INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

There is now substantial understanding of the way in which maternal genes establish the anterior-posterior axis and specify the fates of early blastomeres in the Caenorhabditis elegans embryo (3, 29). In contrast, much less is known about the way in which particular tissue types are produced by these blastomeres later in embryogenesis. The major tissue types of the worm (with the exception of the clonally derived gut and germline) arise from a variety of different cell lineages produced by several different early embryonic blastomeres. It might be anticipated that formation of these tissues will be a complex process that is likely to involve combinatorial use of a number of transcription factors.

The nematode hypodermis (also referred to as the epidermis) comprises the outermost layer of cells of the worm. By completion of embryogenesis, there are 85 hypodermal nuclei (including specialized nuclei of the head and tail but excluding the rectum) deriving from four different blastomeres of the 12-cell embryo. Each of these blastomeres undergoes a complex series of cell divisions that produces a variety of cell types in addition to the hypodermis. Only one gene has been shown to be required for the specific formation of hypodermal tissue i.e., that which encodes GATA transcription factor ELT-1 (22, 31) (for reviews of research on this family of zinc finger transcription factors, see references 6 and 21). ELT-1 acts early in hypodermal precursor cells and appears to specify hypodermal cell fate, as opposed to (or possibly in addition to) being directly involved in hypodermal differentiation. In elt-1 loss-of-function mutants, precursor cells fail to produce hypodermal cells but, instead, produce an excess of cell types that are normally produced by the sister lineage (at least in two of the three major hypodermal lineages) (22).

The identification of genes acting downstream of the elt-1 gene is an important step in understanding how ELT-1 specifies hypodermal cell fate. One such downstream gene is likely to be that which encodes zinc finger candidate transcription factor LIN-26 (17, 19). However lin-26 appears to be more important in the maintenance, rather than the establishment, of hypodermal cell properties and has functions in cell types besides strictly hypodermis cells (e.g., neuronal support cells) (17, 19). We have previously described the isolation and characterization of ELT-3, a second GATA transcription factor expressed in the C. elegans hypodermis (13). Several aspects of the expression pattern of the gene for ELT-3 make it a likely candidate for a gene involved, downstream of ELT-1, in the control of hypodermal cell differentiation. The initiation of elt-3 expression is largely dependent on the presence of elt-1 but appears to be independent of the presence of lin-26. elt-3 is first expressed immediately following the terminal division of cell lineages that give rise to hypodermal cells and is expressed in the hypodermal daughter cell but not in the nonhypodermal daughter cell of such divisions. elt-3 expression begins shortly before the onset of hypodermal cell differentiation, and it is possible that ELT-3 is a direct regulator of hypodermal structural genes, such as the collagen gene dpy-7 (12). elt-3 is expressed exclusively in hypodermal cells, except for a few cells of the digestive tract later in development. Indeed, elt-3 is expressed in all of the major hypodermal cells of the embryo except the lateral seam cells, a specialized subset of hypodermal cells that remain as blast cells throughout embryonic and postembryonic development. In the current study, we investigated the function of elt-3 and the relationship between elt-1 and elt-3 as a first step toward working out the transcription factor hierarchy that controls hypodermal differentiation.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Forced expression of elt-3 and elt-1. Forced expression of GATA transcription factor genes was performed using transgenic strains containing chromosomally integrated plasmids in which the corresponding cDNA had been cloned downstream of a C. elegans heat shock promoter. The details of these plasmid constructs can be found in reference 10. The heat shock promoter used was hsp16-2, which is inactive at 25°C but at 33.5°C is expressed at a high level in most tissues from early embryogenesis onward (32). We have used several independently chromosomally integrated transgenic strains (generously supplied by T. Fukushige) in these experiments. JM53 cals4, JM54 cals5, and JM55 cals6 all contain the hsp16-2::elt-1 construct; JM57 cals8 contains the hsp16-2::elt-2 construct; and JM58 cals9, JM59 cals10, and JM60 cals11 all contain the hsp16-2::elt-3 construct. Most experiments were conducted with all of these strains to rule out possible variability due to factors such as chromosomal location and copy number of the integrated constructs; in fact, no significant differences were found among the three hsp16-2::elt-1 lines or among the three hsp16-2::elt-3 lines. The designations hs-elt-3, hs-elt-2, and hs-elt-1 will be used to describe animals following induction of expression of the corresponding GATA transcription factor by heat shock. The precise experimental conditions used are described in the text as appropriate. We stained hs-elt-3-arrested embryos (JM58, JM59, and JM60) with an ELT-3-specific antibody (13) and detect widespread ELT-3 expression throughout the embryo (data not shown). Although we did not quantitate the level of ELT-3 expression in these embryos, the intensity of staining was not dramatically different than that seen with endogenous ELT-3 in the hypodermal cells of control embryos. Similarly, ELT-2 levels detected when hs-elt-2 embryos are stained with ELT-2-specific antibody are not dramatically different than normal ELT-2 levels in the guts of control embryos (T. Fukushige, personal communication).

