Molecular and Cellular Biology, April 2001, p. 2933-2943, Vol. 21, No. 8
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.8.2933-2943.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Interfakultäres Institut für Zellbiologie, Abteilung Molekularbiologie, Universität Tübingen, 72076 Tübingen,1 Institut für Molekularbiologie, Medizinische Hochschule Hannover, 30625 Hannover,2 Max-Planck-Institut für Entwicklungsbiologie, 72074 Tübingen,4 and Entwicklungs- und Molekularbiologie der Tiere, Heinrich Heine Universität, 40225 Düsseldorf, Germany,5 and Whitehead Institute for Biomedical Research and Massachusetts Institute of Technology, Cambridge, Massachusetts 02142-14793
Received 20 November 2000/Returned for modification 10 January 2001/Accepted 26 January 2001
| |
ABSTRACT |
|---|
|
|
|---|
Addition of serum to mitogen-starved cells activates the cellular
immediate-early gene (IEG) response. Serum response factor (SRF)
contributes to such mitogen-stimulated transcriptional induction of
many IEGs during the G0-G1 cell cycle
transition. SRF is also believed to be essential for cell cycle
progression, as impairment of SRF activity by specific antisera or
antisense RNA has previously been shown to block mammalian cell
proliferation. In contrast, Srf
/
mouse
embryos grow and develop up to E6.0. Using the embryonic stem (ES) cell
system, we demonstrate here that wild-type ES cells do not undergo
complete cell cycle arrest upon serum withdrawal but that they can
mount an efficient IEG response. This IEG response, however, is
severely impaired in Srf
/
ES cells,
providing the first genetic proof that IEG activation is dependent upon
SRF. Also, Srf
/
ES cells display altered
cellular morphology, reduced cortical actin expression, and an impaired
plating efficiency on gelatin. Yet, despite these defects, the
proliferation rates of Srf
/
ES cells are
not substantially altered, demonstrating that SRF function is not
required for ES cell cycle progression.
| |
INTRODUCTION |
|---|
|
|
|---|
Both postmitotic cells and mitotic
cells persisting in a resting G0 state can be induced by
extracellular stimuli to activate an instantaneous gene expression
program called the immediate-early gene (IEG) response
(13). Postmitotic cells such as neurons rely on the IEG
response to convert, for example, neurotransmitter-mediated activation
processes into long-term adaptive responses (19, 46).
G0 cells, on the other hand, employ the IEG response to activate transcription factor-encoding genes (like c-fos,
junB, or Egr-1), which subsequently regulate gene
cascades enabling G1 progression (2, 10, 13,
20). This G0-to-G1 transition is
commonly studied by the addition of mitogens (or serum) to serum-deprived cells. The IEG response displays a very rapid and transient gene activation profile that does not require de novo protein
biosynthesis but instead utilizes preexisting cellular signaling
components and transcription factors. Signaling cascades that mediate
the IEG response include the mitogen-activated protein (MAP) kinase
network, Ca2+-dependent pathways, NF-
B signaling, and
JAK/STAT signaling. The MAP kinase pathway assumes an
especially important role in triggering the IEG response
(41).
Of the many transcription factors that are targeted by MAP kinase signaling, the serum response factor (SRF) has been characterized in significant detail. SRF (28), a ubiquitously expressed MADS box protein (29, 35, 36), mediates both the signal-stimulated transcriptional induction of IEG and the activation of cell type-specific genes. The latter include muscle-specific genes or neuronal genes. SRF binds to serum response elements (SREs) in the promoters of these genes by recognizing the CArG-box sequence (CC[A/T]6GG) (24, 29, 40). SRF can recruit additional proteins to SREs, e.g., the Ets family ternary complex factors (TCFs), muscle-specific accessory factors, or others (for review, see reference 42; Nordheim, submitted). The Ets/TCFs are direct targets of MAP kinase signaling cascades (8, 41), instrumental for rapid and transient IEG induction of, e.g., c-fos and Egr-1. SRF can also activate genes in a TCF-independent fashion (9, 17, 18), primarily through the involvement of Rho signaling in response to, e.g., lysophosphatidic acid (LPA) stimulation (15, 16).
The indicated contribution of SRF to mitogen-stimulated transcriptional
induction of IEGs during the G0-G1 transition
(13) and the requirement of the SRF homologue MCM1 at the
G2-M transition in Saccharomyces cerevisiae
(3, 22) suggested an essential regulatory function for SRF
in both G0 exit and the ensuing cell cycle progression.
This notion was strengthened by experiments in which SRF activity was
impaired by using specific antisera or antisense RNAs blocking the
proliferation of rat embryo fibroblasts (7) or myoblasts
(39), respectively. In stark contrast to these cell-based
assays, we have demonstrated that cells of
Srf
/
mutant embryos are viable and support
early embryonic growth in utero up to E6.0 (4). To explore
SRF function in cells of the early embryo, we have used the embryonic
stem (ES) cell as an in vitro model system for cellular proliferation,
differentiation, and early embryonic development (37, 44,
45).
We demonstrate here that wild-type murine ES cells cannot be rendered quiescent upon withdrawal of serum yet still contain a vigorous IEG response upon serum readdition. SRF-deficient ES cells were found to have a severe defect in both IEG activation and actin gene expression, but the accompanying alterations in cellular morphology did not prevent normal rates of ES cell proliferation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
ES cells.
Germ line competent D3 and E14 ES cells were
provided by R. Jaenisch (Whitehead Institute, Cambridge, Mass.) and K. Rajewsky (Genetics Institute, Cologne, Germany), respectively.
