Previous Article | Next Article 
Molecular and Cellular Biology, April 2001, p. 2891-2905, Vol. 21, No. 8
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.8.2891-2905.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
runt Homology Domain Transcription
Factors (Runx, Cbfa, and AML) Mediate Repression of the Bone
Sialoprotein Promoter: Evidence for Promoter Context-Dependent
Activity of Cbfa Proteins
Amjad
Javed,1
George L.
Barnes,2
B. O.
Jasanya,1
Janet L.
Stein,1
Louis
Gerstenfeld,2
Jane B.
Lian,1 and
Gary S.
Stein1,*
Department of Cell Biology and Cancer Center,
University of Massachusetts Medical School, Worcester,
Massachusetts,1 01655-0106 and
Musculoskeletal Research Laboratories, Department of
Orthopaedic Surgery, Boston University Medical Center, Boston,
Massachusetts2 02118-2526
Received 16 November 2000/Accepted 22 January 2001
 |
ABSTRACT |
Expression of the bone sialoprotein (BSP) gene, a marker of bone
formation, is largely restricted to cells in mineralized tissues.
Recent studies have shown that the Cbfa1 (also known as Runx2, AML-3,
and PEBP2
A) transcription factor supports commitment and
differentiation of progenitor cells to hypertrophic chondrocytes and
osteoblasts. This study addresses the functional involvement of Cbfa
sites in expression of the Gallus BSP gene. Gel mobility shift analyses with nuclear extracts from ROS 17/2.8 osteoblastic cells
revealed that multiple Cbfa consensus sequences are functional Cbfa DNA
binding sites. Responsiveness of the 1.2-kb Gallus BSP promoter to Cbfa factors Cbfa1, Cbfa2, and Cbfa3 was assayed in osseous
and nonosseous cells. Each of the Cbfa factors mediated repression of
the wild-type BSP promoter, in contrast to their well known activation
of various hematopoietic and skeletal phenotypic genes. Suppression of
BSP by Cbfa factors was not observed in BSP promoters in which Cbfa
sites were deleted or mutated. Expression of the endogenous BSP gene in
Gallus osteoblasts was similarly downregulated by forced
expression of Cbfa factors. Our data indicate that Cbfa repression of
the BSP promoter does not involve the transducin-like enhancer (TLE)
proteins. Neither coexpression of TLE1 or TLE2 nor the absence of the
TLE interaction motif of Cbfa1 (amino acids 501 to 513) influenced
repressor activity. However, removal of the C terminus of Cbfa1 (amino
acids 362 to 513) relieved suppression of the BSP promoter. Our
results, together with the evolutionary conservation of the seven Cbfa
sites in the Gallus and human BSP promoters, suggest that
suppressor activity by Cbfa is of significant physiologic consequence
and may contribute to spatiotemporal expression of BSP during bone development.
 |
INTRODUCTION |
Bone sialoprotein (BSP) is a
phosphorylated and sulfated 34-kDa protein that represents one of the
major noncollagenous, extracellular matrix (ECM) proteins associated
with mineralized tissues. In developing rat calvaria, BSP mRNA
expression is detected in osteoblasts on day 17 along with type I
collagen, osteocalcin (OC), osteonectin, and alkaline phosphatase. BSP
expression is also found in hypertrophic chondrocytes (8).
BSP, similar to OC, is upregulated during osteoblast differentiation in
vitro as the ECM mineralizes. BSP reaches peak levels slightly earlier
than OC and is downregulated in mature osteocytes (14, 35, 36,
39, 43). The protein is selectively associated with clusters of
needle-like crystals of hydroxyapatite. Various in vitro studies
suggest that BSP can either promote mineral nucleation or facilitate
mineral growth (22). In other studies the functional role
of this protein was assessed by stably transfecting murine osteosarcoma
cell lines with avian forms of this gene (15). The results
demonstrated that the cell lines expressing the highest levels of BSP
displayed the greatest accumulation of calcium in the ECM, consistent
with BSP binding to hydroxyapatite (5, 12).
Regulatory elements in the BSP promoter that contribute to its high
level of transcription in osteoblasts have not been identified. BSP
promoters from several species have been shown to contain a negative
vitamin D response element (33), an inverted TATA sequence, a YY1 motif (28), several Sp1 sites, and a
homeodomain (engrailed) motif in the proximal promoter
(59), but none of these has been demonstrated to mediate
tissue-specific expression. The OC promoter, however, has provided
examples of several elements that contribute to its osteoblast-specific
expression. The OC box I and homeodomain (Msx or Dlx) binding site
(20, 21, 56) both restricts and attenuates OC expression
in developing osteoblasts. Most significantly, multiple Cbfa (core
binding factor
) sites in the various OC promoters support cell
type-specific expression, and forced expression of Cbfa factors can
confer induction of OC promoter-reporter constructs in both osseous and
nonosseous cells (1, 11, 25). Cbfa1 has been shown to be a
key regulator of osteogenic differentiation (2, 31, 42)
and regulates several osteoblast-related genes.
The Gallus BSP promoter has been sequenced (59)
and contains multiple Cbfa consensus motifs. Several important
observations prompted examination of the functionality of these
putative Cbfa sites. Firstly, the Cbfa1 null mutant revealed loss of
BSP expression, along with other osteoblast phenotypic markers
(31). Secondly, the similarities between BSP and OC with
respect to their high expression levels restricted to mineralized
tissues in vivo and in vitro suggest that Cbfa may be a strong enhancer
of BSP expression in mature bone cells. However, we report here a
series of experimental approaches demonstrating that Cbfa factors
mediate repression of the Gallus BSP promoter in rat and
Gallus osteoblasts, as well as in nonosseous HeLa cells.
The present studies show that the Gallus BSP promoter
contains seven functional Cbfa sites that bind an osteoblast-specific complex comprising Cbfa factors. Cbfa mediates suppression of the BSP
promoter by a mechanism that does not involve interaction of the Cbfa
VWRPY domain with TLE (the human homologue of Drosophila Groucho), a known suppressor of Cbfa activity. The opposing regulation of the BSP and OC promoters by Cbfa is consistent with distinct hormonal responses and functional properties of the proteins. More
importantly, these studies reveal the significance of the promoter
context of Cbfa motifs in contributing to transcriptional control.
 |
MATERIALS AND METHODS |
Cell cultures.
Osteoblasts were isolated by three sequential
trypsin-collagenase treatments of 17-day embryonic chicken
(Gallus) calvaria (14). Primary cultures of
embryonic chick osteoblasts have been well characterized with respect
to their stages of differentiation and reflect bone formation in vivo.
Only the cells released during the third digest were used for
experiments. Cultures were plated and grown for 2 weeks (until
confluence) in minimal essential medium supplemented with 10% fetal
bovine serum, with medium changes every 3 days. Upon reaching
confluence, the cultures were switched to BGJb medium supplemented with
10% fetal bovine serum. After 2 days this medium was supplemented with
10 mM
-glycerophosphate, and after an additional 2 days the medium
was supplemented with 12.5 µg of ascorbic acid per ml. This medium
was considered complete medium. All studies were carried out 3 days
after switching to complete medium. ROS 17/2.8 cells were maintained in
F12 medium supplemented with 5% fetal calf serum (Life Technologies,
Inc. [Gibco BRL], Grand Island, N.Y.). HeLa cells were cultured in suspension in Joklik-modified minimal essential medium and plated in
Dulbecco modified Eagle medium with 10% fetal calf serum for transfections.
Nuclear extracts.
Nuclear extracts were prepared according
to the Dignam method (10). Briefly, 1 × 106 rat osteoblastic cells (ROS 17/2.8) or day 3 Gallus osteoblasts were washed once with 10 ml of ice-cold
phosphate-buffered saline (PBS) and collected by centrifuging at
165 × g for 5 min. The cell pellet was resuspended in 400 µl of ice-cold NP-40 lysis buffer (10 mM Tris [pH 7.4], 3 mM
MgCl2, 10 mM NaCl, 0.5% NP-40) by gentle pipetting and
incubated on ice for 10 min. The nuclei pellet was collected by
centrifugation for 30 s and resuspended in 400 µl of cold
hypotonic buffer (10 mM HEPES [pH 7.9], 1.5 mM MgCl2, 10 mM KCl). The pellet was again collected by centrifugation at 4,000 × g for 1 min, resuspended in 50 µl of ice-cold extraction buffer (20 mM HEPES [pH 7.9], 1.5 mM MgCl2, 420 mM KCl,
0.2 mM EDTA, 20% glycerol), and vigorously rocked in the cold room for 30 min to 1 h followed by microfuging for 5 min. Aliquots of
supernatant containing nuclear proteins were quick-frozen in a dry
ice-ethanol bath and stored at
80°C. Protein concentrations were
determined using a protein assay reagent (Bradford; Bio-Rad
Laboratories, Hercules, Calif.).
Oligonucleotides, probes, and EMSA.
Oligonucleotides
representing the wild-type or mutant Cbfa sites in the
Gallus BSP promoter are shown in Fig.
1. The upper strands (200 ng) of the
oligonucleotides were labeled with 32P for 1 h at
37°C in a 50-µl volume using T4 Polynucleotide Kinase (New England
BioLabs, Beverly, Mass.) as indicated by the manufacturer. The reaction
was stopped by heat inactivation at 65°C for 1 h. Annealing was
performed by addition of a twofold excess amount of bottom strand
followed by boiling for 5 min and slow cooling to room temperature. The
unincorporated nucleotides were removed using a quick-spin G 25 Sephadex column (Roche Molecular Biochemicals, Indianapolis, Ind.)
according to the manufacturer's instructions. Electrophoretic mobility
shift assay (EMSA) reaction mixtures were prepared using 50 fmol of
probe, 50 mM KCl, 12 mM HEPES, 1 mM EDTA, 1 mM dithiothreitol, 12%
glycerol, 2 µg of poly(dI-dC) · poly(dI-dC) and 0 to 10 µg
of nuclear protein. After a 20-min incubation at 22°C, unlabeled
double-stranded competitor oligonucleotide (12.5-, 25-, 50-, and
100-fold molar excess over probe) was added to the reaction mixtures,
and aliquots were loaded onto a 4% nondenaturing polyacrylamide gel.
The gels were electrophoresed for 1.5 h at 200 V, dried, and exposed to
film for autoradiography.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 1.
The Cbfa sites are shown in boxed areas; the dotted box
indicates a second overlapping Cbfa motif. Mutations of the ACC core
are shown in lower case and were selected (ac) to avoid generation of a
new DNA recognition motif.
|
|
Antibodies.
The affinity-purified polyclonal antibodies (a
generous gift from Scott Hiebert [38]), designated
anti-Cbfa1, anti-Cbfa2, anti-Cbfa3 and anti-Cbf
, were raised against
purified peptides. Except for anti-Cbfa2 antibody, which recognizes an
epitope in the N terminus, all the antibodies recognize epitopes within
the C termini. The specificity of each antiserum has previously been demonstrated in detail (38). Anti-Cbfa3 and Cbfa1 are
specific for their respective proteins, but anti-Cbfa2 shows a slight
cross-reactivity with Cbfa1. For EMSA supershift experiments, after
incubation with the DNA probes, 1 µl of undiluted antibody (for each)
was added and incubated with either probe alone (as a negative control) or with the reaction mixtures for an additional 20 min at 37°C.
Transient transfection and CAT assay.
Rat osteosarcoma (ROS
17/2.8) or HeLa cells were plated at a density of 0.5 × 106 per ml, 24 h prior to transfection. Cells were
transfected at 50% confluency using Superfect transfection reagent
(Qiagen Inc., Valencia, Calif.). Briefly, plasmid DNA (2.5 µg of OC
or BSP promoter-chloramphenicol acetyltransferase [CAT] constructs,
0.75 µg of either cytomegalovirus vector control or Cbfa and TLE
expression plasmid and 0.1 µg of Rous sarcoma virus luciferase
construct as an internal control) was added to 100 µl of serum-free
medium and mixed with 10 µl of Superfect reagent followed by
incubation for 15 min at room temperature. After the addition of 0.4 ml
of complete medium the mixture was applied to semiconfluent cultures in
35-mm-diameter culture dishes already washed once with PBS. The cells
were incubated with the transfection mixture for 2 h at 37°C,
washed with PBS, fed 2 ml of complete medium, and then incubated at
37°C for 30 to 36 h before harvesting.
For reporter assays, cells were first washed twice with ice-cold PBS
and lysed with 300 µl of reporter lysis buffer (Promega
Corp.,
Madison, Wis.) for 20 min at room temperature. For CAT
assay, cell
lysate (50 µl) was incubated with the reaction mixture
for 5 h
at 37°C. The products were separated by thin-layer chromatography
and
the amount of incorporated [
14C]chloramphenicol was
quantified using the Beta-scope (Betagen,
Mountain View, Calif.). The
data were normalized to luciferase
values used as an internal control.
For luciferase assay, cell
lysate (20 µl) was mixed with luciferase
assay buffer (Promega
Corp.) and the amount of light units was measured
with a Monolith
luminometer (Analytical Luminescence Laboratory, San
Diego, Calif.).
All experiments were repeated four to six times
(
n = 6 replicates
per experiment) using at least three
different DNA
preparations.
Gallus osteoblasts were transfected with Lipofectamine
reagent and 15 µg of plasmid for each assay. Briefly, plasmid DNA was
complexed with Lipofectamine reagent in a 1:2 ratio (DNA to
lipofectamine)
for 30 min at room temperature. Cells cultured for 3 days in complete
medium were rinsed once with sterile PBS and overlaid
with DNA-lipofectamine
complexes in 6 ml of Opti-MEM transfection
medium for a total
of 5 h. The cells were subsequently rinsed in
PBS, fed fresh complete
medium, and cultured until harvesting. CAT
assays were performed
48 h after transfection on equal aliquots of
samples. CAT activity
was assayed by liquid scintillation counting
(
51). The pCAT
control vector containing the simian virus
40 promoter and enhancer
(Promega Corp.) was used in some experiments
to compare the relative
activities of the various BSP promoter
segments. The final enzyme
activities were expressed in counts of
[
14C]chloramphenicol converted per minute per microgram
of
protein.
Site-directed mutagenesis and expression constructs.
The
plasmid construct containing bp
1,239 to +25 of the BSP promoter in
the sense direction relative to the CAT coding sequence in the pCAT
basic vector (Promega Corp.) was previously described (59). Nested deletions from the 5' end of the BSP promoter
were generated by PCR amplification of selected segments of the
promoter from bp
620,
524, or
131 to +25 and have been previously
described (58). Site-directed mutagenesis was performed to
incorporate 2-nucleotide substitutions into the core binding motif
(TGG) of each individual Cbfa site (Fig. 1) in the bp
524
Gallus BSP promoter fragment. Initially the Cbfa site 4 mutant (Fig. 9) was generated by amplifying the bp
524 promoter
fragment using the forward primer carrying the mutation (indicated in
lower case), 5'TGCCTGCAGCAATTAGAGTacTCTGACCTG3', and the
reverse primer 5'GCTCTAGAGGTGCCACTGGG3'. The PCR product was
digested with PstI/XbaI and cloned in similarly digested pCAT vector
(Promega Corp.). For sites 3, 2, and 1 the mutant oligonucleotides used
as forward and reverse primers were the same as those used for gel
shift analyses (Fig. 1). The plasmid bearing mutations in both sites 4 and 3 was generated by using the bp
524 mutant (site 4) promoter as
the template. The PCR product was digested with DpnI to
destroy the parental DNA, followed by transformation in XL1-Blue
competent cells (Stratagene, La Jolla, Calif.). Similar stepwise
procedures were followed to generate plasmids carrying mutations in all
four Cbfa motifs. Incorporation of the substitution mutations in all
constructs was confirmed by sequencing. CMV-driven Cbfa1, Cbfa2, and
Cbfa3 expression constructs were described previously (2).
The rat OC 5' promoter fragment (bp
1, 097 to +23) fused to the
CAT gene (pOCZCAT) containing three Cbfa-responsive motifs has been reported previously (2, 25). The Cbfa1 MASN
isoform expression construct was obtained from James C. Neil
(University of Glasgow, Glasgow, United Kingdom). Cbfa1
C was
generated by digesting the MRIPV isoform with ApaI to remove
the part of the cDNA encoding amino acids 362 to 513. Two synthetic
oligonucleotides (5'GGGCCCTTGATAACTCGAGGAATTCTTATCAAGGGCCC3'
and 5'GGGCCCTTGATAAGAATTCCTCGAGTTATCAAGGGCCC3') containing stop codon and unique restriction sites were
hybridized to generate a cassette. The cassette was digested with
ApaI and ligated into ApaI-digested
pCDNA3.1-Cbfa1.
Cbfa1