Microscopy and counting of cell nuclei. Microscopy and image processing were performed essentially as previously described (11). Embryos were optically sectioned on the z axis at 1-µm intervals throughout the embryo, and stacked, deconvolved images were analyzed using NIH Image (Scion Corporation).

Laser ablations. One-cell embryos were mounted in M9 on gelatin-coated slides (7). Blastomeres were ablated by pulsing the nuclei with a laser beam from a model VSL-337 nitrogen laser generator (Laser Science Inc.) until nuclear breakdown and scarring were visible. The subsequent two rounds of embryonic cell division were observed to ensure that the appropriate blastomere(s) had been successfully ablated. Embryos operated on were then subjected to the heat shock regimen as appropriate (40 min at 33.5°C beginning at 1 h after laser ablation) and then incubated at 20°C for 14 to 18 h before being observed under UV illumination for green fluorescent protein (GFP) fluorescence.

Isolation of a deletion in the elt-3 gene. Strain NW1122 (ev616::Tc1), which is homozygous for a Tc1 insertion 1,352 bp downstream of the elt-3 polyadenylation site (1,843 bp downstream of the T of the stop codon) was kindly provided by J. Culotti (Samuel Lunenfeld Research Institute, Toronto, Ontario, Canada). (This strain had a UNC phenotype that could be segregated from ev616::Tc1 by backcrossing against N2 [data not shown].) A PCR-based strategy was used to screen for imprecise excisions of the Tc1 insertion as described in reference 25. Briefly, 200 plates were each seeded with four or five NW1122 L4 hermaphrodites and after several weeks of growth, with the plates nearing starvation, half of the worms were washed off and genomic DNA was prepared (35). A two-dimensional matrix of pooled samples (10 samples per pool) was screened by a single round of PCR using primers flanking the insertion site; primers JG8 5'GTCAGCGGCAGCTGATTGAGTATCG3' and JG13 5'CAACGATGAACGATTATCGAGTGG3' are separated by 3,639 bp of the wild-type genomic sequence (see Fig. 6A). A 1.4-kb fragment was detected in one of these pools, and a single positive DNA sample was identified by repeating the PCR on individual samples contributing to the positive pool. A dilution method was used to confirm that this PCR product reflected a germline rather than a somatic excision; a 1-µl aliquot of the original 200-µl DNA sample was diluted 500-fold, and PCR was performed on 15 1-µl aliquots of this diluted sample using two sets of nested primers flanking the insert. The first-round PCR used primers JG8 and JG13 (see above), and the second-round PCR used nested primers JG7 (5'GCTCTTAAATGACATTACGGATCGG3') and JG14 (5'CAACTTGACCAACCGACCTATGCGG3'). The amplification of the product from all 15 aliquots demonstrated that many more template molecules were present in the original DNA sample than could be accounted for by a somatic excision event. Sib selection was then performed on the positive plate by picking 1,000 worms onto 200 plates (i.e., 5 worms per plate). Following growth on these plates, genomic DNA was prepared and screened by PCR exactly as for the first round; three samples yielding the 1.4-kb product were identified. From one of these positive plates, 500 individual worms were picked to separate plates, allowed to lay eggs, and then removed to prepare DNA for PCR. Nine of these worms were positive for the 1.4-kb product. The amplified PCR fragment was sequenced, and a 2,181-bp deletion with a 6-bp GGAAAT insertion was identified. A homozygous strain was isolated by identifying single worms in which the deletion was present in 100% of the progeny tested by PCR. As shown below, the chromosomal deletion was confirmed by Southern blotting.

