INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Yeast cells grown in galactose medium express a set of genes (GAL genes) in order to utilize galactose (15). The activation of the GAL genes is effected by a powerful transcription activator, Gal4, which recognizes one or several upstream activating sequences (UASs) in the promoters of Gal4-regulated genes through its N-terminal DNA binding domain (DBD). Understanding how a regulatory protein such as Gal4 occupies its sites in vivo and the consequences of occupancy is central to understanding gene regulation. We have previously identified 239 putative Gal4 binding sites in the yeast genome using a computational approach (Q. Li and S. A. Johnston, submitted for publication). Among them, 29 novel Gal4 binding sites in the promoters have been intensively studied and new genes regulated by Gal4 have been identified. It is notable that 186 Gal4 binding sites are located in the open reading frames (ORFs) of genes, but there are only about 60 Gal4 dimers per yeast cell (E. H. Xu, Q. Li, A. Vonica, and S. A. Johnston, unpublished data). This raises the interesting questions of whether these binding sites in ORFs compete with the promoter sites for occupancy by Gal4 protein and whether occupancy confers regulation. Here we examine the specific question of whether Gal4 protein occupies sites in the ACC1 gene and, if so, what the consequences are. The results of this analysis may have implications for interpreting genome-wide expression patterns.

Gal4 binding to its putative sites in the ORFs has not been investigated. UAS_GAL sites in promoters tend to be nucleosome free (25, 36). It is quite possible that Gal4 sites in ORFs are nucleosome covered and that this may block Gal4 occupancy. However, it has been noted that, at least in vitro, Gal4 protein can effectively compete with nucleosomes for binding UAS_GAL sites (38, 39). Gal4 may also affect nucleosome stability through recruitment of remodeling complexes (4, 31, 40).

Even if Gal4p does occupy sites in ORFs, it may or may not affect transcription. There have been several reports of other putative regulatory protein binding sites in the ORFs of genes in yeast. Multiple downstream elements in the yeast transposons Ty1 and Ty2 have been shown to either activate or repress transcription (7). The LPD1 gene, which encodes the lipoamide dehydrogenase component (E3) of the pyruvate dehydrogenase, is also regulated by elements in the ORFs. Two downstream activation sites and two downstream repressor sites activate and repress the transcription of LPD1 genes, respectively (30). Similar downstream regulatory elements have been observed in the SRP1 (serine-rich protein 1) (6) and PGK (phosphoglycerate kinase) genes (20). In addition to these natural ORF sites, when three Leu3p binding sites were introduced into a LacZ reporter its transcription was down-regulated threefold (17).

We are interested in constructing a global picture of the occupancy of Gal4 protein on the yeast genome. Since a large portion of the putative Gal4p binding sites are in ORFs, it is important to make an assessment of the potential of these sites to contribute to Gal4p binding. In this report we focus on analysis of the UAS_GAL sites in the ACC1 gene because it is the only ORF in the yeast genome with more than one binding site. We found that the three UAS_GAL sites in ACC1 are occupied by Gal4p in vivo and that this leads to a novel form of regulation. Disruption of these sites does relieve the ACC1 regulation by Gal4p but has no effect on growth on galactose. These observations suggest that the occurrence of these sites might be a by-product of the random distribution of the sites in the genome and has implications for interpretation of genome-wide expression analysis.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Strains, media, and genetic methods. Strain W303a (a ade2-1 leu2-3,112 ura3-1 his3-115 trp1-1 can1-100) was used as a parental strain throughout this study. Strain YJ0Z (a gal4 gal80 ura3-52 leu2-3,112 his3 ade1 trp1 MEL1) has an integrated LacZ reporter gene controlled by the GAL1 promoter. Strain SC18 (a gal80 ura3-52 leu2-3,112 his3 ade1 trp1 MEL1) was used in the plasmid titration assay. To generate yeast strain SC785 with the two Gal4 binding sites removed from the ACC1 ORF, the plasmid YIP352-ACC1(S2&S3) was cut with SpeI and integrated into the ACC1 locus of W303a to create a duplication. The integrated strain was then grown in yeast extract-peptone-dextrose and plated on 5'-fluoroorotic acid. Surviving colonies were picked. ACC1 DNA covering these two sites was obtained by PCR and sequenced (Oligo184 [TCACTTGGAAGTTCAACTGC] and Oligo185 [CGACTTGTAATCTTGGGTTC]). Yeast cells were grown in complete synthetic media with the addition of 2% glucose, raffinose, or galactose unless described otherwise. Yeast transformation was performed using the Saccharomyces cerevisiae EasyComp transformation kit from Invitrogen.

