Previous Article | Next Article 
Molecular and Cellular Biology, April 2001, p. 2906-2917, Vol. 21, No. 8
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.8.2906-2917.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Discoidin Domain Receptor 1 Tyrosine Kinase Has an
Essential Role in Mammary Gland Development
Wolfgang F.
Vogel,1,*
Attila
Aszódi,2
Frauke
Alves,3 and
Tony
Pawson1,4
Programme in Molecular Biology and Cancer,
Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto,
Ontario M5G 1X5,1 and Department of
Molecular and Medical Genetics, University of Toronto, Toronto, Ontario
M5S 1A8,4 Canada; Department of
Experimental Pathology, Lund University Hospital, 22185 Lund,
Sweden2; and Department of Hematology
and Oncology, University of Göttingen, 37075 Göttingen,
Germany3
Received 24 October 2000/Returned for modification 7 December
2000/Accepted 26 January 2001
 |
ABSTRACT |
Various types of collagen have been identified as potential ligands
for the two mammalian discoidin domain receptor tyrosine kinases, DDR1
and DDR2. Here, we used a recombinant fusion protein between the
extracellular domain of DDR1 and alkaline phosphatase to detect
specific receptor binding sites during mouse development. Major sites
of DDR1-binding activity, indicative of ligand expression, were found
in skeletal bones, the skin, and the urogenital tract. Ligand
expression in the uterus during implantation and in the mammary gland
during pregnancy colocalized with the expression of the DDR1 receptor.
The generation of DDR1-null mice by gene targeting yielded homozygous
mutant animals that were viable but smaller in size than control
littermates. The majority of mutant females were unable to bear
offspring due to a lack of proper blastocyst implantation into the
uterine wall. When implantation did occur, the mutant females were
unable to lactate. Histological analysis showed that the alveolar
epithelium failed to secrete milk proteins into the lumen of the
mammary gland. The lactational defect appears to be caused by
hyperproliferation and abnormal branching of mammary ducts. These
results suggest that DDR1 is a key mediator of the stromal-epithelial
interaction during ductal morphogenesis in the mammary gland.
 |
INTRODUCTION |
Membrane-bound receptors with
intrinsic protein tyrosine kinase activity are designed to sense a
variety of extracellular stimuli. Activated receptor tyrosine kinases
(RTKs) initiate signaling pathways leading to proliferation,
differentiation, metabolism, survival, or cell death. It has been
estimated that mammalian cells contain at least 150 genes coding for
protein tyrosine kinases (13).
The two discoidin domain receptors, DDR1 and DDR2, represent a
subfamily of RTKs and are expressed in a variety of mouse and human
tissues (34). In the N-terminal part of the extracellular region, DDRs have a region related to the Dictyostelium
discoideum protein discoidin. During cell aggregation of
Dictyostelium, discoidin is secreted and functions as a
lectin. In higher organisms, discoidin domains have been recognized in
a variety of membrane-bound and secreted proteins, such as the
neuropilins or blood clotting factors V and VIII (4).
However, it still remains to be shown that mammalian discoidin domains
have a binding affinity to carbohydrates.
Various types of collagen have been identified as potential ligands
capable of activating both DDRs. Whereas DDR1 autophosphorylation is
induced by all collagens so far tested (type I to type VI), DDR2 is
only activated by fibrillar collagens, in particular by collagen type I
and type III (30, 33). In contrast to most other RTKs, DDR
activation by collagen follows slow kinetics and can take up to 18 h to
reach maximal kinase activity. While it is apparent that collagen needs
to be in its native, triple-helix configuration to activate DDR, the
binding epitopes for the DDR extracellular domain on a collagen
molecule and the significance of the discoidin region in collagen
binding are not yet defined (30, 33). It remains entirely
possible that DDRs bind additional ligands, which might act together
with or separately from collagen.
While the biological function of DDR1 is unknown, its expression
pattern has been analyzed in a variety of normal and malignant tissues.
The DDR1 cDNA has been isolated from several human carcinoma cells,
notably from MCF7 mammary carcinoma cells, ovarian and esophageal
cancer cells, HeLa cells, and primary pediatric brain tumor samples,
and also from human keratinocytes (1, 9, 14, 17, 22, 36).
Genes homologous to human DDR1 have been identified in the mouse and
rat (29, 37) and in invertebrates. Mammalian DDR1 mRNA is
highly expressed in kidney, lung, thyroid, and brain (1, 29,
37). RNA in situ hybridization analysis has shown specific
expression of human DDR1 in epithelial cells, for example in the mucosa
of the colon, the follicles of the thyroid, and the islets of
Langerhans (1). During mouse pregnancy, an increase in
DDR1 mRNA transcripts in the mammary gland has been detected
(3). Furthermore, DDR1 is significantly overexpressed in
several human breast tumors (3, 23). The DDR1 promoter displays a potential p53 binding site, and DDR1 expression can be
up-regulated by expression of p53 in human osteosarcoma cells (28). The expression of DDR1 and its ligands in the
cerebellum has been analyzed in more detail (5). In the
cerebellum, dominant-negative mutants of DDR1 blocked the elongation of
granule neurones.
Thus far, three isoforms of the DDR1 protein that arise by alternative
splicing have been characterized. The longest DDR1 transcript codes for
the full-length receptor (c-isoform), whereas the a- or b-receptor
isoforms lack 37 or 6 amino acids in the juxtamembrane or kinase
domain, respectively (1). The phosphotyrosine-binding domain of the adapter protein ShcA interacts with an LLXNPXY site located in the alternatively spliced insert of DDR1b (33).
The juxtamembrane region of DDR1a, transfected into PC12 cells,
interacts with the FRS2, a protein adapter which has been identified as a substrate of the fibroblast growth factor receptor (11).
Constitutive tyrosine phosphorylation of DDR1 was reported in T-47D
cells, possibly due to endogenously secreted collagen proteins
(14). Exogenous collagen type I and type V induce a
substantial increase of DDR1 tyrosine kinase activity in T-47D cells
(33).
In this study, we have identified DDR1-binding sites by staining mouse
sections with the extracellular domain of DDR1 conjugated with alkaline
phosphatase. To analyze the in vivo role of DDR1, we have introduced a
deletion into the DDR1 gene in the mouse germ line. Mice lacking DDR1
are small, and mutant females show multiple reproductive defects. The
majority of females are unable to give birth because developing
blastocysts do not implant. Successfully reproducing females are unable
to nourish their litters because the mammary gland epithelium fails to
secrete milk.
 |
MATERIALS AND METHODS |
Vector and plasmid constructs.
A genomic library from 129/Sv
mice was probed with a cDNA fragment coding for the alternatively
spliced exon 11 of DDR1 (24, 28). From two overlapping
genomic clones, the targeting vector was constructed using the pPNT
plasmid (32). To do this, a 750-bp EcoRI/BamHI fragment and a 2.3-kb
XhoI/NotI fragment were isolated and cloned to
either side of the neor cassette. In the mouse DDR1 locus,
the EcoRI site is located in the 5'-untranslated region and
the BamHI site is 12 bp upstream of the start codon. The
XhoI site is located in the 12th intron, and the
NotI site is in the last coding exon. The linearized vector was electroporated into R1 embryonic stem (ES) cells, and transfected cells were selected with G418 and ganciclovir. DNA from drug-resistant colonies was digested with BamHI and screened by Southern
blotting using a 299-bp NotI/BamHI fragment as
external probe. Targeted ES cell lines were aggregated with blastocysts
from ICR mice (Charles River, Toronto, Canada) and implanted into
pseudopregnant ICR females. The resultant chimeric males were mated
with 129/Sv females. Heterozygous offspring were intercrossed into
129/Sv as well as ICR and C57BL/6 (Charles River) backgrounds to
generate inbred and outbred DDR1-null mice. We did not observe any
strain-dependent differences in the described phenotype of DDR1-null mice.
