Previous Article | Next Article 
Molecular and Cellular Biology, April 2001, p. 2533-2544, Vol. 21, No. 7
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.7.2533-2544.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Activation of Hypodermal Differentiation in the
Caenorhabditis elegans Embryo by GATA Transcription
Factors ELT-1 and ELT-3
J. S.
Gilleard1,* and
J. D.
McGhee2
Department of Veterinary Parasitology,
Faculty of Veterinary Medicine, University of Glasgow, Glasgow G61 1QH,
United Kingdom,1 and Department of
Biochemistry and Molecular Biology, Genes and Development Research
Group, Health Sciences Centre, The University of Calgary, Calgary,
Alberta T2N 4N1, Canada2
Received 24 July 2000/Returned for modification 31 August
2000/Accepted 18 December 2000
 |
ABSTRACT |
The Caenorhabditis elegans GATA transcription factor
genes elt-1 and elt-3 are expressed in the
embryonic hypodermis (also called the epidermis). elt-1 is
expressed in precursor cells and is essential for the production of
most hypodermal cells (22). elt-3 is expressed
in all of the major hypodermal cells except the lateral seam cells, and
expression is initiated immediately after the terminal division of
precursor lineages (13). Although this expression pattern
suggests a role for ELT-3 in hypodermal development, no functional
studies have yet been performed. In the present paper, we show that
either elt-3 or elt-1 is sufficient, when force
expressed in early embryonic blastomeres, to activate a program of
hypodermal differentiation even in blastomeres that are not hypodermal
precursors in wild-type embryos. We have deleted the elt-3
gene and shown that ELT-3 is not essential for either hypodermal cell
differentiation or the viability of the organism. We showed that ELT-3
can activate hypodermal gene expression in the absence of ELT-1 and
that, conversely, ELT-1 can activate hypodermal gene expression in the
absence of ELT-3. Overall, the combined results of the mutant
phenotypes, initial expression times, and our forced-expression
experiments suggest that ELT-3 acts downstream of ELT-1 in a redundant
pathway controlling hypodermal cell differentiation.
 |
INTRODUCTION |
There is now substantial
understanding of the way in which maternal genes establish the
anterior-posterior axis and specify the fates of early blastomeres in
the Caenorhabditis elegans embryo (3, 29). In
contrast, much less is known about the way in which particular tissue
types are produced by these blastomeres later in embryogenesis. The
major tissue types of the worm (with the exception of the clonally
derived gut and germline) arise from a variety of different cell
lineages produced by several different early embryonic blastomeres. It
might be anticipated that formation of these tissues will be a complex
process that is likely to involve combinatorial use of a number of
transcription factors.
The nematode hypodermis (also referred to as the epidermis) comprises
the outermost layer of cells of the worm. By completion of
embryogenesis, there are 85 hypodermal nuclei (including specialized nuclei of the head and tail but excluding the rectum) deriving from
four different blastomeres of the 12-cell embryo. Each of these
blastomeres undergoes a complex series of cell divisions that produces
a variety of cell types in addition to the hypodermis. Only one gene
has been shown to be required for the specific formation of hypodermal
tissue i.e., that which encodes GATA transcription factor ELT-1
(22, 31) (for reviews of research on this family of zinc
finger transcription factors, see references 6 and 21).
ELT-1 acts early in hypodermal precursor cells and appears to specify
hypodermal cell fate, as opposed to (or possibly in addition to) being
directly involved in hypodermal differentiation. In elt-1
loss-of-function mutants, precursor cells fail to produce hypodermal
cells but, instead, produce an excess of cell types that are normally
produced by the sister lineage (at least in two of the three major
hypodermal lineages) (22).
The identification of genes acting downstream of the elt-1
gene is an important step in understanding how ELT-1 specifies hypodermal cell fate. One such downstream gene is likely to be that
which encodes zinc finger candidate transcription factor LIN-26
(17, 19). However lin-26 appears to be more
important in the maintenance, rather than the establishment, of
hypodermal cell properties and has functions in cell types besides
strictly hypodermis cells (e.g., neuronal support cells) (17,
19). We have previously described the isolation and
characterization of ELT-3, a second GATA transcription factor expressed
in the C. elegans hypodermis (13). Several
aspects of the expression pattern of the gene for ELT-3 make it a
likely candidate for a gene involved, downstream of ELT-1, in the
control of hypodermal cell differentiation. The initiation of
elt-3 expression is largely dependent on the presence of
elt-1 but appears to be independent of the presence of
lin-26. elt-3 is first expressed immediately following the
terminal division of cell lineages that give rise to hypodermal cells
and is expressed in the hypodermal daughter cell but not in the
nonhypodermal daughter cell of such divisions. elt-3
expression begins shortly before the onset of hypodermal cell
differentiation, and it is possible that ELT-3 is a direct regulator of
hypodermal structural genes, such as the collagen gene dpy-7
(12). elt-3 is expressed exclusively in
hypodermal cells, except for a few cells of the digestive tract later
in development. Indeed, elt-3 is expressed in all of the
major hypodermal cells of the embryo except the lateral seam cells, a
specialized subset of hypodermal cells that remain as blast cells
throughout embryonic and postembryonic development. In the current
study, we investigated the function of elt-3 and the
relationship between elt-1 and elt-3 as a first
step toward working out the transcription factor hierarchy that
controls hypodermal differentiation.
 |
MATERIALS AND METHODS |
Forced expression of elt-3 and
elt-1.
Forced expression of GATA transcription factor
genes was performed using transgenic strains containing chromosomally
integrated plasmids in which the corresponding cDNA had been cloned
downstream of a C. elegans heat shock promoter. The details
of these plasmid constructs can be found in reference 10. The heat
shock promoter used was hsp16-2, which is inactive at 25°C but at
33.5°C is expressed at a high level in most tissues from early
embryogenesis onward (32). We have used several
independently chromosomally integrated transgenic strains (generously
supplied by T. Fukushige) in these experiments. JM53 cals4,
JM54 cals5, and JM55 cals6 all contain the
hsp16-2::elt-1 construct; JM57
cals8 contains the
hsp16-2::elt-2 construct; and JM58
cals9, JM59 cals10, and JM60 cals11
all contain the hsp16-2::elt-3
construct. Most experiments were conducted with all of these strains to
rule out possible variability due to factors such as chromosomal
location and copy number of the integrated constructs; in fact, no
significant differences were found among the three
hsp16-2::elt-1 lines or among the three hsp16-2::elt-3 lines. The designations
hs-elt-3, hs-elt-2, and hs-elt-1 will
be used to describe animals following induction of expression of the
corresponding GATA transcription factor by heat shock. The precise
experimental conditions used are described in the text as appropriate.
We stained hs-elt-3-arrested embryos (JM58, JM59, and JM60)
with an ELT-3-specific antibody (13) and detect widespread
ELT-3 expression throughout the embryo (data not shown). Although we
did not quantitate the level of ELT-3 expression in these embryos, the
intensity of staining was not dramatically different than that seen
with endogenous ELT-3 in the hypodermal cells of control embryos.
Similarly, ELT-2 levels detected when hs-elt-2 embryos are
stained with ELT-2-specific antibody are not dramatically different
than normal ELT-2 levels in the guts of control embryos (T. Fukushige,
personal communication).
Microscopy and counting of cell nuclei.
Microscopy and image
processing were performed essentially as previously described
(11). Embryos were optically sectioned on the z
axis at 1-µm intervals throughout the embryo, and stacked, deconvolved images were analyzed using NIH Image (Scion Corporation).
Laser ablations.
One-cell embryos were mounted in M9 on
gelatin-coated slides (7). Blastomeres were ablated by
pulsing the nuclei with a laser beam from a model VSL-337 nitrogen
laser generator (Laser Science Inc.) until nuclear breakdown and
scarring were visible. The subsequent two rounds of embryonic cell
division were observed to ensure that the appropriate blastomere(s) had
been successfully ablated. Embryos operated on were then subjected to
the heat shock regimen as appropriate (40 min at 33.5°C beginning at
1 h after laser ablation) and then incubated at 20°C for 14 to
18 h before being observed under UV illumination for green fluorescent
protein (GFP) fluorescence.
Isolation of a deletion in the elt-3 gene.