Phenotypic analysis. Brood size and embryonic mortality (at 20 and 25°C) were determined by placing L4 hermaphrodites (10 animals of each strain) singly onto plates and transferring them daily for 4 days. Unhatched eggs and hatched larvae were counted on each plate 16 h after removal of the adult worms. The rate of development at 20°C was estimated by placing freshly laid eggs singly onto plates and then, after 60 h at 20°C, examining the plates hourly to determine the time at which egg laying began. The median development time for a group of 10 animals from each strain was determined.

RNAi. RNA-mediated interference (RNAi) was performed essentially as described in reference 8. RNA was transcribed in vitro separately from the two complementary strands of the appropriate cloned cDNA using either T3 or T7 polymerase. The plasmids used as templates were pBluescript plasmids containing either the full-length elt-3 cDNA (13), an expressed sequence tag corresponding to the elt-5 gene (pYK446E9), or an expressed sequence tag corresponding to the elt-6 gene (pYK173E7). Following in vitro synthesis, the two strands were denatured and then annealed at 37°C in injection buffer (8). Double-stranded RNA was injected into the hermaphrodite gonad at a final concentration of 150 ng/µl. Injected animals were allowed to recover for 6 h and then transferred to fresh plates every 10 to 14 h; the progeny produced during the 36 h following injection were examined.

General worm culture, strains, and genetics. C. elegans culture and genetic methods were as described in reference 4. The worm strains used were IA105 ijls12, JG5 vpls1, NW1229 evls111, PD4251 ccls4251(I), J1129 elt-1 (zu180) unc-43(e408)/unc-24(e138) dpy-20(e1282) IV, JM53 cals4, JM54 cals5, JM55 cals6, JM57 cals8, JM58 cals9, JM59 cals10, JM60 cals11, NW1122 elt-3(ev616::Tc1), JG1 elt-3(vp1), and NS3239 elt-3(nr2088).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Forced ectopic expression of either elt-1 or elt-3 results in widespread ectopic expression of hypodermal marker genes. In order to investigate the function of the elt-1 and elt-3 genes (and their relationship to each other), we determined the effects of ectopically expressing these genes in the pluripotent blastomeres of the early embryo.

View larger version (41K): [in this window] [in a new window]   FIG. 1.   (A) DAPI staining of embryos arrested by forced ectopic expression of elt-3 (A), elt-1 (B), or elt-2 (C) performed at 60 min of development. Such arrested embryos appear as a ball of cells and show no visible signs of morphogenesis.(B) Expression of hypodermal cell markers following forced ectopic expression of elt-3 (JM60), elt-1 (JM53), or elt-2 (JM57). Shown is the expression of four hypodermal cell markers, dpy-7::GFP (ijls12) (A, B, C, and D), LIN-26 antibody (E, F, G, and H), elt-3::GFP (vpls1) (I, J, K, and L), and MH27 antibody (M, N, O, and P), in embryos arrested by forced ectopic expression of elt-3 (B, F, J, and N), elt-1 (C, G, K, and O), or elt-2 (D, H, L, and P). The expression of these markers in wild-type comma stage embryos is shown in parts A, E, I, and M.

Forced expression of elt-3 or elt-1 in nonhypodermal precursor cells can activate hypodermal marker gene expression. The above-described experiments have shown that forced ectopic expression of elt-3 or elt-1 results in additional cells expressing hypodermal cell markers. Although this result suggests that ELT-3 and ELT-1 are sufficient to activate a program of hypodermal cell differentiation, these additional hypodermis-like cells could arise in several ways. For example, hypodermal cells or lineages could undergo additional divisions or expression of hypodermal markers could be induced in the immediate lineal neighbors of hypodermal cells. Hence, we wished to determine whether at least some of the additional cells that express hypodermal markers in hs-elt-1 and hs-elt-3 embryos were derived from precursor cells that do not give rise to hypodermis cells in wild-type embryos. We approached this problem by ectopically expressing elt-3 and elt-1 in blastomeres isolated by laser ablation.

View larger version (47K): [in this window] [in a new window]   FIG. 2.   Activation of dpy-7::GFP and elt-3::GFP by forced expression of elt-3 or elt-1 in the isolated P1 blastomere (A to F) or in the isolated EMS blastomere (G to P). The P1 or EMS blastomere was isolated by laser ablation in JM60 (hs-elt-3), JM55 (hs-elt-1), and N2 embryos carrying chromosomally integrated dpy-7::GFP (A to L) and elt-3::GFP (M to P) reporter genes. One hour later, embryos were heat shocked at 33.5°C for 40 min and then allowed to recover for 16 to 20 h. For each experiment, control embryos were allowed to develop following laser ablation without the application of heat shock. Each panel shows a typical embryo, and the values below are the mean number of positive nuclei, the SD, the maximum number of nuclei counted in a single embryo, and the total number of embryos examined.

