed by sequencing.
Northern and Southern blotting.
Yeast cells were grown to
mid-log phase in 100 ml of synthetic medium plus either raffinose or
galactose to extract total RNA. Cells were harvested and resuspended in
1 ml of RNA extraction buffer (100 mM Tris HCl [pH 7.5], 100 mM LiCl,
10 mM iodoacetate, 1 mM EDTA, 1% sodium dodecyl sulfate). Then 1 ml of
phenol-chloroform and 1 ml of glass beads were added, and the solution
was vortexed at maximum speed for 60 s. The liquid phase was
transferred to new tubes and centrifuged at 14,500 × g for 10 min. Phenol-chloroform extraction was
repeated three times. The supernatant was transferred to new tubes, and
1/10 volume of 3 M sodium acetate (pH 5.0) and 2.5 volumes of
cold 100% ethanol were added. The solution was chilled at
80°C for
at least 5 min and centrifuged at 3,600 × g for 10 min. The
pellet was washed with 5 ml of 80% cold ethanol and dried in the air.
Ten micrograms of total RNA was loaded in each lane of the 1.2%
agarose gel (1× MEA buffer [20 mM morpholineethanesulfonic acid, 1 mM EDTA, 5 mM sodium acetate], 5% formaldehyde, 0.1% diethyl pyrocarbonate [DEPC]). The gel was run at 2.5 V/cm for approximately 2 h and then washed with DEPC-treated water for 30 min. The RNA was then transferred to a nylon transfer membrane (MAGNA, 0.45 µm;
MSI) using the Posi-blotter from Stratagene.
Southern blots were performed using the standard protocol
(28). One microgram of yeast genomic DNA was digested with
the appropriate restriction endonucleases. Radioactive DNA probes were
synthesized using a random primer labeling kit (Gibco BRL). The probed
membrane was exposed to a PhosphorImager screen (Molecular Dynamics) overnight, and radioactive bands were analyzed with ImageQuant software.
Growth competition assay.
Wild-type and mutant yeast cells
were mixed together at approximately a 1:1 ratio. The mixed culture was
then diluted about 1,000-fold in the desired medium and incubated at
30°C until it reached the same optical density as before the
dilution. This allowed the mixed culture to go through 10 doublings.
The culture was then diluted and grown for another 10 doublings. The
final culture was collected, and the genomic DNA was prepared and
digested with HpaII for Southern blotting. A 306-bp
ACC1 fragment was used as a probe. The relative fitness of
the mutant strain was calculated by the number of mutant yeast cells
divided by the number of wild-type yeast cells in the culture after a
certain number of doublings, with the fitness of the wild-type yeast
strain set at 1.00.
Assays for
-Gal and
-Gal.
A 10-ml yeast culture was
grown to an optical density at 600 nm of 0.4 to 0.6. Cell extracts were
prepared, and the
-galactosidase (
-Gal) and
-Gal assays were
performed as previously described (16). The protein
concentrations were determined using the Coomassie blue G250 assay
(Pierce). One
-Gal unit is defined as 1 nmol of
o-nitrophenyl-
-D-galactopyranoside
hydrolyzed per ml per min. One
-Gal unit is defined as 1 nmol of
p-nitrophenyl
-D-galactopyranoside hydrolyzed per min per ml.
Plasmid titration assay.
The ability of Gal4 binding sites
to bind Gal4 protein was determined by the binding site's
ability to decrease MEL1 expression. Sc18 cells were
transformed with plasmid containing Gal4 binding sites and control
plasmid. A 10-ml yeast culture was grown using the appropriate
selection medium to an optical density at 600 nm of 0.6 to 0.8. Cell
extracts were prepared for the
-Gal assay, and at the same time,
total DNA was purified from the remaining extract. For plasmid YEP351,
the copy number was determined using a quantitative Southern blot. The
total DNA was digested with EcoRI and PstI. A
1.2-kb EcoRI fragment from YEP351 containing most of
LEU2 was used as a probe. The genomic DNA produced a 2.2-kb band which is easily distinguished from the 1.2-kb band from YEP351. The copy number was calculated from the relative intensities of the two bands.
DNA sequencing.
The ABI Prism BigDye Terminator Cycle
Sequencing Ready Reaction kit with AmpliTaq DNA polymerase was used for
sequencing. One hundred nanograms of PCR product or 1 µg of plasmid
DNA was used as the template. The sample was loaded on an ABI 310 genetic analyzer.
Protein purification.
The pGEX-CS-Gal4(1-147) expression
plasmid was transformed into Escherichia coli strain
BL21(pLysS). GST-CS-Gal4(1-147) was purified as previously described
(5, 33). Tobacco etch virus protease was added to
cleave Gal4(1-147) from the glutathione S-transferase (GST)
beads. The digest reaction mixture was incubated for 1 to 2 h at
30°C with gentle shaking. The supernatant was collected for further
biochemical studies.
Gel shift.
For the assay of Gal4 binding to
ACC1, two PCR oligonucleotides,
AAACTCGAGCGGTAGAGACTGTTCCGTTC (Acc1.a) and
AAACTCGAGCGGCAGAGACATAACCG (Acc1.b), were synthesized
according to the sequence of ACC1. Two
XhoI sites were created for subsequent cloning purposes.
The 158-bp PCR product which contains sites 2 and 3 was labeled
with [
-32P]ATP (Amersham) with T4 kinase (Promega).