Strain NW1122 (ev616::Tc1), which is homozygous for a Tc1
insertion 1,352 bp downstream of the elt-3 polyadenylation
site (1,843 bp downstream of the T of the stop codon) was kindly
provided by J. Culotti (Samuel Lunenfeld Research Institute, Toronto,
Ontario, Canada). (This strain had a UNC phenotype that could be
segregated from ev616::Tc1 by backcrossing against N2 [data
not shown].) A PCR-based strategy was used to screen for imprecise
excisions of the Tc1 insertion as described in reference 25. Briefly, 200 plates were each seeded with four or five NW1122 L4 hermaphrodites and after several weeks of growth, with the plates nearing starvation, half of the worms were washed off and genomic DNA was prepared (35). A two-dimensional matrix of pooled samples (10 samples per pool) was screened by a single round of PCR using primers flanking the insertion site; primers JG8
5'GTCAGCGGCAGCTGATTGAGTATCG3' and JG13
5'CAACGATGAACGATTATCGAGTGG3' are separated by 3,639 bp of
the wild-type genomic sequence (see Fig. 6A). A 1.4-kb fragment was
detected in one of these pools, and a single positive DNA sample was
identified by repeating the PCR on individual samples contributing to
the positive pool. A dilution method was used to confirm that this PCR
product reflected a germline rather than a somatic excision; a 1-µl
aliquot of the original 200-µl DNA sample was diluted 500-fold, and
PCR was performed on 15 1-µl aliquots of this diluted sample using
two sets of nested primers flanking the insert. The first-round PCR
used primers JG8 and JG13 (see above), and the second-round PCR used
nested primers JG7 (5'GCTCTTAAATGACATTACGGATCGG3') and JG14
(5'CAACTTGACCAACCGACCTATGCGG3'). The amplification of the
product from all 15 aliquots demonstrated that many more template
molecules were present in the original DNA sample than could be
accounted for by a somatic excision event. Sib selection was then
performed on the positive plate by picking 1,000 worms onto 200 plates
(i.e., 5 worms per plate). Following growth on these plates, genomic
DNA was prepared and screened by PCR exactly as for the first round;
three samples yielding the 1.4-kb product were identified. From one of
these positive plates, 500 individual worms were picked to separate
plates, allowed to lay eggs, and then removed to prepare DNA for PCR.
Nine of these worms were positive for the 1.4-kb product. The amplified PCR fragment was sequenced, and a 2,181-bp deletion with a 6-bp GGAAAT
insertion was identified. A homozygous strain was isolated by
identifying single worms in which the deletion was present in 100% of
the progeny tested by PCR. As shown below, the chromosomal deletion was
confirmed by Southern blotting.
A second deletion in the elt-3 gene (nr2088) was
isolated at our request by Nemapharm (Axys Pharmaceuticals) by PCR
screening of populations of chemically mutagenized worms. We used PCR
screening and sib selection as described above to isolate a strain
homozygous for this deletion. Direct sequencing of the PCR product
revealed a 666-bp deletion (with a 19-bp insertion
CGTGGCCCCTTTTGCTAGG) extending from the middle of the first
intron to a point near the end of the third exon.
A multiplex PCR was used to genotype animals at the elt-3
locus in some of the genetic crosses using the JG1 strain. Upstream primer JG20 (5'CAAACTTCGCAACATTCCAACCAGC3') was used in
conjunction with downstream primers JG8c
(5'CAGTGCTTGTTATGTCTTTCTCGG3') and ELT3/1a
(5'CCATCTTTTCTAAGAGACAGTGGACG3'). Downstream primer ELT3/1a, which was complementary to the sequence removed by the
elt-3(vp1) deletion, amplified a 400-bp product from
the wild-type elt-3 allele but no product from the
elt-3(vp1) allele. Primer JG8c, which was
complementary to the sequence 2,874 bp downstream of JG20 in the
wild-type DNA, amplified a 699-bp product from the elt-3(vp1) allele but no band from the wild-type
allele under the PCR conditions used (1-min extension time). This
multiplex PCR distinguished among the genotypes
elt-3(+)/elt3(+) (400-bp product),
elt-3(vp1)/elt-3(vp1) (699-bp
product), and elt-3(+)/elt-3(vp1) (699- and
400-bp products).
Phenotypic analysis.
Brood size and embryonic mortality (at
20 and 25°C) were determined by placing L4 hermaphrodites (10 animals
of each strain) singly onto plates and transferring them daily for 4 days. Unhatched eggs and hatched larvae were counted on each plate
16 h after removal of the adult worms. The rate of development at
20°C was estimated by placing freshly laid eggs singly onto plates
and then, after 60 h at 20°C, examining the plates hourly to
determine the time at which egg laying began. The median development
time for a group of 10 animals from each strain was determined.
RNAi.
RNA-mediated interference (RNAi) was performed
essentially as described in reference 8. RNA was transcribed in vitro
separately from the two complementary strands of the appropriate cloned
cDNA using either T3 or T7 polymerase. The plasmids used as templates were pBluescript plasmids containing either the full-length
elt-3 cDNA (13), an expressed sequence tag
corresponding to the elt-5 gene (pYK446E9), or an expressed
sequence tag corresponding to the elt-6 gene (pYK173E7).
Following in vitro synthesis, the two strands were denatured and then
annealed at 37°C in injection buffer (8).
Double-stranded RNA was injected into the hermaphrodite gonad at a
final concentration of 150 ng/µl. Injected animals were allowed to
recover for 6 h and then transferred to fresh plates every 10 to
14 h; the progeny produced during the 36 h following injection
were examined.
General worm culture, strains, and genetics.
C.
elegans culture and genetic methods were as described in reference
4. The worm strains used were IA105 ijls12, JG5
vpls1, NW1229 evls111, PD4251
ccls4251(I), J1129 elt-1 (zu180)
unc-43(e408)/unc-24(e138) dpy-20(e1282) IV, JM53 cals4,
JM54 cals5, JM55 cals6, JM57 cals8, JM58 cals9, JM59 cals10, JM60 cals11,
NW1122 elt-3(ev616::Tc1), JG1
elt-3(vp1), and NS3239 elt-3(nr2088).
The integrated transgenes were crossed into various hs-GATA strains.
ijls12 (dpy-7::GFP) and
vpls1 (elt-3::GFP) were crossed into
JM53, JM54, JM55, JM57, JM58, JM59, and JM60. evls111
(F25B3.3::GFP) and ccls4251
(myo-3::GFP) were crossed into JM53, JM55, JM57, JM58,
and JM60. Hence, for each reporter gene, the ability of forced
expression to activate marker expression was assayed using at least
two, and in some cases three, independently integrated hs-elt-3 or hs-elt-1 transgenes.
Animals with the genotype elt-1(zu180) unc-43(e408)/+;
elt-3(vp1)/elt-3(vp1) were constructed in the
following manner. elt-1(zu180) unc-43(e408)/unc-24(e138)
dpy-20(e1282) IV hermaphrodites (strain J1129) were crossed with
elt-3(vp1) X males, and F1 animals with the
genotype elt-1(zu180) unc-43(e408)/+;
elt-3(vp1)/+ were identified by progeny testing for the
segregation of arrested embryos (along with failure to segregate Dpy
Uncs) combined with a multiplex PCR using primers that distinguish
elt-3 loci with and without deletions (see above). We then
picked F2 progeny individually to plates and identified
elt-1(zu180) unc-43(e408)/+;
elt-3(vp1)/elt-3(vp1) animals by observing the
segregation of dead embryos and confirming elt-3(vp1)
homozygosity by multiplex PCR.
 |
RESULTS |
Forced ectopic expression of either elt-1 or
elt-3 results in widespread ectopic expression of
hypodermal marker genes.
In order to investigate the function of
the elt-1 and elt-3 genes (and their relationship
to each other), we determined the effects of ectopically expressing
these genes in the pluripotent blastomeres of the early embryo.
Several independent C. elegans transgenic strains have been
produced with chromosomally integrated arrays containing either elt-1 or elt-3 cDNA cloned downstream of the heat
shock promoter gene hsp16-2 (10). These strains
allow elt-1 (strains JM53, JM54, and JM55) or
elt-3 (strains JM58, JM59, and JM60) to be expressed
throughout the embryo in response to the following heat shock regimen.