12 was constructed by digesting the MRIPV isoform with
EcoRI-
XbaI to remove the part of the cDNA
encoding amino acids
501 to 513, followed by blunting and ligation. The
sequences of
these constructs were confirmed by the dideoxy chain
termination
method. pBluescript vectors carrying TLE1 or TLE2 cDNAs
were obtained
from Stefano Stifani, Montreal Neurological Institute,
Montreal,
Quebec, Canada. TLE1 coding region was amplified by PCR using
forward primer 5'GTAATGGATCCAGTATGGGGTTCCCGCAGAGCCGGCACCCG3'
and
reverse primer
5'GCCATACTCGAGCTAGTAGATGACTTCATAGACTGTAGC3'. TLE2
was
amplified by PCR using forward primer
5'GCAGCGGATCCAGCATGGAATACCCCCAGGGAAGGCAC3'
and reverse
primer 5'GCCTGGCTCGAGTCAGTAGACCACCTCATACAC3'.
PCR-generated
fragments of TLE1 and TLE2 were digested with
BamHI-
XhoI and cloned
into
BamHI-
XhoI-digested pCDNA3.1 vector (Invitrogen
Corporation,
San Diego, Calif.). The sequences of these constructs were
confirmed
by the dideoxy chain termination
method.
Isolation of total cellular RNA and Northern blot analysis.
Twenty-four hours after transient transfection, cultures of
Gallus osteoblasts were rinsed twice in 1 × PBS and
incubated at room temperature for 5 to 10 min in Trizol reagent (Life
Technologies, Inc. [Gibco BRL]). (1 ml per 100-mm-diameter plate).
Cells were then scraped from the plates into a microfuge tube, and 0.1 ml of 1-bromo, 3-chloropropane (Sigma, St. Louis, Mo.) was added with
mixing. After centrifugation at 4°C, the aqueous layer was collected
and RNA was precipitated with 0.5 ml of isopropanol. The pellets were
washed with 70% ethanol to remove residual salt, briefly air dried,
dissolved in diethylpyrocarbonate-treated water, and stored at
70°C.
RNA samples (20 µg) were electrophoresed in 1% formaldehyde-agarose
gels and transferred to Hybond-N+ membrane (Amersham Pharmacia
Biotech,
Arlington Heights, Ill.) in 20 × SSC (1 × SSC is 0.15
M
NaCl plus 0.015 M sodium citrate). Blots were hybridized with
randomly
primed (Prime-It kit; Stratagene, La Jolla, Calif.),
32P-labeled cDNA probes for
Gallus BSP at 42°C
overnight. The radiographic
signal was quantitated by using a STORM
Phosphorimager (Molecular
Dynamics, Sunnyvale, Calif.). Blots were then
stripped and reprobed
for 18S rRNA. The BSP data were normalized to
rRNA values for
each
sample.
Western blot analysis.
Western blots were performed on
whole-cell lysates from HeLa and ROS 17/2.8 cells transiently
transfected with Cbfa and TLE expression plasmids. For each construct a
100-mm-diameter dish was transfected with 10 µg of either empty
vector or expression plasmid in parallel with promoter-reporter
transfection studies. After 24 h, cells were washed with 1× PBS
and lysed directly with 200 µl of sodium dodecyl sulfate (SDS) lysis
buffer (2% SDS, 10 mM dithiothreitol, 10% glycerol, 2 M urea, 1.0 mM
phenylmethylsulfonyl fluoride, 10 mM Tris-HCl, 0.002% bromphenol blue,
1× protease inhibitor cocktail). Protein (30 µg/well) was resolved
by SDS-10% polyacrylamide gel electrophoresis and transferred to
Trans-Blot membrane (Bio-Rad Laboratories). The blots were incubated
with 1:5,000 dilution of mouse monoclonal horseradish
peroxidase-conjugated anti-Xpress antibody (Invitrogen Corporation) to
detect the epitope-tagged Cbfa1 and TLE proteins or with a 1:2,000
dilution of rabbit polyclonal anti-Cbfa2 or -Cbfa3 antibodies. The blot
was stripped and reprobed with antibody to lamin B or
-tubulin
(Santa Cruz Biotechnology, Inc., Santa Cruz, Calif.) as a control for
equal sample loading.
Immunofluorescence analysis.
Primary chick osteoblasts were
passed after 6 days in culture onto gelatin-coated glass coverslips
(0.5 × 104 cells) and processed for in situ
immunofluorescence analysis 36 h after plating. ROS 17/2.8 cells
were examined 2 days after plating. Cells were rinsed twice with
ice-cold PBS and were fixed for 10 min on ice with 4% formaldehyde.
After washing once with PBS, cells were made permeable by incubation
for 20 min on ice with 0.1% Triton X-100 in PBS and then incubated at
37°C for 1 h with the appropriate dilution (1:150) of
affinity-purified polyclonal primary antibody against Cbfa1. Cells were
washed four times with 1 ml of PBSA (0.5% BSA in PBS), followed by
incubation with a 1:400 dilution of secondary antibody (fluorescein
isothiocyanate goat anti-rabbit) for 1 h at 37°C. Excess
secondary antibody was removed by washing the cells four times with
PBSA. Cells were stained with DAPI (0.1% 4',
6-diamidino-2-phenylindole, 0.1% Triton X-100 in PBSA) for 5 min on
ice followed by a single rinse with 0.1% Triton X-100 in PBSA. Finally
cells were washed twice with ice-cold PBS and were mounted using
Vectashield (Vector Laboratories, Inc., Burlingame, Calif.). The
coverslips were sealed and stored in the dark at
20°C till
microscopy. Cells were viewed in a Zeiss Axioplan2 microscope equipped
with epifluorescence filters and a charge-coupled device digital
camera. Images were displayed using Metamorph software (Universal
Imaging Corporation, West Chester, Pa.) and printed directly from
Powerpoint (version 5.1).
 |
RESULTS |
Gallus BSP promoter contains functional Cbfa motifs
that bind a Cbfa1-containing complex.
Figure 2 shows the locations
of seven consensus Cbfa sites within 1.3 kb of the 5' flanking
sequences of the Gallus BSP
gene. The human BSP promoter also
contains seven Cbfa recognition motifs, four of which reside within 1.4 kb of 5' flanking sequences (Fig. 2B). In the Gallus
promoter, three Cbfa motifs are distal to the vitamin D response
element from kb
1.2 to
0.8, while four sites reside in the proximal
promoter from kb
0.5 to
0.3. In contrast, promoters of the rodent
species contain either one or two Cbfa consensus sequences
(3). In the present studies, we examined the role of the
Cbfa elements in transcriptional regulation of the Gallus
BSP promoter. We initially assessed which of these Cbfa consensus sites
may contribute to BSP transcription by comparing expression of a series
of promoter deletion constructs in osteoblasts. We observed both in rat
osteoblastic ROS 17/2.8 osteosarcoma cells (Fig.
3) and in Gallus primary
osteoblasts (data not shown) that the bp
131 segment lacking Cbfa
motifs exhibited a higher level of basal activity than the full-length
promoter. This very proximal segment contains several regulatory
elements supporting activation (e.g., Sp1 and TATA [29,
59]), and a homeodomain motif shown to mediate enhancer
activity of the BSP promoter [4]). Notably, deletion of
the upstream promoter segment (from bp
1244 to
620), which includes
a silencer motif and three Cbfa sites, resulted in a threefold increase
in basal promoter activity. Further deletion of an AP-1 motif (to bp
524) did not significantly change promoter activity. However,
removing the four most proximal Cbfa sites decreased activity 44% in
ROS 17/2.8 cells and 50% in Gallus osteoblasts. We
therefore focused on functional characterization of the Cbfa motifs in
the proximal promoter.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Gallus and human BSP promoters contain seven
Cbfa consensus motifs. (A) Illustration of the positions and sequences
of the Cbfa1 sites relative to several conserved regulatory sequences
in the Gallus BSP promoter. TATA, TATA box; VDRE, vitamin D
response element; Col II-labeled octagons, silencer motifs. (B)
Comparative schematic showing the numbers and positions of Cbfa
consensus sequences in human, mouse, and rat BSP promoters (not drawn
to scale).
|
|