Construction of plasmids. (i) pMEL--gal(ACC1-S2&S3). Briefly, a 0.75-kb fragment containing the MEL1 promoter was fused to lacZ, and the natural UAS_MEL in the promoter was deleted and replaced with a unique XhoI site. The reporter gene was inserted into PRS316 (29). The 158-bp PCR product containing sites 2 and 3 from ACC1 was digested with XhoI and ligated into the pMEL--gal plasmid (Oligo176 [AAACTCGAGCGGTAGAGACTGTTCCGTTC] and Oligo177 [AAACTCGAGCGGCAAACTAGCCA]).

YEP351-ACC1 and PRS316-ACC1. An approximately 9-kb SacI genomic fragment containing a functional ACC1 gene was obtained from S. Kohlwein and inserted into the multiple cloning sites of YEP351 and PRS316.

YIP352-ACC1 (S2&S3). A 5.4-kb BamHI fragment which contains the 5' half of a functional ACC1 gene was excised from PRS316-ACC1 and cloned into YIP352. Site 2 and site 3 were replaced by making four point mutations in the crucial CGG and CCG triplets. Site-directed mutagenesis was performed using the QuickChange kit from Stratagene and confirmed by sequencing.

Northern and Southern blotting. Yeast cells were grown to mid-log phase in 100 ml of synthetic medium plus either raffinose or galactose to extract total RNA. Cells were harvested and resuspended in 1 ml of RNA extraction buffer (100 mM Tris HCl [pH 7.5], 100 mM LiCl, 10 mM iodoacetate, 1 mM EDTA, 1% sodium dodecyl sulfate). Then 1 ml of phenol-chloroform and 1 ml of glass beads were added, and the solution was vortexed at maximum speed for 60 s. The liquid phase was transferred to new tubes and centrifuged at 14,500 × g for 10 min. Phenol-chloroform extraction was repeated three times. The supernatant was transferred to new tubes, and 1/10 volume of 3 M sodium acetate (pH 5.0) and 2.5 volumes of cold 100% ethanol were added. The solution was chilled at 80°C for at least 5 min and centrifuged at 3,600 × g for 10 min. The pellet was washed with 5 ml of 80% cold ethanol and dried in the air. Ten micrograms of total RNA was loaded in each lane of the 1.2% agarose gel (1× MEA buffer [20 mM morpholineethanesulfonic acid, 1 mM EDTA, 5 mM sodium acetate], 5% formaldehyde, 0.1% diethyl pyrocarbonate [DEPC]). The gel was run at 2.5 V/cm for approximately 2 h and then washed with DEPC-treated water for 30 min. The RNA was then transferred to a nylon transfer membrane (MAGNA, 0.45 µm; MSI) using the Posi-blotter from Stratagene.

Growth competition assay. Wild-type and mutant yeast cells were mixed together at approximately a 1:1 ratio. The mixed culture was then diluted about 1,000-fold in the desired medium and incubated at 30°C until it reached the same optical density as before the dilution. This allowed the mixed culture to go through 10 doublings. The culture was then diluted and grown for another 10 doublings. The final culture was collected, and the genomic DNA was prepared and digested with HpaII for Southern blotting. A 306-bp ACC1 fragment was used as a probe. The relative fitness of the mutant strain was calculated by the number of mutant yeast cells divided by the number of wild-type yeast cells in the culture after a certain number of doublings, with the fitness of the wild-type yeast strain set at 1.00.

Assays for -Gal and -Gal. A 10-ml yeast culture was grown to an optical density at 600 nm of 0.4 to 0.6. Cell extracts were prepared, and the -galactosidase (-Gal) and -Gal assays were performed as previously described (16). The protein concentrations were determined using the Coomassie blue G250 assay (Pierce). One -Gal unit is defined as 1 nmol of o-nitrophenyl--D-galactopyranoside hydrolyzed per ml per min. One -Gal unit is defined as 1 nmol of p-nitrophenyl -D-galactopyranoside hydrolyzed per min per ml.