Forced expression of elt-3 or elt-1 represses the expression of nonhypodermal cell markers. Does forced ectopic expression of elt-3 or elt-1 simply activate hypodermal marker gene expression in inappropriate cells, or does it lead to additional hypodermis like cells being formed as a result of cell fate transformation? One prediction of the latter model is that forced ectopic expression of elt-3 and elt-1, in addition to activating hypodermal marker gene expression, should concomitantly extinguish the expression of marker genes from nonhypodermal lineages (Fig. 3). myo-3::GFP is expressed in the 81 bodywall muscle cells of wild-type embryos (8), but myo-3::GFP is only expressed in a mean of 7.5 and 4.5 cells of embryos arrested by forced expression of elt-3 and elt-1, respectively (Fig. 3A and B). Similarly, the marker pF25B3.3::GFP is expressed in more than 200 neuronal cells in wild-type embryos (D. Pilgrim, personal communication) but is only expressed in a mean of 7.1 and 11.7 cells of embryos arrested by forced expression of elt-3 and elt-1, respectively (Fig. 3C and D). Hence, in contrast to the widespread expression of hypodermal markers, few cells in the arrested embryos express neuronal and muscle cell markers. Expression of gut cell markers (MH33 and gut granules) is likewise suppressed in hs-elt-3- and hs-elt-1-arrested embryos (10) (J. S. Gilleard, data not shown). Overall, our results are best interpreted in terms of a model in which forced ectopic expression of elt-3 or elt-1 results in additional cells being transformed into hypodermal cells.

View larger version (66K): [in this window] [in a new window]   FIG. 3.   Expression of body wall muscle marker myo-3::GFP and neuronal marker F25B3.3::GFP following forced ectopic elt-3 or elt-1 expression. Transgenes from strains ccls4215 (myo-3::GFP) and evls111 (F25B3.3::GFP) were crossed into strains JM60 (hs-elt-3) and JM53 (hs-elt-1). The doubly transgenic embryos were then subjected to a 40-min heat shock of 33.5°C at 1 h of development and examined 16 h later. Each panel shows a typical embryo, together with the mean number of GFP-positive nuclei observed and the total number of embryos examined (n). Panels A and B show the expression of the myo-3::GFP marker, and panels C and D show the F25B3.3::GFP marker in embryos following forced expression of either elt-3 (A and C) or elt-1 (B and D). WT, wild type.

ELT-3 and ELT-1 can only activate ectopic hypodermal marker gene expression during a restricted time period in early embryogenesis. We investigated whether the ability of ELT-3 and ELT-1 to induce the formation of additional hypodermis-like cells was restricted to the time of embryogenesis when blastomeres were still pluripotent. Embryos were harvested at the two-cell stage, allowed to develop for defined periods of time at 20°C, and then heat shocked at 33.5°C for 40 min. Following heat shock, embryos were allowed to develop overnight at 20°C before being assayed for marker expression. As described above, forced expression of elt-3 or elt-1 during the first 2 h of development causes developmental arrest in essentially 100% of the embryos with a ball-of-cells phenotype (Fig. 4). Essentially all of these arrested embryos show widespread expression of the dpy-7::GFP, elt-3::GFP, LIN-26, and MH27 hypodermal markers (data not shown). This arrest phenotype is not seen when either elt-1 or elt-3 expression is induced later than 3 h beyond the two-cell stage of development (Fig. 4). Furthermore, accurate counts show that only embryos arrested with the ball-of-cells phenotype contain more cells expressing hypodermal markers than occur in wild-type embryos (data not shown). During the first 2 h of C. elegans embryogenesis, most blastomeres are pluripotent. However, inspection of the embryonic lineage (33) suggests that after 3 h of development, the majority of cells are committed to adopting a particular tissue or organ fate. Hence, we concluded that forced ectopic expression of elt-3 or elt-1 can induce the production of additional hypodermis-like cells only from pluripotent cells and not from cells that are already involved in alternative differentiation programs. Forced expression of either elt-1 or elt-3 later than 3 h does, however, produce a variety of morphological abnormalities in the embryos, with elt-1 being significantly more effective than elt-3 (Fig. 4 and data not shown).