To generate the plasmid pRKDDR1-hAP, a cDNA fragment coding for the
extracellular domain of DDR1 (amino acids 1 to 416) was fused in frame
to the cDNA coding for human placenta alkaline phosphatase (hAP; a gift
of A. Nagy).
Alkaline phosphatase staining.
The plasmid pRKDDR1-hAP
coding for the fusion protein between the extracellular domain of DDR1
and alkaline phosphatase was transiently expressed in human embryonic
kidney fibroblast 293 cells (ATCC). Details of the transfection
protocol have been published (33). The staining procedure
with DDR1-hAP was modified from a published protocol (6).
Transfected cells were resuspended in Hanks' balanced salt solution
(HBSS) containing phenylmethylsulfonyl fluoride, aprotinin, and NaF as
inhibitors. Cells were lysed by sonication. Aliquots of the lysate were
incubated with 14-µm-thick cryosections from various mouse tissues
for 90 min. Slides were washed five times with HBSS and fixed with a
solution of 60% acetone, 3% formaldehyde, and 20 mM HEPES (pH 7.5)
for 30 s. After incubation in HBSS buffer at 65°C for 20 min to
inactivate endogenous alkaline phosphatase, slides were washed twice in
AP buffer (100 mM Tris [pH 9.5], 100 mM NaCl, 5 mM
MgCl2). Samples were developed by incubation with AP buffer
containing 0.17 mg of 5-bromo-4-chloro-3-indolyl phosphate/ml, 0.33 mg
of nitroblue tetrazolium/ml, and 5 mM levamisole (all from Sigma) for
0.5 to 4 h. Slides were mounted with Aquamount (Paesel and Lorei,
Hanau, Germany). Bacterial expression and purification of the
extracellular domain of DDR has been described recently (35).
Histological and immunological staining.
Sections (4 µm)
of metatarsal bones from 2-week-old females were stained with
hematoxylin-fast green-safranin O using standard procedures. To detect
proliferating cells, 5-bromo-2'-deoxyuridine (BrdU; Sigma) and
anti-BrdU monoclonal antibody (Boehringer Mannheim) were used as
described previously (2). Apoptosis was analyzed by using
the In Situ Cell Death Detection kit (Roche Diagnostics) according to
the manufacturer's instructions.
For detection of DDR1, paraffin sections were incubated with an
antibody directed against the C terminus of DDR1 (dilution,
1:100;
Santa Cruz) and developed with aminoethylcarbazol staining.
For
Masson-Goldner staining, sections of paraffin-embedded mammary
gland
tissue were pretreated with hematoxylin for 10 min. After
rinsing with
water, sections were incubated with fuchsine-ponceau
(0.2% [wt/vol]
ponceau xylidine, 0.1% [wt/vol] acid fuchsine,
0.6% [vol/vol]
acetic acid) for 6 min. Samples were rinsed with
1% acetic acid and
treated with a solution of 3% (wt/vol) phosphomolybdic
acid-3%
orange G for 5 min. Sections were counterstained with
0.1% light green
for 30
s.
Staining for the proliferation marker Ki-67 was essentially done as
described previously (
12). In brief, paraffin sections
were dewaxed, oxidized with 1% H
2O
2 for 20 min, and equilibrated
in Tris-buffered saline. The antigen was exposed
by microwave
treatment (800 W) for 2 min. Sections were incubated with
a 1:50
dilution of rabbit anti-mouse Ki-67 antibody (Dianova, Hamburg,
Germany) for 30 min. After washing with Tris-buffered saline,
a
peroxidase-coupled goat anti-rabbit secondary antibody was added
for 30 min. Ki-67 expression was detected by 3,3'-diaminobenzidine
tetrahydrochloride staining following a brief counterstain with
hematoxylin.
Whole-mount mammary gland staining.
The first abdominal
mammary gland was removed, spread on a glass slide, and dried
overnight. The gland was fixed and defatted in acetone for 24 h.
Samples were stained with Harris' modified hematoxylin overnight and
destained with several changes of 1% HCl in ethanol. The dye was fixed
with a brief wash in 0.02% ammonium hydroxide. The tissue was cleared
by incubation in xylene and mounted with Permount (BRL).
Western blot analysis.
Embryonic or mammary gland tissue was
homogenized in lysis buffer (33) using an Ultraturax
blender (IKA-Werke, Staufen, Germany). One microgram of protein lysate
was incubated with concanavalin A beads (Sigma) at 4°C for 3 h.
Samples were washed three times with lysis buffer and analyzed by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Gels were
transferred to nitrocellulose membranes and probed with a polyclonal
antibody directed against DDR1 (Santa Cruz). For milk protein analysis,
5 µg of total lysate was analyzed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and blotted with a rabbit
polyclonal serum raised against total mouse milk protein (kindly
provided by N. Hynes). Blots were developed using enhanced
chemiluminescence (Amersham).
Northern blot analysis.
Mouse tissue was lysed in 4 M
guanidinium hydrochloride. RNA was extracted by ultracentrifugation
into a layer of 5.7 M CsCl. Twelve micrograms of total RNA was resolved
with a 1% agarose gel in morpholinepropanesulfonic acid buffer and
transferred to a Hybond N membrane (Amersham). Probes for
-casein
(GTCTCTCTTGCAAGAGCAAGGGCC),
-lactalbumin
(GGGCTTCTCACAACGCCACTGTTCA), WDNM1
(CAGAGCCCAGGCAGTAGTCATTGTC), and 28S rRNA
(GAACAATGTAGGTAAGGGAAGTCGGCAAGCCGGATCCG) were
32P end labeled with T4 polynucleotide kinase
(27).
 |
RESULTS |
Visualization of DDR1 binding sites.
The expression pattern of
ligands for tyrosine kinase receptors can be studied using chimeric
molecules containing the extracellular ligand-binding domain of the
relevant receptor fused to alkaline phosphatase (6). We
utilized this technique to generate a chimeric fusion protein,
consisting of the human DDR1 ectodomain domain and human placenta
alkaline phosphatase (called DDR1-hAP), in order to identify cells and
tissues with the capacity to bind DDR1. Cell extracts from human
embryonic kidney fibroblast 293 cells transfected with a plasmid coding
for the DDR1-hAP fusion protein were used to probe cryosections of mice
at different developmental stages. In a 6-day-old mouse, binding of
DDR1-hAP was detected in several organs, particularly in the vertebrae,
the skull and pubic bones, the urogenital tract, and the skin (Fig.
1A). At higher magnification, specific
hybridization to dentin, alveolar bone, and stellate reticulum of a
molar tooth was detected (Fig. 1B). In Fig. 1C and D, the whisker
barrel and the periosteal collar of the clavicle are shown stained by
the DDR1-hAP protein. In a control experiment, cell lysates lacking the
DDR1-hAP fusion protein did not stain corresponding sections except in
the lumen of the gut, possibly due to high endogenous alkaline
phosphatase activity in the digestive tract (data not shown). The
tissues labeled by the DDR1-hAP probe are considered to express DDR1
ligands, potentially specific collagens.

View larger version (91K):
[in this window]
[in a new window]
|
FIG. 1.