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
Analysis of deletion mutants of Gallus BSP
promoter in ROS 17/2.8 osteoblastic cells. (A) Schematic illustration
of 5' BSP promoter deletion constructs used in transient transfection
assays. Col II-labeled octagons, silencer motifs; VDRE, vitamin D
response element. (B) Assay of BSP promoter-CAT reporter constructs in
ROS 17/2.8 cells. Cells were transfected with the indicated reporter
constructs. Reporter activity was assayed 24 h after transfection and
normalized for transfection efficiency (see Materials and Methods).
Data are means + the standard errors of the means (SEM),
(n = 18 samples); data from three independent
experiments were pooled and represent multiple DNA preparations.
|
|
Nuclear extracts from osteoblastic ROS 17/2.8 cells are known to
contain a bone-specific DNA binding complex that has been
characterized
in relation to the Cbfa recognition motifs in the
OC promoter (
1,
13,
37). Thus, we used these extracts to
examine protein-DNA
interactions at each of the Cbfa motifs in
the BSP proximal promoter.
Each of these Cbfa sites (wild type
[WT]) forms a major complex that
is abolished upon mutation of
the core Cbfa motif (Fig.
1 and
4A [representative data shown
for site
2]). This complex is not formed at BSP elements using
nuclear extracts
from HeLa cells (data not shown). Specificity
of binding to the
putative BSP Cbfa sites was established by competition
analyses with
oligonucleotides containing wild-type and mutated
Cbfa sites (Fig.
4B
and data not shown), as well as the Cbfa consensus
motif (Fig.
4C).
Nuclear extracts from
Gallus osteoblasts also
formed Cbfa
sequence-specific DNA binding complexes at the four
Cbfa sites (data
not shown). Together, these analyses confirm
that each of the Cbfa
motifs is a functional Cbfa interaction
element.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 4.
Sequence-specific protein-DNA interactions at the
proximal Cbfa site 2 in the Gallus BSP promoter. (A)
Oligonucleotides representing wild type (WT) and mutant (mt) sequences
for each Cbfa site (Fig. 1) were incubated with increasing
concentrations (0 to 10 µg) of nuclear extracts from ROS 17/2.8 cells
and examined by gel mobility shift assay Solid arrowheads indicate the
formation of different specific complexes. Cbfa-related proteins bind
with sequence specificity to all four proximal BSP Cbfa motifs, but
representative data are shown only for site 2. The results of
competition studies shown in panels B and C demonstrate
sequence-specific protein-DNA binding complexes at the BSP Cbfa sites.
(B) WT probe was incubated with 6 µg of ROS 17/2.8 nuclear extracts
and increasing concentrations (0, 12.5, 25, 50, and 100×) of either WT
or mutant (mt) oligonucleotides. (C) Lane 1, WT labeled probe without
nuclear extract; lane 2, probe with 6 µg of ROS 17/2.8 nuclear
extract; lanes 3, 4, and 5, competition with 100X unlabeled wild-type,
mutant, and Cbfa consensus sequence oligonucleotides (Fig. 1),
respectively. Only the portion of the gel containing the complexes is
shown.
|
|
We identified the Cbfa factors involved in complex formation with BSP
regulatory elements by antibody supershift analysis
using nuclear
extracts from ROS 17/2.8 cells. A panel of well
characterized,
affinity-purified antibodies to the family of Cbfa
proteins encoded by
distinct genes, Cbfa1, Cbfa2, and Cbfa3 and
their non-DNA binding
partner, Cbf

, was used. Figure
5
reveals
a complete supershift by the Cbfa1 antibody, as well as a
partial
supershift with the Cbfa2 antibody which may reflect possible
cross-reactivity with Cbfa1 (see Materials and Methods). Cbf

,
a
partner protein which enhances Cbfa DNA binding, is also present
in the
complexes formed at all sites. Additionally, a very weak
supershift was
detected only on sites 1 and 3 of the BSP promoter
with the Cbfa3
antibody. Thus, Cbfa1 is the major component of
an osteoblast-derived
complex formed on BSP Cbfa motifs, similar
to findings for the OC
promoter (
2,
37).

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 5.
Cbfa1 is the major component of the transcription factor
complex binding to all BSP Cbfa sites. Electrophoretic mobility
antibody supershift analyses are shown for BSP Cbfa sites 1 to 4. Lanes
1 to 5, antibody controls for each site without nuclear extract,
indicating that antisera alone do not react with the probe; lane 6, 6 µg of nuclear extract without antibodies (control); lanes 7 to 10, the supershifts of the Cbfa complex with the indicated antibody. A
nearly complete supershift is observed in the presence of antibody
specific to Cbfa1 with the complex formed by ROS nuclear extracts at
the four proximal sites (1, 2, 3, and 4) in the Gallus BSP
promoter. Weak supershifts occurred using antibodies specific to Cbfa2
and Cbf , a transactivator partner protein for Cbfa factors.
|
|
We further confirmed the representation of Cbfa1 in
Gallus
osteoblasts compared to that in rat osteoblastic ROS 17/2.8 cells
by in
situ immunofluorescence (Fig.
6). In the
ROS 17/2.8 cells,
Cbfa1 is predominantly restricted to the nucleus and
excluded
from nucleoli (Fig.
6A). Cbfa1 is also detected at significant
levels in the primary (day 3)
Gallus osteoblasts (Fig.
6B
and
C) by in situ immunofluorescence. The subnuclear distribution
of
Cbfa1 in
Gallus osteoblasts (Fig.
6D to F) is shown at
higher
magnification. The punctate staining typical of the nuclear
matrix
association of Cbfa factors is observable (
54,
61).
Together,
these data indicate that Cbfa1 is the major factor in
osteoblasts
interacting with the multiple Cbfa motifs in the BSP
proximal
promoter.