Two cell embryos are collected, allowed to develop for 1 h at
20°C, incubated at 33.5°C for 40 min, and then returned to 20°C
for 16 to 20 h before assay of marker expression. (As described in
Materials and Methods, we used ELT-3-specific antibody to show that
ELT-3 is indeed expressed throughout the JM58, JM59, and JM60 embryos
in response to heat shock and the intensity of staining was not
dramatically different than that seen with endogenous ELT-3 in the
hypodermal cells of control embryos). The heat shock regimen results in
essentially 100% of hs-elt-3 (strains JM58, JM59, and JM60)
or hs-elt-1 (strains JM53, JM54, and JM55) embryos being
arrested in development as a "ball of cells" with no visible signs
of morphogenesis (Fig. 1A and B). As negative
controls, the same heat shock regimen was performed on wild-type N2
worms and on a strain carrying a chromosomally integrated construct in
which the heat shock promoter drives a cDNA of the endoderm-specific GATA transcription factor gene elt-2 but with a frameshift
mutation introduced upstream of the DNA binding domain
(10). In both of these cases, fewer than 5% of the
embryos were arrested in development. Furthermore, control embryos that
were arrested (presumably because of nonspecific effects of heat shock)
underwent various degrees of morphogenesis and did not resemble the
ball-of-cells phenotype. We concluded that the arrest phenotype is due
to ectopic elt-1 or elt-3 expression.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 1.
(A) DAPI staining of embryos arrested by forced ectopic
expression of elt-3 (A), elt-1 (B), or
elt-2 (C) performed at 60 min of development. Such arrested
embryos appear as a ball of cells and show no visible signs of
morphogenesis.(B) Expression of hypodermal cell markers following
forced ectopic expression of elt-3 (JM60), elt-1
(JM53), or elt-2 (JM57). Shown is the expression of four
hypodermal cell markers, dpy-7::GFP (ijls12) (A,
B, C, and D), LIN-26 antibody (E, F, G, and H),
elt-3::GFP (vpls1) (I, J, K, and L),
and MH27 antibody (M, N, O, and P), in embryos arrested by forced
ectopic expression of elt-3 (B, F, J, and N),
elt-1 (C, G, K, and O), or elt-2 (D, H, L, and
P). The expression of these markers in wild-type comma stage embryos is
shown in parts A, E, I, and M.
|
|
Forced ectopic expression of either elt-1 (strains JM54 and
JM55) or elt-3 (strains JM59 and JM60) produces widespread
expression of three quite different hypodermal markers,
dpy-7::GFP (integrated transgene
ijls12), elt-3::GFP (integrated
transgene vpls1), and LIN-26, which was assayed by a
LIN-26-specific polyclonal antibody (17) (Fig. 1B). As
shown in Fig. 1B, expression of these markers was detected in a large
number of cells throughout the embryo and at a level equal to or
greater than that of wild-type expression. As a control for the
specificity of these forced-expression experiments, we repeated the
experiment with endodermal GATA transcription factor ELT-2
(10). In embryos arrested by hs-elt-2,
expression of hypodermal markers was generally suppressed; only small
numbers of cells in each embryo expressed these hypodermal markers at or near wild-type levels (Fig. 1B, parts D, H, and L). The great majority of cells in hs-elt-2-arrested embryos showed no
detectable expression of lin-26 or
elt-3::GFP. Although
dpy-7::GFP expression was seen throughout
hs-elt-2-arrested embryos, the level of this expression was
dramatically lower than the levels of expression seen in response to
hs-elt-1 or hs-elt-3 or in hypodermal cells of
wild-type embryos (Fig. 1B, part D).
An interesting demonstration of the cell type specificity of these
ectopic expression experiments emerged when we used the monoclonal
antibody MH27 as a marker (Fig. 1B, parts M, N, O, and P). This
antibody recognizes a component of adherens junctions in the cell
membranes of hypodermal, gut, and pharyngeal cells and has become a
standard marker for studying cell morphology in these tissues during
C. elegans development (9, 26). A large number
of cell boundaries stain with MH27 throughout
hs-elt-3-arrested (JM59 and JM60),
hs-elt-1-arrested (JM54 and JM55), and
hs-elt-2-arrested (JM57) embryos (Fig. 1B, parts N, O, and
P). However, the morphology of cells outlined by MH27 is quite
different in hs-elt-3- and hs-elt-1-arrested
embryos compared to hs-elt-2-arrested embryos. The large,
flat MH27-positive cells in the hs-elt-3- and
hs-elt-1-arrested embryos are clearly reminiscent of
hypodermal cells, particularly close to the surface of the arrested
embryos (Fig. 1B, parts N and O). In contrast, the distribution of MH27
staining in hs-elt-2-arrested embryos shows small rings of
fluorescence, quite unlike the cells of hypodermal morphology (Fig. 1B,
part P).
To demonstrate that forced ectopic expression of elt-3 or
elt-1 results in larger numbers of cells expressing
hypodermal cell markers than normally occur in wild-type embryos, we
used confocal sections to count total nuclei
(4',6'-diamidino-2-phenylindole [DAPI] stained),
dpy-7::GFP-expressing nuclei, and
elt-3::GFP-expressing nuclei. The counts are
collected in Table 1 and show that there was
an increase in the number of cells expressing the
dpy-7::GFP and elt-3::GFP
reporter genes relative to wild-type embryos and at the same time there
was a reduction in the total number of nuclei. We examined a
substantially greater number of heat-shocked embryos without making
accurate cell counts, and the same conclusion was drawn, namely, that
additional cells expressing hypodermal cell markers are formed in
response to forced ectopic elt-3 and elt-1
expression.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Numbers of nuclei expressing
dpy-7::GFP and elt-3::GFP
reporter gene markers in embryos arrested by forced expression of
elt-3 (JM60), elt-1(JM53), or elt-2
(JM57)a
|
|
We also found that the two hs-elt-1 transgenic lines (JM54
and JM55) consistently produce arrested embryos with a greater number
of dpy-7::GFP- and
elt-3::GFP-expressing cells than do the
hs-elt-3 transgenic lines (JM58, JM59, and JM60) (Table 1 and data not shown), suggesting that ELT-1 is in some way more effective than ELT-3 in activating hypodermal marker expression. One
possibility is that ELT-1 activates hypodermal gene expression in some
lineages in which ELT-3 does not.
Forced expression of elt-3 or elt-1 in
nonhypodermal precursor cells can activate hypodermal marker gene
expression.
The above-described experiments have shown that forced
ectopic expression of elt-3 or elt-1 results in
additional cells expressing hypodermal cell markers. Although this
result suggests that ELT-3 and ELT-1 are sufficient to activate a
program of hypodermal cell differentiation, these additional
hypodermis-like cells could arise in several ways. For example,
hypodermal cells or lineages could undergo additional divisions or
expression of hypodermal markers could be induced in the immediate
lineal neighbors of hypodermal cells. Hence, we wished to determine
whether at least some of the additional cells that express hypodermal
markers in hs-elt-1 and hs-elt-3 embryos were
derived from precursor cells that do not give rise to hypodermis cells
in wild-type embryos. We approached this problem by ectopically
expressing elt-3 and elt-1 in blastomeres
isolated by laser ablation.
We first examined the effect of forced elt-3 or
elt-1 expression in embryos following isolation of the P1
blastomere. The dpy-7::GFP reporter gene is
expressed exclusively in hypodermal cells, and only 13 of these are
derived from the P1 blastomere. Forced ectopic expression of
elt-3 or elt-1 causes the isolated P1 blastomere
to produce greater than 13 dpy-7::GFP-positive cells (Fig. 2B and D). A variety of controls were
performed to rule out artifacts due to incomplete killing of the AB
blastomere and/or nonspecific effects of heat shock (Fig. 2A, C, E, and
F).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 2.
Activation of dpy-7::GFP and
elt-3::GFP by forced expression of
elt-3 or elt-1 in the isolated P1 blastomere (A
to F) or in the isolated EMS blastomere (G to P). The P1 or EMS
blastomere was isolated by laser ablation in JM60
(hs-elt-3), JM55 (hs-elt-1), and N2 embryos
carrying chromosomally integrated dpy-7::GFP (A to
L) and elt-3::GFP (M to P) reporter genes. One
hour later, embryos were heat shocked at 33.5°C for 40 min and then
allowed to recover for 16 to 20 h. For each experiment, control
embryos were allowed to develop following laser ablation without the
application of heat shock. Each panel shows a typical embryo, and the
values below are the mean number of positive nuclei, the SD, the
maximum number of nuclei counted in a single embryo, and the total
number of embryos examined.
|
|
We next examined the effect of forced elt-3 or
elt-1 expression in embryos following the isolation of the
EMS blastomere. In the wild-type embryo, the isolated EMS blastomere
does not give rise to any hypodermal cells (33) (Fig. 2K
and L). However, following forced ectopic expression of
elt-3 or elt-1, the isolated EMS blastomere
produces a significant number of
dpy-7::GFP-positive cells (Fig. 2G to J). We also
tested the ability of ELT-3 and ELT-1 to activate the expression
of a second hypodermal cell marker, elt-3::GFP, in
the isolated EMS blastomere. In later wild-type embryos, this reporter
is expressed in a small number of cells in addition to hypodermal
cells, probably two of the pharyngeal-intestinal valve cells (vpi3
cells, both derived from the MS lineage) and five intestinal rectal
valve cells and rectal epithelial cells (derived from the AB lineage)
(13). As expected, the elt-3::GFP reporter gene is expressed in a maximum of two cells following isolation of the EMS blastomere by laser ablation (Fig. 2M and O). In
contrast, forced ectopic expression of either elt-3 or elt-1 causes the isolated EMS blastomere to produce
additional elt-3::GFP-positive cells (Fig. 2N and P).