Plasmid titration assay. The ability of Gal4 binding sites to bind Gal4 protein was determined by the binding site's ability to decrease MEL1 expression. Sc18 cells were transformed with plasmid containing Gal4 binding sites and control plasmid. A 10-ml yeast culture was grown using the appropriate selection medium to an optical density at 600 nm of 0.6 to 0.8. Cell extracts were prepared for the -Gal assay, and at the same time, total DNA was purified from the remaining extract. For plasmid YEP351, the copy number was determined using a quantitative Southern blot. The total DNA was digested with EcoRI and PstI. A 1.2-kb EcoRI fragment from YEP351 containing most of LEU2 was used as a probe. The genomic DNA produced a 2.2-kb band which is easily distinguished from the 1.2-kb band from YEP351. The copy number was calculated from the relative intensities of the two bands.

DNA sequencing. The ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit with AmpliTaq DNA polymerase was used for sequencing. One hundred nanograms of PCR product or 1 µg of plasmid DNA was used as the template. The sample was loaded on an ABI 310 genetic analyzer.

Protein purification. The pGEX-CS-Gal4(1-147) expression plasmid was transformed into Escherichia coli strain BL21(pLysS). GST-CS-Gal4(1-147) was purified as previously described (5, 33). Tobacco etch virus protease was added to cleave Gal4(1-147) from the glutathione S-transferase (GST) beads. The digest reaction mixture was incubated for 1 to 2 h at 30°C with gentle shaking. The supernatant was collected for further biochemical studies.

Gel shift. For the assay of Gal4 binding to ACC1, two PCR oligonucleotides, AAACTCGAGCGGTAGAGACTGTTCCGTTC (Acc1.a) and AAACTCGAGCGGCAGAGACATAACCG (Acc1.b), were synthesized according to the sequence of ACC1. Two XhoI sites were created for subsequent cloning purposes. The 158-bp PCR product which contains sites 2 and 3 was labeled with [-³²P]ATP (Amersham) with T4 kinase (Promega). Gal4 DBD (positions 1 to 147) and labeled oligonucleotides were mixed in binding buffer (25 mM Tris [pH 7.5], 50 mM KCl, 10% glycerol, 1 mM EDTA, 1 mM spermidine, 10 µg of bovine serum albumin per ml, 50 µg of salmon sperm DNA/ml, and complete protease inhibitor). The binding reaction mixture was incubated for 20 min at 4°C. The mixtures were loaded on 6% native polyacrylamide gel. The gel was dried in vacuum and finally exposed to a PhosphorImager screen for 30 min. In the competition assays, the consensus UAS_GAL was formed by annealing c1 (TCGAGCGGAGGACTGTCCTCCGG) and c2 (TCGACCGGAGGACAGTCCTCCGC). The mutated Gal4 binding site was formed by annealing m1 (TCGAGCGAAGGACTGTCCTCCAG) and m2 (TCGACTGGAGGACAGTCCTTCGC).

Degenerate PCR. A BLAST search was run using the coding sequence of ACC1 against the Candida albicans DNA database (http://candida.stanford.edu) to determine the conserved residues of ACC1. Based on this comparison, two degenerate PCR primers were synthesized from the highly conserved region of ACC1 (ACC1.d1 [TGGTCNGGTACNGGTGTNGAY] and ACC1.d2 [CNACTTGNAATCTTGGGTTC]). A 552-bp PCR product was obtained from the Kluyveromyces lactis genomic DNA. Sequencing was performed using both primers, and the sequence was aligned with the ACC1 sequence of S. cerevisiae.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Gal4 binds to its sites in the ACC1 gene in vitro. By sequence analysis, we found three potential Gal4 binding sites in the ORF of the ACC1 gene, which encodes acetyl-coenzyme A carboxylase. The ACC1 sites are present in a cluster, resembling those of GAL1-10 genes (Fig. 1). Site 2 and site 3 are separated by only 150 bp. Site 2 is the closest to the consensus UAS_GAL, with 13 matches out of 17 bases, suggesting that it is a strong site. Since the strength of a UAS_GAL generally corresponds to its similarity to the consensus UAS_GAL (35), the predicted strengths of these three sites in the ORF are comparable to those of the UAS_GAL sequences present in well-documented GAL genes, such as GAL1-10 genes (Fig. 1).