Expression of DDR1-binding activity, shown by detection
of DDR1-binding sites using a DDR1-hAP fusion protein. (A) Staining of
a transverse section of a 6-day-old mouse with DDR1-hAP. DDR1-binding
sites were detected in the skeleton, skin, and urogenital tract. (B to
D) Staining of a molar tooth (B), the whisker barrel (C), and the
periosteal collar of the clavicle (D). (E to G) Staining of a
parasagittal section of an E13.5 mouse embryo with DDR1-hAP. Strong
signals are seen in the ribs (E), the cartilage primordium of the
metatarsal bones (F), and at higher magnification in the periosteum of
the ribs (G). (H to K) Colocalization of DDR1-binding affinity and
collagen expression in the mouse mammary gland. (H) Staining of mammary
epithelial cells and adjacent myofibroblasts with DDR1-hAP using
sections from a pregnant female at day 12.5 of gestation. (J) The
binding of DDR1-hAP is competed with recombinant extracellular domain
of DDR1. (K) Immunostaining for collagen type III in the mammary gland
(brownish color).
|
|
Tissue-specific binding of DDR1-hAP was also seen throughout mouse
development. In parasagittal sections of an embryonic day
13.5 (E13.5)
mouse embryo, strong DDR1 ligand activity was detected
in the
primordium of the ribs, vertebrae, and the cartilage primordium
of the
metatarsal bones (Fig.
1E and F). Particularly intense
staining was
seen in the periosteal collar of the developing ribs
(Fig.
1G).
Whole-mount staining of an E9.5 mouse embryo indicated
expression of
DDR ligand activity early in development (data not
shown). In the
mammary gland of pregnant mice at day 12.5 of gestation,
DDR1-hAP bound
to the epithelial cells forming ducts and alveoli
and to the
myofibroblasts in close proximity to the epithelium
(Fig.
1H). Binding
of DDR1-hAP to the mammary epithelium was efficiently
competed by
adding bacterially expressed extracellular domain
of DDR1 to the
staining reaction mixture (Fig.
1J). Immunohistochemical
staining with
an antibody against collagen type III coincided
with the pattern of
DDR1-hAP staining in the mammary gland (Fig.
1K).
Generation of DDR1-null mice.
The prominent appearance of
DDR1-binding activity during mouse embryogenesis and the dearth of
information concerning DDR1 biological function prompted us to generate
DDR1-null mice. Homologous recombination in ES cells was used to delete
the first 12 exons of the DDR1 gene, including coding regions for the
extracellular and transmembrane domains and part of the kinase domain
(Fig. 2A). Correct integration of the
neor cassette into the DDR1 locus was confirmed by Southern
hybridization with 5' and 3' probes (data not shown). Blastocyst
injection with the DDR1-targeted ES cell line resulted in several
chimeric founder males that gave rise to DDR1+/
offspring. Heterozygous breeding produced wild-type, heterozygous, and
mutant embryos in a Mendelian ratio (data not shown). We extracted proteins from embryos of one litter from heterozygous breeding and
analyzed them by Western blotting with a DDR1-specific antibody. The
absence of DDR1 protein expression in homozygous embryos indicated that
the targeting event had generated a null mutation (Fig. 2B and C).

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 2.
Generation of DDR1-null mice. (A) Organization of the
mouse DDR1 gene (top) and the targeting construct to generate DDR1-null
mice (bottom). Exons are indicated by black boxes that are numbered
beginning with the first coding exon as exon 1. The lengths of exons
and introns are not to scale. Relevant restriction sites are indicated:
E, EcoRI; B, BamHI; X, XhoI; N,
NotI. The checkered box represents the external probe used
for genotyping of ES cells and mice. (B) Southern blot analysis of DNA
isolated from the embryos of a heterozygous intercross (+/+, wild-type;
+/ , heterozygous; / , homozygous). An 8.0-kb BamHI
fragment corresponds to the wild-type allele, and a 3.8-kb fragment
corresponds to the mutant allele. (C) Western blot analysis of lysates
generated from the same embryos as in panel B. DDR1 is detected as an
approximately 130-kDa protein. Asterisks denote heterozygous embryos
with reduced DDR1 expression.
|
|
Homozygous mutant mice were born alive but remained smaller than their
heterozygous littermates. On average, female DDR1-null
mice had a 35%
lower body weight than control animals (Fig.
3A).
Mutant males remained smaller in the
first few weeks after birth
but gained additional weight after puberty.
As a result, adult
DDR1-null males were only about 10% smaller than
wild-type mice.
In both sexes, all organs were proportionally smaller.
X-ray analysis
revealed that the skeletons of 10-week-old DDR1-null
mice appeared
normal (Fig.
3B and C). Detailed analysis of several
animals showed
that the fibula bone was poorly calcified in the
majority of the
mutant animals (Fig.
3B and C, insert). Morphometric
measurement
indicated that mutant animals presented a narrower pelvis
than
control animals (data not shown).

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 3.
Dwarfism of DDR1-null mice. (A) Growth curves of male
and female offspring during the first 10 weeks of age. One set of
growth curves, which is representative of six measurements taken from
different litters during the same time period, is depicted. (B and C)
X-ray analysis of heterozygous (B) and mutant (C) 10-week-old females.
The lack of proper mineralization of the fibula bone is shown by an
arrow in the insert. (D and E) Hematoxylin-fast green-safranin O
staining of growth plates in heterozygous (D) and mutant (E) metatarsal
bones of 2-week-old mice. The comparable length of the growth plate in
the mutant and control section is indicated by an arrow. (F and G)
BrdU-stained sections of tibias from 2-week-old heterozygous (F) and
mutant (G) mice. Arrows mark the length of the proliferative zone. (H
to N) TUNEL assay with sections from the tibia of 4-week-old wild-type
(H, K, M) and mutant (J, L, N) animals. No increase in chondrocyte
apoptosis was seen in DDR1-null chondrocytes (H and J). Sections were
pretreated with DNase I as positive control (K and L) or incubated
without enzyme as negative control (M and N).
|
|
To investigate the reason for the dwarfism in DDR1-null mice, we
examined the growth plates by staining sections of metatarsal
bones
with hematoxylin-fast green-safranin O. As shown in Fig.
3D and E, the
length of the zone of hypertrophic cartilage in
2-week-old DDR1-null
mice appeared unaltered from that in the
control. To measure
chondrocyte proliferation, mice were injected
for 90 min with BrdU.
BrdU-positive cells were counted in sections
of the tibia from 2-, 7-, and 16-week-old animals (Fig.
3F and
G and data not shown).
Quantitative analysis revealed no significant
difference in the number
of BrdU-positive cells in control (Fig.
3F) versus mutant (Fig.
3G)
animals. Since reduced bone growth
also could be due to increased
chondrocyte apoptosis, we performed
a terminal deoxynucleotidyl
transferase-mediated dUTP-biotin nick
end labeling (TUNEL) assay on
sections of the tibia from 4- and
8-week-old animals. As seen in Fig.
3H and J, no difference in
the rate of chondrocyte apoptosis could be
detected between control
and knockout
tissues.
A high percentage of DDR1-null animals was not able to control their
ear movement. One or sometimes both ears were curled
back towards the
body (Fig.
4A). DDR1-hAP staining showed
high
expression of DDR1 ligand proteins in the elastic ear cartilage,
suggesting that DDR1 is necessary for proper formation of the
mouse ear
(Fig.
4B).

View larger version (113K):
[in this window]
[in a new window]
|
FIG. 4.
Defects of DDR1-null mice in ear and placental
development. (A) Phenotypic appearance of ears in control and mutant
mice. Mice were 3 months of age and were anesthetized prior to
photography. (B) Detection of DDR1-binding affinity in the ear
cartilage using the DDR1-hAP fusion protein (indicated by arrows). The
hair follicles are stained as well. (C to F) DDR1-hAP staining (C and
E) and DDR1 immunostaining (D and F) in pre- (E2.5; C and D) and post-
(E4.5; E and F) implantational uteri in wild-type mice. Abbreviations:
mm, myometrium; lm, longitudinal muscle; st, stroma; gl, glandular
epithelium; dz, desidual zone; em, embryo proper.
|
|
Implantation and lactation are affected in DDR1-null mice.