Consistent with the experiments with intact embryos described earlier,
forced ectopic expression of elt-1 induces both P1 (Fig. 2B
and D) and EMS (Table 2) to produce a greater
number of dpy-7::GFP-positive and
elt-3::GFP-positive cells than does forced ectopic
expression of elt-3.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Activation of the dpy-7::GFP
reporter gene following EMS blastomere isolation in several independent
transgenic lines containing chromosomally integrated
hs-elt-3 or hs-elt-1
constructsa
|
|
Forced expression of elt-3 or elt-1
represses the expression of nonhypodermal cell markers.
Does
forced ectopic expression of elt-3 or elt-1
simply activate hypodermal marker gene expression in inappropriate
cells, or does it lead to additional hypodermis like cells being formed as a result of cell fate transformation? One prediction of the latter model is that forced ectopic expression of elt-3 and
elt-1, in addition to activating hypodermal marker
gene expression, should concomitantly extinguish the expression of
marker genes from nonhypodermal lineages (Fig.
3). myo-3::GFP is
expressed in the 81 bodywall muscle cells of wild-type embryos
(8), but myo-3::GFP is
only expressed in a mean of 7.5 and 4.5 cells of embryos arrested by forced expression of elt-3 and elt-1,
respectively (Fig. 3A and B). Similarly, the marker pF25B3.3::GFP
is expressed in more than 200 neuronal cells in wild-type embryos (D. Pilgrim, personal communication) but is only expressed in a mean of 7.1 and 11.7 cells of embryos arrested by forced expression of
elt-3 and elt-1, respectively (Fig. 3C and D).
Hence, in contrast to the widespread expression of hypodermal markers,
few cells in the arrested embryos express neuronal and muscle cell
markers. Expression of gut cell markers (MH33 and gut granules) is
likewise suppressed in hs-elt-3- and
hs-elt-1-arrested embryos (10) (J. S. Gilleard, data not shown). Overall, our results are best interpreted in
terms of a model in which forced ectopic expression of elt-3
or elt-1 results in additional cells being transformed into
hypodermal cells.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of body wall muscle marker
myo-3::GFP and neuronal marker
F25B3.3::GFP following forced ectopic elt-3 or
elt-1 expression. Transgenes from strains
ccls4215 (myo-3::GFP) and
evls111 (F25B3.3::GFP) were crossed into strains
JM60 (hs-elt-3) and JM53 (hs-elt-1). The doubly
transgenic embryos were then subjected to a 40-min heat shock of
33.5°C at 1 h of development and examined 16 h later. Each
panel shows a typical embryo, together with the mean number of
GFP-positive nuclei observed and the total number of embryos examined
(n). Panels A and B show the expression of the
myo-3::GFP marker, and panels C and D show the
F25B3.3::GFP marker in embryos following forced expression of
either elt-3 (A and C) or elt-1 (B and D). WT,
wild type.
|
|
ELT-3 and ELT-1 can only activate ectopic hypodermal marker gene
expression during a restricted time period in early embryogenesis.
We investigated whether the ability of ELT-3 and ELT-1 to induce
the formation of additional hypodermis-like cells was restricted to the
time of embryogenesis when blastomeres were still pluripotent. Embryos
were harvested at the two-cell stage, allowed to develop for defined
periods of time at 20°C, and then heat shocked at 33.5°C for 40 min. Following heat shock, embryos were allowed to develop overnight at
20°C before being assayed for marker expression. As described above,
forced expression of elt-3 or elt-1 during the
first 2 h of development causes developmental arrest in
essentially 100% of the embryos with a ball-of-cells phenotype (Fig.
4). Essentially all of these arrested embryos
show widespread expression of the dpy-7::GFP,
elt-3::GFP, LIN-26, and MH27 hypodermal markers
(data not shown). This arrest phenotype is not seen when either
elt-1 or elt-3 expression is induced later than
3 h beyond the two-cell stage of development (Fig. 4).
Furthermore, accurate counts show that only embryos arrested with the
ball-of-cells phenotype contain more cells expressing hypodermal
markers than occur in wild-type embryos (data not shown). During the
first 2 h of C. elegans embryogenesis, most blastomeres are
pluripotent. However, inspection of the embryonic lineage
(33) suggests that after 3 h of development, the
majority of cells are committed to adopting a particular tissue or
organ fate. Hence, we concluded that forced ectopic expression of
elt-3 or elt-1 can induce the production of
additional hypodermis-like cells only from pluripotent cells and not
from cells that are already involved in alternative differentiation
programs. Forced expression of either elt-1 or
elt-3 later than 3 h does, however, produce a variety
of morphological abnormalities in the embryos, with elt-1
being significantly more effective than elt-3 (Fig. 4 and
data not shown).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 4.
Results of forced ectopic expression of (A)
elt-3 (JM60) and (B) elt-1 (JM53) performed at
different times of embryogenesis. The x axis shows the time
(in minutes) elapsed between the isolation of two cell embryos and the
beginning of a 40-min period of heat shock (at 33.5°C). Embryos were
examined 16 h after the heat shock period. The y axis
shows the percentage of embryos in each of three phenotypic categories:
ball of cells, i.e., embryos that undergo developmental arrest without
any visible signs of morphogenesis; abnormal morphogenesis, i.e.,
embryos in which morphogenesis proceeds but in which a variety of
abnormalities (including "lumpy-dumpy" phenotypes and the presence
of vacuoles) are visible in late embryos or hatched larvae; and embryos
with apparently wild-type development.
|
|
ELT-3 can activate hypodermal gene expression in the absence of
ELT-1 function.
If ELT-3 acts downstream of ELT-1 in the pathway
that controls hypodermal differentiation, we would predict that ELT-3
could still activate hypodermal gene expression in the absence of ELT-1 function. The availability of the elt-1(zu180) mutant
allowed us to test this prediction. Although Page et al.
(22) have reported that elt-1(zu180) mutant
embryos lack any cells with hypodermal morphology, the existence of
some hypodermal cells in elt-1(zu180) mutant embryos is
suggested by the presence of a small number of
elt-3::GFP-positive cells (13).
Indeed, we measured a mean of 11.9 (standard deviation [SD], 3.7;
n = 31) dpy-7::GFP-positive cells
(maximum, 16) in arrested embryos segregating from strain JG42
elt-1(zu180) unc-43(e408)lunc-24(e138)
dpy-20(e1282) IV; ijls12. We do not know the lineal
origin of this small number of hypodermal cells in
elt-1(zu180) mutant embryos, but some of them may
be the "minor" hypodermal cells of the head and tail in which
elt-3 and dpy-7 are expressed (13)
but elt-1 is not (22). However, the important
conclusion with respect to the following experiment is that a maximum
of 16 dpy-7::GFP-expressing cells are formed in
elt-1(u180) mutant embryos.
To test if ELT-3 can activate hypodermal gene expression in the
absence of ELT-1 function, we constructed strain JG48, with the
genotype elt-1(zu180) unc-43(e408)lunc-24(e138)
dpy-20(e1282) IV; cals10; ijls12. As
expected, in the absence of heat shock, approximately 25% of JG48
embryos were arrested in development and all showed fewer than 17 dpy-7::GFP-expressing cells (Fig. 5A). In contrast, heat shock induction of
elt-3 expression in JG48 embryos caused widespread
dpy-7::GFP expression in almost all of the embryos
examined, 25% of which were predicted to be elt-1(zu180)
homozygotes (Fig. 5B). Indeed, comparison of heat-shocked JG48 embryos
with heat-shocked JG10 embryos (genotype cals10 ijls12 but
wild type for the elt-1 gene) revealed no differences either in the proportion of embryos with widespread
dpy-7::GFP expression (Fig. 5B and C) or in
the number of dpy-7::GFP-expressing cells in individual
arrested embryos (data not shown). Thus, we concluded that forced
expression of elt-3 can activate hypodermal gene expression in the absence of elt-1 function.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
Forced expression of elt-3 in
elt-1(zu180) mutant embryos. Each panel shows a typical
arrested embryo and the number of embryos that were arrested with
either fewer than 17, between 18 and 40, or greater than 40 GFP-positive nuclei, respectively.(A) Control JG48 elt-1(zu180)
unc-43(e408)lunc-24(e138) dpy-20(e1282) IV; cals10;
ijls12 embryos examined for dpy-7::GFP
expression in the absence of heat shock. The photomicrograph shows two
typical elt-1(zu180) embryos. The number of embryos arrested
with fewer than 17 GFP-positive nuclei is shown; the remaining embryos,
which hatched as L1s with the wild-type dpy-7 expression
pattern, are shown in the >40 column.(B and C) JG48
elt-1(zu180) unc-43(e408)lunc-24(e138) dpy-20(e1282)
IV; cals10; ijls12 and JG10 (cals10 ijls12)
embryos examined for dpy-7::GFP expression
after heat shock induction of elt-3 expression. Two-cell
embryos were allowed to develop at room temperature for 1 h, heat
shocked at 33.5°C for 40 min, and examined for GFP expression 16 to
20 h later. The photomicrographs show representative embryos
following heat shock.
|
|
The elt-3 gene is not essential for hypodermal
differentiation or for viability of C. elegans.