Srf
/+ ES cells, derived from the E14 line,
were described previously (4, 44). Selection for enhanced
G418 resistance and characterization of Srf
/
ES cells, as well as the generation of
Srf
/
rescue ES cells, are described in
reference 44.
ES cell culture conditions. (i) General growth conditions. ES cells were kept without feeders on gelatin-coated dishes in Dulbecco modified Eagle medium, containing 4.5 g of glucose/liter and 3.7 g of NaHCO3/liter supplemented with 2mM L-glutamine, 100 U of penicillin/ml, 100 g of streptomycin/ml, 0.1 mM mercaptoethanol, 15% fetal calf serum (FCS), and 1,000 U of leukemia inhibitory factor/ml (referred to as complete medium). Cultivation was at 37°C in a humidified atmosphere at 5% CO2, and cells were passaged every 48 h.
(ii) ES cell culture conditions for IEG induction. For serum-withdrawal experiments, cells were seeded and grown for 12 to 24 h in complete medium for optimal attachment. The medium was then exchanged and cells were kept for 24 to 38 h in complete medium lacking FCS. The expression of IEGs was assayed before and 10, 30, 60, or 180 min after the addition of 15% FCS, 100 ng of phorbol ester tetradecanoyl phorbol acetate (TPA)/ml, or 20 µM LPA (final concentrations). LPA stimulations were done for 30 min only. The kinetic profiles of IEG induction proved somewhat variable in ES cells, explaining the differences in the expression kinetics of Fig. 5A and B and 5C and D, respectively, as well as the magnitude of the deviations shown in Fig. 6, which represent the mean of five separate experiments, each sampled at the 30-min time point.
Northern blotting. RNA was isolated by the guanidinium isothiocyanate method (5). RNA (20 µg) was electrophoresed and transferred to Gene Screen nylon membrane (NEN, Boston, Mass.). Filters were successively hybridized with [32P]dCTP-labeled human Egr-1, v-fos, and, for standardization, mouse fox cDNA probes (33), under standard conditions.
Western blotting. Preparation of cell extracts was as described previously (11), and Western blotting using a pan-actin antibody (Acurate, Westbury, N.Y.) was performed according to reference 44.
Quantitative RT-PCR.
Total RNA preparation (RNeasy kit;
QIAGEN) and first-strand cDNA synthesis (Superscript II; Gibco) were
done according to the manufacturers' protocols. One microgram of total
RNA treated with DNase I was used for reverse transcription (RT).
One-twentieth of the RT reaction was included in a 25-µl PCR
reaction. For quantitative analysis, the SYBR Green PCR technology was
used (Perkin-Elmer). Real-time detection of the PCR product was
monitored by measuring the increase in fluorescence caused by the
binding of SYBR Green to double-stranded DNA with the ABI PRISM 7700 sequence detector. In order to obtain relative quantification, a
threshold cycle (Ct), the cycle at which a statistically
significant increase in fluorescence occurs, was derived from the
resulting PCR profiles of each sample. Ct is a measure for
the amount of template present in the starting reaction. To correct for
different amounts of total cDNA in the starting reaction,
Ct values of an endogenous control (Hprt) were subtracted
from those of the corresponding sample, resulting in
Ct.
The relative quantitation value is expressed as 2
Ct.
Induction of specific mRNAs by IEG stimulation is then plotted as the
induction factor relative to uninduced mRNA levels in starved cells.
-Actin, F(GGCGCTTTTGACTCAGGAT)
and R(GGGATGTTTGCTCCAACCAA); c-fos,
F(AAGGGAACGGAATAAGATGGC) and
R(CAACGCAGACTTCTCATCTTCAA); Egr-1,
F(GCCGAGCGAACAACCCTA) and R(TCCACCATCGCCTTCTCATT);
Hprt, F(GCCTAAGATGAGCGCAAGTTG) and
R(TACTAGGCAGATGGCCACAGG); and Vinculin, F(CCAAGGTCAGAGAAGCCTTCC) and R(CGTAGCTGTTCAAGGTCTGGT).
Cell cycle analysis. For analysis of DNA content, cells were harvested, incubated for 15 min in staining solution (0.5 mg of propidium iodide [PI]/ml, 4 mM sodium citrate, 0.03% Triton X-100), treated for 30 min with RNase A, and diluted with phosphate-buffered saline (PBS). Fluorescence intensity was determined by flow cytometry on a Becton Dickinson FACScan, and the percentages of G1-, S-, and G2-phase cells were calculated with the LYSIS (Becton Dickinson) or MODFIT software program. To measure DNA synthesis, serum-starved cells were cultured in the presence of 30 µm of bromodeoxyuridine (BrdU) (Roche) for 30 min, trypsinized, and stored in 70% ethanol for >2 h. Cells were rehydrated in PBS containing 1% heat-inactivated fetal serum (PBS/IFS) treated with 0.3 ml of 2 M HCl at room temperature for 20 min, washed in PBS/IFS, neutralized with 0.1 M sodium borate (pH 8.0) for 2 min, and washed again in PBS/IFS. BrdU was identified by labeling the cells with anti-BrdU monoclonal antibodies at a 1:10 dilution (Roche) and fluorescein isothiocyanate-conjugated goat anti-mouse antibody. Cells were then resuspended in modified PI staining solution (0.4 mg of PI/ml, 4 mM sodium citrate, 25 µg of RNase A/ml) for 15 min and analyzed by flow cytometry as described above.