View larger version (35K): [in this window] [in a new window]   FIG. 4.   Results of forced ectopic expression of (A) elt-3 (JM60) and (B) elt-1 (JM53) performed at different times of embryogenesis. The x axis shows the time (in minutes) elapsed between the isolation of two cell embryos and the beginning of a 40-min period of heat shock (at 33.5°C). Embryos were examined 16 h after the heat shock period. The y axis shows the percentage of embryos in each of three phenotypic categories: ball of cells, i.e., embryos that undergo developmental arrest without any visible signs of morphogenesis; abnormal morphogenesis, i.e., embryos in which morphogenesis proceeds but in which a variety of abnormalities (including "lumpy-dumpy" phenotypes and the presence of vacuoles) are visible in late embryos or hatched larvae; and embryos with apparently wild-type development.

ELT-3 can activate hypodermal gene expression in the absence of ELT-1 function. If ELT-3 acts downstream of ELT-1 in the pathway that controls hypodermal differentiation, we would predict that ELT-3 could still activate hypodermal gene expression in the absence of ELT-1 function. The availability of the elt-1(zu180) mutant allowed us to test this prediction. Although Page et al. (22) have reported that elt-1(zu180) mutant embryos lack any cells with hypodermal morphology, the existence of some hypodermal cells in elt-1(zu180) mutant embryos is suggested by the presence of a small number of elt-3::GFP-positive cells (13). Indeed, we measured a mean of 11.9 (standard deviation [SD], 3.7; n = 31) dpy-7::GFP-positive cells (maximum, 16) in arrested embryos segregating from strain JG42 elt-1(zu180) unc-43(e408)lunc-24(e138) dpy-20(e1282) IV; ijls12. We do not know the lineal origin of this small number of hypodermal cells in elt-1(zu180) mutant embryos, but some of them may be the "minor" hypodermal cells of the head and tail in which elt-3 and dpy-7 are expressed (13) but elt-1 is not (22). However, the important conclusion with respect to the following experiment is that a maximum of 16 dpy-7::GFP-expressing cells are formed in elt-1(u180) mutant embryos.

View larger version (27K): [in this window] [in a new window]   FIG. 5.   Forced expression of elt-3 in elt-1(zu180) mutant embryos. Each panel shows a typical arrested embryo and the number of embryos that were arrested with either fewer than 17, between 18 and 40, or greater than 40 GFP-positive nuclei, respectively.(A) Control JG48 elt-1(zu180) unc-43(e408)lunc-24(e138) dpy-20(e1282) IV; cals10; ijls12 embryos examined for dpy-7::GFP expression in the absence of heat shock. The photomicrograph shows two typical elt-1(zu180) embryos. The number of embryos arrested with fewer than 17 GFP-positive nuclei is shown; the remaining embryos, which hatched as L1s with the wild-type dpy-7 expression pattern, are shown in the >40 column.(B and C) JG48 elt-1(zu180) unc-43(e408)lunc-24(e138) dpy-20(e1282) IV; cals10; ijls12 and JG10 (cals10 ijls12) embryos examined for dpy-7::GFP expression after heat shock induction of elt-3 expression. Two-cell embryos were allowed to develop at room temperature for 1 h, heat shocked at 33.5°C for 40 min, and examined for GFP expression 16 to 20 h later. The photomicrographs show representative embryos following heat shock.