Gal4 DBD (positions 1 to 147) and labeled oligonucleotides were mixed
in binding buffer (25 mM Tris [pH 7.5], 50 mM KCl, 10% glycerol, 1 mM EDTA, 1 mM spermidine, 10 µg of bovine serum albumin per ml, 50 µg of salmon sperm DNA/ml, and complete protease inhibitor). The
binding reaction mixture was incubated for 20 min at 4°C. The
mixtures were loaded on 6% native polyacrylamide gel. The gel was
dried in vacuum and finally exposed to a PhosphorImager screen for 30 min. In the competition assays, the consensus UASGAL was
formed by annealing c1 (TCGAGCGGAGGACTGTCCTCCGG) and c2
(TCGACCGGAGGACAGTCCTCCGC). The mutated Gal4 binding site was
formed by annealing m1 (TCGAGCGAAGGACTGTCCTCCAG) and m2 (TCGACTGGAGGACAGTCCTTCGC).
Degenerate PCR.
A BLAST search was run using the coding
sequence of ACC1 against the Candida albicans DNA
database (http://candida.stanford.edu) to determine the conserved
residues of ACC1. Based on this comparison, two degenerate
PCR primers were synthesized from the highly conserved region of
ACC1 (ACC1.d1
[TGGTCNGGTACNGGTGTNGAY] and ACC1.d2
[CNACTTGNAATCTTGGGTTC]). A 552-bp PCR product was obtained
from the Kluyveromyces lactis genomic DNA. Sequencing was
performed using both primers, and the sequence was aligned with the
ACC1 sequence of S. cerevisiae.
 |
RESULTS |
Gal4 binds to its sites in the ACC1 gene in
vitro.
By sequence analysis, we found three potential Gal4 binding
sites in the ORF of the ACC1 gene, which encodes
acetyl-coenzyme A carboxylase. The ACC1 sites are present in
a cluster, resembling those of GAL1-10 genes
(Fig. 1). Site 2 and site 3 are separated by only 150 bp. Site 2 is the closest to the consensus
UASGAL, with 13 matches out of 17 bases,
suggesting that it is a strong site. Since the strength of a
UASGAL generally corresponds to its similarity to
the consensus UASGAL (35), the
predicted strengths of these three sites in the ORF are comparable to
those of the UASGAL sequences present in
well-documented GAL genes, such as GAL1-10 genes (Fig. 1).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
There are three Gal4 binding sites in the ORF of the
ACC1 gene. The arrows indicate the direction of
transcription. The ORF of ACC1 is 6.7 kb. In the 1-kb 5'
region of the ACC1 ORF there are three Gal4 binding
sites. Sites 2 and 3 are closer to each other. The Gal4 binding sites
in GAL1-10 are also listed. The
sequences matching the consensus UASGAL are in boldface
type. The fraction listed is the total number of matches out of the 17 bases. The consensus sequence was generalized from all previously
identified GAL genes (Li and Johnston, submitted).
|
|
We performed a gel shift assay to determine if these predicted sites
actually bind Gal4 protein. A 150-bp DNA fragment containing
sites 2 and 3 was obtained by PCR and labeled as a probe in a
gel shift
experiment. A purified Gal4 DBD (amino acids 1 to 147)
binds the probe
very well (Fig.
2A). Complex C1 is formed
by a
Gal4 DBD binding one site, and complex C2 is formed when both
sites are occupied by Gal4 (Fig.
2A, lanes 2 to 6). Interestingly,
a
third complex C3 is observed when the Gal4 level is increased
(Fig.
2A,
lane 6). We suggest that this complex is formed by the
occupancy of a
third weak UAS
GAL-like site
(
CAGCCTTT
TCCATC
TCG;
boldface type
indicates conserved positions) between site 2 and
site 3 by Gal4
at a higher concentration. Based on these types
of experiments, the
estimated
Kd of Gal4 binding to one site
is
about 1 nM while the
Kd of a Gal4 DBD
binding to a consensus sequence
is ~0.1 nM in large (>50-bp) DNA
fragments (K. Melcher and S.
A. Johnston, unpublished data). The
specific binding of Gal4 to
sites 2 and 3 is supported by the results
of competition experiments
with cold consensus
UAS
GAL (Fig.
2B, lanes 3 to 5) and a mutated
Gal4
binding site (lanes 6 to 8). Gal4 DNA complexes were completely
disrupted at a 10-fold excess of consensus UAS
GAL
over the labeled
probe. The mutated Gal4 binding site has two point
mutations in
the CGG and CCG triplets.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 2.
Gel shift assay of sites 2 and 3. A 0.1-pmol portion of
radiolabeled PCR fragment containing sites 2 and 3 from the
ACC1 ORF was used. C1, C2, and C3 represent one, two,
and three Gal4 DBD dimers bound to the probe, respectively. (A) Lanes 1 to 6, 0, 0.0005, 0.0024, 0.012, 0.06, and 0.3 pmol of purified
Gal4DBD(1-147). (B) For lanes 2 to 8, 0.15 pmol of Gal4DBD(1-147) was
used in binding reactions. For competition, 0.01, 0.1, and 1.0 pmol of
cold consensus UASGAL were added (lanes 3 to 5). Then 0.01, 0.1, and 1.0 pmol of cold mutated Gal4 binding sites were added to
(lanes 6 to 8).
|
|
The Gal4 binding sites in the ORF of ACC1 activate
transcription when inserted into a promoter.
We then tested if the
Gal4 binding sites in the ACC1 ORF can replace an authentic
UAS and activate transcription. We used a reporter construct
(pMEL-
-gal) which fuses a
-Gal reporter gene to a MEL1
promoter. The single, natural UASGAL in
MEL1 promoter was eliminated and replaced with a cloning
site. MEL1 encodes
-Gal and is a member of the GAL
regulon. The 150-bp PCR fragment containing sites 2 and 3 was inserted
into the MEL1 promoter. As shown in Fig.
3, sites 2 and 3 can induce transcription
sixfold in the presence of galactose. The wild-type MEL1
gene is activated 50-fold in galactose. This experiment demonstrates
that these sites can function like a natural
UASGAL when placed in the promoters and that
there are no intrinsic difference between the Gal4 binding sites in the
ACC1 ORF and those previously found in the promoters of
GAL genes. The activation level of sites 2 and 3 is lower
than expected, given that the ACC1 sites have a
Kd comparable to that of the
MEL1 UASGAL (35). The
lower activation might be due to effects of the sequence between the
two sites.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 3.