View larger version (96K):
[in this window]
[in a new window]
|
FIG. 6.
Immunofluorescence detection of Cbfa1 in osteoblasts.
(A) Cellular representation of Cbfa1 in ROS 17/2.8 cells 24 h
after plating. (B) Cellular representation of Cbfa1 in day 3 Gallus osteoblasts by immunofluorescence microscopy.
Magnification, ×40. Nuclear staining is observed in whole cells
incubated with antisera specific to Cbfa1 (as described in Materials
and Methods). (C) Corresponding phase-contrast images of the
Gallus osteoblast cell layer. (D) Punctate subnuclear
distribution of Cbfa1 foci in Gallus osteoblasts.
Magnification, ×100. DAPI-stained nuclei. (F) Differential
interference contrast (DIC) of the immunopositive cells.
|
|
Cbfa factors downregulate BSP promoter activity and expression of
the endogenous gene.
Cbfa1, Cbfa2, and Cbfa3 were previously
documented to support enhanced transcriptional activity of the rat OC
promoter in both nonosseous cells (1, 11) and the ROS
17/2.8 cell line (2). To assess the consequences of Cbfa
protein interactions with Cbfa elements in the Gallus BSP
promoter, we transfected the various promoter deletion constructs (from
kb
1.2 to
0.1) along with expression plasmids encoding each of the
Cbfa proteins into either primary Gallus osteoblasts, ROS
17/2.8 cells, or human HeLa cells, the latter having a zero background
of Cbfa factors. As shown in Fig. 7 for
the kb
1.2 Gallus BSP promoter, forced expression of the
Cbfa factors resulted in suppression of promoter activity in each of
the cell types. In the species-homologous Gallus
osteoblasts, a highly significant 14.5- to 32-fold suppression was
observed with the three Cbfa proteins (Fig. 7A). Notably, in the
mammalian cell lines, a greater suppression of the BSP promoter was
observed with Cbfa3 than with other family members (Fig. 7B and C).
This finding was not the result of significant differences in
expression levels, as determined by Western blot analysis of cell
layers (Fig. 7C and data not shown). Because of the relatively weaker
suppression exhibited by Cbfa1 (MRIPV isoform) on the BSP promoter in
HeLa and osteoblast cells, we examined the activity of the bone-related
Cbfa1 MASN isoform (52). Only a slightly stronger
repression was observed for Cbfa1 (MASN) with all promoter segments in
osseous and nonosseous cells (Table 1).
Thus, all Cbfa factors and the two Cbfa1 isoforms regulate suppression
of BSP promoter activity.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 7.
Cbfa factors mediate suppression of the
Gallus BSP promoter containing seven Cbfa regulatory
elements. Various regulatory elements are shown in the diagram at the
top of the figure. Gallus (A), ROS 17/2.8 (B), and HeLa (C)
cells were transiently transfected with 2.5 µg of 1244 BSP-CAT and
0.75 µg of Cbfa1 (MRIPV), Cbfa1 (MASN), Cbfa2, or Cbfa3 as indicated.
CAT activity was quantitated and normalized for transfection
efficiency. The data are fold repression values (Cbfa over empty
vector). Each bar represents a pool of samples (n = 18)
from three independent experiments. Each group showed significant
repression (P < 0.001) as tested by analysis of
variance. (ANOVA) HeLa cells (100-mm-diameter dishes) were transiently
transfected with 10 µg of indicated plasmid. Thirty micrograms of
total protein was subjected to SDS-10% PAGE. Blots were incubated
with either mouse monoclonal Xpress antibody (to detect tagged Cbfa1
proteins) or rabbit polyclonal anti-Cbfa2 and -Cbfa3 antibodies (see
Materials and Methods). Blots were stripped and probed with -tubulin
for equal loading control. The relative mobility of different proteins
is indicated. Col II-labeled octagons, silencer motifs; VDRE, vitamin D
response element.
|
|
Because the full-length promoter in HeLa and ROS 17/2.8 cells exhibited
weaker suppression than in
Gallus osteoblasts, we
examined
Cbfa responsiveness of the bp

620 and

524 promoter
deletions which
are expressed at higher basal levels and each
contain four Cbfa sites
(Table
1). The bp

620 promoter construct
contains an AP-1 site, which
has been deleted from the bp

524
construct. The comparison of these
promoters was viewed as necessary
since AP-1 proteins can strongly
regulate bone-related genes (e.g.,
those for OC and collagenase 3) and
can interact with Cbfa factors
(
49). The deletion of the
AP-1 motif does not influence this
suppression. We observe a
significant level of repression by Cbfa1
in these shorter segments
(from two- to threefold in the kb

1.2
BSP promoter to seven- to eight
fold in the bp

620 and

524,
promoter fragments). Complete loss of
repression was observed
with the bp

131 promoter which lacks Cbfa
motifs. A representative
example of an autoradiogram demonstrating the
extent of suppression
is shown in Figure
8. In the mammalian cells, we
consistently
observed a greater fold suppression of the proximal
promoter bp

620 and

524 by Cbfa3 and Cbfa2 (from 8- to 16-fold)
than by
Cbfa1 (four- to eightfold). These differences were observed at
several concentrations of expression plasmid (data not shown),
are
independent of the cell type, and are not a consequence of
differences
in expression levels, as confirmed by Western blot
analysis (Fig.
7C
and data not shown). In the same experiment,
the kb

1.1 rat OC
promoter was similarly examined and the expected
upregulation occurred
with all three Cbfa expression plasmids
(data not shown), ranging from
four- to sixfold, as previously
reported (
2).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 8.
Representative CAT autoradiogram of Cbfa-mediated
suppression of the BSP promoter. ROS 17/2.8 cells were transiently
transfected with 620 BSP-CAT containing four Cbfa binding sites
(upper panel) and 131 BSP-CAT lacking Cbfa sites (lower panel) and
the indicated Cbfa expression constructs. CMV, empty vectors.
|
|
In order to establish that suppression of BSP promoter activity is
indeed mediated by Cbfa sites, we introduced point mutations
(Fig.
1)
in each of the four Cbfa sites in the bp

524 promoter
(Fig.
9). Interestingly, we observed a twofold
increase in basal
promoter activity of the mutant promoter (Fig.
9B)
and a loss
of suppressor activity in response to Cbfa factors (Fig.
9C).
These results further confirm the role of Cbfa sites in mediating
repressive activity on the BSP promoter. Because suppression of
BSP by
Cbfa proteins was not anticipated, we examined the effect
of Cbfa
factors on the expression of the endogenous BSP gene.
Gallus
primary osteoblasts were transiently transfected with either
empty
vector or Cbfa expression constructs, and total cellular
RNA was
isolated 24 h posttransfection. Figure
9D shows a 31 to
39%
decrease in BSP mRNA levels in osteoblasts in response to
forced
expression of Cbfa factors. This decrease in BSP expression,
observed
in a transient assay, defines the physiological significance
of Cbfa
suppression of the BSP promoter in osteoblasts.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 9.
Cbfa proteins suppress expression of the BSP gene
through interaction with Cbfa motifs. (A) Schematic representation of
WT and Cbfa mutant bp 524 promoters. (B) ROS 17/2.8 cells were
transfected with 2.5 µg of WT and Cbfa mutant bp 524 promoter to
assess basal promoter activity. The cells were assayed for CAT-reporter
activity as described in Materials and Methods. n = 6.
(C) The WT or mutant promoters were cotransfected with 0.75 µg of
empty vector, Cbfa1, Cbfa2, or Cbfa3 expression constructs in HeLa
cells. The CAT activity was determined 24 h posttransfection and
normalized to RSV luciferase values used as an internal control. The
fold suppression data were obtained by comparing Cbfa to empty vector
[n = 6]. (D) Primary Gallus osteoblasts
were transfected in triplicate with 15 µg of either empty vector,
Cbfa2, or two isoforms of Cbfa1. Cells were harvested 24 h later,
and total RNA was isolated. A total of 20 µg of RNA was resolved and
blots were hybridized with Gallus BSP and rRNA probes.
Values for each RNA were determined by radiographic analysis using the
STORM Phosphorimager. The normalized values of BSP RNA expression are
shown at the bottom.
|
|
Cbfa suppression of the BSP promoter is not mediated through Cbfa
interactions with the known repressor protein partner TLE.
Drosophila Groucho and the related human TLE proteins (TLE1
and TLE2) (53) are well characterized repressors of
Cbfa-dependent transcription. The mechanism of this suppression
involves a specific protein-protein interaction between TLE proteins
and the VWRPY motif in the C terminus of all Cbfa factors. Earlier
studies of the OC promoter demonstrated that TLE suppresses
Cbfa-mediated transactivation of the OC promoter (18, 55).
We anticipated that contransfection of the Cbfa factors with TLE
proteins might lead to further suppression or potentially relieve the
downregulation of promoter activity by Cbfa. TLE expression plasmids at
several concentrations had no effect on activity of the full-length or proximal BSP promoters (data not shown). The effects of forced Cbfa
expression in the presence or absence of TLE1 or TLE2 expression on the
bp
620 BSP promoter are shown in Figure
10A. The fold
suppression mediated by Cbfa factors or Cbfa1 isoforms was not altered
by the presence of TLE proteins. Similar results were obtained using the full-length kb
1.2 promoter in osseous and nonosseous cell lines
(data not shown). These observations suggested that cellular levels of
TLE proteins may be sufficient to provide maximal suppressor activity
of Cbfa on the BSP promoter or that suppression is independent of TLE
interactions with Cbfa.



View larger version (82K):
[in this window]
[in a new window]
|
FIG. 10.
(Continued) TLE repressor proteins do not modulate
Cbfa-mediated repression of the Gallus BSP promoter. (A)
Coexpression of 0.75 µg of TLE1 or TLE2 with an equal amount of Cbfa
expression plasmid with bp 620 Gallus BSP promoter in
transiently transfected ROS 17/2.8 cells. The MRIPV and MASN Cbfa1
isoforms are also compared. (B) Cbfa1 12 expression plasmid encodes
a mutant which does not include the last 12 amino acids and the
conserved VWRPY motif. All groups for panels A and B were assayed in
the same experiment, and each bar represents the data for several wells
(n = 12). Error bars, SEM. Statistically significant
differences were not found by ANOVA. HeLa cells were transiently
cotransfected in parallel and assayed for expression levels of these
proteins. The blot was incubated with anti-Xpress antibody to detect
epitope-tagged TLE and Cbfa proteins. Lamin B was evaluated to assess
sample loading. (C) C-terminal domain of Cbfa1 contributes to
suppression of the Gallus BSP promoter. The Cbfa1 C mutant
lacking amino acids 362 to 513 is compared to the WT and to the
Cbfa1 12 mutant for functional activity on the bp 620 BSP promoter.
The inset shows Western blot analysis indicating comparable levels of
expression of Cbfa1 proteins.
|
|
To address these possibilities, we constructed a series of C-terminal
deletion mutations of Cbfa1. The Cbfa1

12 expression
construct
produces a protein that lacks the last 12 amino acids
including the
conserved VWRPY motif that interacts with TLE proteins.
Figure
10B
shows that suppressive activity on the BSP promoter
by Cbfa1

12 is
equivalent to that of the wild-type Cbfa1 and that
the coexpression of
either TLE1 or TLE2 has no effect on this
suppression. These results
indicate that repression of the BSP
promoter by Cbfa1 does not involve
TLE interaction. Since the
Cbfa1

12 exhibited equivalent suppressive
activity to (WT)Cbfa1,
the repressor activity must reside in another
domain of the protein.
The C termini of Cbfa factors contain several
functional domains,
including a 31-amino-acid sequence that is required
for trafficking
these nuclear factors to subnuclear sites that support
transcription
(
61). Thus, we compared the effect of WT
Cbfa1 (from amino acids
1 to 513) and Cbfa1