Mating between DDR1-null females and either mutant or control males was
often unsuccessful. The appearance of vaginal plugs suggested that
mating could take place. On dissection of mutant females at day 3.5 of
gestation, we observed a normal number of mature preimplantation
blastocysts in the uterus (data not shown). No decidual swelling was
observed in mice dissected after day 4.5 of gestation. Blastocyst
transfer into pseudopregnant wild-type mothers resulted in a normal
litter. We therefore reasoned that the lack of implantation might be
due to a maternal defect. To pursue this notion, we probed uterine
sections from wild-type mice at days 2.5 and 4.5 of gestation with the
DDR1-hAP fusion protein (Fig. 4C and E). The longitudinal muscles and
the myometrium of the preimplantation uterus (E2.5) expressed high
levels of DDR1-binding sites (Fig. 4C). In contrast, the uterine stroma showed a much lower intensity of staining. Using immunohistochemistry to detect DDR1, we found a striking correlation between receptor and
ligand (presumably collagen) expression (Fig. 4D). The longitudinal muscles and the outer layer of the myometrium displayed expression of
DDR1, whereas it was absent in the glandular epithelium and in the
stroma. After implantation at E4.5, cells in the decidual zone around
the embryo stained strongly with the DDR1-hAP reagent (Fig. 4E). The
expression of DDR1 colocalized to the decidual cell population (Fig.
4F). In contrast, the embryo proper was negative for ligand as well as
for receptor expression. The concomitant expression of receptor and
ligand suggests that DDR1 is necessary for the peri-implantational
adhesion between the luminal epithelium of the uterus and the blastocyst.
In approximately 20% of DDR1-null females, implantation took place and
the mice gave birth to a full litter. One day after
birth, all of the
pups appeared malnourished. Only small amounts
of milk were detected in
their stomachs. When left with their
mother, all pups died within the
following days. The pups could
be saved by transferring them to a
wild-type foster mother shortly
after birth. To investigate the defect
in lactation seen in DDR1-null
mice, we analyzed the mammary glands of
mutant females during
pregnancy. Sections of mammary tissue from mutant
mice at day
18.5 of gestation revealed a much more condensed alveolar
structure
(Fig.
5B) compared to the
control (Fig.
5A). The heterozygous
control showed a large number of
lipid vesicles in the mammary
epithelium, whereas DDR1-null mice
appeared to have few lipid
vesicles. Whole-mount analysis of the E18.5
mammary gland confirmed
that the fat pad of mutant mice was almost
entirely filled with
ducts (Fig.
5D and F), which had a more distended
appearance than
in controls (Fig.
5C and E).

View larger version (102K):
[in this window]
[in a new window]
|
FIG. 5.
Mammary gland defects in DDR1-null mice. (A and B)
Hematoxylin-eosin stain of late pregnancy (day 18.5 of gestation)
mammary glands of heterozygous (A) and mutant (B) mice. (C to F)
Whole-mount analysis of control (C and E) and mutant (D and F) mammary
glands of day 18.5 pregnant females. Pictures are taken at low (C and
D) and higher (E and F) magnification. (G and H) Mammary gland
morphology of heterozygous (G) and mutant (H) mice 1 day postpartum.
Note the almost complete absence of milk secretion into the lumens in
panel H. (J and K) Regressed mammary epithelium in mutant mice (K)
compared to that in control mice (J) 2 days postpartum.
|
|
To study lactation, sections of mammary tissue from mutant and control
animals 1 day postpartum were taken. In control females,
the adipose
tissue had disappeared and was entirely replaced by
alveolar structures
filled with milk (Fig.
5G). In contrast, the
mutant mammary gland
tissue was largely composed of adipocytes
(Fig.
5H). The alveoli were
predominantly condensed, and very
little milk had been secreted. At day
2 after birth, the alveoli
in the mutants started to collapse and the
previously formed epithelium
began to regress (Fig.
5J and K). We
suspected that the lack of
appropriate mammary gland differentiation in
DDR1-null mice might
be caused by premature apoptosis during pregnancy.
To test this
hypothesis, we analyzed sections of mutant mammary gland
tissue
by TUNEL staining, but we could not see any increase in DNA
fragmentation
above that in wild-type controls (data not
shown).
To gain further understanding of the developmental defect of the
mammary gland in DDR1-null mice, we analyzed early ductal
growth in the
mammary fat pad of 3-week-old littermates. In heterozygous
animals, the
ducts, which originate from the nipple, reached into
the center of the
mammary gland, thereby passing the lymph node
(Fig.
6A). In mutant animals, ductal growth was
considerably delayed.
At 3 weeks of age, only the first quarter of the
gland was filled
with ducts (Fig.
6B). Notably, the terminal end buds
in the mutant
mice appeared to be enlarged compared to those in control
mice.
At 3 months of age, the fat pads of both wild-type (Fig.
6C) and
mutant (Fig.
6D) animals were filled with epithelial ducts. In
sections
from mutant mice, we detected a substantial increase
in the number and
diameter of the ducts (Fig.
6C and D). To further
characterize the
abnormal development, we stained the extracellular
matrix in breast
sections of 3-month-old female mice using the
method of Masson-Goldner.
We detected a substantial increase in
extracellular matrix deposition
in the mutant mammary gland above
that in the wild type (Fig.
6C and
D). In the mutant tissue, collagenous
extracellular matrix was not only
found along the epithelial ducts
but also was widespread in the adipose
tissue (Fig.
6C and D,
inserts). To quantify the proliferation rate in
the mutant epithelium,
we analyzed sections with an antibody to Ki-67,
which has been
found to label all cells that are not in the
G
0 phase of the cell
cycle (
12). The mutant
epithelium had approximately four to
five times more Ki-67-positive
cells (Fig.
6F) than the heterozygous
control (Fig.
6E). Taken
together, the invasion of the mammary
fat pad by epithelial cells
during puberty is delayed in DDR1-null
mice, but the epithelium itself
is hyperproliferative, resulting
in an increased number of enlarged
ducts.

View larger version (103K):
[in this window]
[in a new window]
|
FIG. 6.
Mammary gland development during puberty and pregnancy
in DDR1-null mice. (A and B) Whole-mount analysis of the developing
mammary gland in 3-week-old heterozygous (A) and mutant (B) mice. Some
terminal end buds are marked by arrows. (C and D) Masson-Goldner stain
of virgin heterozygous (C) and mutant (D) mammary glands. Note the
enlarged ducts and the increase in extracellular matrix deposition in
the adipose tissue (insert). (E and F) Ki-67 staining of virgin control
(E) and mutant (F) mammary gland. The number of Ki-67-positive
(red-labeled) nuclei is approximately five times higher in the
mutant tissue. (G) Immunolocalization of DDR1 in a lactating mammary
gland. Specific staining (brownish color) is seen in the luminal
epithelial cells. (H) Western blot analysis of DDR1 expression during
pregnancy and lactation.
|
|
To further support the notion that DDR1 is essential for mammary gland
differentiation during pregnancy and lactation, we
analyzed DDR1
expression by immunohistochemistry and Western blotting.
As shown in
Fig.
6G, luminal epithelial cells of a wild-type mammary
gland express
increased amounts of DDR1 in comparison to the underlying
smooth muscle
cells and adipocytes. Western blot analysis showed
an increase of DDR1
expression during pregnancy, with highest
levels at late pregnancy
(Fig.