View larger version (29K): [in this window] [in a new window]   FIG. 1.   There are three Gal4 binding sites in the ORF of the ACC1 gene. The arrows indicate the direction of transcription. The ORF of ACC1 is 6.7 kb. In the 1-kb 5' region of the ACC1 ORF there are three Gal4 binding sites. Sites 2 and 3 are closer to each other. The Gal4 binding sites in GAL1-10 are also listed. The sequences matching the consensus UASGAL are in boldface type. The fraction listed is the total number of matches out of the 17 bases. The consensus sequence was generalized from all previously identified GAL genes (Li and Johnston, submitted).

View larger version (70K): [in this window] [in a new window]   FIG. 2.   Gel shift assay of sites 2 and 3. A 0.1-pmol portion of radiolabeled PCR fragment containing sites 2 and 3 from the ACC1 ORF was used. C1, C2, and C3 represent one, two, and three Gal4 DBD dimers bound to the probe, respectively. (A) Lanes 1 to 6, 0, 0.0005, 0.0024, 0.012, 0.06, and 0.3 pmol of purified Gal4DBD(1-147). (B) For lanes 2 to 8, 0.15 pmol of Gal4DBD(1-147) was used in binding reactions. For competition, 0.01, 0.1, and 1.0 pmol of cold consensus UASGAL were added (lanes 3 to 5). Then 0.01, 0.1, and 1.0 pmol of cold mutated Gal4 binding sites were added to (lanes 6 to 8).

The Gal4 binding sites in the ORF of ACC1 activate transcription when inserted into a promoter. We then tested if the Gal4 binding sites in the ACC1 ORF can replace an authentic UAS and activate transcription. We used a reporter construct (pMEL--gal) which fuses a -Gal reporter gene to a MEL1 promoter. The single, natural UAS_GAL in MEL1 promoter was eliminated and replaced with a cloning site. MEL1 encodes -Gal and is a member of the GAL regulon. The 150-bp PCR fragment containing sites 2 and 3 was inserted into the MEL1 promoter. As shown in Fig. 3, sites 2 and 3 can induce transcription sixfold in the presence of galactose. The wild-type MEL1 gene is activated 50-fold in galactose. This experiment demonstrates that these sites can function like a natural UAS_GAL when placed in the promoters and that there are no intrinsic difference between the Gal4 binding sites in the ACC1 ORF and those previously found in the promoters of GAL genes. The activation level of sites 2 and 3 is lower than expected, given that the ACC1 sites have a K_d comparable to that of the MEL1 UAS_GAL (35). The lower activation might be due to effects of the sequence between the two sites.

View larger version (12K): [in this window] [in a new window]   FIG. 3.   The Gal4 binding sites in the ORF can function as UASGAL. Sites 2 and 3 were cloned into a reporter construct, pMEL--gal, in which the UASGAL of MEL1 gene was removed and replaced with a cloning site. W303a cells transformed with the pMEL--gal and pMel-ACC1(S2&S3)--gal were grown in glycerol-lactic acid and galactose. -Gal activity was measured as described in the text.

Gal4 binds its sites in the ACC1 ORF in vivo. We have developed a plasmid titration assay to address occupancy of DNA by transcription activators in vivo (34; Xu et al., unpublished). Expression of MEL1 is Gal4 dependent and activated in galactose (23). Gal4 activates the transcription of MEL1 through a single UAS_GAL in its promoter (19), which is not fully occupied under normal conditions as evidenced by increased level of MEL1 expression when Gal4 is overexpressed. When exogenous Gal4 binding sites are introduced into yeast cells, the MEL1 expression level decreases as a result of the titration of Gal4 protein. Therefore, the relative occupancy of Gal4 on the sites of the plasmid is reflected by the relative decrease in the expression level of MEL1 (Fig. 4A).

View larger version (17K): [in this window] [in a new window]   FIG. 4.   Gal4 occupies the sites in ACC1 ORF. (A) The principle of the plasmid titration assay. There is one single weak UASGAL in the promoter of MEL1 (-Gal gene). The expression of MEL1 reflects the available Gal4. When Gal4 binding sites are introduced by a multicopy plasmid, a decreased level of Gal4 will result in a lower level of MEL1. (B) Sc18 cells transformed with Yep351, YEP351-Gal1-10 promoter, and YEP351-ACC1. There are four Gal4 binding sites in the promoter of GAL1-10. The average copy number was determined by Southern blot.