SEM. ES cells were grown on gelatin-coated coverslips for up to 72 h. Samples were fixed with 1.6% glutaraldehyde in 20 mM HEPES-120 mM NaCl for 5 min at room temperature and for 1 h at 4°C, postfixed with 1% osmium tetroxide in PBS for 1 h on ice, washed with H2O, and treated with 1% aqueous uranyl acetate for 1 h at 4°C. For scanning electron microscopy (SEM) ES cell colonies grown on coverslips were dehydrated in ethanol and critical-point dried from CO2. The samples were sputter coated with 8 nm of gold-palladium and examined at 20 kV accelerating voltage in a Hitachi S-800 field emission scanning electron microscope.
Indirect immunofluorescence. Cells were grown on gelatin-coated coverslips in complete growth medium for 48 h. The samples were then fixed in 4% formaldehyde and permeabilized in 0.2% Triton X-100. Nonspecific binding was blocked by incubating the cells for 1 h in 1% bovine serum albumin in PBS at 37°C before staining with a rabbit anti-E-cadherin antibody (1:300 in PBS; gift of H. Beug) for 1 h at 37°C. Incubation with Oregon green-conjugated secondary antibody (Molecular Probes; 1:200 in 0.2% bovine serum albumin) was performed for 30 min at 37°C. To visualize filamentous actin, 1 U of Texas red phalloidin (Molecular Probes) was included in the mixture. Coverslips were washed four times with PBS and once in water, air dried, and mounted in Moviol. Image acquisition was done with LSM 510 (Zeiss).
| |
RESULTS |
|---|
|
|
|---|
To investigate the contributions of SRF to cellular growth
control, we generated and characterized Srf
/
ES cells (44) derived from the
Srf
/+ ES cells that were originally used for
blastocyst injections and the generation of
Srf
/+ mice (4). The homozygous
Srf
/
ES cells were obtained from the
heterozygous Srf
/+ ES cells upon selection for
elevated cellular resistance levels to the drug G418. In the
Srf
/
ES cells obtained, no protein was
observed that might be antigenically related to SRF and no SRF-derived
DNA binding activity could be seen (44). Rescued cells
(Srf
/
rescue) expressed SRF at levels three
to four times higher than wild-type ES cells (44).
Normal proliferation but impaired colony formation of
Srf
/
ES cells.
Since SRF activity
appears to be essential for the growth of in vitro cultured somatic
cells (7, 39), we sought to determine if SRF deficiency
altered the proliferation characteristics of ES cells. We first
examined the growth rates of one Srf
/+ and two
Srf
/
ES clones. Equal numbers of cells were
seeded at low densities in leukemia inhibitory factor-containing
medium, and the proliferation kinetics of colonized cells were
monitored by counting total cell numbers for a period of 7 days.
Proliferation started after a lag period of 1 to 2 days in all clones.
The growth curves revealed that the colonies of the
Srf
/+ clone increased more rapidly in cell
number than did those of each of the two
Srf
/
clones (Fig.
1A). Additionally, after 150 h of
culture, the total cell numbers of SRF-deficient cells plateaued (E81
Srf
/
) or even declined (E100
Srf
/
), whereas
Srf
/+ cell numbers increased, reaching a
higher saturation cell count than SRF-deficient cells. At this late
phase of the growth curve, ES cell colonies had become rather
big and cells began to display signs of differentiation (data not
shown). In the case of Srf
/
cells this was
accompanied by an enhanced tendency to undergo apoptosis (unpublished
observation). During the early phase of the growth curve, i.e., up to
125 h, the observed lower increase in the
Srf
/
ES cell number might have been caused
by either an impaired plating efficiency or an altered proliferation
capacity. We therefore first investigated the efficiencies of colony
formation subsequent to plating. We seeded identical numbers of ES
cells of different Srf genotypes and counted the number of
colonies formed after 6 days of culturing. Both
Srf
/
ES clones displayed significantly
reduced efficiencies in colony formation compared to the wild type and
Srf
/+ clones (Fig. 1B). We believe that this
difference is the prime cause for the differences in the cumulative
cell numbers over time, as observed in Fig. 1A with cultures of ES
cells either containing or lacking SRF.
|
/+ ES cells (data not shown).
To investigate more closely the rates of proliferation of SRF-deficient
ES cells, we also monitored growth under high cell-density conditions
over several passages. Cells (4 × 105) were seeded on
a gelatin-coated 10-cm dish, trypsinized every 24 h, counted, and
replated at the above-mentioned density. Under these conditions,
differences in plating efficiency or spontaneous differentiation
between SRF-containing and SRF-deficient cells were not apparent
(unpublished data) and similar total cell counts were reached after
each 24-h cycle (Fig. 1D). Therefore, also under high-density plating
conditions, no significant SRF-dependent differences in ES cell
proliferation were observed. Collectively we infer from these data that
SRF does not contribute in an important way to the rates at which ES
cells proliferate.
Altered morphology of Srf
/
ES colonies
is accompanied by impaired cortical actin expression.
The observed
differences in plating efficiency of Srf
/
ES
cell clones (Fig. 1B) warranted a closer inspection of their
morphologies. Light microscopic analysis of ES cells revealed
protrusions on many of the SRF-deficient cells (Fig.
2A, right panel), features rarely
seen with Srf
/+ ES cells
(Fig. 2A, left panel) or with wild-type ES cells (data not shown).
After 72 h of culture, colonies of cells deficient in SRF were
less compact and appeared to display less tight cell-cell interaction
(Fig. 2B). This was confirmed by SEM, which demonstrated that
individual cells within an Srf
/
ES colony
established fewer contacts with neighboring cells than those within an
Srf
/+ ES colony (Fig. 2C). We speculate that
the decreased plating efficiency is a direct consequence of these
altered structural characteristics.
|
-actin) in Srf
/
ES cells.