Having
shown that ELT-3 is sufficient to activate a program of hypodermal
differentiation, we next determined whether ELT-3 is necessary for this
program. We used the method of imprecise excision of a Tc1 transposon
(25, 38) to disrupt the elt-3 gene. Strain
NW1122 (ev616::Tc1), isolated in the
laboratory of J. Culotti, contains a Tc1 insertion 1,352 bp downstream
of the elt-3 polyadenylation site (1,843 bp downstream of
the T of the stop codon). We screened populations of worms from this
strain by PCR and isolated a strain that contains a deletion of 2,181 bp, accompanied by a 6-bp GGAAAT insertion. This deletion removes the
entire DNA binding domain (Fig. 6A). The
strain was backcrossed 15 times against N2, resulting in strain JG1,
which is homozygous for the deletion allele elt-3(vp1) as
assessed by PCR and by genomic Southern blotting (Fig. 6B and data not
shown). Homozygous elt-3(vp1) animals were morphologically
indistinguishable from the wild type, had a normal brood size with
~100% of the embryos hatching (at either 20 or 25°C), and had a
normal rate of development at 20°C (Fig. 6F). The expression of
hypodermal cell markers (LIN-26, dpy-7::GFP, and
MH27) was also indistinguishable from that in the wild type (Fig. 6C,
D, and E). At our request, Nemapharm (Axys Pharmaceuticals) has
isolated a second deletion in the elt-3 gene using PCR
screening of chemically mutagenized worms. Strain NS3239 is homozygous
for elt-3(nr2088), a 666-bp deletion (with an insertion of
19 bp [CGTGGCCCCTTTTGCTAGG]) that extends from the middle
of the first intron to a point inside the third exon. There are no identifiable 3' splice acceptor sites downstream of the deletion that
might allow variant splicing to maintain the reading frame, and thus,
this deletion is likely to result in a truncated polypeptide lacking
the DNA binding domain. elt-3(nr2088)-homozygous animals (after backcrossing three times against N2) are also viable and have a
normal brood size, morphology, hatching frequency, development time,
and expression of hypodermal markers (Fig. 6F and data not shown).
Finally, injection of in vitro-synthesized double-stranded RNA
corresponding to the full-length elt-3 transcript
(elt-3 RNAi) (8) also failed to produce a
visible phenotype. Hence, we concluded that the elt-3 gene
is not essential for C. elegans viability or, within the
limits of our phenotypic analysis, normal hypodermal differentiation
and development.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 6.
Chromosomal deletion of the elt-3 gene. (A)
Schematic representation of the elt-3 genomic locus. Exons
are shown as boxes, and noncoding sequence are shown as lines. Strain
NW1122 (ev616) was screened for deletions induced by
imprecise Tc1 excision using primers at the positions indicated by open
arrowheads. The elt-3(vp1) deletion was isolated and shown
by direct sequencing to remove the elt-3 DNA binding domain.
A homozygous strain was isolated by sib selection and backcrossed 15 times against N2. The elt-3(nr2088) deletion was isolated
following chemical mutagenesis (Axys Pharmaceuticals, San Francisco,
Calif.). (B) Southern blot of N2 worms (lanes 1 and 4), JG1 worms
before backcrossing (lanes 2 and 5), and JG1 worms after 15 backcrosses
(lanes 3 and 6). Genomic DNA was digested with EcoRV (lanes
1, 2, and 3) or ApaI (lanes 4, 5, and 6) and probed with the
858-bp fragment indicated in panel A. The positions of the
EcoRV and ApaI sites are also indicated in panel
A. The blot shows that the JG1 strain is homozygous for the
elt-3(vp1) deletion. (C, D, and E) Comma stage
JG1(vp1) embryos stained with LIN-26 antibody and MH27
antibody and expressing dpy-7::GFP, respectively.
The expression of these markers and the morphology of the hypodermis
appear indistinguishable from those of the wild type. This was also
true for pretzel stage embryos and L1 larvae (data not shown). (F)
Summary of reproduction and development parameters from
JG1(vp1) and NS3239(nr2088) worms. The final
column shows median development times with the ranges in parentheses.
|
|
In order to test the ability of ectopic elt-1 to
activate hypodermal gene expression in the absence of ELT-3 function,
we constructed strain JG49, with the genotype cals5;
ijls12; elt-3(vp1). Heat shock induction of
elt-1 expression in JG49 embryos (33.5°C for 40 min
at 1 h after the two-cell stage) resulted in widespread expression
of dpy-7::GFP at levels comparable to those
obtained in the same experiment done with elt-3+
embryos (data not shown). In other words ELT-1 can activate hypodermal gene expression in the absence of ELT-3 function, a result consistent with the lack of phenotype of the elt-3 deletion mutants.
Presumably, ectopic elt-1 expression activates
hypodermal gene expression either directly or through genes redundant
with elt-3.
Testing for functional redundancy between ELT-3 and other members
of the C. elegans GATA transcription factor family.
The C. elegans genomic sequence is essentially complete
(2) and reveals a total of 11 genes clearly identifiable
as genes that encode GATA-type transcription factors. The expression of seven of these genes appears to be confined to the endoderm and/or mesoderm (10, 14, 37) (M. Maduro and J. L. Rothman,
personal communication), and their products would not be expected to
have embryonic functions that overlap those of ELT-3. The remaining two
genes (in addition to elt-1 and elt-3) are
elt-5 (F55A8.1) and elt-6 (F52C12.5). These form
an apparent discistronic unit that is expressed throughout the ectoderm
but at a particularly high level in lateral seam cells (K. Koh and
J. L. Rothman, personal communication). These two genes appear to
have overlapping (i.e., mutually redundant) functions that are critical
to lateral seam cell development (Koh and Rothman, personal
communication). We found that reduction of elt-5 gene
function using RNAi in N2 worms gave a highly penetrant larval arrest
phenotype but that reduction of elt-6 function by RNAi had
no visible effect (in agreement with the unpublished results of Koh and
Rothman; elt-5 is the upstream gene of the apparent
dicistron, and RNAi of elt-5 appears to interfere with the
expression of both elt-5 and elt-6). The result
from RNAi with these two genes, performed either separately or
combined, is indistinguishable whether performed in N2 or JG1 elt-3(vp1) worms (data not shown). In other words, RNAi
experiments provide no evidence for redundancy among elt-3,
elt-5, and elt-6. Because RNAi is not effective
for all zygotically expressed genes, confirmation of these results must
await the production of elt-5 and elt-6 deletion mutants.
Because elt-1 mutant embryos arrest development before
elt-3 is first expressed, neither RNAi nor the available
loss-of-function mutants can be used to investigate possible functional
redundancy between elt-3 and elt-1. As an
alternative, we have tested the effect of reducing the copy number of
the elt-1 wild-type allele in an elt-3
homozygous mutant background. The progeny of seven hermaphrodites with
the genotype elt-1(zu180) unc-43(e408)/+; elt-3(vp1)/elt-3(vp1) were examined; 24.3% of the embryos
were arrested (464 arrested embryos from 1,909 total progeny examined), but the remaining viable progeny showed no visible abnormalities. Since
two-thirds of the viable progeny are predicted to be heterozygous for
elt-1(zu180), we concluded that reducing the copy number of the wild-type elt-1 allele in elt-3
null mutant animals does not produce a detectable phenotype. Further
investigation of possible redundancy between elt-1 and
elt-3 must await the isolation of a conditional
elt-1 mutant or the development of inducible inhibition.
 |
DISCUSSION |
The role of ELT-3 and ELT-1 in hypodermal development.