The Gal4 binding sites in the ORF can function as
UASGAL. Sites 2 and 3 were cloned into a reporter
construct, pMEL- -gal, in which the UASGAL of
MEL1 gene was removed and replaced with a cloning site.
W303a cells transformed with the pMEL- -gal and
pMel-ACC1(S2&S3)- -gal were grown in glycerol-lactic
acid and galactose. -Gal activity was measured as described in the
text.
|
|
Gal4 binds its sites in the ACC1 ORF in vivo.
We have developed a plasmid titration assay to address occupancy of DNA
by transcription activators in vivo (34; Xu et al., unpublished). Expression of MEL1 is Gal4 dependent and
activated in galactose (23). Gal4 activates the
transcription of MEL1 through a single
UASGAL in its promoter (19), which
is not fully occupied under normal conditions as evidenced by increased
level of MEL1 expression when Gal4 is overexpressed. When
exogenous Gal4 binding sites are introduced into yeast cells, the
MEL1 expression level decreases as a result of the titration
of Gal4 protein. Therefore, the relative occupancy of Gal4 on the sites
of the plasmid is reflected by the relative decrease in the expression level of MEL1 (Fig.
4A).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
Gal4 occupies the sites in ACC1 ORF. (A)
The principle of the plasmid titration assay. There is one single weak
UASGAL in the promoter of MEL1 ( -Gal
gene). The expression of MEL1 reflects the available
Gal4. When Gal4 binding sites are introduced by a multicopy plasmid, a
decreased level of Gal4 will result in a lower level of
MEL1. (B) Sc18 cells transformed with Yep351,
YEP351-Gal1-10 promoter, and YEP351-ACC1. There are four
Gal4 binding sites in the promoter of
GAL1-10. The average copy number was
determined by Southern blot.
|
|
As a positive control, the four Gal4 binding sites from the
GAL1-
10 promoter in a multicopy YEP351 vector
were transformed
into yeast cells. This plasmid reduced the
MEL1-encoded

-Gal
activity to 56% of its original level
through titration of Gal4
protein (Fig.
4B). There are four Gal4
binding sites in the
GAL1-
10 promoter, two of
which are strong sites (Fig.
1). The copy number
of
GAL1-
10 promoter determined by Southern blotting
was approximately
19 per cell. To investigate whether the Gal4 binding
sites in
the
ACC1 ORF can cause a similar effect, we cloned
a functional
genomic fragment of
ACC1 into the YEP351
vector. The
ACC1 plasmid
was then transformed into yeast
cells. In these cells, the
MEL1 expression level was reduced
to 69% of its original level (Fig.
4B). There were approximately 10 copies of the
ACC1 gene per cell.
Though it is possible that
multiple copies of
ACC1 reduce
MEL1 expression
through other mechanisms, since the observed titration
effect for
ACC1 is as expected for a DNA containing three
UAS
GAL sequences, we think it likely that the
effect on
MEL1 is through
titration of Gal4 by the
ACC1 fragment.
Gal4 represses the transcription of ACC1.
In
the case of the artificial addition of Leu3 binding sites to an ORF,
the observed repression was proposed to be due to the DNA binding of
Leu3 (17). Gal4 can exist in two states when bound to DNA.
In noninducing medium (raffinose), Gal4 is bound to DNA but
transcriptionally inactive due to Gal80 repression. In inducing medium
(galactose), Gal4 is bound to its site and capable of activating
transcription. We first examined whether these two states had any
effect on the transcription of the ACC1 gene. RNA was
extracted from the W303 strain grown on either galactose or raffinose
and probed for ACC1 transcript levels. Surprisingly, the
ACC1 level was approximately fourfold lower when Gal4p was in the inducing (galactose) state (Fig.
5, lanes 1 and 2).

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 5.
Gal4 represses the transcription of ACC1.
(A) Wild-type (WT) ACC1 mRNA levels in raffinose (lane
1) and galactose (lane 2) and mutant ACC1 mRNA levels in
raffinose (lane 3) and galactose (lane 4). In the mutant
ACC1, two Gal4 binding sites, sites 2 and 3, were
eliminated without changing the codons.
|
|
If the repression on galactose of
ACC1 transcription is
directly due to Gal4p binding of the
ACC1 ORF, disruption of
the Gal4
binding sites should relieve this repression. The CGG triplets
in the Gal4 binding sites
(CGGN
5TN
5CCG)
are crucial for Gal4 binding,
as a single mutation in the triplet
reduces the binding of Gal4
500-fold and completely compromises the
ability of a UAS
GAL to
activate transcription in
vivo (
35). We inactivated sites 2
and 3 in
ACC1
by introducing two silent point mutations into each
site. The 5.4-kb 5'
half of
ACC1 carrying these mutations was
reconstructed and
cloned into YIP352, an integration vector. The
plasmid was linearized
by cutting in the middle of the
ACC1 DNA
fragment and
integrated into the endogenous locus of
ACC1 to create
a
partial duplication of
ACC1. Finally, the duplicated region
was excised by selection against the
URA3 marker. This
strain
has a single
ACC1 allele with the sites 2 and 3 eliminated by
silent mutations in the CGG sites. As is evident by
comparing
lanes 3 and 4 in Fig.
5, eliminating the Gal4 binding sites
relieves
the galactose repression of
ACC1. This demonstrates
that the down-regulation
of
ACC1 in galactose medium is
dependent on these Gal4 binding
sites.
To further investigate the mechanism of the repression, we determined
the relative levels of
ACC1 gene in
gal4 and
gal80 deletion
backgrounds (Fig.
6). In agreement with the proposal of
Gal4-mediated
regulation of
ACC1, the repression is
abolished when both
GAL4 and
GAL80 are deleted
(Fig.