Figure 2D reveals a 50 to 65% drop in actin protein expression levels
in SRF-deficient cells, accompanied by a strongly reduced intensity of
cortical actin networks (Fig. 2E). While reduced in intensity, the
cortical actin arrangement
at this level of resolution
does not
appear severely disturbed in structural terms. At the same time,
expression and cellular localization of E-cadherin appear unaffected by
the lack of SRF (Fig. 2E).
Cell cycle progression of Srf
/
ES
cells.
The apparently normal proliferation rate of SRF-deficient
ES cells contrasted with earlier demonstrations of SRF being required for the proliferation of somatic cells. SRF is known to regulate gene
activation at specific stages of the cellular growth cycle (i.e., the
G0-G1 transition as quiescent cells enter into
the active growth cycle, progression of cycling cells through
G1, and the G2-M transition). This cell
cycle-specific nature of SRF function suggested that ES cells lacking
SRF may display specific alterations in the progression through the
cell cycle, despite having a growth rate similar to wild-type cells.
The parental ES cell line E14 (Srf+/+), the
heterozygous line 226 (Srf
/+), and the two
homozygous lines 226-81 and 226-100 (each
Srf
/
) were studied regarding their cell
cycle progression. In nonstarved, normally growing cultures (Fig.
3A), the majority of cells were found in
the S phase and lower but comparable amounts of cells were found in
each of the G1 and G2 phases. No obvious
differences in these distributions were seen between wild-type,
heterozygote, or homozygote mutant ES cells.
|
/
ES cells cultured in the presence of
serum, we speculated that serum restimulation of quiescent
Srf
/
ES cells may be altered in some manner.
Thus, we analyzed the cell cycle distribution profiles of the various
ES cell lines after serum withdrawal and upon subsequent stimulation
with serum. In none of the ES clones tested did serum withdrawal lead
to efficient growth arrest. After a 38-h period of starvation, the
percentage of G1 cells was slightly but significantly
increased at the expense of S-phase cells, but there was no difference
between the cells of different Srf genotypes (Fig. 3B). When
wild-type and heterozygote ES cells were reexposed to serum for 24 h
(Fig. 3C), the cell cycle distribution again resembled that of
asynchronously growing cells. Restimulation of starved mutant cells
with serum, however, led to the accumulation of 10% more of the cells
in the G2-M phase of the cell cycle, a small but
significant alteration in the cell cycle distribution of the cells
(Fig. 3C). Thus, while SRF function does not appear to be essential for
the cell cycle progression of ES cells, it may nonetheless contribute
to the G2-M checkpoint function, as has been previously
suggested (21).
Cell cycle progression of wild-type ES cells.
We were
surprised that the E14 ES cells failed to accumulate in G1
in the absence of serum. We wished to test whether this was a
characteristic of ES cells in general and whether the ES cells are
altered in any way in the absence of serum. To do so, we examined a
second independently derived ES cell line, termed D3, which is also
capable of germ line transmission. As noted for E14 ES cells above, the
cell cycle profile of D3 cells was not substantially altered up to 24 h
after withdrawal of serum (Fig. 4). In
this experiment we also examined DNA synthesis by the uptake of the
thymidine analog BrdU. Although serum-starved cells retained normal
cell cycle distribution, their rate of DNA synthesis gradually slowed,
as evidenced by a progressive decrease in the rate of uptake of BrdU.
Thus, ES cells appear to be sensitive to serum withdrawal, as evidenced
by a slowing in the rate of DNA synthesis, yet nonetheless lack the
ability to undergo G0 exit.
|
SRF-mediated induction of the IEGs Egr-1 and
c-fos is dispensable in the ES cell.
Given the
relatively inefficient exit of ES cells from the active cell cycle into
G0 and the lack of a requirement for SRF for ES cell
proliferation, we first wondered whether wild-type ES cells were able
to mount an efficient IEG activation response. The activation of
SRF complexes by the MAP kinase cascade has been implicated in the
transcriptional up-regulation of IEGs such as c-fos and
Egr-1 in the G0-G1 transition. This
step is believed to be essential for resting cells to reenter the cell
cycle (13). We therefore investigated the pattern of
Egr-1 and c-fos induction following stimulation
of ES cells with intact SRF function, either wild-type (data not shown)
or Srf
/+ ES cells (Fig.
5). Serum-withdrawn ES cells were
stimulated for up to 3 h with either serum or the phorbol ester
TPA, and the resulting mRNA levels were measured over time by Northern
blot analysis. ES cells containing at least one intact Srf
allele were able to mount a robust IEG response, as judged by
c-fos and Egr-1 gene activation profiles.
|
/
cells. They exhibited a drastically
impaired induction of both Egr-1 and c-fos
following serum stimulation. Whereas no induction at all could be seen
for Egr-1 in the Srf
/
ES cells, a
residual response was observed with c-fos. This data set was
fully confirmed by separate experiments which investigated independently derived RNA preparations by quantitative RT-PCR analysis
(Fig. 5C and D and Fig. 6). While the
induction of other IEGs was not examined, we suggest that it is
similarly compromised in these cells.
|
/
rescue ES cells the
levels of SRF expression are three- to fivefold higher than those of
the endogenous protein (44). Indeed, the Srf
/
rescue ES clone reacquired a very efficient
serum-dependent induction of both c-fos and Egr-1
(Fig. 5C and D). This induction was both rapid and transient, in a
manner similar to that seen in wild-type ES cells expressing endogenous
SRF. These data provide for the first time direct genetic evidence that
SRF is an important regulator of a component of the cellular IEG
activation response.