6H). The expression persisted during
lactation but dramatically
decreased at the time of
involution.
Gene expression in the DDR1-null mammary gland.
To gain a more
detailed understanding of why DDR1-null mice have insufficient milk
production, we tested the expression of milk proteins in the mammary
gland of mice at 2 days postpartum. We found reduced expression of a
26-kDa milk protein and almost complete absence of an 82-kDa protein in
lysates from DDR1-null mammary gland (Fig.
7A). The mRNA expression of individual
milk proteins was quantified using Northern blotting. We found that DDR1 mutant mice have mRNA for the milk proteins
-casein,
-lactalbumin, whey acidic protein (WAp), and the milk protein
transcription regulator WDNM1 in amounts comparable to control animals
during lactation (Fig. 7B and C). Hybridization with a probe against 28S rRNA indicated that the reduction of
-casein and WDNM1 mRNA at
late pregnancy (day 18.5 of embryonic development, mutant) and
mid-lactation (day 5 postpartum, wild type) appeared to be due to
differences in sample loading.

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 7.
Expression of milk proteins in DDR1-null females. (A)
Western blot analysis of milk protein expression in lysates from mouse
mammary glands 2 days postpartum. Arrows indicate milk proteins reduced
or absent in DDR1-null animals. Northern blot analysis of -casein
(B) and -lactalbumin together with WDNM1 (C) expression during
mammary gland development of mutant and control mice. The lower strip
in panel B shows the ethidium bromide-stained gel, and the lower strip
in panel C shows reanalysis of the blot with a 28S rRNA probe.
|
|
 |
DISCUSSION |
We have investigated the expression of potential DDR1 RTK ligands
using a chimeric receptor fusion protein. This approach has identified
the growing skeleton, the skin, the kidney, and the urogenital tract as
major sites of DDR1 receptor binding. All these tissues abundantly
express fibrillar as well as basement membrane collagens, consistent
with the in vitro binding and activation of DDR1 by type I to type V
collagen (33). In the mammary gland, we demonstrated
colocalization of DDR1 binding sites with the expression of collagen
type III. However, these results do not exclude the possibility that
other ligands are involved in DDR1 recognition. The sites with highest
receptor and ligand expressions were the developing teeth, the skin,
and the vibrissae. Surprisingly, we did not detect DDR1-hAP binding in
neuronal tissues, although DDR1 is expressed in the developing and
adult mouse brain, in particular in the cortex, hippocampus, and
cerebellum (5, 29).
Ablation of DDR1 in the mouse resulted in a severe postnatal growth
reduction. Despite strong binding of the DDR1-hAP fusion protein to the
skeleton, DDR1 appears to have no general influence on bone formation
or mineralization. Furthermore, chondrocyte proliferation, apoptosis,
and the morphology of the growth plates in the tibia and metatarsus are
normal. It is possible that a hormonal stimulus that regulates bone and
tissue growth may be reduced in DDR1-deficient mice. The apparent lack
of any embryonic phenotype in DDR1 mutant mice is surprising, since
DDR1 is highly expressed throughout embryogenesis (29). It
is possible that DDR1 and DDR2 receptors have overlapping functions
during fetal development (16).
In the mouse, the process of implantation begins with the contact
between trophoectodermal cells of the embryo and the luminal epithelium
of the uterus. The initial attachment of the blastocyst induces local
apoptosis of the epithelium, followed by degradation of the underlying
basement membrane. During decidualization, trophoectodermal cells
invade the uterine stroma and form the implantation chamber (26). These proesses are accompanied by a drastic
remodeling of the extracellular matrix, involving proteases such as
gelatinases A and B, also called MMP2 and MMP9 (8). DDR1
is expressed in the decidua during that time of implantation (Fig. 4F),
as are the ligands for DDR1 including the
1 and
2 chain of type
VI collagen, which are specifically expressed in the uterine epithelium around the implantation site (10). Therefore, we propose a
model in which DDR1 expressed in the decidual cells is necessary for MMP production and/or reorganization of collagenous matrix.
In female mice lacking DDR1, development of the mammary gland is
delayed and deviates rather early from the normal differentiation path.
Mutant mice show enlarged terminal end buds due to aberrant ductal
growth. The number of secondary ducts is increased, the ducts have
wider lumens, and significantly larger amounts of extracellular matrix
are deposited around the ducts. In the absence of DDR1, the mammary
epithelium of virgin mice is hyperproliferative. During pregnancy, the
lack of DDR1 perturbs the lobuloalveolar proliferation and
differentiation, resulting in a large number of alveoli that are not
able to secrete milk. The fact that we detected normal levels of milk
protein transcripts in mutant mammary gland suggests that protein
translation is perturbed in the mutant tissue.
During pubertal development, the mammary gland is one of the most
active organs undergoing cell growth and differentiation. In a newborn
female mouse, the mammary gland only consists of a fat pad that is
attached to the nipple. From the nipple, a primary duct opens into the
adipose tissue. Around the third postnatal week, the terminal end bud
at the tip of the primary duct branches and invades the fat pad. This
sequence of events is altered in DDR1-deficient mice. While mammary
duct outgrowth is delayed, the primary ducts and the terminal end buds
are enlarged compared to those in control mice. A severalfold-higher
proliferative rate of mutant cells resulted in the formation of ducts
with a wider lumen. In addition, the mammary epithelium in mutant mice
is lined by a substantially increased amount of collagenous
extracellular matrix. During pregnancy, accelerated ductal growth and
aberrant lobuloalveolar differentiation continue in the mutants. At
birth, the alveoli show intracellular lipid production and deposition but fail to secrete milk into the central lumen. As a result, DDR1-null
mice are unable to produce sufficient milk, despite normal
transcriptional activation of milk proteins. At the time of lactation,
when we detected the highest protein expression of DDR1 (Fig. 6H), the
most dramatic phenotype in DDR1-null mice is apparent.
The results presented here suggest that DDR1 has at least two control
functions in the mammary gland: (i) epithelial proliferation and (ii)
synthesis of collagenous extracellular matrix. Since both processes
were up-regulated in the mutant mice, a general negative regulatory
function can be attributed to DDR1. The hyperproliferation in the
mutant mammary gland suggests that one potential physiological function
of DDR1 is to suppress cell proliferation. The aberrant deposition of
extracellular matrix suggests that another function of DDR1 is to
program cellular differentiation and to mediate cell-matrix contacts.
Using C2C12 myofibroblasts overexpressing dominant-negative DDR1, we
recently showed that cellular differentiation can be efficiently
blocked by inhibition of DDR1 signaling (35).
A central regulator in cell proliferation is the Ras/mitogen-activated
protein kinase pathway, which is activated by the Shc-Grb2-Sos complex.
After tyrosine kinase receptor stimulation, Shc binds to the NPXpY
motifs, for example, in activated epidermal growth factor or Trk
receptors, becomes phosphorylated, and thus allows the Grb2-Sos complex
to bind (21). In human mammary carcinoma T-47D cells, the
LLXNPXpY sequence in the b-isoform of DDR1 binds to Shc. In contrast to
activation of epidermal growth factor receptor or Trk, collagen-induced
activation of DDR1 does not result in tyrosine phosphorylation of Shc
(35). In the absence of DDR1, more Shc molecules are
potentially able to interact with growth-promoting receptors, which
results in an enhancement of cell proliferation. It is therefore
tempting to speculate that DDR1 suppresses mitogen-activated protein
kinase activation by recruiting Shc into a nonactivating complex.