C (from amino acids 1 to
361), lacking the
C terminus, on BSP promoter activity. Although DNA
binding activity
is retained, this mutant protein is not targeted to
the nuclear
matrix (
54). Interestingly, we observed a loss
of suppressor
function by this mutant protein on BSP promoter activity
(Fig.
10C). Taken together, these results indicate that BSP promoter
activity and expression (mRNA) in osteoblasts is downregulated
by Cbfa1
interaction with Cbfa motifs, but does not involve Cbfa-TLE
protein-protein interactions. A different domain in Cbfa1, residing
between amino acids 362 and 501, may contribute to Cbfa-mediated
suppression of BSP promoter
activity.
 |
DISCUSSION |
The present studies clearly demonstrate, by several lines of
evidence, that the Cbfa family of transcription factors mediate suppression of the Gallus BSP promoter in osseous and
nonosseous cell lines. This repression occurred in rodent and human
cells (2- to 16-fold) but was most evident (14- to 32-fold) in the
species homologous Gallus osteoblasts. Notably, the mouse
BSP promoter has been characterized with respect to its responsiveness
to Cbfa1 and no consensus Cbfa sequences were defined within the
proximal 1.2 kb, nor could the promoter be modulated by forced
expression of Cbfa (3). The mouse and rat share similar
promoter organizational properties and are in contrast to
Gallus and humans, which are more closely related. Thus,
downregulation of BSP by Cbfa appears to be more important for
regulation in humans and Gallus than for that in rodent
species, but the reason why is not clear.
Cbfa factors have been reported to mediate activation of genes related
to differentiation of either hematopoietic cells (T- and B-cell
differentiation) or osteoblasts, for example, the mouse germ line alpha
immunoglobulin promoter (50) and OC promoters (1). Presently, a few gene promoters are known to be
downregulated by Cbfa factors (p21 and the multidrug resistance [MDR]
genes [34]). However, the suppressive effects on
promoter activity were observed only in certain cell types and are
either mSin3A- or TLE-dependent (24, 34). In contrast to
those studies, we show that suppression of BSP is cell type independent
and that both the promoter and endogenous transcripts are downregulated by Cbfa factors. Furthermore, the suppression mechanism does not involve the interaction of TLE proteins. Our findings, which indicate that the seven Cbfa consensus sequences within 1.2 kb of the
Gallus BSP promoter mediate a repression of BSP
transcription concurrent with the activation of OC in osteoblasts, can
be summarized as follows: (i) deletion of 600 bp of distal BSP promoter
sequences (from kb
1.2 to
0.6) containing three Cbfa sites raises
promoter activity three- to fourfold in osteoblasts and HeLa cells,
(ii) forced expression of Cbfa factors in HeLa cells and in rat and Gallus osteoblasts leads to marked downregulation of BSP
promoter activity and mRNA levels (31 to 39%) of the BSP gene in
osteoblasts, (iii) mutation of Cbfa motifs (bp
524) increases
(twofold) basal promoter activity and loss of repression in response to
forced expression of Cbfa factors, (iv) competition studies and
antibody supershift analyses demonstrate sequence-specific binding of
Cbfa factors to the consensus regulatory elements, and, lastly, (v) deletion of the established interaction domain of Cbfa1 with TLE does
not affect repressor activity (in contrast, deletion of the entire
Cbfa1 C terminus [amino acids 362 to 513] results in loss of
suppressor function, suggesting that other regulatory sequences are
required for activity). These observations raise several significant questions related to the biology of regulation of this bone-restricted marker of osteoblast differentiation by the Cbfa proteins, as well as
the precise molecular mechanism for repressor activity in osteoblasts
involving Cbfa1.
The first question raised by our observations is the apparent
inconsistency between Cbfa repressor activity on the BSP promoter and
the role of Cbfa1 as a critical determinant of osteogenesis and
osteoblast differentiation in vivo. Similar to the bone-specific OC
gene, BSP mRNA is upregulated in concert with the active deposition of
minerals (36, 41, 43, 45, 57). However, BSP is temporally expressed earlier than OC during development of the osteoblast phenotype and is downregulated in mature osteocytes (8, 23, 35,
57, 60). Cbfa1 DNA binding activity is highest in mature osteoblasts (2), when the decline in BSP mRNA is observed
(57). This contrasting regulation between the BSP and OC
promoters by Cbfa is consistent with other findings. Notably, BSP and
OC are quite distinct with respect to their tissue-specific functions and hormonal regulation of expression. For example, vitamin D, dexamethasone, and transforming growth factor
(TGF-
) have
opposing effects on transcription of these two genes. BSP is an
RGD-containing phosphorylated sialoprotein (5, 17, 40,
60). RGD-containing bone-related proteins (9, 16, 17,
39) have been of considerable interest because they have been
shown to interact specifically with the integrin isotypes found on
osteoclasts (46, 47). As such, these molecules may be
important in the processes of resorption, and, therefore, BSP may
require well-controlled transcriptional levels in mature osteoblasts
possessing high levels of Cbfa1 in order for bone resorption to be
tightly regulated. In this regard, vitamin D, which can promote bone
turnover and is a strong enhancer of the OC gene, is a negative
regulator of BSP. Thus, OC and BSP genes are similar with respect to
bone tissue-specific expression but are distinct with respect to the
timing of their expression, their protein properties, their spatial
distribution in the bone tissue, and their functions. Thus, it may be
necessary to differentially regulate OC and BSP expression through a
tissue-restricted transcription factor. Cbfa factors may attenuate BSP
levels at certain stages of osteoblast differentiation to accommodate
the functional role of BSP in bone.
The question remains as to how BSP is initially activated in
osteoblasts, if not by Cbfa1. Studies have shown that Cbfa1 is necessary but not sufficient for osteogenic differentiation
(32). For example, both BMP-2 and TGF-
can induce
expression of Cbfa1 and homeodomain proteins in the nonosseous myogenic
cell line C2C12 (6, 32), but only BMP-2 can support a
change to the osteogenic phenotype with concomitant expression of OC
and other osteoblast markers (27). Thus Cbfa1 may be
inducing or interacting with an unknown factor in response to BMP-2
that functions as a transcriptional activator, either directly as a DNA
binding protein or indirectly as a Cbfa partner protein. BMP-2 induces homeodomain proteins (32, 44a) which have been shown to
support bone-specific BSP expression and mediate enhancer activity of the BSP promoter (4). Both OC and BSP, as well as collagen type I expressed in bone, have similar homeodomain binding motifs which
have been demonstrated to support tissue-restricted expression of OC
and collagen in osteoblasts (20, 48, 56).
Several mechanisms may contribute to Cbfa1 suppression of BSP
transcription. Our findings indicate that the C terminus of Cbfa1
contains an important regulatory domain specific to repression of the
BSP promoter. The mutant Cbfa
C lacking amino acids 362 to 513 (known
to interact with a variety of partner proteins) fails to repress the
BSP promoter. Thus, a corepressor Cbfa1 interacting partner may
participate in transcriptional regulation within the context of BSP
Cbfa motifs. Our mutational evidence has proven that Cbfa elements can
mediate repression in the BSP promoter, in addition to the activation
function that has been shown for other promoters (e.g., OC, TGF-
type 1 receptor, and collagenase 3). Therefore, the context of the Cbfa
sequences within a promoter must contribute to the formation of a Cbfa
regulatory complex, mediating either repression or activation. While
multimers of the Cbfa consensus sequence fused to a reporter result in
enhancer activity (13, 55), the multiplicity of Cbfa sites
noted within various promoters (rat OC [37] and TGF-
type 1 receptor [26]) may provide one mechanism for
context-dependent modulation of activity through structural
organization of gene promoters. We have demonstrated for the OC gene
that the three Cbfa sites contribute to formation and maintenance of
promoter architecture (25). Cbfa factors are known to
interact with proteins that influence chromatin architecture (e.g.,
p300 histone acetyltransferases [30], LEF-ALY