We also investigated the expression profiles of the
-Actin and Vinculin genes, both of which are
known to be SRE regulated yet do not fall into the class of transiently
induced IEGs (25, 27). Indeed, in SRF-containing
heterozygous ES cells both
-Actin (data not shown) and
Vinculin (Fig. 5E) are stimulated 1.5 to 3-fold by serum
addition. This activation, however, did not follow the rapid and
transient IEG activation kinetics but rather mRNAs accumulated
gradually over a 3-h time period. The basal RNA levels of
-Actin as well as the serum-stimulated induction of both
-Actin and Vinculin were reduced in
Srf
/
ES cells. Again, reintroduction of SRF
protein into the Srf
/
rescue ES cells
restored the serum-stimulated expression of both genes (Fig. 5E and
data not shown). From these data we conclude that in ES cells SRF
controls the expression levels of SRE-containing genes. In doing so, it
regulates rapidly responding, transiently activated IEGs, such as
Egr-1 and c-fos, as well as
-Actin
and Vinculin, other SRE-containing genes that do not display
the same transient activation profiles.
LPA-induced signaling targets endogenous genes via SRF. TCF-independent activation of SRF target genes was reported to occur upon stimulation with serum and LPA (9, 15, 17, 18). These results were obtained with transiently transfected or microinjected reporter constructs, and the chromosomal state of the reporters was found to matter (1). The availability of SRF-deficient cells provided us with the tool to examine directly a potential involvement of SRF in the stimulation of endogenous IEGs by LPA. Fig. 6 demonstrates that SRF is indeed required for efficient activation of both the c-fos and Egr-1 genes by LPA. As seen before with serum induction (Fig. 5D), LPA-stimulated induction of ES cells lacking SRF still permits significant residual activation of c-fos (Fig. 6B) but not of Egr-1 (Fig. 6A). This analysis provides the first genetic proof for a direct involvement of SRF in LPA-stimulated induction of cellular target genes.
| |
DISCUSSION |
|---|
|
|
|---|
Mouse embryos lacking the transcription factor SRF develop until
the onset of gastrulation at around E6.0 (4). At that point an essential requirement for SRF exists since the
Srf
/
embryos fail to develop detectable
mesodermal cells and die in utero. Up until E6.0, however, it is
apparent that many cell division cycles occur in a fashion that is
apparently little affected by the absence of SRF. Prior to this
unexpected finding, SRF was believed to be essential for the
proliferation of all mammalian cells (7, 39). In the
present work we made use of the ES cell system to explore the
mechanisms that permit the cells of the early
Srf
/
mouse embryo to proliferate. To that
end, we have used Srf
/
ES cells to
investigate the requirement for SRF during ES cell proliferation, cell
cycle progression, and IEG activation.
ES cell morphology and cortical actin expression are influenced by
SRF.
Srf
/
ES cells display
morphological characteristics indicative of altered cell surface
activities, including cell-substrate and cell-cell interactions. The
reduction in plating efficiency on gelatin substrates, as observed when
cells were seeded at low density, may be the direct cause of the
smaller increases in the total number of
Srf
/
ES cells over time seen in our growth
curves. We do not yet know the fate of those individual ES cells that
are unable to give rise to colony formation on the growth plates.
However, preliminary data indicate that Srf
/
ES cells display reduced adhesion to various matrices (unpublished data). The nonadherent cells are unable to form colonies and can be
expected to die by anoikis, i.e., the apoptosis that occurs in certain
cell types when cell matrix contact is lost. We did not observe signs
of apoptosis in continuously growing Srf
/
ES
cells (unpublished). However, it is possible that detached cells might
have been lost during the experiment.
/
ES cells
(unpublished). Disturbance of the cortical actin network has also been
implicated in the formation of cytoplasmic extrusions (31), structures also displayed by the
Srf
/
ES cells. Similar alterations in cell
morphology were also seen with embryoid bodies derived from
Srf
/
ES cells (44). This
supports the notion that SRF fulfills an important role in directing
the expression of structural proteins of the cytoskeleton, thereby
facilitating the buildup of structures crucial for cell shape and cell
adhesion. More detailed investigations of cytoskeletal structures and
associated adhesion properties of Srf
/
ES
cells are currently under way.
SRF is not required for ES cell proliferation.
Although a
comparison of Srf
/+ and
Srf
/
ES cell growth curves revealed smaller
increases in the total number of Srf
/
ES
cells over time, the rates of proliferation of both types of ES cell
were found to be comparable. This was true for both low and high
cell-density growth conditions. This is in distinct contrast to the
block in proliferation observed when SRF function was inhibited in rat
embryo fibroblasts (7) and myoblasts (39). Therefore, in contrast to the somatic cells investigated, ES cells lacking SRF function do not have a severe impairment in their proliferative capacity, and this correlates well with the unaffected early development of Srf
/
mouse embryos up
to E6.0. Similarly, the product of the SRF target gene c-fos
is not required for proliferation of ES cells (6). However, we cannot formally rule out the possibility that our Srf
/
ES cells acquired unidentified
mutations during neomycin selection that allowed them to grow in the
absence of SRF.
/
cells displayed a cell
cycle distribution identical to wild-type cells, whether asynchronously
growing or deprived of serum. However, slightly more cells accumulated
in G2-M following restimulation of serum-starved
Srf
/
cells than wild-type cells. SRF
function in the G2-M phase of the cell cycle may be
associated with effects on microtubular reorganization
(21). Since yeast cells lacking the SRF homologue Mcm1 are
completely arrested at the G2-M transition
(3), our data may suggest that murine ES cells may also
activate critical SRF-dependent genes in a cell cycle-specific fashion
at the G2-M transition.