However, other mechanisms can be postulated: DDR1 could influence
proliferation as a potential upstream regulator of cell cycle control
proteins, for example, p53 (28). Inhibition of cell cycle
progression has been recently shown in smooth muscle cells stimulated
with fibrillar collagen and in lung epithelial cells stimulated with
collagen type V, suggesting that some of these processes may be
mediated by DDR1 (15, 20)
Malformation of the mammary gland and lactational failure have been
previously described in several other mouse mutants. For example,
lobuloalveolar development is impaired in mice lacking the prolactin
receptor and its targets, Stat5a and Stat5b (31). Prolactin signaling regulates the expression of milk proteins such as
WAP. Whereas in Stat5a-deficient mice WAP gene expression is absent, we
could detect transcripts for WAP and
-casein in DDR1-null mice,
suggesting that milk protein expression is not regulated by DDR1
(18). This is supported by the finding that Stat5
expression or tyrosine phosphorylation was not significantly altered in
DDR1-null animals (data not shown).
Similar to the DDR1-null mice, the majority of mice with a deletion in
the colony-stimulating factor 1 (CSF-1) gene lack proper blastocyst
implantation (25). Pregnant CSF-1-null mice show premature
lobuloalveolar outgrowth with an excess of branch density. As with
DDR1-null mice, postpartum alveoli of CSF-1-deficient mice are widely
dispersed in the fat pad and lack a luminal opening. Recent evidence
suggests that the defects in CSF-1-null mice are primarily caused by
ovulation problems, whereas DDR1-null mice ovulate normally (reference
7 and data not shown). It is tempting to speculate that
CSF-1R and DDR1 RTKs complement each other during mammary gland
development. Whereas the CSF-1R is triggered by exocrine stimuli, in
particular by CSF-1 secreted from the uterus, DDR1 may be activated in
the mammary epithelium by directly contacting the collagenous matrix of
connective tissue.
The results presented here identify DDR1 as an essential gene product
in mammary gland development and suggest a role for DDR1 in human
breast carcinoma progression.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from the National Cancer
Institute of Canada, the Medical Research Council of Canada (MRC), the
Protein Engineering Network of Centers of Excellence, and by an
International Research Scholar Award from the Howard Hughes Medical
Institute to T.P. W.V. is recipient of a fellowship of the
Deutsche Forschungsgemeinschaft (Vo 663/1-1). T.P. is a distinguished Scientist of the MRC.
We thank V. Jassal and J. Cross for critically reading the manuscript.
We are grateful to K. Harpel, R. Streich, M. Eck, and K. Sasaki for
histology work. We thank S. Kulkarni for ES cell aggregation, M. Grynpas for help during skeletal analysis, A. Nagy and N. Hynes for
providing reagents, and S. Osadschuk for animal care.
 |
FOOTNOTES |
*
Corresponding author. Present address:
Georg-Speyer-Haus Institute for Biomedical Research, Johann Wolfgang
Goethe Universität Frankfurt, Paul-Ehrlich-Strasse 42-44, 60596 Frankfurt am Main, Germany. Phone: 49-69-63395 222. Fax: 49-69-63395 297. E-mail: W.Vogel{at}em.uni-frankfurt.de.
 |
REFERENCES |
| 1.
|
Alves, F.,
W. Vogel,
K. Mossie,
B. Millauer,
H. Höfler, and A. Ullrich.
1995.
Distinct structural characteristics of discoidin I subfamily receptor tyrosine kinases and complementary expression in human cancer.
Oncogene
10:609-618[Medline].
|
| 2.
|
Aszódi, A.,
D. Chan,
E. Hunziker,
J. F. Bateman, and R. Fässler.
1998.
Collagen II is essential for the removal of the notochord and the formation of invertebral discs.
J. Cell Biol.
30:1399-1412.
|
| 3.
|
Barker, K. T.,
J. E. Martindale,
P. J. Mitchell,
T. Kamalati,
M. J. Page,
D. J. Phippard,
T. C. Dale,
B. A. Guterson, and M. R. Crompton.
1995.
Expression patterns of the novel receptor-like tyrosine kinase, DDR, in human breast tumors.
Oncogene
10:569-575[Medline].
|
| 4.
|
Baumgartner, S.,
K. Hofmann,
R. Chiquet-Ehrismann, and P. Bucher.
1998.
The discoidin domain family revisited: new members from prokaryotes and homology-based fold prediction.
Protein Sci.
7:1626-1631[Medline].
|
| 5.
|
Bhatt, R. S.,
T. Tomoda,
Y. Fang, and M. E. Hatten.
2000.
Discoidin domain receptor 1 functions in axon extension of cerebellar granule neurons.
Genes Dev.
14:2216-2228[Abstract/Free Full Text].
|
| 6.
|
Cheng, H. J., and J. G. Flanagan.
1994.
Identification and cloning of ELF-1, a developmentally expressed ligand for the Mek4 and Sek receptor tyrosine kinases.
Cell
79:157-168[CrossRef][Medline].
|
| 7.
|
Cohen, F. E.,
L. Zhu, and J. W. Pollard.
1997.
Absence of colony stimulating factor-1 in osteopetrotic (cfmsop/cfmsop) mice disrupts estrous cycles and ovulation.
Biol. Reprod.
55:110-118.
|
| 8.
|
Das, S. K.,
S. Yano,
J. Wang,
D. R. Edwards,
H. Nagase, and S. K. Dey.
1997.
Expression of matrix-metalloproteinases and tissue inhibitors of metalloproteinases in the mouse uterus during the peri-implantation period.
Dev. Genet.
21:44-54[CrossRef][Medline].
|
| 9.
|
DiMarco, E.,
N. Cutuli,
L. Guerra,
R. Cancedda, and M. DeLuca.
1993.
Molecular cloning of trkE, a novel trk-related putative tyrosine kinase receptor isolated from normal human keratinocytes and widely expressed in normal human tissues.
J. Biol. Chem.
268:24290-24295[Abstract/Free Full Text].
|
| 10.
|
Dziadek, M.,
P. Darling,
R. Z. Zhang,
T.-C. Pan,
E. Tillet,
R. Timpl, and M.-L. Chu.
1995.
Expression of collagen a1(VI), a2(VI) and a3(VI) in the pregnant mouse uterus.
Biol. Reprod.
5:885-894.
|
| 11.
|
Foehr, E. D.,
A. Tatavos,
E. Tanabe,
S. Raffioni,
S. Goetz,
E. Dimarco,
M. De Luca, and R. A. Bradshaw.
2000.
Discoidin domain receptor 1 (DDR1) signaling in PC12 cells: activation of juxtamembrane domains in PDGFR/DDR/TrkA chimeric receptor.
FASEB J.
14:973-981[Abstract/Free Full Text].
|
| 12.
|
Gerdes, J.,
T. Scholzen,
C. Gerlach,
M. H. G. Kubbutat, and H. Zentgraf.
1997.
Assessment of cell proliferation in murine tissues with a polyclonal antiserum against the murine Ki-67 protein.
Eur. J. Cell Biol.
72(Suppl. 43):88.
|
| 13.
|
Hunter, T.
2000.
Signaling 2000 and beyond.
Cell
100:113-127[CrossRef][Medline].
|
| 14.
|
Johnson, J. D.,
J. C. Edman, and W. J. Rutter.
1993.
A receptor tyrosine kinase found in breast carcinoma cells has an extracellular discoidin I-like domain.
Proc. Natl. Acad. Sci. USA
90:5677-5681[Abstract/Free Full Text].
|
| 15.
|
Koyama, H.,
E. W. Raines,
K. E. Bornfeldt,
J. M. Roberts, and R. Ross.
1997.
Fibrillar collagen inhibits arterial smooth muscle proliferation through regulation of Cdk2 inhibitors.