The
GATA transcription factor ELT-1 has been shown to be required for
hypodermal precursor cells to produce hypodermal cell fates
(22). We have previously described a second hypodermal GATA transcription factor, ELT-3 (13). elt-3 is
first expressed later than elt-1, immediately before the
onset of hypodermal differentiation. In the present paper, we have
shown that either elt-1 or elt-3, when force
expressed in early blastomeres, is sufficient to activate the
expression of a collection of hypodermal markers, even in blastomeres
that would ordinarily never produce hypodermal cells in wild-type
embryos. This set of hypodermal markers comprises two transcription
factors, a cuticle collagen gene and an adherens junction component.
Forced ectopic ELT-1 and ELT-3 expression also represses the expression
of muscle, neuron, and endoderm markers. Overall, the expression of
such a range of functionally unrelated markers, together with the
repression of nonhypodermal marker genes, suggests that either ELT-1 or
ELT-3 is able to activate a significant portion of the hypodermal
differentiation program in nonhypodermal cells. This may actually
constitute a change in cell fate.
ELT-3 can activate hypodermal gene expression in the absence of a
functional elt-1 gene, showing that ELT-3 does not activate hypodermal differentiation simply by activating elt-1
expression. These results, within the limitations of ectopic-expression
experiments, are also consistent with the idea that ELT-3 acts
downstream of ELT-1 or in an independent pathway. Since ELT-1 is
essential for the formation of the majority of hypodermal cells, the
existence of such a pathway seems unlikely. It is not yet known whether ELT-1 directly activates elt-3 expression, but this is a
distinct possibility; there are nine WGATAR consensus motifs within the 1.3 kb upstream of the elt-3 gene. Indeed, one particular
240-bp region contains seven of these sites, six of which have the
sequence TGATAA. This sequence is possibly a preferred ELT-1 binding
site, since an A residue immediately 3' to the GATA core motif was
found to be essential for ELT-1 binding as assayed by activation of reporter gene expression in yeast (30).
We have shown that ELT-3 function is not essential, either for
hypodermal differentiation or for C. elegans viability,
suggesting that at least one other gene acts redundantly with
elt-3 downstream of elt-1. This suggestion is
consistent with the results of a deficiency screen (covering
approximately 75% of the genome) in which a number of C. elegans loci were identified that, when deleted, resulted in
morphological abnormalities of the hypodermis (5). However, only one deficiency (covering the elt-1 locus)
resulted in a specific failure in hypodermal cell formation. Other
deficiencies that produced a significant loss of hypodermal cells also
resulted in a low total embryonic cell number, suggesting a general
role in cell proliferation rather than a specific role in hypodermal differentiation. Furthermore, a number of forward genetic screens have
failed to identify mutations (other than elt-1) that result in a specific reduction in hypodermal cell number (I. L. Johnstone and M. Labouesse, personal communications). Although there are classes
of genes that might have been missed in such screens, e.g., genes
acting maternally or genes with additional early embryonic functions,
the simplest interpretation is that the core program of hypodermal cell
differentiation is controlled in a redundant manner. The identification
of elt-3 as a gene that is sufficient but not essential for
activation of the hypodermal differentiation program supports this conclusion.
Two other GATA factors (in addition to elt-1 and
elt-3) are known to be expressed in ectodermal tissues,
elt-5 and elt-6 (Koh and Rothman, personal
communication). However, RNAi with these genes in the elt-3
mutant background did not unveil any enhanced phenotype that would
indicate functional overlap with elt-3. This is not entirely
surprising, since the predominant function of the genes for these two
factors, as determined by RNAi (Koh and Rothman, personal
communication), is in lateral seam cells, a specialized subset of
hypodermal cells in which elt-3 is not expressed.
In spite of the fact that deletion of elt-3 causes no
apparent phenotype, it must be recalled that a gene highly similar to elt-3 (100% amino acid identity within the predicted DNA
binding domain) exists in the related nematode Caenorhabditis
briggsae, suggesting that elt-3 does indeed play an
evolutionarily significant role (13).
General principles of tissue and organ development.
The
results of our experiments with elt-1 and elt-3
are generally consistent with the framework of tissue and organ
development described by Labouesse and Mango (18), who
have suggested that genes involved in controlling the development of
organs and tissues in C. elegans can be divided into organ
and tissue identity genes and organ and tissue differentiation genes.
An organ and tissue identity gene is defined as a gene that acts before
terminal differentiation in precursor cells to specify the fate of
cells that will comprise a particular organ or tissue. In contrast, a
differentiation gene activates the process of differentiation itself
and controls, either directly or indirectly, the expression of terminal
differentiation markers. Labouesse and Mango (18) defined
tissue and organ identity genes by three characteristics (see also
reference 15). First, absence of the gene leads to the
loss of a tissue due to a cell fate transformation. Second, the gene is
able to activate the tissue developmental program in naive blastomeres.
Third, the gene is expressed early in precursor cells, before the onset
of terminal differentiation. The first and third of these
characteristics have already been demonstrated for elt-1
(22). Our results now show that elt-1 can
indeed activate a program of hypodermal cell differentiation in naive blastomeres.
Our experiments also show that elt-3 broadly fits the
definition of a tissue differentiation gene, as defined by the
following three characteristics. First, mutations in differentiation
genes, unlike those in identity genes, do not prevent the formation of an organ or tissue. Second, ectopic expression of differentiation genes
leads to ectopic expression of appropriate terminal differentiation markers. Third, expression begins after expression of the identity gene
(in this case, elt-1) but before terminal differentiation. elt-3 fulfills all of these criteria.
Although the distinction between identity and differentiation genes is
useful as a general framework, it is likely to be an oversimplification. Our results suggest that there is a large degree of
functional overlap between elt-1 (identity gene) and elt-3 (differentiation gene), in that they produce similar
effects when force expressed in naive blastomeres. We cannot
distinguish between activation of a tissue developmental program and
activation of appropriate terminal differentiation markers because the
markers are generally the same. We will be able to make such a
distinction only when we know the direct downstream targets of ELT-1
and ELT-3.
Our results have also revealed a marked difference in the effectiveness
with which the endodermal GATA factors and the hypodermal GATA factors
induce marker gene expression in naive blastomeres. Forced expression
of the endodermal GATA factors end-1 and elt-2 causes essentially 100% of the cells in the early embryo to express endodermal markers (10, 36). In contrast, forced
expression of elt-1 or elt-3 causes a maximum of
30 to 40% of embryonic cells to express hypodermal markers. The
explanation for this may lie in differences between the embryonic
origins of hypodermal and endodermal cells. Endoderm is a simple clonal
lineage; end-1 and elt-2 are expressed early in
the lineage, and perhaps they are able to issue a simple "become
endoderm" command to all other embryonic blastomeres. In contrast,
hypodermis is derived from several rather complex lineages and
elt-1, in particular, is expressed in hypodermal precursor
cells at a time when they will go on to produce a variety of other cell
types in addition to hypodermis. Perhaps elt-1 (and
elt-3) is not able to issue a simple "become hypodermis"
command but must operate in a context of other factors that make
hypodermal cell lineages distinct from nonhypodermal sister lineages
such as nerves or muscles. Perhaps only those cells in the embryo that
contain these additional factors are able to express hypodermal markers
in response to ectopic hypodermal GATA factors.
Nematode GATA factors and redundancy.
We have found that the
C. elegans GATA factor ELT-3 is not essential for either
viability or, within the limits of our phenotypic analysis, normal
development. There are now null mutations available for 3 of the 11 known C. elegans GATA factors in addition to the elt-3 deletions described here. Both elt-1 and
elt-2 are essential genes involved in hypodermal and
endodermal development, respectively (10, 22). A
chromosomal deletion that removes the endodermal GATA factor gene
end-1, along with a considerable number of other genes (or
the elimination of end-1 together with a second GATA factor
gene, end-3), results in failure of endoderm formation (37). However, a deletion that removes only the
end-1 gene appears not to affect endoderm specification
(Rothman, personal communication). RNAi experiments conducted on the
remaining seven genes by a number of laboratories suggest that these
may have redundant functions (K. Koh, M. Maduro, and J. L. Rothman, personal communication; J. S. Gilleard, T. Fukushige, and
J. D. McGhee, unpublished data). Although confirmation of this
statement must await deletion or mutation of the remaining family
members, there is growing evidence that the majority of the C. elegans GATA transcription factors are functionally redundant.