[19], and TLE [7, 18, 44]). In the BSP promoter, if Cbfa binding facilitates promoter architecture and chromatin structure, the binding of Cbfa factors may result in secondary interactions allowing accessibility of potential
transcription factors that suppress promoter activity.
In conclusion, we have demonstrated promoter context-dependent
Cbfa-mediated suppression of the osteoblast-related BSP gene by several
lines of evidence. This first demonstration of negative promoter
regulation by Cbfa1 for an osteoblast-expressed gene illustrates the
necessity for precise control of expression of a gene that is
temporally and spatially restricted in bone tissue and during
development of the osteoblast phenotype.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from the National Institutes of
Health (grant no. AR39588, DE12528, AR45689, and HD22400).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Cell Biology, University of Massachusetts Medical School, 55 Lake Ave. North, Worcester, MA 01655-0106. Phone: (508) 856-5625. Fax: (508) 856-6800. E-mail: Gary.Stein{at}umassmed.edu.
 |
REFERENCES |
| 1.
|
Banerjee, C.,
S. W. Hiebert,
J. L. Stein,
J. B. Lian, and G. S. Stein.
1996.
An AML-1 consensus sequence binds an osteoblast-specific complex and transcriptionally activates the osteocalcin gene.
Proc. Natl. Acad. Sci. USA
93:4968-4973[Abstract/Free Full Text].
|
| 2.
|
Banerjee, C.,
L. R. McCabe,
J.-Y. Choi,
S. W. Hiebert,
J. L. Stein,
G. S. Stein, and J. B. Lian.
1997.
Runt homology domain proteins in osteoblast differentiation: AML-3/CBFA1 is a major component of a bone specific complex.
J. Cell. Biochem.
66:1-8[CrossRef][Medline].
|
| 3.
|
Benson, M. D.,
J. E. Aubin,
G. Xiao,
P. E. Thomas, and R. T. Franceschi.
1999.
Cloning of a 2.5 kb murine bone sialoprotein promoter fragment and functional analysis of putative Osf2 binding sites.
J. Bone Miner. Res.
14:396-405[CrossRef][Medline].
|
| 4.
|
Benson, M. D.,
J. L. Bargeon,
G. Xiao,
P. E. Thomas,
A. Kim,
Y. Cui, and R. T. Franceschi.
2000.
Identification of a homeodomain binding element in the bone sialoprotein gene promoter that is required for its osteoblast-selective expression.
J. Biol. Chem.
275:13907-13917[Abstract/Free Full Text].
|
| 5.
|
Bianco, P.,
L. W. Fisher,
M. F. Young,
J. D. Termine, and P. G. Robey.
1991.
Expression of bone sialoprotein (BSP) in developing human tissues.
Calcif. Tissue Int.
49:421-426[Medline].
|
| 6.
|
Chen, D.,
X. Ji,
M. A. Harris,
J. Q. Feng,
G. Karsenty,
A. J. Celeste,
V. Rosen,
G. R. Mundy, and S. E. Harris.
1998.
Differential roles for bone morphogenetic protein (BMP) receptor type IB and IA in differentiation and specification of mesenchymal precursor cells to osteoblast and adipocyte lineages.
J. Cell Biol.
142:295-305[Abstract/Free Full Text].
|
| 7.
|
Chen, G.,
J. Fernandez,
S. Mische, and A. J. Courey.
1999.
A functional interaction between the histone deacetylase Rpd3 and the corepressor groucho in Drosophila development.
Genes Dev.
13:2218-2230[Abstract/Free Full Text].
|
| 8.
|
Cowles, E. A.,
M. E. Derome,
G. Pastizzo,
L. L. Brailey, and G. A. Gronowicz.
1998.
Mineralization and the expression of matrix proteins during in vivo bone development.
Calcif. Tissue Int.
62:74-82[CrossRef][Medline].
|
| 9.
|
Denhardt, D. T., and X. Guo.
1993.
Osteopontin: a protein with diverse functions.
FASEB J.
7:1475-1482[Abstract].
|
| 10.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 11.
|
Ducy, P.,
R. Zhang,
V. Geoffroy,
A. L. Ridall, and G. Karsenty.
1997.
Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation.
Cell
89:747-754[CrossRef][Medline].
|
| 12.
|
Fujisawa, R.,
M. Mizuno,
Y. Nodasaka, and Y. Kuboki.
1997.
Attachment of osteoblastic cells to hydroxyapatite crystals by a synthetic peptide (Glu7-Pro-Arg-Gly-Asp-Thr) containing two functional sequences of bone sialoprotein.
Matrix Biol.
16:21-28[CrossRef][Medline].
|
| 13.
|
Geoffroy, V.,
P. Ducy, and G. Karsenty.
1995.
A PEBP2 /AML-1-related factor increases osteocalcin promoter activity through its binding to an osteoblast-specific cis-acting element.
J. Biol. Chem.
270:30973-30979[Abstract/Free Full Text].
|
| 14.
|
Gerstenfeld, L. C.,
S. D. Chipman,
J. Glowacki, and J. B. Lian.
1987.
Expression of differentiated function by mineralizing cultures of chicken osteoblasts.
Dev. Biol.
122:49-60[CrossRef][Medline].
|
| 15.
| Gerstenfeld, L. C., S. S. Shih, C. George, S. Mizunmo, and J. Glowacki. Effect of overexpression of bone
sialoprotein or osteocalcin on osteosarcoma tissue growth and
mineralization Proc. Am. Acad. Orthoped. Surgeons, in press.
|
| 16.
|
Gotoh, Y.,
L. C. Gerstenfeld, and M. J. Glimcher.
1990.
Identification and characterization of the major chicken bone phosphoprotein. Analysis of its synthesis by cultured embryonic chick osteoblasts.
Eur. J. Biochem
187:49-58[Medline].
|
| 17.
|
Gotoh, Y.,
M. D. Pierschbacher,
J. J. Grzesiak,
L. Gerstenfeld, and M. J. Glimcher.
1990.
Comparison of two phosphoproteins in chicken bone and their similarities to the mammalian bone proteins, osteopontin and bone sialoprotein II.
Biochem. Biophys. Res. Commun.
173:471-479[CrossRef][Medline].
|
| 18.
|
Guo, B.,
A. Javed,
J. Green,
J. L. Stein,
J. B. Lian,
A. J. van Wijnen, and G. S. Stein.
1998.
Groucho/TLE proteins associate with the nuclear matrix and repress Cbfa/AML mediated transactivation on osteocalcin promoter, abstr.
Bone
23:S184-S184.
|
| 19.
|
Hernandez-Munain, C.,
J. L. Roberts, and M. S. Krangel.
1998.
Cooperation among multiple transcription factors is required for access to minimal T-cell receptor alpha-enhancer chromatin in vivo.
Mol. Cell. Biol.
18:3223-3233[Abstract/Free Full Text].
|
| 20.
|
Hoffmann, H. M.,
T. L. Beumer,
S. Rahman,
L. R. McCabe,
C. Banerjee,
F. Aslam,
J. A. Tiro,
A. J. van Wijnen,
J. L. Stein,
G. S. Stein, and J. B. Lian.
1996.
Bone tissue-specific transcription of the osteocalcin gene: role of an activator osteoblast-specific complex and suppressor hox proteins that bind the OC box.
J. Cell. Biochem.
61:310-324[CrossRef][Medline].
|
| 21.
|
Hoffmann, H. M.,
K. M. Catron,
A. J. van Wijnen,
L. R. McCabe,
J. B. Lian,
G. S. Stein, and J. L. Stein.
1994.
Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.
Proc. Natl. Acad. Sci. USA
91:12887-12891[Abstract/Free Full Text].
|
| 22.
|
Hunter, G. K., and H. A. Goldberg.
1993.
Nucleation of hydroxyapatite by bone sialoprotein.
Proc. Natl. Acad. Sci. USA
90:8562-8565[Abstract/Free Full Text].
|
| 23.
|
Ibaraki, K.,
J. D. Termine,
S. W. Whitson, and M. F. Young.
1992.
Bone matrix mRNA expression in differentiating fetal bovine osteoblasts.
J. Bone Miner. Res.
7:743-754[Medline].
|
| 24.
|
Javed, A.,
B. Guo,
S. Hiebert,
J.-Y. Choi,
J. Green,
S.-C. Zhao,
M. A. Osborne,
S. Stifani,
J. L. Stein,
J. B. Lian,
A. J. van Wijnen, and G. S. Stein.
2000.
Groucho/TLE/R-Esp proteins associate with the nuclear matrix and repress RUNX (CBF /AML/PEBP2 ) dependent activation of tissue-specific gene transcription.
J. Cell Sci.
113:2221-2231[Abstract].
|
| 25.
|
Javed, A.,
S. Gutierrez,
M. Montecino,
A. J. van Wijnen,
J. L. Stein,
G. S. Stein, and J. B. Lian.
1999.
Multiple Cbfa/AML sites in the rat osteocalcin promoter are required for basal and vitamin D responsive transcription and contribute to chromatin organization.
Mol. Cell. Biol.
19:7491-7500[Abstract/Free Full Text].
|
| 26.
|
Ji, C.,
S. Casinghino,
D. J. Chang,
Y. Chen,
A. Javed,
Y. Ito,
S. W. Hiebert,
J. B. Lian,
G. S. Stein,
T. L. McCarthy, and M. Centrella.
1998.
CBFa(AML/PEBP2)-related elements in the TGF-beta type I receptor promoter and expression with osteoblast differentiation.
J. Cell. Biochem.
69:353-363[CrossRef][Medline].
|
| 27.
|
Katagiri, T.,
A. Yamaguchi,
M. Komaki,
E. Abe,
N. Takahashi,
T. Ikeda,
V. Rosen,
J. M. Wozney,
A. Fujisawa-Sehara, and T. Suda.
1994.
Bone morphogenetic protein-2 converts the differentiation pathway of C2C12 myoblasts into the osteoblast lineage.
J. Cell Biol.
127:1755-1766[Abstract/Free Full Text].
|
| 28.
|
Kerr, J. M.,
D. R. Hiscock,
W. Grzesik,
P. G. Robey, and M. F. Young.
1997.
The human bone sialoprotein gene contains an NF-E1/YY1 cis-acting sequence with putative regulatory activity.
Calcif. Tissue Int.
60:276-282[CrossRef][Medline].
|
| 29.
|
Kim, R. H.,
H. S. Shapiro,
J. J. Li,
J. L. Wrana, and J. Sodek.
1994.
Characterization of the human bone sialoprotein (BSP) gene and its promoter sequence.
Matrix Biol.
14:31-40[CrossRef][Medline].
|
| 30.
|
Kitabayashi, I.,
A. Yokoyama,
K. Shimizu, and M. Ohki.
1998.
Interaction and functional cooperation of the leukemia-associated factors AML1 and p300 in myeloid cell differentiation.
EMBO J.
17:2994-3004[CrossRef][Medline].
|
| 31.
|
Komori, T.,
H. Yagi,
S. Nomura,
A. Yamaguchi,
K. Sasaki,
K. Deguchi,
Y. Shimizu,
R. T. Bronson,
Y.-H. Gao,
M. Inada,
M. Sato,
R. Okamoto,
Y. Kitamura,