Cell
87:1069-1078.
|
| 16.
|
Lai, C., and G. Lemke.
1994.
Structure and expression of the Tyro 10 receptor tyrosine kinase.
Oncogene
9:877-883[Medline].
|
| 17.
|
Laval, S.,
R. Butler,
A. N. Shelling,
A. M. Hanby,
R. Poulson, and T. S. Ganesan.
1994.
Isolation and characterisation of an epithelial-specific receptor tyrosine kinase from an ovarian cancer cell line.
Cell Growth Differ.
5:1173-1183[Abstract].
|
| 18.
|
Liu, X.,
G. W. Robinson,
K. U. Wagner,
L. Garrett,
A. Wynshaw-Boris, and L. Hennighausen.
1997.
Stat5a is mandatory for adult mammary gland development and lactogenesis.
Genes Dev.
11:179-186[Abstract/Free Full Text].
|
| 19.
|
Nemoto, T.,
K. Ohashi,
T. Akashi,
J. D. Johnson, and K. Hirokawa.
1997.
Overexpression of protein tyrosine kinases in human esophageal cancer.
Pathobiology
65:195-203[Medline].
|
| 20.
|
Parekh, T. V.,
X. W. Wang,
D. M. Makri-Werzen,
D. S. Greenspan, and M. J. Newman.
1998.
Type V collagen is an epithelial cell cycle inhibitor that is induced by and mimics the effects of transforming growth factor 1.
Cell Growth Differ.
9:423-433[Abstract].
|
| 21.
|
Pawson, T., and T. M. Saxton.
1999.
Signaling networks do all roads lead to the same genes?
Cell
97:675-678[CrossRef][Medline].
|
| 22.
|
Perez, J. L.,
X. Shen,
S. Finkernagel,
L. Sciorra,
N. A. Jenkins,
D. J. Gilbert,
N. G. Copeland, and T. W. Wong.
1994.
Identification and chromosomal mapping of a receptor tyrosine kinase with a putative phospholipid binding sequence in its ectodomain.
Oncogene
9:211-219[Medline].
|
| 23.
|
Perez, J. L.,
S. Q. Jing, and T. W. Wong.
1996.
Identification of two isoforms of the Cak receptor kinase that are co-expressed in breast tumor cell lines.
Oncogene
12:1469-1477[Medline].
|
| 24.
|
Playford, M. P.,
R. J. Butler,
X. C. Wang,
R. M. Katso,
I. E. Cooke, and T. S. Ganesan.
1996.
The genomic structure of discoidin domain tyrosine kinase.
Genome Res.
6:620-627[Abstract/Free Full Text].
|
| 25.
|
Pollard, J., and L. Henninghausen.
1994.
Colony stimulating factor 1 is required for mammary gland development during pregnancy.
Proc. Natl. Acad. Sci. USA
91:9312-9316[Abstract/Free Full Text].
|
| 26.
|
Rinkenberger, J. L.,
J. C. Cross, and Z. Werb.
1997.
Molecular genetics of implantation in the mouse.
Dev. Genet.
21:6-20[CrossRef][Medline].
|
| 27.
|
Robinson, G. W.,
R. A. Mcknight,
G. H. Smith, and L. Hennighausen.
1995.
Mammary epithelial cells undergo secretory differentiation in cycling virgins but require pregnancy for the establishment of terminal differentiation.
Development
121:2079-2090[Abstract].
|
| 28.
|
Sakuma, S.,
H. Saya,
M. Tada,
M. Nakao,
T. Fujiwara,
J. A. Roth,
Y. Sawamura,
Y. Shinohe, and H. Abe.
1996.
Receptor protein tyrosine kinase DDR is up-regulated by p53 protein.
FEBS Lett.
398:165-169[CrossRef][Medline].
|
| 29.
|
Sanchez, M. P.,
P. Tapley,
S. S. Saini,
B. He,
D. Pulido, and M. Barbacid.
1994.
Multiple tyrosine kinases in rat hippocampal neurons: isolation of Ptk-3, a receptor expressed in proliferative zones of the developing brain.
Proc. Natl. Acad. Sci. USA
91:1819-1823[Abstract/Free Full Text].
|
| 30.
|
Shrivastava, A.,
C. Radziejewski,
E. Campbell,
L. Kovac,
M. McGlynn,
T. E. Ryan,
S. Davis,
M. P. Goldfarb,
D. J. Glass,
G. Lemke, and G. D. Yancopoulos.
1997.
An orphan receptor tyrosine kinase family whose members serve as nonintegrin collagen receptors.
Mol. Cell
1:25-34[CrossRef][Medline].
|
| 31.
|
Teglund, S.,
C. McKay,
E. Schuetz,
J. M. van Deursen,
D. Stravopodis,
D. Wang,
M. Brown,
S. Bodner,
G. Grosveld, and J. N. Ihle.
1998.
Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses.
Cell
93:841-850[CrossRef][Medline].
|
| 32.
|
Tybulewicz, V. L.,
C. E. Crawford,
P. K. Jackson,
R. T. Bronson, and R. C. Mulligan.
1991.
Neonatal lethality and lymphopenia in mice with a homologous disruption of the c-abI proto-oncogene.
Cell
65:1153-1163[CrossRef][Medline].
|
| 33.
|
Vogel, W.,
G. Gish,
F. Alves, and T. Pawson.
1997.
The discoidin domain receptor tyrosine kinases are activated by collagen.
Mol. Cell
1:13-23[CrossRef][Medline].
|
| 34.
|
Vogel, W.
1999.
Discoidin domain receptors: structural relations and functional implications.
FASEB J.
13:S77-S82[Abstract/Free Full Text].
|
| 35.
|
Vogel, W.,
C. Brakebusch,
R. Fassler,
F. Alves,
F. Ruggiero, and T. Pawson.
2000.
Discoidin domain receptor 1 is activated independently of beta(1) integrin.
J. Biol. Chem.
275:5779-5784[Abstract/Free Full Text].
|
| 36.
|
Weiner, H. L.,
M. Rothman,
D. C. Miller, and E. B. Ziff.
1996.
Pediatric brain tumors express multiple receptor tyrosine kinases including novel cell adhesion kinases.
Pediatr. Neurosurg.
25:64-72[Medline].
|
| 37.
|
Zerlin, M.,
M. A. Julius, and M. Goldfarb.
1993.
NEP: a novel receptor-like tyrosine kinase expressed in proliferating neuroepithelia.
Oncogene
8:2731-2739[Medline].
|
Molecular and Cellular Biology, April 2001, p. 2906-2917, Vol. 21, No. 8
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.8.2906-2917.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Perera, C. N., Spalding, H. S., Mohammed, S. I., Camarillo, I. G.
(2008). Identification of Proteins Secreted from Leptin Stimulated MCF-7 Breast Cancer Cells: A Dual Proteomic Approach. Exp. Biol. Med.
233: 708-720
[Abstract]
[Full Text]
-
Abdulhussein, R., Koo, D. H. H., Vogel, W. F.
(2008). Identification of Disulfide-linked Dimers of the Receptor Tyrosine Kinase DDR1. J. Biol. Chem.
283: 12026-12033
[Abstract]
[Full Text]
-
Konitsiotis, A. D., Raynal, N., Bihan, D., Hohenester, E., Farndale, R. W., Leitinger, B.
(2008). Characterization of High Affinity Binding Motifs for the Discoidin Domain Receptor DDR2 in Collagen. J. Biol. Chem.
283: 6861-6868
[Abstract]
[Full Text]
-
Roarty, K., Serra, R.