The elt-3 gene is not essential for hypodermal differentiation or for viability of C. elegans. Having shown that ELT-3 is sufficient to activate a program of hypodermal differentiation, we next determined whether ELT-3 is necessary for this program. We used the method of imprecise excision of a Tc1 transposon (25, 38) to disrupt the elt-3 gene. Strain NW1122 (ev616::Tc1), isolated in the laboratory of J. Culotti, contains a Tc1 insertion 1,352 bp downstream of the elt-3 polyadenylation site (1,843 bp downstream of the T of the stop codon). We screened populations of worms from this strain by PCR and isolated a strain that contains a deletion of 2,181 bp, accompanied by a 6-bp GGAAAT insertion. This deletion removes the entire DNA binding domain (Fig. 6A). The strain was backcrossed 15 times against N2, resulting in strain JG1, which is homozygous for the deletion allele elt-3(vp1) as assessed by PCR and by genomic Southern blotting (Fig. 6B and data not shown). Homozygous elt-3(vp1) animals were morphologically indistinguishable from the wild type, had a normal brood size with ~100% of the embryos hatching (at either 20 or 25°C), and had a normal rate of development at 20°C (Fig. 6F). The expression of hypodermal cell markers (LIN-26, dpy-7::GFP, and MH27) was also indistinguishable from that in the wild type (Fig. 6C, D, and E). At our request, Nemapharm (Axys Pharmaceuticals) has isolated a second deletion in the elt-3 gene using PCR screening of chemically mutagenized worms. Strain NS3239 is homozygous for elt-3(nr2088), a 666-bp deletion (with an insertion of 19 bp [CGTGGCCCCTTTTGCTAGG]) that extends from the middle of the first intron to a point inside the third exon. There are no identifiable 3' splice acceptor sites downstream of the deletion that might allow variant splicing to maintain the reading frame, and thus, this deletion is likely to result in a truncated polypeptide lacking the DNA binding domain. elt-3(nr2088)-homozygous animals (after backcrossing three times against N2) are also viable and have a normal brood size, morphology, hatching frequency, development time, and expression of hypodermal markers (Fig. 6F and data not shown). Finally, injection of in vitro-synthesized double-stranded RNA corresponding to the full-length elt-3 transcript (elt-3 RNAi) (8) also failed to produce a visible phenotype. Hence, we concluded that the elt-3 gene is not essential for C. elegans viability or, within the limits of our phenotypic analysis, normal hypodermal differentiation and development.

View larger version (35K): [in this window] [in a new window]   FIG. 6.   Chromosomal deletion of the elt-3 gene. (A) Schematic representation of the elt-3 genomic locus. Exons are shown as boxes, and noncoding sequence are shown as lines. Strain NW1122 (ev616) was screened for deletions induced by imprecise Tc1 excision using primers at the positions indicated by open arrowheads. The elt-3(vp1) deletion was isolated and shown by direct sequencing to remove the elt-3 DNA binding domain. A homozygous strain was isolated by sib selection and backcrossed 15 times against N2. The elt-3(nr2088) deletion was isolated following chemical mutagenesis (Axys Pharmaceuticals, San Francisco, Calif.). (B) Southern blot of N2 worms (lanes 1 and 4), JG1 worms before backcrossing (lanes 2 and 5), and JG1 worms after 15 backcrosses (lanes 3 and 6). Genomic DNA was digested with EcoRV (lanes 1, 2, and 3) or ApaI (lanes 4, 5, and 6) and probed with the 858-bp fragment indicated in panel A. The positions of the EcoRV and ApaI sites are also indicated in panel A. The blot shows that the JG1 strain is homozygous for the elt-3(vp1) deletion. (C, D, and E) Comma stage JG1(vp1) embryos stained with LIN-26 antibody and MH27 antibody and expressing dpy-7::GFP, respectively. The expression of these markers and the morphology of the hypodermis appear indistinguishable from those of the wild type. This was also true for pretzel stage embryos and L1 larvae (data not shown). (F) Summary of reproduction and development parameters from JG1(vp1) and NS3239(nr2088) worms. The final column shows median development times with the ranges in parentheses.

Testing for functional redundancy between ELT-3 and other members of the C. elegans GATA transcription factor family. The C. elegans genomic sequence is essentially complete (2) and reveals a total of 11 genes clearly identifiable as genes that encode GATA-type transcription factors. The expression of seven of these genes appears to be confined to the endoderm and/or mesoderm (10, 14, 37) (M. Maduro and J. L. Rothman, personal communication), and their products would not be expected to have embryonic functions that overlap those of ELT-3. The remaining two genes (in addition to elt-1 and elt-3) are elt-5 (F55A8.1) and elt-6 (F52C12.5). These form an apparent discistronic unit that is expressed throughout the ectoderm but at a particularly high level in lateral seam cells (K. Koh and J. L. Rothman, personal communication). These two genes appear to have overlapping (i.e., mutually redundant) functions that are critical to lateral seam cell development (Koh and Rothman, personal communication). We found that reduction of elt-5 gene function using RNAi in N2 worms gave a highly penetrant larval arrest phenotype but that reduction of elt-6 function by RNAi had no visible effect (in agreement with the unpublished results of Koh and Rothman; elt-5 is the upstream gene of the apparent dicistron, and RNAi of elt-5 appears to interfere with the expression of both elt-5 and elt-6). The result from RNAi with these two genes, performed either separately or combined, is indistinguishable whether performed in N2 or JG1 elt-3(vp1) worms (data not shown). In other words, RNAi experiments provide no evidence for redundancy among elt-3, elt-5, and elt-6. Because RNAi is not effective for all zygotically expressed genes, confirmation of these results must await the production of elt-5 and elt-6 deletion mutants.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