S. Yoshiki, and T. Kishimoto.
1997.
Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts.
Cell
89:755-764[CrossRef][Medline].
|
| 32.
|
Lee, M. H.,
A. Javed,
H. J. Kim,
H. I. Shin,
S. Gutierrez,
J. Y. Choi,
V. Rosen,
J. L. Stein,
A. J. van Wijnen,
G. S. Stein,
J. B. Lian, and H. M. Ryoo.
1999.
Transient upregulation of CBFA1 in response to bone morphogenetic protein-2 and transforming growth factor 1 in C2C12 myogenic cells coincides with suppression of the myogenic phenotype but is not sufficient for osteoblast differentiation.
J. Cell. Biochem.
73:114-125[CrossRef][Medline].
|
| 33.
|
Li, J. J.,
R. H. Kim,
Q. Zhang,
Y. Ogata, and J. Sodek.
1998.
Characteristics of vitamin D3 receptor (VDR) binding to the vitamin D response element (VDRE) in rat bone sialoprotein gene promoter.
Eur. J. Oral Sci.
106:408-417.
|
| 34.
|
Lutterbach, B.,
J. J. Westendorf,
B. Linggi,
S. Isaac,
E. Seto, and S. W. Hiebert.
2000.
A mechanism of repression by acute myeloid leukemia-1, the target of multiple chromosomal translocations in acute leukemia.
J. Biol. Chem.
275:651-656[Abstract/Free Full Text].
|
| 35.
|
Malaval, L.,
F. Liu,
P. Roche, and J. E. Aubin.
1999.
Kinetics of osteoprogenitor proliferation and osteoblast differentiation in vitro.
J. Cell. Biochem.
74:616-627[CrossRef][Medline].
|
| 36.
|
Manduca, P.,
C. Palermo,
C. Caruso,
A. Brizzolara,
C. Sanguineti,
C. Filanti, and A. Zicca.
1997.
Rat tibial osteoblasts III: propagation in vitro is accompanied by enhancement of osteoblast phenotype.
Bone
21:31-39[Medline].
|
| 37.
|
Merriman, H. L.,
A. J. van Wijnen,
S. Hiebert,
J. P. Bidwell,
E. Fey,
J. Lian,
J. Stein, and G. S. Stein.
1995.
The tissue-specific nuclear matrix protein, NMP-2, is a member of the AML/CBF/PEBP2/runt domain transcription factor family: interactions with the osteocalcin gene promoter.
Biochemistry
34:13125-13132[CrossRef][Medline].
|
| 38.
|
Meyers, S.,
N. Lenny,
W.-H. Sun, and S. W. Hiebert.
1996.
AML-2 is a potential target for transcriptional regulation by the t(8;21) and t(12;21) fusion proteins in acute leukemia.
Oncogene
13:303-312[Medline].
|
| 39.
|
Moore, M. A.,
Y. Gotoh,
K. Rafidi, and L. C. Gerstenfeld.
1991.
Characterization of a cDNA for chicken osteopontin: expression during bone development, osteoblast differentiation, and tissue distribution.
Biochemistry
30:2501-2508[CrossRef][Medline].
|
| 40.
|
Nagata, T.,
R. Todescan,
H. A. Goldberg,
Q. Zhang, and J. Sodek.
1989.
Sulphation of secreted phosphoprotein I (SPPI, osteopontin) is associated with mineralized tissue formation.
Biochem. Biophys. Res. Commun.
165:234-240[CrossRef][Medline].
|
| 41.
|
Nefussi, J. R.,
G. Brami,
D. Modrowski,
M. Oboeuf, and N. Forest.
1997.
Sequential expression of bone matrix proteins during rat calvaria osteoblast differentiation and bone nodule formation in vitro.
J. Histochem. Cytochem.
45:493-503[Abstract/Free Full Text].
|
| 42.
|
Otto, F.,
A. P. Thornell,
T. Crompton,
A. Denzel,
K. C. Gilmour,
I. R. Rosewell,
G. W. H. Stamp,
R. S. P. Beddington,
S. Mundlos,
B. R. Olsen,
P. B. Selby, and M. J. Owen.
1997.
Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development.
Cell
89:765-771[CrossRef][Medline].
|
| 43.
|
Owen, T. A.,
D. R. Soprano, and K. J. Soprano.
1989.
Analysis of the growth factor requirements for stimulation of WI-38 cells after extended periods of density-dependent growth arrest.
J. Cell. Physiol.
139:424-431[CrossRef][Medline].
|
| 44.
|
Palaparti, A.,
A. Baratz, and S. Stifani.
1997.
The Groucho/transducin-like enhancer of split transcriptional repressors interact with the genetically defined amino-terminal silencing domain of histone H3.
J. Biol. Chem.
272:26604-26610[Abstract/Free Full Text].
|
| 44a.
|
Pera, E.,
S. Stein, and M. Kessel.
1999.
Ectodermal patterning in the avian embryo: epidermis versus neural plate.
Development
126:63-73[Abstract].
|
| 45.
|
Pockwinse, S. M.,
L. G. Wilming,
D. M. Conlon,
G. S. Stein, and J. B. Lian.
1992.
Expression of cell growth and bone specific genes at single cell resolution during development of bone tissue-like organization in primary osteoblast cultures.
J. Cell. Biochem.
49:310-323[CrossRef][Medline].
|
| 46.
|
Roach, H. I.
1992.
Trans-differentiation of hypertrophic chondrocytes into cells capable of producing a mineralized bone matrix.
Bone Miner.
19:1-20[CrossRef][Medline].
|
| 47.
|
Ross, F. P.,
J. Chappel,
J. I. Alvarez,
D. Sander,
W. T. Butler,
M. C. Farach-Carson,
K. A. Mintz,
P. G. Robey,
S. L. Teitelbaum, and D. A. Cheresh.
1993.
Interactions between the bone matrix proteins osteopontin and bone sialoprotein and the osteoclast integrin alpha v beta 3 potentiate bone resorption.
J. Biol. Chem.
268:9901-9907[Abstract/Free Full Text].
|
| 48.
|
Rossert, J. A.,
S. S. Chen,
H. Eberspaecher,
C. N. Smith, and B. de Crombrugghe.
1996.
Identification of a minimal sequence of the mouse pro- 1(I) collagen promoter that confers high-level osteoblast expression in transgenic mice and that binds a protein selectively present in osteoblasts.
Proc. Natl. Acad. Sci. USA
93:1027-1031[Abstract/Free Full Text].
|
| 49.
|
Selvamurugan, N., and N. C. Partridge.
2000.
Constitutive expression and regulation of collagenase-3 in human breast cancer cells.
Mol. Cell Biol. Res. Commun.
3:218-223[CrossRef][Medline].
|
| 50.
|
Shi, M. J., and J. Stavnezer.
1998.
CBF alpha3 (AML2) is induced by TGF- 1 to bind and activate the mouse germline Ig alpha promoter.
J. Immunol.
161:6751-6760[Abstract/Free Full Text].
|
| 51.
|
Sleigh, M. J.
1986.
A nonchromatographic assay for expression of the chloramphenicol acetyltransferase gene in eucaryotic cells.
Anal. Biochem
156:251-256[CrossRef][Medline].
|
| 52.
|
Stewart, M.,
A. Terry,
M. Hu,
M. O'Hara,
K. Blyth,
E. Baxter,
E. Cameron,
D. E. Onions, and J. C. Neil.
1997.
Proviral insertions induce the expression of bone-specific isoforms of PEBP2 A (CBFA1): evidence for a new myc collaborating oncogene.
Proc. Natl. Acad. Sci. USA
94:8646-8651[Abstract/Free Full Text].
|
| 53.
|
Stifani, S.,
C. M. Blaumueller,
N. J. Redhead,
R. E. Hill, and S. Artavanis-Tsakonas.
1992.
Human homologs of a Drosophila enhancer of split gene product define a novel family of nuclear proteins.
Nat. Genet.
2:119-127[CrossRef][Medline].
|
| 54.
|
Tang, L.,
B. Guo,
A. Javed,
J.-Y. Choi,
S. Hiebert,
J. B. Lian,
A. J. van Wijnen,
J. L. Stein,
G. S. Stein, and G. W. Zhou.
1999.
Crystal structure of the nuclear matrix targeting signal of the transcription factor AML-1/PEBP2 B/CBF 2.
J. Biol. Chem.
274:33580-33586[Abstract/Free Full Text].
|
| 55.
|
Thirunavukkarasu, K.,
M. Mahajan,
K. W. McLarren,
S. Stifani, and G. Karsenty.
1998.
Two domains unique to osteoblast-specific transcription factor Osf2/Cbfa1 contribute to its transactivation function and its inability to heterodimerize with Cbf .
Mol. Cell. Biol.
18:4197-4208[Abstract/Free Full Text].
|
| 56.
|
Towler, D. A.,
S. J. Rutledge, and G. A. Rodan.
1994.
Msx-2/Hox 8.1: a transcriptional regulator of the rat osteocalcin promoter.
Mol. Endocrinol.
8:1484-1493[Abstract/Free Full Text].
|
| 57.
|
White, C.,
E. Gardiner, and J. Eisman.
1998.
Tissue specific and vitamin D responsive gene expression in bone.
Mol. Biol. Rep.
25:45-61[CrossRef][Medline].
|
| 58.
|
Yang, R., and L. C. Gerstenfeld.
1996.
Signal transduction pathways mediating parathyroid hormone stimulation of bone sialoprotein gene expression in osteoblasts.
J. Biol. Chem.
271:29839-29846[Abstract/Free Full Text].
|
| 59.
|
Yang, R., and L. C. Gerstenfeld.
1997.
Structural analysis and characterization of tissue and hormonal responsive expression of the avian bone sialoprotein (BSP) gene.
J. Cell. Biochem.
64:77-93[CrossRef][Medline].
|
| 60.
|
Yang, R.,
Y. Gotoh,
M. A. Moore,
K. Rafidi, and L. C. Gerstenfeld.
1995.
Characterization of an avian bone sialoprotein (BSP) cDNA: comparisons to mammalian BSP and identification of conserved structural domains.
J. Bone Miner. Res.
10:632-640[Medline].
|
| 61.
|
Zeng, C.,
A. J. van Wijnen,
J. L. Stein,
S. Meyers,
W. Sun,
L. Shopland,
J. B. Lawrence,
S. Penman,
J. B. Lian,
G. S. Stein, and S. W. Hiebert.
1997.
Identification of a nuclear matrix targeting signal in the leukemia and bone-related AML/CBF transcription factors.
Proc. Natl. Acad. Sci. USA
94:6746-6751[Abstract/Free Full Text].
|
Molecular and Cellular Biology, April 2001, p. 2891-2905, Vol. 21, No. 8
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.8.2891-2905.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhang, C.Y., Zheng, S.G., Wang, Y.X., Zhu, J.X., Zhu, X., Zhao, Y.M., Ge, L.H.
(2009). Novel RUNX2 Mutations in Chinese Individuals with Cleidocranial Dysplasia. JDR
88: 861-866
[Abstract]
[Full Text]
-