(2007). Wnt5a is required for proper mammary gland development and TGF-{beta}-mediated inhibition of ductal growth. Development
134: 3929-3939
[Abstract]
[Full Text]
-
Matsuyama, W., Mitsuyama, H., Ono, M., Shirahama, Y., Higashimoto, I., Osame, M., Arimura, K.
(2007). Discoidin domain receptor 1 contributes to eosinophil survival in an NF-{kappa}B-dependent manner in Churg-Strauss syndrome. Blood
109: 22-30
[Abstract]
[Full Text]
-
Flamant, M., Placier, S., Rodenas, A., Curat, C. A., Vogel, W. F., Chatziantoniou, C., Dussaule, J.-C.
(2006). Discoidin Domain Receptor 1 Null Mice Are Protected against Hypertension-Induced Renal Disease. J. Am. Soc. Nephrol.
17: 3374-3381
[Abstract]
[Full Text]
-
Das, S., Ongusaha, P. P., Yang, Y. S., Park, J.-M., Aaronson, S. A., Lee, S. W.
(2006). Discoidin Domain Receptor 1 Receptor Tyrosine Kinase Induces Cyclooxygenase-2 and Promotes Chemoresistance through Nuclear Factor-{kappa}B Pathway Activation. Cancer Res.
66: 8123-8130
[Abstract]
[Full Text]
-
Avivi-Green, C., Singal, M., Vogel, W. F.
(2006). Discoidin Domain Receptor 1-deficient Mice Are Resistant to Bleomycin-induced Lung Fibrosis. Am. J. Respir. Crit. Care Med.
174: 420-427
[Abstract]
[Full Text]
-
Noordeen, N. A., Carafoli, F., Hohenester, E., Horton, M. A., Leitinger, B.
(2006). A Transmembrane Leucine Zipper Is Required for Activation of the Dimeric Receptor Tyrosine Kinase DDR1. J. Biol. Chem.
281: 22744-22751
[Abstract]
[Full Text]
-
Matsuyama, W., Watanabe, M., Shirahama, Y., Mitsuyama, H., Higashimoto, I., Osame, M., Arimura, K.
(2006). Discoidin Domain Receptor 1 Contributes to the Survival of Lung Fibroblast in Idiopathic Pulmonary Fibrosis. Am. J. Pathol.
168: 866-877
[Abstract]
[Full Text]
-
Atabai, K., Fernandez, R., Huang, X., Ueki, I., Kline, A., Li, Y., Sadatmansoori, S., Smith-Steinhart, C., Zhu, W., Pytela, R., Werb, Z., Sheppard, D.
(2005). Mfge8 Is Critical for Mammary Gland Remodeling during Involution. Mol. Biol. Cell
16: 5528-5537
[Abstract]
[Full Text]
-
Shyu, K.-G., Chao, Y.-M., Wang, B.-W., Kuan, P.
(2005). Regulation of Discoidin Domain Receptor 2 by Cyclic Mechanical Stretch in Cultured Rat Vascular Smooth Muscle Cells. Hypertension
46: 614-621
[Abstract]
[Full Text]
-
Thomas, E. K., Nakamura, M., Wienke, D., Isacke, C. M., Pozzi, A., Liang, P.
(2005). Endo180 Binds to the C-terminal Region of Type I Collagen. J. Biol. Chem.
280: 22596-22605
[Abstract]
[Full Text]
-
Xu, L., Peng, H., Wu, D., Hu, K., Goldring, M. B., Olsen, B. R., Li, Y.
(2005). Activation of the Discoidin Domain Receptor 2 Induces Expression of Matrix Metalloproteinase 13 Associated with Osteoarthritis in Mice. J. Biol. Chem.
280: 548-555
[Abstract]
[Full Text]
-
Abdulhussein, R., McFadden, C., Fuentes-Prior, P., Vogel, W. F.
(2004). Exploring the Collagen-binding Site of the DDR1 Tyrosine Kinase Receptor. J. Biol. Chem.
279: 31462-31470
[Abstract]
[Full Text]
-
Ortega-Velazquez, R., Gonzalez-Rubio, M., Ruiz-Torres, M. P., Diez-Marques, M. L., Iglesias, M. C., Rodriguez-Puyol, M., Rodriguez-Puyol, D.
(2004). Collagen I upregulates extracellular matrix gene expression and secretion of TGF-{beta}1 by cultured human mesangial cells. Am. J. Physiol. Cell Physiol.
286: C1335-C1343
[Abstract]
[Full Text]
-
Ferri, N., Carragher, N. O., Raines, E. W.
(2004). Role of Discoidin Domain Receptors 1 and 2 in Human Smooth Muscle Cell-Mediated Collagen Remodeling: Potential Implications in Atherosclerosis and Lymphangioleiomyomatosis. Am. J. Pathol.
164: 1575-1585
[Abstract]
[Full Text]
-
Matsuyama, W., Wang, L., Farrar, W. L., Faure, M., Yoshimura, T.
(2004). Activation of Discoidin Domain Receptor 1 Isoform b with Collagen Up-Regulates Chemokine Production in Human Macrophages: Role of p38 Mitogen-Activated Protein Kinase and NF-{kappa}B. J. Immunol.
172: 2332-2340
[Abstract]
[Full Text]
-
Wienke, D., MacFadyen, J. R., Isacke, C. M.
(2003). Identification and Characterization of the Endocytic Transmembrane Glycoprotein Endo180 as a Novel Collagen Receptor. Mol. Biol. Cell
14: 3592-3604
[Abstract]
[Full Text]
-
Fassett, J. T., Tobolt, D., Nelsen, C. J., Albrecht, J. H., Hansen, L. K.
(2003). The Role of Collagen Structure in Mitogen Stimulation of ERK, Cyclin D1 Expression, and G1-S Progression in Rat Hepatocytes. J. Biol. Chem.
278: 31691-31700
[Abstract]
[Full Text]
-
Leitinger, B.
(2003). Molecular Analysis of Collagen Binding by the Human Discoidin Domain Receptors, DDR1 and DDR2. IDENTIFICATION OF COLLAGEN BINDING SITES IN DDR2. J. Biol. Chem.
278: 16761-16769
[Abstract]
[Full Text]
-
Muschler, J., Levy, D., Boudreau, R., Henry, M., Campbell, K., Bissell, M. J.
(2002). A Role for Dystroglycan in Epithelial Polarization: Loss of Function in Breast Tumor Cells. Cancer Res.
62: 7102-7109
[Abstract]
[Full Text]
-
Curat, C. A., Vogel, W. F.
(2002). Discoidin Domain Receptor 1 Controls Growth and Adhesion of Mesangial Cells. J. Am. Soc. Nephrol.
13: 2648-2656
[Abstract]
[Full Text]
-
Mercurio, A. M.
(2002). Lessons from the {alpha}2 Integrin Knockout Mouse. Am. J. Pathol.
161: 3-6
[Full Text]
-
Hou, G., Vogel, W. F., Bendeck, M. P.
(2002). Tyrosine Kinase Activity of Discoidin Domain Receptor 1 Is Necessary for Smooth Muscle Cell Migration and Matrix Metalloproteinase Expression. Circ. Res.
90: 1147-1149
[Abstract]
[Full Text]
-
Wiseman, B. S., Werb, Z.
(2002). Stromal Effects on Mammary Gland Development and Breast Cancer. Science
296: 1046-1049
[Abstract]
[Full Text]
-
Curat, C. A., Eck, M., Dervillez, X., Vogel, W. F.
(2001). Mapping of Epitopes in Discoidin Domain Receptor 1 Critical for Collagen Binding. J. Biol. Chem.
276: 45952-45958
[Abstract]
[Full Text]