Gal4 represses the transcription of ACC1. In the case of the artificial addition of Leu3 binding sites to an ORF, the observed repression was proposed to be due to the DNA binding of Leu3 (17). Gal4 can exist in two states when bound to DNA. In noninducing medium (raffinose), Gal4 is bound to DNA but transcriptionally inactive due to Gal80 repression. In inducing medium (galactose), Gal4 is bound to its site and capable of activating transcription. We first examined whether these two states had any effect on the transcription of the ACC1 gene. RNA was extracted from the W303 strain grown on either galactose or raffinose and probed for ACC1 transcript levels. Surprisingly, the ACC1 level was approximately fourfold lower when Gal4p was in the inducing (galactose) state (Fig. 5, lanes 1 and 2).

View larger version (62K): [in this window] [in a new window]   FIG. 5.   Gal4 represses the transcription of ACC1. (A) Wild-type (WT) ACC1 mRNA levels in raffinose (lane 1) and galactose (lane 2) and mutant ACC1 mRNA levels in raffinose (lane 3) and galactose (lane 4). In the mutant ACC1, two Gal4 binding sites, sites 2 and 3, were eliminated without changing the codons.

View larger version (60K): [in this window] [in a new window]   FIG. 6.   Active Gal4 is required to repress AccI mRNA. The ACC1 mRNA levels were measured by Northern blot. The sizes of ACC1 mRNA and ACT1 mRNA are 7.2 and 1.2 kb, respectively. ACT1 was used as a control for quantification of ACC1 mRNA levels.

The repression of ACC1 by Gal4 does not affect the growth of yeast S. cerevisiae in galactose. It is generally assumed that activator binding and regulations are physiologically relevant (26). The ACC1 gene is essential and is regulated by the level of phospholipids. One possibility is that the Gal4 binding sites in ACC1 reflect a linkage of the two regulatory systems and that ACC1 regulation plays an undiscovered role in galactose growth. To test for this possibility we used a very sensitive mixed culture growth competition assay to see if the growth rate in galactose medium is altered when sites 2 and 3 are eliminated from ACC1 (Fig. 7). Briefly, wild-type and mutant yeast cells were mixed together at a 1:1 ratio, the mixed culture was grown for a certain number of doublings, and the ratio of wild-type to mutant forms was determined. The site 2 and 3 mutations disrupt a natural HpaII site (CCGG is changed to CAGG). This creates a restriction fragment length polymorphism convenient for discriminating between the wild-type and mutant strains. After 10, 20, and 30 doublings, the ratio of wild-type and mutant remained unchanged in both raffinose and galactose medium (Fig. 7, lanes 2 to 8). This protocol should readily detect effects of 1% or more on fitness. Therefore the elimination of repression of ACC1 transcription by Gal4 does not detectably affect growth in galactose.

View larger version (42K): [in this window] [in a new window]   FIG. 7.   The Gal4 regulation of ACC1 has no effect on growth. The wild-type (WT) and mutant (S2,3) yeast cells were mixed in a 1:1 ratio and grown in raffinose (Raf) or galactose (Gal) for 10 (lanes 2 and 6), 20 (lanes 3 and 7), or 30 (lanes 5 and 8) generations. Southern blots were performed using a ACC1 probe, and the genomic DNA was digested with HpaII. In the site 2 and 3 mutant, one HpaII site was destroyed.

The repression of ACC1 by Gal4 is not conserved in K. lactis K. lactis is closely related to S. cerevisiae, and the galactose system is highly conserved between the two organisms. The K. lactis equivalent of the Gal4 protein, Lac9, is able to recognize identical binding sequences (2, 27). ACC1 is highly conserved between many eukaryotic species. If the ACC1 UAS_GAL sites play a role in galactose growth, they might also be present in the K. lactis ACC1 gene. Therefore, we cloned the relevant part of the K. lactis ACC1 gene to determine if these sites are also present. In order to locate the regions in ACC1 which are likely to be conserved in K. lactis, we aligned the ACC1 sequence from the yeast C. albicans with that from S. cerevisiae. Degenerate oligonucleotides were made, and a PCR fragment of ACC1 was obtained from K. lactis genomic DNA and sequenced. The sequence of K. lactis ACC1 in this region is highly similar to the counterpart in S. cerevisiae, with 76% identity at the DNA level. However, none of the Gal4 (Lac9) sites are present in the K. lactis ACC1 gene. In the K. lactis ACC1 gene, the same amino acids are encoded but the Gal4 binding sites are not conserved (Fig. 8). This comparison between the two yeast strains indicates that the regulation of ACC1 by Gal4 is not conserved, at least in K. lactis.