This is in marked contrast to the vertebrate GATA factors, all of which
(GATA-1 to GATA-6) have been shown to have essential functions by gene
knockout experiments with-mice or, in the case of GATA-5, zebra fish
(16, 20, 23, 24, 27, 34). It is also noteworthy that in
spite of the greater complexity of vertebrates, they appear to have
only half of the number of GATA factors present in C. elegans. Although it is possible that additional vertebrate GATA
factors await to be discovered, the recently completed Drosophila
melanogaster genome sequence (1, 28) predicts only
four GATA factors in the fly. Hence, the GATA factors represent an
example of a gene family that is larger and more redundant in nematodes
than in apparently more complex organisms.
 |
ACKNOWLEDGMENTS |
We thank J. Culotti (Toronto, Ontario, Canada) for strains NW1122
and NW1129, Axys Pharmaceuticals (San Francisco, Calif.) for strain
NS3239, Andrew Fire (Baltimore, Md.) for providing convenient reporter
vectors, Barbara Page (Seattle, Wash.) for strain J1129, Michel
Labouesse (Strasbourg, France) for the LIN-26 antibody, R. Waterson
(St. Louis, Mo.) for the MH27 antibody, Iain Johnstone (Glasgow, United
Kingdom) for strain IA105, and Kyunghee Koh and Joel Rothman (Santa
Barbara, Calif.) for generously providing information prior to
publication. Particular thanks are due to Tetsunari Fukushige (Calgary,
Alberta, Canada) for providing strains JM53 through JM60. Several
strains in this work were supplied by the Caenorhabditis Genetics
Centre, which is funded by the NIH Centre for Research Resources.
This work was funded by the Wellcome Trust by virtue of a Wellcome
Trust Prize Traveling Fellowship (J.G.) and by the Medical Research
Council of Canada (J.D.M.). J.D.M. is a Medical Scientist of the
Alberta Heritage Foundation for Medical Research.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Veterinary Parasitology, Bearsden Rd., University of Glasgow, Glasgow G61 1QH, United Kingdom. Phone: 141-330-5604. Fax: 141-330-5603. E-mail: j.gilleard{at}vet.gla.ac.uk.
 |
REFERENCES |
| 1.
|
Adams, M. D.,
S. E. Celniker,
R. A. Holt,
C. A. Evans,
J. D. Gocayne,
P. G. Amanatides,
S. E. Scherer,
P. W. Li,
R. A. Hoskins,
R. F. Galle,
R. A. George,
S. E. Lewis,
S. Richards,
M. Ashburner,
S. N. Henderson,
G. G. Sutton,
J. R. Wortman,
M. D. Yandell,
Q. Zhang,
L. X. Chen,
R. C. Brandon,
Y. H. Rogers,
R. G. Blazej,
M. Champe,
B. D. Pfeiffer,
K. H. Wan,
C. Doyle,
E. G. Baxter,
G. Helt,
C. R. Nelson,
G. L. Gabor Miklos,
J. F. Abril,
A. Agbayani,
H. J. An,
C. Andrews-Pfannkoch,
D. Baldwin,
R. M. Ballew,
A. Basu,
J. Baxendale,
L. Bayraktaroglu,
E. M. Beasley,
K. Y. Beeson,
P. V. Benos,
B. P. Berman,
D. Bhandari,
S. Bolshakov,
D. Borkova,
M. R. Botchan,
J. Bouck,
P. Brokstein,
P. Brottier,
K. C. Burtis,
D. A. Busam,
H. Butler,
E. Cadieu,
A. Center,
I. Chandra,
J. M. Cherry,
S. Cawley,
C. Dahlke,
L. B. Davenport,
P. Davies,
B. de Pablos,
A. Delcher,
Z. Deng,
A. D. Mays,
I. Dew,
S. M. Dietz,
K. Dodson,
L. E. Doup,
M. Downes,
S. Dugan-Rocha,
B. C. Dunkov,
P. Dunn,
K. J. Durbin,
C. C. Evangelista,
C. Ferraz,
S. Ferriera,
W. Fleischmann,
C. Fosler,
A. E. Gabrielian,
N. S. Garg,
W. M. Gelbart,
K. Glasser,
A. Glodek,
F. Gong,
J. H. Gorrell,
Z. Gu,
P. Guan,
M. Harris,
N. L. Harris,
D. Harvey,
T. J. Heiman,
J. R. Hernandez,
J. Houck,
D. Hostin,
K. A. Houston,
T. J. Howland,
M. H. Wei,
C. Ibegwam, et al.
2000.
The genome sequence of Drosophila melanogaster
Science
287:2185-195[Abstract/Free Full Text].
|
| 2.
|
Anonymous.
1998.
Genome sequence of the nematode C. elegans: a platform for investigating biology. The C. elegans Sequencing Consortium.
Science
282:2012-2018[Abstract/Free Full Text].
|
| 3.
|
Bowerman, B.
1998.
Maternal control of pattern formation in early Caenorhabditis elegans embryos.
Curr. Top. Dev. Biol.
39:73-117[Medline].
|
| 4.
|
Brenner, S.
1974.
The genetics of Caenorhabditis elegans.
Genetics
77:71-94[Abstract/Free Full Text].
|
| 5.
|
Chanal, P., and M. Labouesse.
1997.
A screen for genetic loci required for hypodermal cell and glial-like cell development during Caenorhabditis elegans embryogenesis.
Genetics
146:207-226[Abstract].
|
| 6.
|
Charron, F., and M. Nemer.
1999.
GATA transcription factors and cardiac development.
Semin. Cell Dev. Biol.
10:85-91[CrossRef][Medline].
|
| 7.
|
Edgar, L. G., and J. D. McGhee.
1986.
Embryonic expression of a gut-specific esterase in Caenorhabditis elegans.
Dev. Biol.
114:109-118[CrossRef][Medline].
|
| 8.
|
Fire, A.,
S. Xu,
M. K. Montgomery,
S. A. Kostas,
S. E. Driver, and C. C. Mello.
1998.
Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.
Nature
391:806-811[CrossRef][Medline].
|
| 9.
|
Francis, G. R., and R. H. Waterston.
1985.
Muscle organization in Caenorhabditis elegans: localization of proteins implicated in thin filament attachment and I-band organization.
J. Cell Biol.
101:1532-1549[Abstract/Free Full Text].
|
| 10.
|
Fukushige, T.,
M. G. Hawkins, and J. D. McGhee.
1998.
The GATA-factor elt-2 is essential for formation of the Caenorhabditis elegans intestine.
Dev. Biol.
198:286-302[Medline].
|
| 11.
|
Fukushige, T.,
M. J. Hendzel,
D. P. Bazett-Jones, and J. D. McGhee.
1999.
Direct visualization of the elt-2 gut-specific GATA factor binding to a target promoter inside the living Caenorhabditis elegans embryo.
Proc. Natl. Acad. Sci. USA
96:11883-11888[Abstract/Free Full Text].
|
| 12.
|
Gilleard, J. S.,
J. D. Barry, and I. L. Johnstone.
1997.
cis regulatory requirements for hypodermal cell-specific expression of the Caenorhabditis elegans cuticle collagen gene dpy-7.
Mol. Cell. Biol.
17:2301-2311[Abstract].
|
| 13.
|
Gilleard, J. S.,
Y. Shafi,
J. D. Barry, and J. D. McGhee.
1999.
ELT-3: a Caenorhabditis elegans GATA factor expressed in the embryonic epidermis during morphogenesis.
Dev. Biol.
208:265-280[CrossRef][Medline].
|
| 14.
|
Hawkins, M. G., and J. D. McGhee.
1995.
elt-2, a second GATA factor from the nematode Caenorhabditis elegans.
J. Biol. Chem.
270:14666-14671[Abstract/Free Full Text].
|
| 15.
|
Kalb, J. M.,
K. K. Lau,
B. Goszczynski,
T. Fukushige,
D. Moons,
P. G. Okkema, and J. D. McGhee.
1998.
pha-4 is Ce-fkh-1, a fork head/HNF-3alpha, beta, gamma homolog that functions in organogenesis of the C. elegans pharynx.
Development
125:2171-2180[Abstract].
|
| 16.
|
Koutsourakis, M.,
A. Langeveld,
R. Patient,
R. Beddington, and F. Grosveld.
1999.
The transcription factor GATA-6 is essential for early extraembryonic development.
Development
126(9):723-732[Abstract]. (Corrected and republished with original paging; originally, Development 126(4):723-732, 1999.)
|
| 17.
|
Labouesse, M.,
E. Hartwieg, and H. R. Horvitz.
1996.
The Caenorhabditis elegans LIN-26 protein is required to specify and/or maintain all non-neuronal ectodermal cell fates.