The role of ELT-3 and ELT-1 in hypodermal development. The GATA transcription factor ELT-1 has been shown to be required for hypodermal precursor cells to produce hypodermal cell fates (22). We have previously described a second hypodermal GATA transcription factor, ELT-3 (13). elt-3 is first expressed later than elt-1, immediately before the onset of hypodermal differentiation. In the present paper, we have shown that either elt-1 or elt-3, when force expressed in early blastomeres, is sufficient to activate the expression of a collection of hypodermal markers, even in blastomeres that would ordinarily never produce hypodermal cells in wild-type embryos. This set of hypodermal markers comprises two transcription factors, a cuticle collagen gene and an adherens junction component. Forced ectopic ELT-1 and ELT-3 expression also represses the expression of muscle, neuron, and endoderm markers. Overall, the expression of such a range of functionally unrelated markers, together with the repression of nonhypodermal marker genes, suggests that either ELT-1 or ELT-3 is able to activate a significant portion of the hypodermal differentiation program in nonhypodermal cells. This may actually constitute a change in cell fate.

General principles of tissue and organ development. The results of our experiments with elt-1 and elt-3 are generally consistent with the framework of tissue and organ development described by Labouesse and Mango (18), who have suggested that genes involved in controlling the development of organs and tissues in C. elegans can be divided into organ and tissue identity genes and organ and tissue differentiation genes. An organ and tissue identity gene is defined as a gene that acts before terminal differentiation in precursor cells to specify the fate of cells that will comprise a particular organ or tissue. In contrast, a differentiation gene activates the process of differentiation itself and controls, either directly or indirectly, the expression of terminal differentiation markers. Labouesse and Mango (18) defined tissue and organ identity genes by three characteristics (see also reference 15). First, absence of the gene leads to the loss of a tissue due to a cell fate transformation. Second, the gene is able to activate the tissue developmental program in naive blastomeres. Third, the gene is expressed early in precursor cells, before the onset of terminal differentiation. The first and third of these characteristics have already been demonstrated for elt-1 (22). Our results now show that elt-1 can indeed activate a program of hypodermal cell differentiation in naive blastomeres.

Nematode GATA factors and redundancy. We have found that the C. elegans GATA factor ELT-3 is not essential for either viability or, within the limits of our phenotypic analysis, normal development. There are now null mutations available for 3 of the 11 known C. elegans GATA factors in addition to the elt-3 deletions described here. Both elt-1 and elt-2 are essential genes involved in hypodermal and endodermal development, respectively (10, 22). A chromosomal deletion that removes the endodermal GATA factor gene end-1, along with a considerable number of other genes (or the elimination of end-1 together with a second GATA factor gene, end-3), results in failure of endoderm formation (37). However, a deletion that removes only the end-1 gene appears not to affect endoderm specification (Rothman, personal communication). RNAi experiments conducted on the remaining seven genes by a number of laboratories suggest that these may have redundant functions (K. Koh, M. Maduro, and J. L. Rothman, personal communication; J. S. Gilleard, T. Fukushige, and J. D. McGhee, unpublished data). Although confirmation of this statement must await deletion or mutation of the remaining family members, there is growing evidence that the majority of the C. elegans GATA transcription factors are functionally redundant. This is in marked contrast to the vertebrate GATA factors, all of which (GATA-1 to GATA-6) have been shown to have essential functions by gene knockout experiments with-mice or, in the case of GATA-5, zebra fish (16, 20, 23, 24, 27, 34). It is also noteworthy that in spite of the greater complexity of vertebrates, they appear to have only half of the number of GATA factors present in C. elegans. Although it is possible that additional vertebrate GATA factors await to be discovered, the recently completed Drosophila melanogaster genome sequence (1, 28) predicts only four GATA factors in the fly. Hence, the GATA factors represent an example of a gene family that is larger and more redundant in nematodes than in apparently more complex organisms.