Li, Y., Pan, W., Xu, W., He, N., Chen, X., Liu, H., Darryl Quarles, L., Zhou, H., Xiao, Z.
(2009). RUNX2 mutations in Chinese patients with cleidocranial dysplasia. Mutagenesis
24: 425-431
[Abstract]
[Full Text]
-
Sun, X., Wei, L., Chen, Q., Terek, R. M.
(2009). HDAC4 Represses Vascular Endothelial Growth Factor Expression in Chondrosarcoma by Modulating RUNX2 Activity. J. Biol. Chem.
284: 21881-21890
[Abstract]
[Full Text]
-
Sharff, K. A., Song, W.-X., Luo, X., Tang, N., Luo, J., Chen, J., Bi, Y., He, B.-C., Huang, J., Li, X., Jiang, W., Zhu, G.-H., Su, Y., He, Y., Shen, J., Wang, Y., Chen, L., Zuo, G.-W., Liu, B., Pan, X., Reid, R. R., Luu, H. H., Haydon, R. C., He, T.-C.
(2009). Hey1 Basic Helix-Loop-Helix Protein Plays an Important Role in Mediating BMP9-induced Osteogenic Differentiation of Mesenchymal Progenitor Cells. J. Biol. Chem.
284: 649-659
[Abstract]
[Full Text]
-
Matsubara, T., Kida, K., Yamaguchi, A., Hata, K., Ichida, F., Meguro, H., Aburatani, H., Nishimura, R., Yoneda, T.
(2008). BMP2 Regulates Osterix through Msx2 and Runx2 during Osteoblast Differentiation. J. Biol. Chem.
283: 29119-29125
[Abstract]
[Full Text]
-
Javed, A., Bae, J.-S., Afzal, F., Gutierrez, S., Pratap, J., Zaidi, S. K., Lou, Y., van Wijnen, A. J., Stein, J. L., Stein, G. S., Lian, J. B.
(2008). Structural Coupling of Smad and Runx2 for Execution of the BMP2 Osteogenic Signal. J. Biol. Chem.
283: 8412-8422
[Abstract]
[Full Text]
-
Lamour, V., Detry, C., Sanchez, C., Henrotin, Y., Castronovo, V., Bellahcene, A.
(2007). Runx2- and Histone Deacetylase 3-mediated Repression Is Relieved in Differentiating Human Osteoblast Cells to Allow High Bone Sialoprotein Expression. J. Biol. Chem.
282: 36240-36249
[Abstract]
[Full Text]
-
Wang, Q., Wei, X., Zhu, T., Zhang, M., Shen, R., Xing, L., O'Keefe, R. J., Chen, D.
(2007). Bone Morphogenetic Protein 2 Activates Smad6 Gene Transcription through Bone-specific Transcription Factor Runx2. J. Biol. Chem.
282: 10742-10748
[Abstract]
[Full Text]
-
Fu, Q., Manolagas, S. C., O'Brien, C. A.
(2006). Parathyroid Hormone Controls Receptor Activator of NF-{kappa}B Ligand Gene Expression via a Distant Transcriptional Enhancer.. Mol. Cell. Biol.
26: 6453-6468
[Abstract]
[Full Text]
-
Wai, P. Y., Mi, Z., Gao, C., Guo, H., Marroquin, C., Kuo, P. C.
(2006). Ets-1 and Runx2 Regulate Transcription of a Metastatic Gene, Osteopontin, in Murine Colorectal Cancer Cells. J. Biol. Chem.
281: 18973-18982
[Abstract]
[Full Text]
-
Shen, R., Wang, X., Drissi, H., Liu, F., O'Keefe, R. J., Chen, D.
(2006). Cyclin D1-Cdk4 Induce Runx2 Ubiquitination and Degradation. J. Biol. Chem.
281: 16347-16353
[Abstract]
[Full Text]
-
Shen, R., Chen, M., Wang, Y.-J., Kaneki, H., Xing, L., O'Keefe, R. J., Chen, D.
(2006). Smad6 Interacts with Runx2 and Mediates Smad Ubiquitin Regulatory Factor 1-induced Runx2 Degradation. J. Biol. Chem.
281: 3569-3576
[Abstract]
[Full Text]
-
Shen, Q., Christakos, S.
(2005). The Vitamin D Receptor, Runx2, and the Notch Signaling Pathway Cooperate in the Transcriptional Regulation of Osteopontin. J. Biol. Chem.
280: 40589-40598
[Abstract]
[Full Text]
-
Gaur, T., Lengner, C. J., Hovhannisyan, H., Bhat, R. A., Bodine, P. V. N., Komm, B. S., Javed, A., van Wijnen, A. J., Stein, J. L., Stein, G. S., Lian, J. B.
(2005). Canonical WNT Signaling Promotes Osteogenesis by Directly Stimulating Runx2 Gene Expression. J. Biol. Chem.
280: 33132-33140
[Abstract]
[Full Text]
-
Chen, S., Rani, S., Wu, Y., Unterbrink, A., Gu, T. T., Gluhak-Heinrich, J., Chuang, H.-H., MacDougall, M.
(2005). Differential Regulation of Dentin Sialophosphoprotein Expression by Runx2 during Odontoblast Cytodifferentiation. J. Biol. Chem.
280: 29717-29727
[Abstract]
[Full Text]
-
Javed, A., Barnes, G. L., Pratap, J., Antkowiak, T., Gerstenfeld, L. C., van Wijnen, A. J., Stein, J. L., Lian, J. B., Stein, G. S.
(2005). Impaired intranuclear trafficking of Runx2 (AML3/CBFA1) transcription factors in breast cancer cells inhibits osteolysis in vivo. Proc. Natl. Acad. Sci. USA
102: 1454-1459
[Abstract]
[Full Text]
-
Schroeder, T. M., Kahler, R. A., Li, X., Westendorf, J. J.
(2004). Histone Deacetylase 3 Interacts with Runx2 to Repress the Osteocalcin Promoter and Regulate Osteoblast Differentiation. J. Biol. Chem.
279: 41998-42007
[Abstract]
[Full Text]
-
Barnes, G. L., Hebert, K. E., Kamal, M., Javed, A., Einhorn, T. A., Lian, J. B., Stein, G. S., Gerstenfeld, L. C.
(2004). Fidelity of Runx2 Activity in Breast Cancer Cells Is Required for the Generation of Metastases-Associated Osteolytic Disease. Cancer Res.
64: 4506-4513
[Abstract]
[Full Text]
-
Bertrand-Philippe, M., Ruddell, R. G., Arthur, M. J. P., Thomas, J., Mungalsingh, N., Mann, D. A.
(2004). Regulation of Tissue Inhibitor of Metalloproteinase 1 Gene Transcription by RUNX1 and RUNX2. J. Biol. Chem.
279: 24530-24539
[Abstract]
[Full Text]
-
Slobedman, B., Stern, J. L., Cunningham, A. L., Abendroth, A., Abate, D. A., Mocarski, E. S.
(2004). Impact of Human Cytomegalovirus Latent Infection on Myeloid Progenitor Cell Gene Expression. J. Virol.
78: 4054-4062
[Abstract]
[Full Text]
-
Sevetson, B., Taylor, S., Pan, Y.
(2004). Cbfa1/RUNX2 Directs Specific Expression of the Sclerosteosis Gene (SOST). J. Biol. Chem.
279: 13849-13858
[Abstract]
[Full Text]
-
McCarthy, T. L., Chang, W.-Z., Liu, Y., Centrella, M.
(2003). Runx2 Integrates Estrogen Activity in Osteoblasts. J. Biol. Chem.
278: 43121-43129
[Abstract]
[Full Text]
-
Enomoto, H., Shiojiri, S., Hoshi, K., Furuichi, T., Fukuyama, R., Yoshida, C. A., Kanatani, N., Nakamura, R., Mizuno, A., Zanma, A., Yano, K., Yasuda, H., Higashio, K., Takada, K., Komori, T.
(2003). Induction of Osteoclast Differentiation by Runx2 through Receptor Activator of Nuclear Factor-{kappa}B Ligand (RANKL) and Osteoprotegerin Regulation and Partial Rescue of Osteoclastogenesis in Runx2-/- Mice by RANKL Transgene. J. Biol. Chem.
278: 23971-23977
[Abstract]
[Full Text]
-
Zhao, M., Berry, J.E., Somerman, M.J.
(2003). Bone Morphogenetic Protein-2 Inhibits Differentiation and Mineralization of Cementoblasts in vitro. JDR
82: 23-27
[Abstract]
[Full Text]
-
Westendorf, J. J., Zaidi, S. K., Cascino, J. E., Kahler, R., van Wijnen, A. J., Lian, J. B., Yoshida, M., Stein, G. S., Li, X.
(2002). Runx2 (Cbfa1, AML-3) Interacts with Histone Deacetylase 6 and Represses the p21CIP1/WAF1 Promoter. Mol. Cell. Biol.
22: 7982-7992
[Abstract]
[Full Text]
-
Harrington, K. S., Javed, A., Drissi, H., McNeil, S., Lian, J. B., Stein, J. L., van Wijnen, A. J., Wang, Y.-L., Stein, G. S.
(2002). Transcription factors RUNX1/AML1 and RUNX2/Cbfa1 dynamically associate with stationary subnuclear domains. J. Cell Sci.
115: 4167-4176
[Abstract]
[Full Text]
-
Banerjee, C., Javed, A., Choi, J.-Y., Green, J., Rosen, V., van Wijnen, A. J., Stein, J. L., Lian, J. B., Stein, G. S.
(2001). Differential Regulation of the Two Principal Runx2/Cbfa1 N-Terminal Isoforms in Response to Bone Morphogenetic Protein-2 during Development of the Osteoblast Phenotype. Endocrinology
142: 4026-4039
[Abstract]
[Full Text]
-
Choi, J.-Y., Pratap, J., Javed, A., Zaidi, S. K., Xing, L., Balint, E., Dalamangas, S., Boyce, B., van Wijnen, A. J., Lian, J. B., Stein, J. L., Jones, S. N., Stein, G. S.
(2001). Subnuclear targeting of Runx/Cbfa/AML factors is essential for tissue-specific differentiation during embryonic development. Proc. Natl. Acad. Sci. USA
10.1073/pnas.151236498v1
[Abstract]
[Full Text]
-
Zaidi, S. K., Javed, A., Choi, J.-Y., van Wijnen, A. J., Stein, J. L., Lian, J. B., Stein, G. S.
(2001). A specific targeting signal directs Runx2/Cbfa1 to subnuclear domains and contributes to transactivation of the osteocalcin gene. J. Cell Sci.
114: 3093-3102
[Abstract]
[Full Text]
-
Gilbert, L., He, X., Farmer, P., Rubin, J., Drissi, H., van Wijnen, A. J., Lian, J. B., Stein, G. S., Nanes, M. S.
(2002). Expression of the Osteoblast Differentiation Factor RUNX2 (Cbfa1/AML3/Pebp2alpha A) Is Inhibited by Tumor Necrosis Factor-alpha. J. Biol. Chem.
277: 2695-2701
[Abstract]
[Full Text]
-
Gutierrez, S., Javed, A., Tennant, D. K., van Rees, M., Montecino, M., Stein, G. S., Stein, J. L., Lian, J. B.
(2002). CCAAT/Enhancer-binding Proteins (C/EBP) beta and delta Activate Osteocalcin Gene Transcription and Synergize with Runx2 at the C/EBP Element to Regulate Bone-specific Expression. J. Biol. Chem.
277: 1316-1323
[Abstract]
[Full Text]
-
Choi, J.-Y., Pratap, J., Javed, A., Zaidi, S. K., Xing, L., Balint, E., Dalamangas, S., Boyce, B., van Wijnen, A. J., Lian, J. B., Stein, J. L., Jones, S. N., Stein, G. S.
(2001). Subnuclear targeting of Runx/Cbfa/AML factors is essential for tissue-specific differentiation during embryonic development. Proc. Natl. Acad. Sci. USA
98: 8650-8655
[Abstract]
[Full Text]