Development
122:2579-2588[Abstract].
|
| 18.
|
Labouesse, M., and S. E. Mango.
1999.
Patterning the C. elegans embryo: moving beyond the cell lineage.
Trends Genet.
15:307-313[CrossRef][Medline].
|
| 19.
|
Labouesse, M.,
S. Sookhareea, and H. R. Horvitz.
1994.
The Caenorhabditis elegans gene lin-26 is required to specify the fates of hypodermal cells and encodes a presumptive zinc-finger transcription factor.
Development
120:2359-2368[Abstract/Free Full Text].
|
| 20.
|
Molkentin, J. D.,
Q. Lin,
S. A. Duncan, and E. N. Olson.
1997.
Requirement of the transcription factor GATA-4 for heart tube formation and ventral morphogenesis.
Genes Dev.
11:1061-1072[Abstract/Free Full Text].
|
| 21.
|
Orkin, S. H.
1995.
Hematopoiesis: how does it happen?
Curr. Orkin. Cell Biol.
7:870-877.
|
| 22.
|
Page, B. D.,
W. Zhang,
K. Steward,
T. Blumenthal, and J. R. Priess.
1997.
ELT-1, a GATA-like transcription factor, is required for epidermal cell fates in Caenorhabditis elegans embryos.
Genes Dev.
11:1651-1661[Abstract/Free Full Text].
|
| 23.
|
Pandolfi, P. P.,
M. E. Roth,
A. Karis,
M. W. Leonard,
E. Dzierzak,
F. G. Grosveld,
J. D. Engel, and M. H. Lindenbaum.
1995.
Targeted disruption of the GATA-3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoiesis.
Nat. Genet.
11:40-44[CrossRef][Medline].
|
| 24.
|
Pevny, L.,
M. C. Simon,
E. Robertson,
W. H. Klein,
S. F. Tsai,
V. D'Agati,
S. H. Orkin, and F. Costantini.
1991.
Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1.
Nature
349:257-260[CrossRef][Medline].
|
| 25.
|
Plasterk, R. H. A.
1995.
Reverse genetics: from gene sequence to mutant worm, p. 59-80.
In
H. F. Epstein, and D. C. Shakes (ed.), Caenorhabditis elegans: modern biological analysis of an organism, vol. 48. Academic Press, Inc., New York, N.Y.
|
| 26.
|
Podbilewicz, B., and J. G. White.
1994.
Cell fusions in the developing epithelial of C. elegans.
Dev. Biol.
161:408-424[CrossRef][Medline].
|
| 27.
|
Reiter, J. F.,
J. Alexander,
A. Rodaway,
D. Yelon,
R. Patient,
N. Holder, and D. Y. Stainier.
1999.
GATA-5 is required for the development of the heart and endoderm in zebrafish.
Genes Dev.
13:2983-2995[Abstract/Free Full Text].
|
| 28.
|
Rubin, G. M.,
M. D. Yandell,
J. R. Wortman,
G. L. Gabor Miklos,
C. R. Nelson,
I. K. Hariharan,
M. E. Fortini,
P. W. Li,
R. Apweiler,
W. Fleischmann,
J. M. Cherry,
S. Henikoff,
M. P. Skupski,
S. Misra,
M. Ashburner,
E. Birney,
M. S. Boguski,
T. Brody,
P. Brokstein,
S. E. Celniker,
S. A. Chervitz,
D. Coates,
A. Cravchik,
A. Gabrielian,
R. F. Galle,
W. M. Gelbart,
R. A. George,
L. S. Goldstein,
F. Gong,
P. Guan,
N. L. Harris,
B. A. Hay,
R. A. Hoskins,
J. Li,
Z. Li,
R. O. Hynes,
S. J. Jones,
P. M. Kuehl,
B. Lemaitre,
J. T. Littleton,
D. K. Morrison,
C. Mungall,
P. H. O'Farrell,
O. K. Pickeral,
C. Shue,
L. B. Vosshall,
J. Zhang,
Q. Zhao,
X. H. Zheng,
F. Zhong,
W. Zhong,
R. Gibbs,
J. C. Venter,
M. D. Adams, and S. Lewis.
2000.
Comparative genomics of the eukaryotes.
Science
287:2204-2215[Abstract/Free Full Text].
|
| 29.
|
Schnabel, R. P., Jr.
1997.
Specification of cell fates in the early embryo, p. 361-382.
In
D. L. Riddle, T. Blumenthal, B. J. Meyer, and J. R. Priess (ed.), C. elegans II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 30.
|
Shim, Y. H.,
J. J. Bonner, and T. Blumenthal.
1995.
Activity of a C. elegans GATA transcription factor, ELT-1, expressed in yeast.
J. Mol. Biol.
253:665-676[CrossRef][Medline].
|
| 31.
|
Spieth, J.,
Y. H. Shim,
K. Lea,
R. Conrad, and T. Blumenthal.
1991.
ELT-1, an embryonically expressed Caenorhabditis elegans gene homologous to the GATA transcription factor family.
Mol. Cell. Biol.
11:4651-4659[Abstract/Free Full Text].
|
| 32.
|
Stringham, E. G.,
D. K. Dixon,
D. Jones, and E. P. Candido.
1992.
Temporal and spatial expression patterns of the small heat shock (hsp16) genes in transgenic Caenorhabditis elegans.
Mol. Biol. Cell
3:221-233[Abstract].
|
| 33.
|
Sulston, J. E.,
E. Schierenberg,
J. G. White, and J. N. Thomson.
1983.
The embryonic cell lineage of the nematode Caenorhabditis elegans.
Dev. Biol.
100:64-119[CrossRef][Medline].
|
| 34.
|
Tsai, F. Y.,
G. Keller,
F. C. Kuo,
M. Weiss,
J. Chen,
M. Rosenblatt,
F. W. Alt, and S. H. Orkin.
1994.
An early haematopoietic defect in mice lacking the transcription factor GATA-2.
Nature
371:221-226[CrossRef][Medline].
|
| 35.
|
Williams, B. D.
1995.
Genetic mapping with polymorphic sequence tagged sites, p. 81-96.
In
H. F. Epstein, and D. C. Shakes (ed.), Caenorhabditis elegans: modern biological analysis of an organism, vol. 48. Academic Press, Inc., New York, N.Y.
|
| 36.
|
Zhu, J.,
T. Fukushige,
J. D. McGhee, and J. H. Rothman.
1998.
Reprogramming of early embryonic blastomeres into endodermal progenitors by a Caenorhabditis elegans GATA factor.
Genes Dev.
12:3809-3814[Abstract/Free Full Text].
|
| 37.
|
Zhu, J.,
R. J. Hill,
P. J. Heid,
M. Fukuyama,
A. Sugimoto,
J. R. Priess, and J. H. Rothman.
1997.
end-1 encodes an apparent GATA factor that specifies the endoderm precursor in Caenorhabditis elegans embryos.
Genes Dev.
11:2883-2896[Abstract/Free Full Text].
|
| 38.
|
Zwaal, R. R.,
A. Broeks,
J. van Meurs,
J. T. Groenen, and R. H. Plasterk.
1993.
Target-selected gene inactivation in Caenorhabditis elegans by using a frozen transposon insertion mutant bank.
Proc. Natl. Acad. Sci. USA
90:7431-7435[Abstract/Free Full Text].
|
Molecular and Cellular Biology, April 2001, p. 2533-2544, Vol. 21, No. 7
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.7.2533-2544.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Smith, J. A., McGarr, P., Gilleard, J. S.
(2005). The Caenorhabditis elegans GATA factor elt-1 is essential for differentiation and maintenance of hypodermal seam cells and for normal locomotion. J. Cell Sci.
118: 5709-5719
[Abstract]
[Full Text]
-
Baugh, L. R., Hill, A. A., Claggett, J. M., Hill-Harfe, K., Wen, J. C., Slonim, D. K., Brown, E. L., Hunter, C. P.
(2005). The homeodomain protein PAL-1 specifies a lineage-specific regulatory network in the C. elegans embryo. Development
132: 1843-1854
[Abstract]
[Full Text]
-
Baugh, L. R., Hill, A. A., Slonim, D. K., Brown, E. L., Hunter, C. P.
(2003). Composition and dynamics of the Caenorhabditis elegans early embryonic transcriptome. Development
130: 889-900
[Abstract]
[Full Text]
-
Koh, K., Rothman, J. H.
(2001). ELT-5 and ELT-6 are required continuously to regulate epidermal seam cell differentiation and cell fusion in C. elegans. Development
128: 2867-2880
[Abstract]
[Full Text]