SRF is required for IEG activation. In SRF-negative ES cells, Egr-1 and c-fos were found to be drastically impaired in their immediate-early response upon induction with serum or TPA. This provides genetic proof that SRF contributes in an essential way to the cellular immediate-early response of SRE-containing genes, a concept previously suggested by the use of transiently expressed SRF effector and reporter systems of altered binding specificity (14, 18).
Even in Srf
/
ES cells, however, we observed
a modest induction of c-fos following serum stimulation.
This may be due to other transcription factors binding to the
v-sis-inducible element (SIE) present in the
c-fos promoter, which is lacking in the Egr-1
promoter. Indeed, serum stimulation-mediated activation of the
c-fos promoter independently of SRF, by factors that bind to
the SIE, has previously been demonstrated (23). Robertson
et al. argued for functional interdependence of the c-fos
SIE and SRE elements, based on the assessment of cis-element
mutagenesis in transgenic mice and explanted cells (32).
The drastic reduction in c-fos IEG activation that we see in
ES cells lacking only SRF is consistent with this notion. It will be
interesting to investigate by genomic footprinting (12)
whether the c-fos SRE in Srf
/
ES
cells is occupied by SRE binding proteins other than SRF.
Our analysis also provides genetic evidence for LPA-induced activation
of c-fos and Egr-1 to depend upon functional SRF,
thereby strengthening previous findings (15). Rho family
small GTPases are suggested to be involved (16), a
signaling scenario that is likely to be influenced by SRF target genes
like
-Actin (see above and reference 38). We
note that treatment of serum-withdrawn ES cells with LPA was sufficient
to elicit a significant transcriptional response of endogenous genes,
indicating that in these cells the required signaling events can all be
activated by LPA alone (1). The expression of
-Actin and Vinculin, known to be regulated by
SRF (25, 27), was similarly affected by SRF deficiency in
both asynchronously growing and serum-restimulated cells (data not
shown). More than 60 genes have been identified with functional SREs in
their promoters (A. Nordheim, unpublished data), and we speculate that
transcriptional regulation of most of these genes will be impaired in
the absence of SRF. This altered regulation of SRF-dependent genes is
likely to affect many physiological processes in organisms that lack
SRF function.
ES cells do not assume a quiescent G0 state upon serum
withdrawal.
One striking difference between ES and somatic cells
is the response to serum withdrawal. Serum-deprived somatic cells
undergo G0 exit (43), while similarly treated
ES cells fail to do so. ES cells continue to proliferate in the absence
of serum, even with substantially reduced c-fos and
Egr-1 expression, and they appear to proliferate normally in
the absence of SRF. These data suggest that the IEG program and SRF
function are dispensable in the ES cell, in part because ES cells lack
the capacity to undergo G0 exit and cell cycle reentry.
Furthermore, the relatively normal growth in vitro of SRF-deficient ES
cells is reminiscent of the normal growth of cells of the early
Srf
/
embryo, which are able to support
embryonic development until E6.0. We speculate that, like ES cells, the
cells of the early mouse embryo also undergo continuous cell division
cycles without G0 exit and therefore do not require the
mechanisms to undergo cell cycle reentry. Thus, rather than containing
cellular factors that complement SRF deficiency and maintain the IEG
program, the cells of the early embryo simply may not require SRF
function and IEG activation. Recently, Poser et al. described SRF as
contributing to a novel phosphatidylinositol 3-kinase-mediated
mechanism of cell cycle reentry seen with HeLa and 3T3-L1 cells
(30). It will be interesting to determine whether such an
SRF-dependent mechanism is also operative in ES cells.
| |
ACKNOWLEDGMENTS |
|---|
G. Schratt and B. Weinhold contributed equally to this work.
We thank Marianne Petry for expert technical assistance. We acknowledge the gift of anti-E-cadherin antiserum from H. Beug (IMP, Vienna, Austria). We appreciate the comments on this manuscript by O. Heidenreich.
This work was supported through grants of the VolkswagenStiftung (I/74039 to U.R. and I/74043 to A.N.) and the DFG (NO 120/10-1 and NO 120/7-4 to A.N.). A.S.L. and R.A.W. acknowledge financial support through NIH grant R35CA39826.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Interfakultäres Institut für Zellbiologie, Abteilung Molekularbiologie, Universität Tübingen, Auf der Morgenstelle 15, 72076 Tübingen, Germany. Phone: 49-7071-297 8898. Fax: 49-7071-295359. E-mail: alfred.nordheim{at}uni-tuebingen.de.
Present address: Institut für Medizinische Mikrobiologie,
Medizinische Hochschule Hannover, 30625 Hannover, Germany.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Alberts, A. S., O. Geneste, and R. Treisman. 1998. Activation of SRF-regulated chromosomal templates by Rho-family GTPases requires a signal that also induces H4 hyperacetylation. Cell 92:475-487[CrossRef][Medline]. |
| 2. |
Almendral, J. M.,
D. Sommer,
H. Macdonald-Bravo,
J. Burckhardt,
J. Perera, and R. Bravo.
1988.
Complexity of the early genetic response to growth factors in mouse fibroblasts.
Mol. Cell. Biol.