6, lane 3). When
GAL80 alone is deleted,
the
ACC1 transcription is repressed even in raffinose (Fig.
6,
lane 1). These data suggest that Gal4 binding itself does not
repress
ACC1 transcription but that the activation domain must
also
be accessible, either through induction by galactose or deletion
of
GAL80. This is the first example of Gal4 acting as a
negative
regulator.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 6.
Active Gal4 is required to repress AccI
mRNA. The ACC1 mRNA levels were measured by Northern
blot. The sizes of ACC1 mRNA and ACT1
mRNA are 7.2 and 1.2 kb, respectively. ACT1 was
used as a control for quantification of ACC1 mRNA
levels.
|
|
The repression of ACC1 by Gal4 does not affect the
growth of yeast S. cerevisiae in galactose.
It is
generally assumed that activator binding and regulations are
physiologically relevant (26). The ACC1 gene is
essential and is regulated by the level of phospholipids. One
possibility is that the Gal4 binding sites in ACC1 reflect a
linkage of the two regulatory systems and that ACC1
regulation plays an undiscovered role in galactose growth. To test for
this possibility we used a very sensitive mixed culture growth
competition assay to see if the growth rate in galactose medium is
altered when sites 2 and 3 are eliminated from ACC1 (Fig.
7). Briefly, wild-type and mutant yeast
cells were mixed together at a 1:1 ratio, the mixed culture was grown
for a certain number of doublings, and the ratio of wild-type to mutant
forms was determined. The site 2 and 3 mutations disrupt a natural
HpaII site (CCGG is changed to CAGG). This creates a
restriction fragment length polymorphism convenient for discriminating
between the wild-type and mutant strains. After 10, 20, and 30 doublings, the ratio of wild-type and mutant remained unchanged in both
raffinose and galactose medium (Fig. 7, lanes 2 to 8). This protocol
should readily detect effects of 1% or more on fitness. Therefore the
elimination of repression of ACC1 transcription by Gal4 does
not detectably affect growth in galactose.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 7.
The Gal4 regulation of ACC1 has no effect
on growth. The wild-type (WT) and mutant (S2,3 ) yeast cells were
mixed in a 1:1 ratio and grown in raffinose (Raf) or galactose (Gal)
for 10 (lanes 2 and 6), 20 (lanes 3 and 7), or 30 (lanes 5 and 8)
generations. Southern blots were performed using a ACC1
probe, and the genomic DNA was digested with HpaII. In
the site 2 and 3 mutant, one HpaII site was destroyed.
|
|
The repression of ACC1 by Gal4 is not conserved in
K. lactis
K. lactis is closely
related to S. cerevisiae, and the galactose system is
highly conserved between the two organisms. The K.
lactis equivalent of the Gal4 protein, Lac9, is able to
recognize identical binding sequences (2, 27).
ACC1 is highly conserved between many eukaryotic
species. If the ACC1 UASGAL sites play a
role in galactose growth, they might also be present in the K.
lactis ACC1 gene. Therefore, we cloned the relevant part of the
K. lactis ACC1 gene to determine if these sites are also
present. In order to locate the regions in ACC1 which
are likely to be conserved in K. lactis, we aligned the
ACC1 sequence from the yeast C. albicans
with that from S. cerevisiae. Degenerate
oligonucleotides were made, and a PCR fragment of ACC1
was obtained from K. lactis genomic DNA and sequenced.
The sequence of K. lactis ACC1 in this region is highly
similar to the counterpart in S. cerevisiae, with 76%
identity at the DNA level. However, none of the Gal4 (Lac9) sites are
present in the K. lactis ACC1 gene. In the K. lactis ACC1 gene, the same amino acids are encoded but the Gal4 binding sites are not conserved (Fig. 8).
This comparison between the two yeast strains indicates that the
regulation of ACC1 by Gal4 is not conserved, at least in
K. lactis.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 8.
Alignment of ACC1 DNA sequences from
K. lactis (KL) and S.
cerevisiae (SC). The Gal4 binding sites are underlined
and in bold type.
|
|
 |
DISCUSSION |
In this study, we investigated the Gal4 binding sites in the ORF
of ACC1, showing that Gal4 can bind to these sites both in vitro and in vivo. In galactose, Gal4 represses the transcription of
the ACC1 gene when bound to the ORF. This repression
requires both Gal4 binding and the induction of Gal4 or deletion of the Gal80 negative regulator. The absence of these
UASGAL sites eliminates the regulation but does
not affect the growth potential in galactose medium, and these sites
are not present in K. lactis ACC1, indicating that these sites may not have a critical or conserved biological role.
The Gal4 binding sites in the ACC1 gene are
occupied.
In order to activate the transcription of GAL
genes, Gal4 must occupy its sites in the promoters, and the
transcription output depends on the relative occupancy of Gal4 (Xu et
al., unpublished). Theoretically, Gal4's occupancy is affected by the
concentration of Gal4 protein, the number of specific binding sites,
the amount of nonspecific genomic DNA, and the binding affinity of Gal4
to specific and nonspecific DNA. Gal4 is expressed at a low level, about 60 dimers per cell, and it is known that high levels of a potent
transcription activator like Gal4 can be toxic to the cell (1,
9). How are these few Gal4 dimers able to locate the
UASGALs in the yeast genome? Besides the
UASGAL in the promoters of GAL genes,
we have found ~300 potential Gal4 binding sites in the genome,
~80% of which are in the coding regions.