View larger version (42K): [in this window] [in a new window]   FIG. 8.   Alignment of ACC1 DNA sequences from K. lactis (KL) and S. cerevisiae (SC). The Gal4 binding sites are underlined and in bold type.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

In this study, we investigated the Gal4 binding sites in the ORF of ACC1, showing that Gal4 can bind to these sites both in vitro and in vivo. In galactose, Gal4 represses the transcription of the ACC1 gene when bound to the ORF. This repression requires both Gal4 binding and the induction of Gal4 or deletion of the Gal80 negative regulator. The absence of these UAS_GAL sites eliminates the regulation but does not affect the growth potential in galactose medium, and these sites are not present in K. lactis ACC1, indicating that these sites may not have a critical or conserved biological role.

The Gal4 binding sites in the ACC1 gene are occupied. In order to activate the transcription of GAL genes, Gal4 must occupy its sites in the promoters, and the transcription output depends on the relative occupancy of Gal4 (Xu et al., unpublished). Theoretically, Gal4's occupancy is affected by the concentration of Gal4 protein, the number of specific binding sites, the amount of nonspecific genomic DNA, and the binding affinity of Gal4 to specific and nonspecific DNA. Gal4 is expressed at a low level, about 60 dimers per cell, and it is known that high levels of a potent transcription activator like Gal4 can be toxic to the cell (1, 9). How are these few Gal4 dimers able to locate the UAS_GALs in the yeast genome? Besides the UAS_GAL in the promoters of GAL genes, we have found ~300 potential Gal4 binding sites in the genome, ~80% of which are in the coding regions.

Gal4 represses ACC1 expression by a novel mechanism. Leu3, another acidic activator, regulates the gene involved in leucine biosynthesis and responds to the levels of the metabolic intermediate -isopropylmalate, which serves as a sensor of leucine availability (8). When three Leu3 binding sites were artificially introduced within the RPL16-lacZ reporter, downstream of the start of transcription, the expression of the reporter gene was inhibited threefold (17). Leu3 and Gal4 belong to a super class of zinc finger DNA binding transactivators. They recognize sequences with a similar motif (32). In the case of ACC1, the Gal4 binding sites naturally exist in the downstream region of an ORF.

View larger version (24K): [in this window] [in a new window]   FIG. 9.   A proposed mechanism for Gal4 repressing of ACC1. The Ino2-Ino4 heterodimer activates transcription of ACC1 by binding to the inositol-choline response element (ICRE) and recruiting the general transcription factors. When Gal4 binds in the ORF of ACC1, Gal4 titrates the general transcription factors and competes with Ino2-Ino4. This local squelching effect results in the repression of ACC1 transcription.

Biological role of the UAS_GAL in the ACC1 gene. It is generally assumed that binding and regulation by a regulatory protein imply that the target gene is part of a physiologically relevant pathway (26). Probably the most important aspect of the work we report here is its implication relative to this assumption. Is the regulation of ACC1 by Gal4 a manifestation of an undiscovered metabolic link between galactose metabolism and long-chain fatty acids synthesis, or does it reflect "noise" in regulation due to the random distribution of Gal4 sites? We feel that our data support the latter interpretationthat is, there may be no positive selection to maintain these sites. This conclusion is based on the following considerations. First, the total number of Gal4 binding sites in the yeast genome is almost exactly the number predicted to occur at random, and the number of sites in ORFs is what would be predicted to occur at random (Li and Johnston, submitted). So there does not appear to be any strong selection to limit binding sites to promoters. Second, we did not observe any adverse effect of eliminating the Gal4 binding sites in the ORF of ACC1. Neither growth on rich glucose medium (data not shown) nor growth on galactose was affected by eliminating the Gal4 regulation of the ACC1. In order not to overlook a small growth potential of the wild-type over the mutant, we used a growth competition assay which is very sensitive and can easily pick up a growth difference of 1%. However, we cannot exclude the possibility that this regulation is meaningful for S. cerevisiae under conditions in nature. Third, in a related yeast, K. lactis, we find that the ACC1 gene encodes the identical amino acid sequence in the corresponding regions where Gal4 binding sites are located but that the Gal4 (Lac9) binding sites are not present. The GAL system regulation in these two species is very similar. Therefore, if the Gal4 regulation of ACC1 in S. cerevisiae is biologically relevant, it has not been conserved between the two species.