8:2140-2148 |
| 3. | Althoefer, H., A. Schleiffer, K. Wassmann, A. Nordheim, and G. Ammerer. 1995. Mcm1 is required to coordinate G2-specific transcription in Saccharomyces cerevisiae. Mol. Cell. Biol. 15:5917-5928[Abstract]. |
| 4. | Arsenian, S., B. Weinhold, M. Oelgeschlager, U. Rüther, and A. Nordheim. 1998. Serum response factor is essential for mesoderm formation during mouse embryogenesis. EMBO J. 17:6289-6299[CrossRef][Medline]. |
| 5. | Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159[Medline]. |
| 6. |
Field, S. J.,
R. S. Johnson,
R. M. Mortensen,
V. E. Papaioannou,
B. M. Spiegelman, and M. E. Greenberg.
1992.
Growth and differentiation of embryonic stem cells that lack an intact c-fos gene.
Proc. Natl. Acad. Sci. USA
89:9306-9310 |
| 7. | Gauthier-Rouviere, C., J. C. Cavadore, J. M. Blanchard, N. J. Lamb, and A. Fernandez. 1991. p67SRF is a constitutive nuclear protein implicated in the modulation of genes required throughout the G1 period. Cell Regul. 7:575-588. |
| 8. | Gille, H., A. D. Sharrocks, and P. E. Shaw. 1992. Phosphorylation of transcription factor p62TCF by MAP kinase stimulates ternary complex formation at c-fos promoter. Nature 358:414-417[CrossRef][Medline]. |
| 9. |
Graham, R., and M. Gilman.
1991.
Distinct protein targets for signals acting at the c-fos serum response element.
Science
251:189-192 |
| 10. | Greenberg, M. E., and E. B. Ziff. 1984. Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene. Nature 311:433-438[CrossRef][Medline]. |
| 11. |
Heidenreich, O.,
A. Neininger,
G. Schratt,
R. Zinck,
M. A. Cahill,
K. Engel,
A. Kotlyarov,
R. Kraft,
S. Kostka,
M. Gaestel, and A. Nordheim.
1999.
MAPKAP kinase 2 phosphorylates serum response factor in vitro and in vivo.
J. Biol. Chem.
274:14434-14443 |
| 12. | Herrera, R. E., P. E. Shaw, and A. Nordheim. 1989. Occupation of the c-fos serum response element in vivo by a multi-protein complex is unaltered by growth factor induction. Nature 340:68-70[CrossRef][Medline]. |
| 13. | Herschman, H. R. 1991. Primary response genes induced by growth factors and tumor promoters. Annu. Rev. Biochem. 60:281-319[CrossRef][Medline]. |
| 14. | Hill, C. S., R. Marais, S. John, J. Wynne, S. Dalton, and R. Treisman. 1993. Functional analysis of a growth factor-responsive transcription factor complex. Cell 73:395-406[CrossRef][Medline]. |
| 15. | Hill, C. S., and R. Treisman. 1995. Differential activation of c-fos promoter elements by serum, lysophosphatadic acid, G proteins and polypeptide growth factors. EMBO J. 14:5037-5047[Medline]. |
| 16. | Hill, C. S., J. Wynne, and R. Treisman. 1995. The Rho family GTPases RhoA, Rac1, and CDC42Hs regulate transcriptional activation by SRF. Cell 81:1159-1170[CrossRef][Medline]. |
| 17. | Hill, C. S., J. Wynne, and R. Treisman. 1994. Serum-regulated transcription by serum response factor (SRF): a novel role for the DNA binding domain. EMBO J. 13:5421-5432[Medline]. |
| 18. |
Johansen, F.-E., and R. Prywes.
1994.
Two pathways for serum regulation of the c-fos serum response element require specific sequence elements and a minimal domain of serum response factor.
Mol. Cell. Biol.
14:5920-5928 |
| 19. |
Johnson, C. M.,
C. S. Hill,
S. Chawla,
R. Treisman, and H. Bading.
1997.
Calcium controls gene expression via three distinct pathways that can function independently of the Ras/mitogen-activated protein kinases (ERKs) signaling cascade.
J. Neurosci.
17:6189-6202 |
| 20. | Lau, L. F., and D. Nathans. 1985. Identification of a set of genes expressed during the G0/G1 transition of cultured mouse cells. EMBO J. 4:3145-3151[Medline]. |
| 21. | Liu, S. H., H. H. Lee, J. J. Chen, C. F. Chuang, and S. Y. Ng. 1994. Serum response element-regulated transcription in the cell cycle: possible correlation with microtubule reorganization. Cell Growth Differ. 5:447-455[Abstract]. |
| 22. | Maher, M., F. Cong, D. Kindelberger, K. Nasmyth, and S. Dalton. 1995. Cell cycle-regulated transcription of the CLB2 gene is dependent on Mcm1 and a ternary complex factor. Mol. Cell. Biol. 15:3129-3137[Abstract]. |
| 23. |
Meyer, D. J.,
G. S. Campbell,
B. H. Cochran,
L. S. Argetsinger,
A. C. Larner,
D. S. Finbloom,
C. Carter-Su, and J. Schwartz.
1994.
Growth hormone induces a DNA binding factor related to the interferon-stimulated 91-kDa transcription factor.
J. Biol. Chem.
269:4701-4704 |
| 24. |
Minty, A., and L. Kedes.
1986.
Upstream regions of the human cardiac actin gene that modulate its transcription in muscle cells: presence of an evolutionarily conserved repeated motif.
Mol. Cell. Biol.
6:2125-2136 |
| 25. |
Moiseyeva, E. P.,
P. A. Weller,
N. I. Zhidkova,
E. B. Corben,
B. Patel,
I. Jasinska,
V. E. Koteliansky, and D. R. Critchley.
1993.