We found that the
ACC1 gene on a multicopy plasmid can
decrease the transcription of
MEL1 to a level similar to
that observed
with the
GAL1-
10 promoter. These
results suggest that Gal4 occupies
the sites in the ORF of
ACC1 quite well. This also suggests that
if nucleosomes are
present on the UAS
GAL in
ACC1,
they do not
affect the accessibility of Gal4 binding. It has been shown
that
Gal4p can compete nucleosomes for binding a
UAS
GAL (
4,
18)
and that this process
may be aided by various chromatin-remodeling
complexes like the
SWI-SNF complex (
22). Though the
ACC1
gene
was placed in a yeast expression plasmid in the titration assay,
it behaved identically with respect to regulation. It is well
documented that plasmid DNA is packed with nucleosomes when transformed
into yeast nuclei (
13).
Besides nucleosomes, Gal4 binding sites in an ORF would encounter the
polymerase II (Pol II) complex. Gal4p may be displaced
from its sites
by Pol II transcription. Furthermore, in the transcribed
region of
ACC1, the DNA double strands have to be separated from
each
other to allow the transcription to occur. Since Gal4 does
not bind to
single-stranded DNA, Gal4 would have to dissociate
from its sites at
the moment when the Pol II passes. Because transcription
is a very
rapid process and the initiation frequency is relatively
low even for a
highly expressed gene (
14), Gal4 may not be forced
off its
sites in an ORF for long. Gal4 binding in the
ACC1 ORF
is
presumably a dynamic
process.
It is also notable that the Gal4 binding sites in the promoters and
ORFs have different contexts that may be important for
their occupancy
by Gal4. In the promoters, there are potential
sites for other general
DNA binding transcription factors such
as TATA binding protein.
There is evidence that transcription
activators bind cooperatively with
them (
3,
12,
34). Since
this context is absent in the
ORFs, Gal4 binding to UASs in ORFs
could be weakened. However, our data
imply that the Gal4 binding
sites in the
ACC1 ORF do not
require a promoter context for binding.
Three Gal4 binding sites in the
ACC1 ORF in a high-copy-number
plasmid decreased the
MEL1 expression to a level comparable to
that of four Gal4
binding sites in the
GAL1-
10 promoter, indicating
that Gal4 binds to these ORF sites equally well even if they are
not
located in a promoter. It is notable that Gal4 binding sites
in the
ACC1 ORF are in a cluster and they are strong sites. In
contrast, the other Gal4 binding sites in the ORFs are isolated
and
most of them are predicted to have weak
affinity.
Given these considerations, we feel the UAS
GAL
sites in ORFs will have little contribution to Gal4 binding on a
genomic scale.
The
ACC1 ORF is unique in that it has three
relatively strong
sites. This may facilitate cooperative binding of
Gal4 protein.
We note that this cooperativity is not evident in vitro
(Fig.
2 and unpublished data), but Gal4 without its activation domain
does not bind cooperatively (W. V. Ding and S. A. Johnston,
unpublished
data). Single sites are almost all weaker sites. Weak sites
(for
example, the
MEL1 UAS) are occupied by Gal4, but this
is in the
context of a promoter where cooperative interaction with
other
transcription factors can come into play (
34).
Gal4 represses ACC1 expression by a novel
mechanism.
Leu3, another acidic activator, regulates the gene
involved in leucine biosynthesis and responds to the levels of the
metabolic intermediate
-isopropylmalate, which serves as a sensor of
leucine availability (8). When three Leu3 binding sites
were artificially introduced within the RPL16-lacZ reporter,
downstream of the start of transcription, the expression of the
reporter gene was inhibited threefold (17). Leu3 and
Gal4 belong to a super class of zinc finger DNA binding
transactivators. They recognize sequences with a similar motif
(32). In the case of ACC1, the Gal4 binding sites naturally exist in the downstream region of an ORF.
Unlike higher eukaryotes, placement of a UAS from the
CYC1
gene in a downstream intron cannot activate transcription
(
11).
This is consistent with the data presented here. The
inhibition
of transcription we observed for the
ACC1 gene
and possibly that
in the case of
LEU3 could be for at least
three possible
reasons.
First, Gal4 protein binding itself may present a "roadblock" for
RNA polymerase. If the roadblock model is correct, binding
of the
Gal4-Gal80 complex to the
ACC1 UAS
GAL
in noninducing medium
would be expected to repress. However,
ACC1 transcription is repressed
only in galactose, and the
repression is relieved in noninducing
raffinose medium. We feel that
this argues against a simple roadblock
model.
Second, bound Gal4 may remodel the chromatin structure so that it is
unfavorable for the transcription of
ACC1. Activators
such
as Gal4 are known to recruit chromatin-remodeling machines
such as
SWI-SNF and SAGA complexes (
10,
21). In vitro,
SWI-SNF
can alter nucleosome structure in a manner that facilitates the
binding of transcription factors (
37). SWI-SNF affects the
nuclease
sensitivity pattern of chromatin in some promoters and may
facilitate
binding of other transcription factors. It is possible that
Gal4
binding downstream of the promoter may also recruit the chromatin
remodeling machines and alter the chromatin structure in a way
that
interferes with transcription. However, such modification
of chromatin
structure would have a negative effect when it occurs
downstream of the
promoter.
Third, bound Gal4 may interfere with Ino2 and Ino4, the
requisite activators of
ACC1, or other transcription factors
on the
ACC1 promoter. For example, the Gal4p activation
domain could
compete for transcription factors required by Ino2 and
Ino4. The
repression may be connected to Gal4's function of activating
transcription.
It is generally believed that the transcription
machinery must
be recruited to the promoter by an activator, AD, for
transcription
activation (
24). Upon binding to the
promoter, a transcription
activator can increase the recruitment by
binding direct targets
in the transcription machinery, which leads to
transcriptional
activation. Since there are a limited number of general
transcriptional
factors, many of these targets must be shared by
different transcription
activators. Thus, the presence of a powerful
activator such as
Gal4 could compete with the Ino2-Ino4 activator
complex in the
vicinity for some common targets. As a result, the
activation
of the
ACC1 gene by Ino2-Ino4 could be reduced
(Fig.
9). We called
this phenomenon
"local squelching," which is similar to the "squelching"
caused
by overexpression of a strong transcriptional activator.
For example,
overexpression of Gal4 inhibits the expression of
a gene which is
normally activated by Gcn4 (
9). Analogous to
this, a
similar squelching effect of Ino2-Ino4 could be caused
by proximally
bound Gal4, which creates a high "local concentration"
of
its activation domain. This type of squelching presumably would
be
against promoter-bound rather than free elements.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 9.
A proposed mechanism for Gal4 repressing of
ACC1. The Ino2-Ino4 heterodimer activates transcription
of ACC1 by binding to the inositol-choline response
element (ICRE) and recruiting the general transcription factors. When
Gal4 binds in the ORF of ACC1, Gal4 titrates the general
transcription factors and competes with Ino2-Ino4. This local
squelching effect results in the repression of ACC1
transcription.
|
|
Biological role of the UASGAL in the
ACC1 gene.
It is generally assumed that binding and
regulation by a regulatory protein imply that the target gene is part
of a physiologically relevant pathway (26). Probably the
most important aspect of the work we report here is its implication
relative to this assumption. Is the regulation of ACC1 by
Gal4 a manifestation of an undiscovered metabolic link between
galactose metabolism and long-chain fatty acids synthesis, or does it
reflect "noise" in regulation due to the random distribution of
Gal4 sites? We feel that our data support the latter
interpretation
that is, there may be no positive selection to maintain
these sites. This conclusion is based on the following considerations.
First, the total number of Gal4 binding sites in the yeast genome is
almost exactly the number predicted to occur at random, and the number
of sites in ORFs is what would be predicted to occur at random (Li and
Johnston, submitted). So there does not appear to be any strong
selection to limit binding sites to promoters. Second, we did not
observe any adverse effect of eliminating the Gal4 binding sites in the ORF of ACC1. Neither growth on rich glucose medium (data not
shown) nor growth on galactose was affected by eliminating the Gal4
regulation of the ACC1. In order not to overlook a small
growth potential of the wild-type over the mutant, we used a growth
competition assay which is very sensitive and can easily pick up a
growth difference of 1%. However, we cannot exclude the possibility
that this regulation is meaningful for S. cerevisiae under
conditions in nature. Third, in a related yeast, K. lactis,
we find that the ACC1 gene encodes the identical amino acid
sequence in the corresponding regions where Gal4 binding sites are
located but that the Gal4 (Lac9) binding sites are not present. The
GAL system regulation in these two species is very similar.
Therefore, if the Gal4 regulation of ACC1 in S. cerevisiae is biologically relevant, it has not been conserved
between the two species.
It is generally thought that gene regulation networks are biologically
relevant, in that there is positive selection pressure
to maintain
them. However, we propose that at least in the case
of Gal4 regulation
of
ACC1, the regulation is not under selection.
The three
sites appear to have occurred by chance and to exert
regulation on
ACC1 with little or no effect on galactose growth
or,
apparently, selection against the regulation. Considering
the large
number of Gal4 binding sites found in ORFs, it is not
improbable to
have multiple Gal4 binding sites present in a single
ORF by chance.
Since there are many more DNA binding transcriptional
activators like
Gal4 in the yeast genome, the case of
ACC1 may
not be
unique. There may be multiple binding sites in the ORFs
for other
activators. Those sites may regulate transcription by
a similar
mechanism, and this proposed mechanism of repression
may be common. In
contrast to the apparent situation with
ACC1,
some of these
ORF regulatory sites may reflect biologically relevant
regulation.
However, particularly with the advent of the global
analysis of gene
expression, the
ACC1 example illustrates the
point that some
portion of coregulation may be the product of
noise in the random
distribution of binding
sites.
 |
ACKNOWLEDGMENTS |
We thank S.A.J. lab members for helpful discussions and S. Kohlwein for providing us a plasmid carrying ACC1. We
are grateful to Fernando Gonzalez for reading the manuscript and to
Liping Sun for providing consensus UASGAL. John Shelton
helped us with some figures.
This work was supported by grants to S.A.J. from NIH (40070).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Center for
Biomedical Inventions, University of Texas-Southwestern Medical Center, Dallas, TX 75390-8573. Phone: (214) 648-1415. Fax: (214) 648-1298. E-mail: stephen.johnston{at}utsouthwestern.edu.
 |
REFERENCES |
| 1.
|
Berger, S. L.,
W. D. Cress,
A. Cress,
S. J. Triezenberg, and L. Guarente.
1990.
Selective inhibition of activated but not basal transcription by the acidic activation domain of VP16: evidence for transcriptional adaptors.
Cell
61:1199-208[CrossRef][Medline].
|
| 2.
|
Breunig, K. D., and P. Kuger.
1987.
Functional homology between the yeast regulatory proteins GAL4 and LAC9: LAC9-mediated transcriptional activation in Kluyveromyces lactis involves protein binding to a regulatory sequence homologous to the GAL4 protein-binding site.
Mol. Cell. Biol.
7:4400-4406[Abstract/Free Full Text].
|
| 3.
|
Chen, X.,
G. Farmer,
H. Zhu,
R. Prywes, and C. Prives.
1993.
Cooperative DNA binding of p53 with TFIID (TBP): a possible mechanism for transcriptional activation.
Genes Dev.
7:1837-1849[Abstract/Free Full Text].
|
| 4.
|
Cote, J.,
J. Quinn,
J. L. Workman, and C. L. Peterson.
1994.
Stimulation of GAL4 derivative binding to nucleosomal DNA by the yeast SWI/SNF complex.
Science
265:53-60[Abstract/Free Full Text].
|
| 5.
|
Ding, W. V., and S. A. Johnston.
1997.
The DNA binding and activation domains of Gal4p are sufficient for conveying its regulatory signals.
Mol. Cell. Biol.
17:2538-2549[Abstract].
|
| 6.
|
Fantino, E.,
D. Marguet, and G. J. Lauquin.
1992.
Downstream activating sequence within the coding region of a yeast gene: specific binding in vitro of RAP1. protein.
Mol. Gen. Genet.
236:65-75[Medline].
|
| 7.
|
Farabaugh, P.,
X. B. Liao,
M. Belcourt,
H. Zhao,
J. Kapakos, and J. Clare.
1989.
Enhancer and silencerlike sites within the transcribed portion of a Ty2 transposable element of Saccharomyces cerevisiae.
Mol. Cell. Biol.
9:4824-4834[Abstract/Free Full Text].
|
| 8.
|
Friden, P., and P. Schimmel.
1988.
LEU3 of Saccharomyces cerevisiae activates multiple genes for branched-chain amino acid biosynthesis by binding to a common decanucleotide core sequence.
Mol. Cell. Biol.
8:2690-2697[Abstract/Free Full Text].
|
| 9.
|
Gill, G., and M. Ptashne.
1988.
Negative effect of the transcriptional activator GAL4.
Nature
334:721-724[CrossRef][Medline].
|
| 10.
|
Grant, P. A.,
L. Duggan,
J. Cote,
S. M. Roberts,
J. E. Brownell,
R. Candau,
R. Ohba,
T. Owen-Hughes,
C. D. Allis,
F. Winston,
S. L. Berger, and J. L. Workman.
1997.
Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex.
Genes Dev.
11:1640-1650[Abstract/Free Full Text].
|
| 11.
|
Guarente, L., and E. Hoar.
1984.
Upstream activation sites of the CYC1 gene of Saccharomyces cerevisiae are active when inverted but not when placed downstream of the "TATA box."
Proc. Natl. Acad. Sci. USA
81:7860-7864[Abstract/Free Full Text].
|
| 12.
|
Horikoshi, M.,
T. Hai,
Y. S. Lin,
M. R. Green, and R. G. Roeder.
1988.
Transcription factor ATF interacts with the TATA factor to facilitate establishment of a preinitiation complex.
Cell
54:1033-1042[CrossRef][Medline].
|
| 13.
|
Hsiao, C. L., and J. Carbon.
1981.
Characterization of a yeast replication origin (ars2) and construction of stable minichromosomes containing cloned yeast centromere DNA (CEN3).
Gene
15:157-166[CrossRef][Medline].
|
| 14.
|
Iyer, V., and K. Struhl.
1996.
Absolute mRNA levels and transcriptional initiation rates in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
93:5208-5212[Abstract/Free Full Text].
|
| 15.
|
Johnston, M., and M. Carlson.
1992.
Regulation of carbon and phosphate utilization, p. 193-281.
In
J. R. Broach, and E. W. Jones (ed.), The molecular biology of the yeast Saccharomyces cerevisiae. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 16.
|
Johnston, S. A., and J. E. Hopper.
1982.
Isolation of the yeast regulatory gene GAL4 and analysis of its dosage effects on the galactose/melibiose regulon.
Proc. Natl. Acad. Sci. USA
79:6971-6975[Abstract/Free Full Text].
|
| 17.
|
Kirkpatrick, C. R., and P. Schimmel.
1995.
Detection of leucine-independent DNA site occupancy of the yeast Leu3p transcriptional activator in vivo.
Mol. Cell. Biol.
15:4021-4030[Abstract].
|
| 18.
|
Kwon, H.,
A. N. Imbalzano,
P. A. Khavari,
R. E. Kingston, and M. R. Green.
1994.
Nucleosome disruption and enhancement of activator binding by a human SW1/SNF complex.
Nature
370:477-481[CrossRef][Medline].
|
| 19.
|
Liljestrom, P. L.
1985.
The nucleotide sequence of the yeast MEL1 gene.
Nucleic Acids Res.
13:7257-7268[Abstract/Free Full Text].
|
| 20.
|
Mellor, J.,
M. J. Dobson,
A. J. Kingsman, and S. M. Kingsman.
1987.
A transcriptional activator is located in the coding region of the yeast PGK gene.
Nucleic Acids Res.
15:6243-6259[Abstract/Free Full Text].
|
| 21.
|
Peterson, C. L.,
A. Dingwall, and M. P. Scott.
1994.
Five SWI/SNF gene products are components of a large multisubunit complex required for transcriptional enhancement.
Proc. Natl. Acad. Sci. USA
91:2905-2908[Abstract/Free Full Text].
|
| 22.
|
Peterson, C. L., and J. W. Tamkun.
1995.
The SWI-SNF complex: a chromatin remodeling machine?
Trends Biochem. Sci.
20:143-146[CrossRef][Medline].
|
| 23.
|
Post-Beittenmiller, A. M.,
R. W. Hamilton, and J. E. Hopper.
1984.
Regulation of basal and induced levels of the MEL1 transcript in Saccharomyces cerevisiae.
Mol. Cell. Biol.
4:1238-1245[Abstract/Free Full Text].
|
| 24.
|
Ptashne, M., and A. Gann.
1997.
Transcriptional activation by recruitment.
Nature
386:569-577[CrossRef][Medline].
|
| 25.
|
Reagan, S. M., and J. E. Majors.
1998.
The chromatin structure of the GAL1 promoter forms independently of Reb1p in Saccharomyces cerevisiae.
Mol. Gen. Genet.
259:142-149[CrossRef][Medline].
|
| 26.
|
Ren, B.,
F. Robert,
J. J. Wyrick,
O. Aparicio,
E. G. Jennings,
I. Simon,
J. Zeitlinger,
J. Schreiber,
N. Hannett,
E. Kanin,
T. L. Volkert,
C. J. Wilson,
S. P. Bell, and R. A. Young.
2000.
Genome-wide location and function of DNA binding proteins.
Science
290:2306-2309[Abstract/Free Full Text].
|
| 27.
|
Salmeron, J. M., Jr., and S. A. Johnston.
1986.
Analysis of the Kluyveromyces lactis positive regulatory gene LAC9 reveals functional homology to, but sequence divergence from, the Saccharomyces cerevisiae GAL4 gene.
Nucleic Acids Res.
14:7767-7781[Abstract/Free Full Text].
|
| 28.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 29.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 30.
|
Sinclair, D. A.,
G. D. Kornfeld, and I. W. Dawes.
1994.
Yeast intragenic transcriptional control: activation and repression sites within the coding region of the Saccharomyces cerevisiae LPD1 gene.
Mol. Cell. Biol.
14:214-225[Abstract/Free Full Text].
|
| 31.
|
Taylor, I. C.,
J. L. Workman,
T. J. Schuetz, and R. E. Kingston.
1991.
Facilitated binding of GAL4 and heat shock factor to nucleosomal templates: differential function of DNA-binding domains.
Genes Dev.
5:1285-1298[Abstract/Free Full Text].
|
| 32.
|
Todd, R. B., and A. Andrianopoulos.
1997.
Evolution of a fungal regulatory gene family: the Zn(II)2Cys6 binuclear cluster DNA binding motif.
Fungal Genet. Biol.
21:388-405[CrossRef][Medline].
|
| 33.
|
Van Hoy, M.,
K. K. Leuther,
T. Kodadek, and S. A. Johnston.
1993.
The acidic activation domains of the GCN4 and GAL4 proteins are not alpha helical but form beta sheets.
Cell
72:587-594[CrossRef][Medline].
|
| 34.
|
Vashee, S., and T. Kodadek.
1995.
The activation domain of GAL4 protein mediates cooperative promoter binding with general transcription factors in vivo.
Proc. Natl. Acad. Sci. USA
92:10683-10687[Abstract/Free Full Text].
|
| 35.
|
Vashee, S.,
H. Xu,
S. A. Johnston, and T. Kodadek.
1993.
How do "Zn2 cys6" proteins distinguish between similar upstream activation sites? Comparison of the DNA-binding specificity of the GAL4 protein in vitro and in vivo.
J. Biol. Chem.
268:24699-24706[Abstract/Free Full Text].
|
| 36.
|
Weiss, E.,
C. Ruhlmann, and P. Oudet.
1986.
Transcriptionally active SV40 minichromosomes are restriction enzyme sensitive and contain a nucleosome-free origin region.
Nucleic Acids Res.
14:2045-2058[Abstract/Free Full Text].
|
| 37.
|
Workman, J. L., and R. E. Kingston.
1998.
Alteration of nucleosome structure as a mechanism of transcriptional regulation.
Annu. Rev. Biochem.
67:545-579[CrossRef][Medline].
|
| 38.
|
Workman, J. L., and R. E. Kingston.
1992.
Nucleosome core displacement in vitro via a metastable transcription factor-nucleosome complex.
Science
258:1780-1784[Abstract/Free Full Text].
|
| 39.
|
Workman, J. L.,
I. C. Taylor, and R. E. Kingston.
1991.
Activation domains of stably bound GAL4 derivatives alleviate repression of promoters by nucleosomes.
Cell
64:533-544[CrossRef][Medline].
|
| 40.
|
Yudkovsky, N.,
C. Logie,
S. Hahn, and C. L. Peterson.
1999.
Recruitment of the SWI/SNF chromatin remodeling complex by transcriptional activators.
Genes Dev.
13:2369-2374[Abstract/Free Full Text].
|
Molecular and Cellular Biology, April 2001, p. 2467-2474, Vol. 21, No. 7
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.7.2467-2474.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
van Hijum, S. A. F. T., Medema, M. H., Kuipers, O. P.
(2009). Mechanisms and Evolution of Control Logic in Prokaryotic Transcriptional Regulation. Microbiol. Mol. Biol. Rev.
73: 481-509
[Abstract]
[Full Text]
-
Carey, M. F., Peterson, C. L., Smale, S. T.
(2009). Chromatin Immunoprecipitation (ChIP). CSH Protocols
2009: pdb.prot5279-pdb.prot5279
[Abstract]
[Full Text]
-
Levy, E. D., Landry, C. R., Michnick, S. W.
(2009). How Perfect Can Protein Interactomes Be?. Sci Signal
2: pe11-pe11
[Abstract]
[Full Text]
-
Holmstrom, S. R., Chupreta, S., So, A. Y.-L., Iniguez-Lluhi, J. A.
(2008). SUMO-Mediated Inhibition of Glucocorticoid Receptor Synergistic Activity Depends on Stable Assembly at the Promoter But Not on DAXX. Mol. Endocrinol.
22: 2061-2075
[Abstract]
[Full Text]
-
Wray, G. A., Hahn, M. W., Abouheif, E., Balhoff, J. P., Pizer, M., Rockman, M. V., Romano, L. A.
(2003). The Evolution of Transcriptional Regulation in Eukaryotes. Mol Biol Evol
20: 1377-1419
[Abstract]
[Full Text]
-
Hahn, M. W., Stajich, J. E., Wray, G. A.
(2003). The Effects of Selection Against Spurious Transcription Factor Binding Sites. Mol Biol Evol
20: 901-906
[Abstract]
[Full Text]
-
Kohlhaw, G. B.
(2003). Leucine Biosynthesis in Fungi: Entering Metabolism through the Back Door. Microbiol. Mol. Biol. Rev.
67: 1-15
[Abstract]
[Full Text]
-
Wenz, P., Schwank, S., Hoja, U., Schuller, H.-J.
(2001). A downstream regulatory element located within the coding sequence mediates autoregulated expression of the yeast fatty acid synthase gene FAS2 by the FAS1 gene product. Nucleic Acids Res
29: 4625-4632
[Abstract]
[Full Text]