Organization of the human gene encoding the cytoskeletal protein vinculin and the sequence of the vinculin promoter.
J. Biol. Chem.
268:4318-4325 |
| 26. |
Muscat, G. E. O.,
T. A. Gustafson, and L. Kedes.
1988.
A common factor regulates skeletal and cardiac -actin gene transcription in muscle.
Mol. Cell. Biol.
8:4120-4133 |
| 27. |
Ng, S. Y.,
P. Gunning,
S. H. Liu,
J. Leavitt, and L. Kedes.
1989.
Regulation of the human beta-actin promoter by upstream and intron domains.
Nucleic Acids Res.
17:601-615 |
| 28. | Norman, C., M. Runswick, R. Pollock, and R. Treisman. 1988. Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element. Cell 55:989-1003[CrossRef][Medline]. |
| 29. | Pellegrini, L., S. Tan, and T. J. Richmond. 1995. Structure of serum response factor core bound to DNA. Nature 376:490-498[CrossRef][Medline]. |
| 30. | Poser, S., S. Impey, K. Trinh, Z. Xia, and D. R. Storm. 2000. SRF-dependent gene expression is required for PI3-kinase-regulated cell proliferation. EMBO J. 19:4955-4966[CrossRef][Medline]. |
| 31. |
Priddle, H.,
L. Hemmings,
S. Monkley,
A. Woods,
B. Patel,
D. Sutton,
G. A. Dunn,
D. Zicha, and D. R. Critchley.
1998.
Disruption of the talin gene compromises focal adhesion assembly in undifferentiated but not differentiated embryonic stem cells.
J. Cell Biol.
142:1121-1133 |
| 32. | Robertson, L. M., T. K. Kerppola, M. Vendrell, D. Luk, R. J. Smeyne, C. Bocchiaro, J. I. Morgan, and T. Curran. 1995. Regulation of c-fos expression in transgenic mice requires multiple interdependent transcription control elements. Neuron 14:241-252[CrossRef][Medline]. |
| 33. | Rüther, U., D. Komitowski, F. R. Schubert, and E. F. Wagner. 1989. c-fos expression induces bone tumors in transgenic mice. Oncogene 4:861-865[Medline]. |
| 34. | Schmidt, A., and M. N. Hall. 1998. Signaling to the actin cytoskeleton. Annu. Rev. Cell Dev. Biol. 14:305-338[CrossRef][Medline]. |
| 35. | Schwarz-Sommer, Z., I. Hue, P. Huijser, P. J. Flor, R. Hansen, F. Tetens, W. E. Lonnig, H. Saedler, and H. Sommer. 1992. Characterization of the Antirrhinum floral homeotic MADS-box gene deficiens: evidence for DNA binding and autoregulation of its persistent expression throughout flower development. EMBO J. 11:251-263[Medline]. |
| 36. | Shore, P., and A. D. Sharrocks. 1995. The MADS-box family of transcription factors. Eur. J. Biochem. 229:1-13[Medline]. |
| 37. | Smith, A. G., J. K. Heath, D. D. Donaldson, G. G. Wong, J. Moreau, M. Stahl, and D. Rogers. 1988. Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336:688-690[CrossRef][Medline]. |
| 38. | Sotiropoulos, A., D. Gineitis, J. Copeland, and R. Treisman. 1999. Signal-regulated activation of serum response factor is mediated by changes in actin dynamics. Cell 98:159-169[CrossRef][Medline]. |
| 39. | Soulez, M., C. G. Rouviere, P. Chafey, D. Hentzen, M. Vandromme, N. Lautredou, N. Lamb, A. Kahn, and D. Tuil. 1996. Growth and differentiation of C2 myogenic cells are dependent on serum response factor. Mol. Cell. Biol. 16:6065-6074[Abstract]. |
| 40. | Treisman, R. 1986. Identification of a protein-binding site that mediates transcriptional response of the c-fos gene to serum factors. Cell 46:567-574[CrossRef][Medline]. |
| 41. | Treisman, R. 1996. Regulation of transcription by MAP kinase cascades. Curr. Opin. Cell Biol. 8:205-215[CrossRef][Medline]. |
| 42. | Treisman, R. 1994. Ternary complex factors: growth factor regulated transcriptional activators. Curr. Opin. Genet. Dev. 4:96-101[CrossRef][Medline]. |
| 43. |
Wang, Z. M.,
H. Yang, and D. M. Livingston.
1998.
Endogenous E2F-1 promotes timely G0 exit of resting mouse embryo fibroblasts.
Proc. Natl. Acad. Sci. USA
95:15583-15586 |
| 44. |
Weinhold, B.,
G. Schratt,
S. Arsenian,
J. Berger,
K. Kamino,
H. Schwarz,
U. Rüther, and A. Nordheim.
2000.
Srf( / ) ES cells display non-cell autonomous impairment in mesodermal differentiation.
EMBO J.
19:5835-5844[CrossRef][Medline].
|
| 45. | Williams, R. L., D. J. Hilton, S. Pease, T.A. Willson, C. L. Stewart, D. P. Gearing, E. F. Wagner, D. Metcalf, N. A. Nicola, and N. M. Gough. 1988. Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells. Nature 336:684-687[CrossRef][Medline]. |
| 46. |
Xia, Z.,
H. Dudek,
C. K. Miranti, and M. E. Greenberg.
1996.
Calcium influx via the NMDA receptor induces immediate early gene transcription by a MAP kinase/ERK-dependent mechanism.
J. Neurosci.
16:5425-5436 |
This article has been cited by other articles: