Previous Article | Next Article 
Molecular and Cellular Biology, April 2001, p. 2944-2955, Vol. 21, No. 8
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.8.2944-2955.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
The Human Kinesin-Like Protein RB6K Is under Tight
Cell Cycle Control and Is Essential for Cytokinesis
Ruud D.
Fontijn,1
Bruno
Goud,2
Arnaud
Echard,2
Florence
Jollivet,2
Jan
van
Marle,3
Hans
Pannekoek,1 and
Anton
J. G.
Horrevoets1,*
Departments of
Biochemistry1 and Electron
Microscopy,3 Academic Medical Center, University
of Amsterdam, Amsterdam, The Netherlands, and UMR CNRS 144, Institut Curie, Paris, France2
Received 21 September 2000/Returned for modification 25 October
2000/Accepted 10 January 2001
 |
ABSTRACT |
Several members of the kinesin superfamily are known to play a
prominent role in the motor-driven transport processes that occur in
mitotic cells. Here we describe a new mitotic human kinesin-like protein, RB6K (Rabkinesin 6), distantly related to MKLP-1. Expression of RB6K is regulated during the cell cycle at both the mRNA and protein
level and, similar to cyclin B, shows a maximum during M phase.
Isolation of the RB6K promoter allowed identification of a CDE-CHR
element and promoter activity was shown to be maximal during M phase.
Immunofluorescence microscopy using antibodies raised against RB6K
showed a weak signal in interphase Golgi but a 10-fold higher signal in
prophase nuclei. During M phase, the newly synthesized RB6K does not
colocalise with Rab6. In later stages of mitosis RB6K localized to the
spindle midzone and appeared on the midbodies during cytokinesis. The
functional significance of this localization during M phase was
revealed by antibody microinjection studies which resulted exclusively
in binucleate cells, showing a complete failure of cytokinesis. These
results substantiate a crucial role for RB6K in late anaphase B and/or
cytokinesis, clearly distinct from the role of MKLP-1.
 |
INTRODUCTION |
Recently, we described the isolation
of a new human cDNA (GenBank accession no. AF070672) encoding a protein
that has all the characteristics of a kinesin-like protein (KLP)
(11). Its sequence is 86% identical to murine RB6K
(Rabkinesin 6) (GenBank accession no. Y09632), and because the
differences in amino acids were randomly scattered throughout the
sequence in structural rather than functional regions, we assumed it to
be the human homolog. Murine RB6K was identified as a Golgi-localized
KLP that, upon interaction with GTP-bound forms of Rab6, may be
involved in retrograde vesicular traffic between the Golgi apparatus
and the endoplasmic reticulum (6, 34). The human RB6K
showed differential levels of expression in cytokine-stimulated human umbilical vein endothelial cells (HUVEC) (11).
Downregulation of human RB6K upon cytokine stimulation was a late
response but did not correlate with changes in Golgi architecture.
Comparable to the gene encoding RB6K, GSPT1 and
RGS5, two genes involved in cell cycle initiation, were
found to be repressed, whereas the antiproliverative BTG1
gene was upregulated by tumor necrosis factor alpha (11).
Serum starvation, leading to entry of the cells into G0,
also resulted in downregulation of RB6K. In a recent work, the sequence
of the human gene RAB6KIFL, encoding RB6K, was described
(15). The gene is located on chromosome 5 in a region
containing several cell cycle genes, including cdc25. In adult tissue the mRNA for RB6K is almost exclusively expressed in
tissues with high proliferation rates (thymus, bone marrow, and
testis), which suggests a role in the cell cycle. Sequence conservation
within the extensive KLP family is mainly restricted to the catalytic
motor domain, which typically comprises approximately 350 amino acids
and is involved in microtubule binding and ATP hydrolysis (2,
10; L. Greene and S. Henikoff,
http://howard.fhcrc.org/kinesin/). The phylogenetic tree of
kinesins shows that both human and mouse RB6K are related to the MKLP-1
subfamily, based on homology within the motor domain (52% homology;
34% identity), whereas the C termini lack any discernible homology
(website of Greene and Henikoff). MKLP-1 has been reported to play a
role in assembly of the mitotic spindle and separation of spindle poles
during anaphase B based on its ability to cross-link and slide
antiparallel microtubuli past each other in vitro (22).
Like MKLP-1, RB6K has been shown to be able to bind microtubules both
with its N and C terminus (6). Knowledge on cargo binding
and control of motoractivity of KLPs is still rather limited.
Interestingly, regulation at the level of expression has been suggested
for MKLP-1, but no supporting data were provided (16).
Intracellular levels of CENP-E were reported to be regulated by steady
synthesis throughout the cell cycle, combined with stabilization during
the S and G2 phase and rapid proteolytic degradation at the
end of mitosis (3, 27). As cells proceed through the cell
cycle, activity of different members of the KLP family is required. The
interphase microtubule network supports motor-driven transport of,
e.g., vesicles and organelles by members of the KHC, Unc-104, and
KRP85/95 subfamilies. Motility events during M phase include centrosome separation, chromosome positioning on the metaphase plate, chromosome movement, force generation in the mitotic spindle, and, finally, cytokinesis. In these processes, members of the BimC, C-terminal, MKLP-1, and chromokinesin subfamilies have been implicated (2, 10). Regulation of KLP expression and function could therefore be an important means by which cells generate and regulate the required
transport capacity. The study presented here was undertaken to
establish a possible role of the novel human KLP RB6K in mitosis. We
provide evidence that RB6K is maximally expressed during M phase,
specifically localizes to the spindle midzone and midbody, and plays an
obligatory role during cytokinesis.
 |
MATERIALS AND METHODS |
Cell culture and immunofluorescence.
HeLa cells were
cultured in Iscove's modified minimal medium, supplemented with
penicillin (100 U/ml), streptomycin (100 U/ml) and 10% (vol/vol) fetal
bovine serum. EC-RF24 cells were cultured as described
(7). The medium was composed of equal parts of medium 199 and RPMI 1640, supplemented with 20% (vol/vol) heat-inactivated, pooled human serum; 2mM glutamine; and a 1:100 dilution of
antibiotic-antimycotic mix (final concentrations: penicillin, 100 U/ml;
streptomycin 100 U/ml; amphotericin B [Fungizone], 2.5 mg/ml, [Life
Technologies]).
Primary endothelial cells or EC-RF24 cells were grown on gelatin-coated
coverslips for at least 24 h. Cells were then washed with
serum-free medium and fixed for 10 min with methanol at room temperature. After fixation, cells were washed twice with
phosphate-buffered saline (PBS) and incubated for 1 h with rabbit
anti-murine RB6K antibodies (6) in PBS supplemented with
1% (wt/vol) bovine serum albumin (BSA) (Organon Teknika, Boxtel, The
Netherlands). Then, the coverslips were washed twice with PBS and
incubated for 1 h with affinity-purified Cy3-conjugated goat
anti-rabbit antibodies (Jackson Immunoresearch, West Grove, Pa.) in PBS
with 1% (wt/vol) BSA. Nuclei were counterstained for 10 min in a
dilution (100 ng/ml) of Hoechst 33258 in PBS. After washing three times in PBS, the coverslips were mounted in Mowiol (Calbiochem, La Jolla,
Calif.) and viewed with a Zeiss AxioplanII microscope. Confocal laser
scanning microscopy (CLSM) was performed using a Leica CLSM (Leica
Microsystems, Heidelberg, Germany) equipped with an argon-krypton
laser. Images were collected with a fixed setting for the laser power
(excitation; 568 nm; detection, 580 nm; dichroid mirror and a 610-nm
long-pass filter). A 40/1.30 NPL Fluotar objective was used together
with a pinhole setting, giving an optical thickness of approximately 1 µm, and images were adjusted to the full dynamic range of the system
(8 bit). The amount of Cy3 fluorescence as found in either the nucleus or the Golgi for individual cells in the confocal stack was determined with the Leica Qwin image analysis software (Leica Cambridge). The
values for each cell were corrected for background (the amount of
fluorescence outside of the cells) and photomultiplier settings.
In situ hybridization.
EC-RF24 cells were grown on
gelatin-coated glass slides for at least 24 h. Cells were washed
with serum-free medium and fixed in 4% (wt/vol) paraformaldehyde in
PBS. Slides were dehydrated by passing them successively through 30, 50, 75, 85, 95, and 100% ethanol. A riboprobe was synthesized by in
vitro transcription of a cDNA fragment spanning RB6K nucleotides 1190 to 1426 cloned in pGEM-4Z. The construct was linearized, and RNA was
synthesized with T7 RNA polymerase (Stratagene, La Jolla, Calif.),
according to the manufacturer's instructions, using
35S-UTP (Amersham, Amersham, United Kingdom) as label.
Unincorporated nucleotides were removed on a G-50 Sephadex spin column.
The riboprobe was added to and stored in hybridization mixture,
consisting of 40% (vol/vol) formamide, 8% (wt/vol) dextrane sulfate,
0.8× Denhardt's solution, 0.5 mg of yeast tRNA per ml, 4 mM EDTA, 16 mM Tris-HCl (pH 8.0), and 0.24 mol of NaCl per liter. In situ
hybridization was performed as described (35) with minor modifications. The slides with fixed cells were rehydrated and treated
for 10 min with 0.25% (wt/vol) acetic anhydride in 0.1 M
triethanolamnine (pH 8.0). After washing and dehydration, approximately 0.1 µCi per cm2 of fixed cells was added, and
hybridization was performed overnight at 50°C under a coverslip in a
moist chamber.
After hybridization, coverslips were removed in 5× SSC (1× SSC is
0.15 M NaCl plus 0.015 M sodium citrate)-10 mM dithiothreitol at
50°C (30 to 60 min), followed by a high-stringency wash for 30 min at
65°C in 50% (vt/vol) formamide-2× SSC-10 mM dithiothreitol. RNase
A (20 µg/ml) digestion was performed for 30 min at 37°C in 10 mM
Tris-HCl (pH 8.0)-5 mM EDTA-500 mM NaCl. The high stringency wash was
repeated and was followed by washing for 15 min in 2× SSC. After
dehydration, slides were prepared for autoradiography by dipping in a
1:0.4 (vt/vol) dilution of Ilford G5 photographic emulsion (Ilford,
Paramus, N.I.) with 2% glycerol. After an exposure of 4 weeks, slides
were developed in Kodak D19 and fixed in Kodak UNIFIX (Kodak-Pathe,
Paris, France). Finally, developed slides were counterstained with
hematoxylin and eosin.
Cell cycle arrest, synchronization, and flow cytometry.
Cells were arrested in different stages of the cell cycle by addition
of one of the following drugs to the medium: hydroxyurea (2 mM) or
nocodazole (0.17 mM). Twenty hours after addition of the drug, cells
were harvested for analysis. To synchronize cells, near-confluent
cultures were blocked at the G1/early S stage by addition
of hydroxyurea to the medium to a final concentration of 2 mM. After
20 h, cells were released from the block by washing them three
times with serum-free medium and growing them on complete medium. For
monitoring synchrony by flow cytometry, cells were briefly trypsinized,
pelleted by centrifugation at 200 × g, and resuspended
in 2 ml of PBS. While gently mixing on a vortex, ethanol was added to a
final concentration of 75%. Shortly before flow cytometry, propidium
iodide staining was performed. Cells were centrifuged at 200 × g and carefully resuspended in 0.25 ml of PBS. The actual
staining was performed during 30 min at 37°C in 1 ml of PBS
containing propidium iodide (0.025 mg/ml), 0.01% (wt/vol) saponin, and
RNase A (1 mg/ml). Subsequently, cell cycle distribution of the cells
was determined by analyzing their DNA content on a Becton Dickinson
FACSVantage SE flow cytometer. Data were analyzed using WinMDI 2.8 software (J. Trotter, Scripps Research Institute, La Jolla, Calif.).
RNA isolation and Northern blot analysis.
RNA was isolated
from synchronized cultures and analyzed by Northern blotting as
described previously (11). As probes we used
agarose-purified restriction fragments containing RB6K cDNA nucleotides
1712 to 2972 or cyclin B as an insert of approximately 1.5 kb from
IMAGE clone 549825 (17). The fragments were labeled to
high specific radioactivity using the random primers DNA labeling system (Life Technologies) and [
-32P]dATP (Redivue;
Amersham). Unincorporated nucleotides were removed by the Qiaquick
nucleotide removal kit (Qiagen, Hilden, Germany). Radioactivity was
quantified using a STORM device and ImageQuant software (Molecular
Dynamics, Sunnyvale, Calif.).
Cell lysates and immunoblotting.
Cells were washed in PBS
and lysed in a buffer containing 150 mM NaCl, 10 mmol of EDTA per
liter, 1% (vol/vol) Triton X-100, 25 mM Tris-HCl (pH 8.0), and a 1:10
dilution of a protease and phosphatase inhibitor cocktail (catalog no.
P8340; Sigma, St. Louis, Mo.). Insoluble material was pelleted by
centrifugation at 15,000 × g for 5 min. Protein
content of the lysate was measured using a micro-BCA protein assay
(Pierce, Rockford, III.). Fifteen micrograms of total protein was used
for electrophoresis on an 8% (wt/vol) sodium dodecyl
sulfate-polyacrylamide gel under reducing conditions (14)
and subsequently transferred to a 0.45-µm-pore-size nitrocellulose
membrane (Schleicher and Schuell, Dassel, Germany). Filters were
blocked by incubation with 2% (wt/vol) BSA in Tris-buffered saline
(TBS) and incubated with affinity-purified rabbit immunoglobulins (Ig)
raised against RB6K (6) diluted 1:1,000 in TBS containing 0.4% BSA. After three washes in TBS, the blot was developed using the
ProtoBlot II AP system (Promega, Madison, Wis.), according to the
manufacturer's instructions. As a control for equal loading the
filters were reprobed using antibodies against
-tubulin (Cedarlane, Hornby, Ontario, Canada) and an ECL Western blotting detection system
(Amersham Pharmacia Biotech, Uppsala, Sweden).
Microinjection.
Forty hours before microinjection, HeLa
cells were seeded onto microinjection grids. Twenty hours before
injection, cells were arrested in G1/S by addition of 2 mM
hydroxyurea. Needles were pulled using a PB-7 micropipette puller
(Narishage Co., Tokyo, Japan) and back-filled with affinity-purified
polyclonal antibody preparations (6) containing Ig (1.5 mg/ml) in 0.5× PBS. Cells were released from the block by transferring
the grids to fresh medium and injected into the cytoplasm with the
appropriate Ig preparation. After injection, cells were washed and
incubated in complete medium for 20 h to allow at least one
passage through the cell cycle. Subsequently, cells were washed in PBS,
fixed in methanol for 15 min at room temperature, and prepared for
inspection by immunofluorescence, using Cy3-conjugated anti-rabbit Ig
antibodies to detect injected cells.
RB6K-EGFP, RB6K 5'UTR, and RB6K-5' upstream sequences: isolation,
constructs, and functional analyses.
The 5' untranslated region
(5' UTR) of RB6K was extended by 5' rapid amplification of cDNA ends
(5'-RACE) using human placenta Marathon-Ready cDNA and the Marathon
cDNA amplification kit (Clontech, Palo Alto, Calif.). The nested
gene-specific primers used, corresponded to nucleotides 121 to 145 and
151 to 175 of the RB6K cDNA (GenBank accession no. AF070672).
PCR-amplification products were cloned in the pGEM-T vector (Promega)
for sequence analysis.
pRB6K-EGFP encodes RB6K with its C terminus fused in frame to EGFP
cDNA. A fragment of RB6K cDNA with an XmaI site replacing the stop codon was generated by PCR and cloned in frame with EGFP in
the pEGFP-N2 expression vector (Clontech). Genomic sequences 5'
upstream of the RB6K cDNA were PCR-amplified from the human PAC clone
DJ0309D19 (GB:AC004826) using Advantage cDNA polymerase mix (Clontech)
and synthetic oligonucleotides 5'ATCACCAGTGACCGGGGTACC3' and
5'ATGGAAGATCTCCGAAGACGTGCCACTTGCTCC3' as the forward and
reverse primer, respectively. The amplified fragment was cloned in the pGL3-Basic luciferase reporter plasmid (Promega) using KpnI
and BglII sites. Thus, the resulting plasmid, referred to as
pGL3 RB6K-5', comprises 7 nucleotides of the 5'UTR and 1,342 nucleotides upstream of the originally published RB6K cDNA.
Transfection of EC-RF24 cells (7) or HeLa cells with RB6K
constructs were performed using Superfect (Qiagen), essentially according to the manufacturer's instructions. pRB6K-EGFP-transfected cells were analyzed after fixation in 4% (wt/vol) paraformaldehyde in
PBS and mounted for microscopy as mentioned under "Cell culture and
immunofluorescence" above. Cells transfected with pGL3RB6K-5' were
analyzed for luciferase activity, using the luciferase assay system
(Promega). Transfection efficiencies in these experiments were
monitored by measuring
-galactosidase activity expressed from the
cotransfected pSV-
-Galactosidase vector (Promega) using the
Galacto-light chemiluminiscent reporter assay (Tropix, Bedford, Mass.).
Both assays were performed on a Luminat LB 9501 illuminometer.
Primer extension analysis was performed according to standard methods
(26), using 5 µg of total RNA isolated from ECRF-24 cells. Ten picomoles of a Cy5-5'-labeled synthetic oligonucleotide, 5'CCGAAGACGTGCCACTTGCTCCTCCTGGGATACTGGC3', was used to
initiate first-strand synthesis, and resulting products were analyzed
on a high-resolution gel on an ALF-express automatic
sequence analyzer (Amersham Pharmacia Biotech).
 |
RESULTS |
RB6K is a mitotic kinesin-like protein.
As the observation
that RB6K is repressed by cytokine incubation was initially made in
HUVEC, we chose to study its subcellular localization in either HUVEC
or EC-RF24, a cell line derived from HUVEC and previously characterized
as a reliable model for studying endothelial -cell functions
(7). The affinity-purified anti-mouse RB6K antibodies that
we used in this study were previously described (6). The
reactivity of these antibodies with human RB6K and specificity of the
antibodies in lysates of the cell types that we used in this study were
tested on a Western blot. For this purpose we performed in vitro
transcription-translation of human RB6K cDNA and Triton X-100 extracts
of EC-RF24 cells were made. Samples were electrophoresed under reducing
conditions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
and blotted onto nitrocellulose. Immunostaining with anti-mouse RB6K
antibodies detected a major band of approximately 98 kDa, the expected
size for human RB6K (SwissProt accession no. O95235) (Fig.
1). In the samples of the in vitro
transcription-translation material some bands with slightly lower
molecular weights were observed, probably resulting from leaky scanning
for translation initiation sites. An additional band at approximately
200 kDa is probably a remainder of the dimer conformation.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Reactivity of affinity-purified anti-mouseRB6K
polyclonal antibodies. Samples were electrophoresed under reducing
conditions on an 8% (wt/vol) polyacrylamide gel and transferred to a
Protran membrane, which was subsequently probed with anti-RB6K
antibodies. Lane 1, product of coupled in vitro
transcription-translation: reticulocyte lysate programmed with hRB6K
cDNA cloned in pGEM4Z; lane 2, control, reticulocyte lysate without
plasmid added; lane 3, lysate of EC-RF24 cells. Molecular weight
markers (in thousands) are indicated at the right side of the figure.
|
|
Next, we investigated expression of RB6K by immunofluorescence
microscopy. The vast majority of the cells showed a perinuclear stain
that has previously been localized to the medial Golgi compartment by
colocalization with CTR 433 (6). Remarkably, in a minor part of the cell population different staining patterns with a relatively high fluorescence intensity were observed. Costaining of DNA
with the Hoechst 33258 dye revealed that these patterns were associated
with various stages of mitosis (Fig. 2A).
A higher resolution localization during cell cycle progression is shown and discussed in relation to Fig. 6 (vide infra). Strikingly, the
appearance of fluorescence signal in prophase nuclei was apparently accompanied neither by loss of signal from the Golgi apparatus nor by
loss of integrity of the Golgi structure, prompting us to make a
quantitative assessment of the fluorescence at these sites, using CLSM.
As RB6K fluorescence in nuclei of prophase cells and in Golgi
structures in interphase cells was spatially well defined due to
compartmentalization (cf. Fig. 2C panels 1 and 2), we chose to use
these compartments for further quantitative analysis. The mean integral
fluorescence (standard deviation) measured in prophase nuclei, 1,244 (322) arbitrary units, was ~1 order of magnitude higher than that in
interphase Golgi, 117 (60) arbitrary units. To further
substantiate the nuclear targeting of RB6K, transfection experiments
were performed. Expression from a constitutive promoter of native,
untagged human RB6K resulted in the accumulation of the excess protein
in the nucleus as detected by anti-RB6K antibodies and a fluorescein
isothiocyanate (FITC) conjugate. (Fig. 2C, panel 3). As a second
approach, independent of the use of antibodies, we transfected EC-RF24
cells with a construct in which the C -terminus of RB6K, devoid of its
stop codon, was fused in -frame to enhanced green fluorescent protein (EGFP) in the pEGFP-N2 vector. Again, the EGFP-tagged RB6K localized predominantly to the nucleus in all transfected cells (Fig. 2C, panels
4 and 5). Thus, nuclear targeting of endogenous RB6K in prophase cells
was confirmed by two independent approaches. Typically, the nuclei
contain several nucleoli, indicating that the cells are indeed in
G1 phase (Fig. 2C, panels 3 and 5). Not only do these
observations confirm targeting of RB6K to the nucleus, they also imply
that when expression is driven from a constitutive promoter, entrance
of (GFP-tagged) RB6K into the nucleus is independent from cell cycle
progression. Thus, it is conceivable that cell cycle-induced increase
of synthesis of the endogenous RB6K in prophase cells saturates the
Golgi localization machinery and leads to the observed nuclear
localization.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of RB6K protein and mRNA during the cell
cycle in nonsynchronously growing cells. (A) Immunofluorescence of
RB6K. Cells were fixed with methanol and incubated with anti-RB6K
polyclonal antibodies followed by Cy3-conjugated goat anti-rabbit Ig
(red). DNA was stained using Hoechst 33258 (blue). (B) In situ
hybridization of paraformaldehyde-fixed EC-RF24 cells with an RB6K
antisense riboprobe. (C) Details of subcellular localization. Panels 1 and 2, 1-µm-thick CLSM sections of RB6K immunofluorescence in
interphase (1) and prophase (2) cells; panel
3, fluorescence of EC-RF24 cells transiently transfected with RB6K cDNA
and stained with anti-RB6K polyclonal antibodies followed by incubation
with FITC-conjugated goat anti-rabbit Ig (green); panel 4, fluorescence
of EC-RF24 cells transiently transfected with RB6K-EGFP cDNA (in panels
3 and 4, arrows indicate localization of RB6K to the microtubuli);
panel 5, fluorescence of EC-RF24 cells transiently transfected with
RB6K-EGFP cDNA (the Golgi apparatus is stained using antibodies against
Giantin and a Cy3 conjugate [red]). Bars: A, B, and C, panels 1 and
2, 15 µm; C, panels 3 to 5, 20 µm.
|
|
In cells showing overexpression of either native or GFP-tagged RB6K,
fluorescence also localized to the microtubuli, which then obtained an
abnormal, bundled appearance (Fig. 2C, panels 3 and 4 [arrows]).
Cells constitutively overexpressing RB6K-EGFP did not enter mitosis and
died within 48 h after transfection. Essentially the same
observations were made using the native, untagged, construct, whereas
cells transfected with the nonfused EGFP construct did maintain their
proliferative capacity (data not shown). These results suggest that the
constitutive overexpression of RB6K, either native or as a moiety of an
EGFP-tagged fusion protein, is detrimental to the cells. No
fluorescence of de novo-synthesized RB6K on the Golgi was observed,
neither for wild-type nor for EGFP-tagged RB6K, which may be due to
high levels of fluorescence of RB6K(-EGFP), in the nucleus and on the
microtubules, that hamper detection of the signal of a much smaller
pool of the protein localizing to the Golgi. Integrity of the Golgi
during RB6K overexpression was substantiated by costaining with the
Golgi-specific marker Giantin (Fig. 2C, panel 5 [red stain]).
RB6K expression is upregulated in mitosis.
In a culture of
growing cells, at any time point, a minor fraction of the population
will be in mitosis. In fact, the relative number of cells in a certain
stage of the cell cycle can be considered to reflect the time span in
which individual cells pass that particular stage of the cell cycle. As
the duration of M phase is short relative to interphase, mitotic cells
are underrepresented in nonsynchronized cultures, hampering analysis of
expression regulation around M phase. Here, we used two different
approaches to further study cell cycle dependency of RB6K expression.
First, in situ hybridization of nonsynchronized EC-RF24 cells with an
antisense RB6K riboprobe was performed to examine mRNA expression
related to different stages of the cell cycle and, more specifically,
throughout different stages of mitosis. Indeed, expression of RB6K mRNA
was almost exclusively observed in cells that could be characterized as
mitotic cells, based on hematoxylin and eosin counterstaining that was applied after visualizing the in situ hybridization signals by autoradiography (Fig. 2B). Control hybridizations run in parallel with
an antisense probe for the constitutively expressed vWF mRNA showed no
changes in mRNA signal during the cell cycle, thus indicating that the
observed changes for RB6K were indeed cell cycle-dependent and
excluding that the typical change in morphology of mitotic cells, due
to partial detachment from the matrix, had influenced interpretation
(data not shown).
Second, EC-RF24 cells were synchronized by a hydroxyurea block and
subsequent release in fresh medium. With 2-hour intervals, cells were
harvested for further analysis. For each timepoint, three parameters
were analyzed. First, synchrony of the cell population was monitored by
flow cytometric analysis of propidium iodide-stained cells. Second,
lysates were prepared and used for making Western blots that were
subsequently stained with anti-RB6K antiserum. Third, RNA was isolated
and analyzed on Northern blot by hybridization with an hRB6K probe and,
as a control, a cyclin B probe.
Arrest of cultures by incubation with hydroxyurea, an inhibitor of DNA
replication, caused an efficient, reversible arrest at late
G1/early S phase. Upon release, the degree of
synchronization was sufficient to allow reliable analysis of regulation
of RB6K mRNA and protein in the subsequent S and G2/M
phases. Two hours after release, the majority of the cells were in S
phase, and they subsequently shifted to G2/M phase at
6 h. The net distribution over the phases did not change during
the next 2-h period, which we interpret as a reflection of the duration
of the G2 phase. Then, at 10 h after release, a strong
shift from G2/M to G1/G0 occurred,
indicating that at this point a maximum in the number of M-phase cells
was reached. At 14 h, 86% of the cells again entered the
G1 phase which lasted at least another 7 h, leading to
loss of synchronization (Fig. 3A).
Changes in RB6K protein levels after release from the
G1/early S stage were assessed by analyzing equal amounts
of total cellular protein, isolated at 2-h intervals, on a Western blot
with an affinity-purified anti-RB6K preparation.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of RB6K mRNA and protein in
synchronized cultures. (A) Synchrony of cultures. Cells were
synchronized as described in Materials and Methods. During progression
through the cell cycle, cultures were harvested at 2-h intervals and
the distribution of the cells over the stages of the cell cycle was
determined by analyzing DNA contents using flow cytometry. The
x axis shows time in hours after release from the
hydroxyurea block. Bars: white, G2/M population; black, S
population; grey, G1/G0 population. (B) RB6K
protein expression. In parallel with the experiment shown in panel A,
cell extracts were prepared and total protein was determined. Equal
amounts were electrophoresed on an 8% (wt/vol) polyacrylamide gel
under denaturing conditions and transferred to a Protran membrane,
which was subsequently probed with anti-RB6K antibodies. As a control
for equal loading the blot was reprobed with antibodies against
-tubulin. (C) RB6K mRNA levels and comparison to cyclin B. In
parallel with the experiment shown in panel A, RNA was isolated. Ten
micrograms of total RNA was denatured, electrophoresed, and blotted to
Hybond-N filters. Filters were hybridized with radiolabeled probes for
RB6K and cyclin B. After autoradiography and quantification, blots were
stripped and reprobed for 28S RNA to allow normalization of the
signals. The x axis shows time in hours after release from
the hydroxyurea block. Bars: white, RB6K; black, cyclin B. n.s.,
nonsynchronized.
|
|
Combination of the data from the Western blot with flow cytometric
analyses shows that a slight increase of the RB6K protein level
occurred at 6 and 8 h after release when the majority of the cells
passed through G2. Then, at 10 h after release, the protein level showed a further increase when cells passed M phase. In
early G1, at 12 and 14 h after release, a gradual decrease of protein level was observed. During the subsequent G1
phase there is a further decline of RB6K to a level comparable to that at the time of release from the hydroxyurea block, as can be inferred from the control nonsynchronized cultures that contain mainly cells
randomly distributed over the G1 phase (Fig. 3A and B). The
level of RB6K mRNA was measured at intervals of 2 h after release from
the hydroxyurea block by probing a Northern blot of total RNA, isolated
at the respective time points, with an RB6K cDNA probe. In order to
show the validity of synchronization of EC-RF24 cultures and subsequent
mRNA quantification as a method to assess cell cycle dependency of RB6K
expression, we hybridized identical blots with a cyclin B cDNA probe.
Using a comparable approach for synchronized HeLa cells, a fourfold
increase of the cyclin B mRNA in G2/M populations has been
reported (23). Obviously, the levels of RB6K and cyclin B
mRNA showed nearly identical temporal changes in the synchronized
cultures. After 20 h of hydroxyurea incubation, signal levels of both
mRNAs were at a minimum. Upon release from the block, the levels of
both mRNAs increased, showed a maximum at 10 h after release, and
subsequently started to decrease at 12 and 14 h after release, the
decline for RB6K mRNA being somewhat slower than that for cyclin B mRNA
(Fig. 3C). Thus, the maximal mRNA levels for both RB6K and cyclin B
occur at the time point (10 h) when the synchronized cultures are
maximally enriched in cells that are in or near M phase as can be
deduced from the large flux of cells from the G2/M to the
G1/G0 population that was observed in flow cytometry.
Structure and promoter activity of the 5' upstream region of the
RB6K gene.
To investigate whether an increased transcriptional
activity of the RB6K promoter contributes to the observed increase in RB6K mRNA levels in M phase, we isolated the 5' upstream sequences of
the RB6K gene. The 5'UTR of the RB6K cDNA (GenBank accession no.
AF070672) comprised only 27 nucleotides and was therefore unlikely to
represent the complete 5'UTR of the transcript. Therefore, we completed
the cDNA by 5'-RACE. The longest transcript we obtained extended the
5'UTR with 64 nucleotides. BLAST searches on the high-throughput
genomic sequence database revealed that RB6K cDNA sequences matched to
a contig from PAC DJ0309D19, (GenBank accession no. AC004826). This
contig comprises 17.3 kb upstream of our cDNA; therefore, it is
conceivable that it contains RB6K promoter sequences.
By analysis of RNA from EC-RF24 cells using a primer extension assay,
two potential transcription start sites were mapped respectively 25 and
38 nucleotides upstream of the longest transcript that we isolated in
5'-RACE (Fig. 4A and C). These initiation sites will be referred to as position 1 and
13, respectively.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 4.
RB6K 5' upstream sequence. (A) The sequence shown
corresponds to nucleotides 102787 to 103454 from GenBank accession no.
AC004826. Indicated are transcription initiation sites (horizontal
arrows), the longest cDNA isolated by 5'-RACE (vertical arrow), the
open reading frame (in boldface type and underlined), and the CDE-CHR
element (box). (B) Alignment of CDE-CHR element sequences from cell
cycle-regulated genes. The consensus sequence as originally described
for cdc2, cyclin A, and cdc25C (35) is shown in boxes. (C)
Primer extension mapping of the transcription initiation site. Sequence
analysis and primer extention assay were performed using a Cy5-labeled
oligonucleotide primer. The reaction products were analyzed on an
ALF-express sequence analyzer. Lanes A, C, G, and T contain
sequence ladder. Lanes and + contain primer extension
reaction mixtures using 5 µg of total RNA isolated from EC-RF24 cells
without ( ) and with (+) reverse transcriptase added.
|
|
To test the upstream sequences for cell cycle-dependent promoter
activity, we placed a fragment containing nucleotides
1253 to +96
into a luciferase reporter vector, pGL3-basic, and transfected the
construct, pGL3RB6K-5', into HeLa cells. As controls, the pGL3-basic
vector or the pGL3 vector containing the strong, constitutive cytomegalovirus promoter was transfected. In all transfections, a
pSV-
-galactosidase vector was cotransfected to allow for
normalization. Twenty-four hours after transfection, cells were treated
for 20 h with hydroxyurea or nocodazole to arrest them in late
G1/early S phase and M phase, respectively. Cells were then
either lysed and used for determination of luciferase activity or
prepared for flow-cytometric analysis of the DNA content. As the
half-life of luciferase protein is approximately 3 h
(31), this approach allowed us to specifically compare the
promoter activities of G1/S- and M-phase cells. First, the
luciferase activity measured in extracts of pGL3RB6K-5'-transfected
cells was typically found to be increased by almost 3 orders of
magnitude compared to the pGL3-transfected controls. Second, as shown
in Fig. 5, the luciferase expression
driven by the cytomegalovirus promoter did not vary between M-phase-and
G1/S-phase-arrested cells, whereas expression driven by the
RB6K promoter in M-phase-arrested cells showed a 3.5-fold increase
compared to G1/S-phase cells. Taken together, these
observations show that a sequence spanning nucleotides
1253 to +96
relative to the RB6K transcription start not only provides promoter
activity but also confers cell cycle-dependent variation to the
expression of the luciferase reporter gene and is therefore likely to
contain sequences responsible for the observed cell cycle-dependent
expression of RB6K in cultured cells (Fig. 4B).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
Cell cycle dependency of activity of the RB6K promoter.
(A) HeLa cells were transiently cotransfected with the pGL3RB6K-5'- and
pSV- -galactosidase plasmids. Control cotransfections were performed
with the pGL3 basic and pGL3CMV plasmids. Twenty-four hours after
transfection, cultures were cell cycle arrested for 20 h as described
in Materials and Methods. Cells were then harvested, and the
distribution of the cells over the stages of the cell cycle was
determined by flow cytometry. Bars: white, G2/M population;
black, S population; grey, G1/G0 population.
(B) In paralel with A, cells were lysed and luciferase and
-galactosidase activities were measured in the lysates. Luciferase
values were normalized for -galactosidase activities and are given
relative to luciferase activity measured in G1/S
(hydroxyurea)-arrested cells. Bars: grey, G1/S
(hydroxyurea)-arrested cells; white, G2/M
(nocodazole)-arrested cells.
|
|
RB6K plays a crucial role in cytokinesis.
To further delineate
the mechanistic function of RB6K, a detailed confocal imaging was
performed of cells, at various stages of mitosis, costained with an
anti-RB6K antibody (red) and an antitubulin antibody (green). It was
observed that a dominant nuclear staining appears at prophase, while in
metaphase the staining becomes dispersed throughout the cytoplasm
surrounding the mitotic spindle. In the subsequent stages of anaphase
and telophase, concomittant with the onset of cytokinesis, RB6K
accumulates throughout the equatorial region of the cell, thus
colocalizing with the spindle midzone and the area of the contracting
cleavage furrow. In the end stage of cytokinesis, RB6K becomes sharply
concentrated on the midbodies (Fig. 6A).
RB6K was previously shown to interact with the GTPase Rab6 in
interphase cells (6). Figure 6B shows HeLa cells stably
expressing Rab6-GFP (34) in early anaphase where RB6K
(red) becomes concentrated in the equatorial zone, whereas Rab6-GFP
(green) is dispersed throughout the cytoplasm, localizing to dispersed
Golgi fragments (28). Cells in telophase show a clear
concentration of RB6K on the forming cytoplasmic bridge, and only a
small fraction of RB6K colocalizes with Rab6 at the centrosomes of the
two daughter cells (Fig. 6B [arrows]), where the Golgi stacks are
being re-formed. Rab6 also localizes adjacent to the cytoplasmic bridge
(Fig. 6B) as do other Golgi markers, such as mannosidase II or
galactosyl-transferase (data not shown). From the above data, it can be
inferred that most of the RB6K in M-phase cells shows a behavior that
is likely not compatible with a role related to the Golgi apparatus.


View larger version (78K):
[in this window]
[in a new window]
|
FIG. 6.
(A) Subcellular localization of RB6K during
the cell cycle. Endogenous RB6K was detected in EC-RF24 cells using an
affinity-purified anti-RB6K preparation and Cy3-conjugated goat
anti-rabbit Ig (red). Microtubuli were stained using anti- -tubulin
antibodies and a FITC-labeled conjugate (green). Shown is a series of
the subsequent stages of the cell cycle as brightest point projections
of confocal sections taken every 1.0 µm. Bar, 20 µm. (B)
Subcellular localization of RB6K during the cell cycle. Endogenous RB6K
was detected in HeLa cells stably expressing Rab6-GFP (35)
using an affinity-purified anti-RB6K preparation and Texas
red-conjugated goat anti-rabbit Ig (red).
|
|
To test the functional significance of the observed subcellular
localization of RB6K, we performed microinjection of synchronized cell
cultures with anti-RB6K antibodies. For these studies we used HeLa
cells as the passage of these cells through the cell cycle after
control injections with buffer or inert antibody preparations was less
affected than that of EC-RF24 cells. Control immunofluorescence microscopy showed that the RB6K expression patterns in HeLa cells during the cell cycle were identical to those observed in EC-RF24 cells
(Fig. 6B). Cells were grown on grids to facilitate evaluation of the
effects of injection. Twenty hours after seeding, near-confluent cultures were incubated for 20 h with 2 mM hydroxyurea. Cells were
then washed to completely remove the hydroxyurea, released in fresh
medium, and injected in the cytoplasm with an affinity-purified polyclonal anti-RB6K antibody preparation. As a control, cells were
injected with identical amounts of affinity-purified polyclonal antibodies against von Willebrand factor, a secretory protein that does
not have a role in the cell cycle. The injections were either clustered
(all cells in one grid, approximately 100 cells) or scattered (9 cells
per grid), allowing the examination of the phenotype and a possible
effect on mitosis, respectively. Following microinjection, the cells
were grown for another 20 h, in principle allowing at least one
passage through the cell cycle. The grids were then fixed and the
microinjected cells were detected by staining the injected antibodies
with a Cy3-coupled anti-rabbit Ig preparation. Using immunofluorescence
microscopy the grids were then screened for the following categories of
injected cells: (i) single cells that were mononucleate and therefore
had not passed mitosis, (ii) pairs of cells that were mononucleate,
indicating successful completion of mitosis, and (iii) any phenotype
indicative for arrest in M phase. Figure
7A shows that injection of anti-RB6K
antibodies specifically and reproducibly results in cells showing a
double nucleus and an increased cell size (Fig. 7B). This phenotype
shows that injection of anti-RB6K antibodies results in a failure of cytokinesis. Mitosis is not disturbed by the microinjected anti-RB6K antibodies before completion of anaphase A, as can be inferred from the
presence of two apparently normal nuclei. RB6K-injected cells that fail
to undergo cytokinesis typically show close spacing of the two nuclei
and an apparent lack of a functional cleavage furrow, suggesting that
the RB6K antibodies interfere with processes during anaphase B or
cytokinesis that are essential for completion of M phase.


View larger version (64K):
[in this window]
[in a new window]
|
FIG. 7.
Effects of microinjection of anti-RB6K antibodies on the
cell cycle. HeLa cells were synchronized and injected as described in
Materials and Methods with either affinity-purified anti-RB6K
antibodies or, as a negative control, anti-von Willebrand factor
antibodies (vWF) at identical concentrations. Injected cells were
visualized after 20 h by immunofluorescent staining of the
injected antibodies. (A) Result of four independent injection
procedures. In each procedure 9 cells per grid were injected with a
total of approximately 100 cells (scattered protocol). In the injected
population, frequencies of occurrence of the following events were
counted and expressed as percentage of the total number of
immunofluorescence-positive cells: (i) single cells, no signs of
mitosis (black bars); (ii) doubled cells, after mitosis (white bars);
(iii) cells containing double nuclei, failure of cytokinesis (light
grey bars); (iv) cells in any stage of mitosis (dark grey bars). (B)
Result of clustered injection with anti-von Willebrand factor
polyclonal antibodies (panel 1) and affinity-purified anti-RB6K
polyclonal antibodies (panel 2). Bar, 20 µm.
|
|
 |
DISCUSSION |
The novel human protein RB6K is shown to be a mitotic KLP that has
a distinct function in the final stages of the cell cycle. Its
expression is highly regulated to peak during M phase, with low
intracellular mRNA and protein concentrations during G1 and S phase (Fig. 2 and 3). This is highly similar to the expression kinetics of cyclin B, a protein of which the expression has been extensively studied in relation to regulation of the cell cycle (23, 24). The observed fluctuations of the mRNA levels are at least in part based on cell cycle-dependent promoter regulation (Fig. 4 and 5). Similar to the cell cycle-regulated promoters of
cdc25C, cyclin A, cdc2, and plk genes (18,
32, 37), the RB6K promoter contains a CDE-CHR element (Fig. 4B)
that is known to induce repression of transcription during
G1 (32, 37). In contrast to typical cell
cycle-regulatory proteins of which the intracellular concentrations are
regulated by ubiquitin-mediated proteolysis (12, 13, 36),
RB6K protein shows a rather gradual decline that continues in early
G1 (Fig. 3B). Indeed, no consensus sequences for
ubiquitination were found, and no changes in molecular weight
indicative of ubiquitination were observed (Fig. 3B and data not
shown). The importance of correctly tuned de novo synthesis and
proteolysis of RB6K is illustrated by the finding that constitutive overexpression of RB6K in interphase cells leads to cell death, probably caused by a bundling of interphase microtubuli (Fig. 2C,
panels 3 and 4). This microtubule binding was not observed for the
endogenous RB6K in interphase cells. Therefore, incorrectly regulated
expression of RB6K might directly interfere with interphase microtubule
function. The observed tight expression regulation of RB6K during the
cell cycle represents a means by which the cell can adapt its transport
capacity to the specific requirements of the various stages of the cell cycle.
Human RB6K showed 91% homology and 86% identity to mouse RB6K
(11) and was therefore considered to be its human
equivalent. Murine RB6K was initially isolated and characterized as a
protein tightly binding the Golgi-localized GTPase Rab6. Overexpression in HeLa cells of GFP-tagged murine RB6K caused dispersion of the Golgi
apparatus, suggesting a role for murine RB6K in Golgi dynamics (6). Like murine RB6K, the human RB6K is able to bind Rab6 in a two-hybrid assay (A. Echard and B. Goud, unpublished results) and
is localized to the Golgi apparatus in interphase cells (Fig. 6A). Our
study, however, also covered M phase, during which we found RB6K to be
expressed at levels considerably higher than that in interphase cells.
Concomitantly, RB6K no longer localizes exclusively to the Golgi but
appears in the prophase nucleus. This localization is in good agreement
with a PSORT-II prediction (60.9% nuclear versus 17.4% cytoplasmic).
For MKLP-1, it was suggested that sequestration in the nucleus prevents
undesirable binding to the interphase microtubuli and only after
dispersal of the nuclear envelope after prophase the KLP is released
and allowed to interact with the then-formed mitotic spindle
(21). For RB6K, an explanation should concern both the
function of RB6K in interphase Golgi and the function in M phase. The
relatively small RB6K pool on the interphase Golgi is involved in
retrograde transport and is regulated by the effector GTPase Rab6.
However, Fig. 6B shows that localization of most of the M phase-induced
RB6K is independent of Rab6, which seemingly contradicts a function
related to the mitotic Golgi apparatus (28). Rather,
taking into consideration the fact that several proteins that are
critically involved in cytokinesis initially localize to the prophase
nucleus (29, 30), it can be hypothesized that localization
to the nucleus of the RB6K pool that is synthesized at the onset of M
phase is instrumental in binding cargo and/or modulation of RB6K
function by regulatory proteins. This hypothesis will require an
unbiased search for proteins that interact with RB6K in various stages of the cell cycle.
Concomitant with the onset of cytokinesis during anaphase, RB6K
concentrates in the equatorial zone of the cell. Consistent with this
localization, effects of interference with RB6K function by injection
of specific antibodies are restricted to cytokinesis. Phylogenetic
analysis of the motor domain sequences has been used to classify most
of the KLPs into 8 to 10 subfamilies that, in addition to having
related motor domain sequences, usually have a related domain structure
and show similarity with regard to motility behavior and cellular
functions (2, 10; website of Greene and Henikoff).
Detailed information on the function of members of the MKLP1 family has
been derived from mutant analysis in the case of the Drosophila
melanogaster gene pavarotti (1) and the
C. elegans gene zen-4 (25) or from
antibody microinjection studies of the MKLP-1 (CHO1 antigen) protein in
mammalian cells (21). When antibodies raised against the
CHO1 protein are injected in mammalian cells before onset of anaphase,
cells are arrested in metaphase, showing partially impaired congression
of chromosomes and a disorganized spindle, indicating that the
antibodies interfere in a stage preceding anaphase A. Injection after
onset of anaphase has little effect on completion of cell division
(21). In contrast, RB6K antibody microinjection does not
affect mitosis before anaphase B, indicating that its function
temporally follows that of MKLP-1 rather than being redundant with it.
As RB6K, like the other MKLP-1 family members, has the ability to
cross-link antiparallel microtubules, our microinjection results might
indicate interference with dynamics of midzone microtubules in anaphase
B. It should be noted, however, that RB6K is only distantly related to
MKLP-1, PAV-KLP, and ZEN-4, as sequence homology is confined to the
motor domain.
Presently, the combined databases do not contain KLPs from other
species that could be considered to be functional equivalents of human
and mouse RB6K by showing even distant homology to the C-terminal 350 residues. Still, the phenotype resulting from microinjection of
anti-RB6K antibodies is comparable to that of zen-4, polo, and pav mutants (1, 4, 25), suggesting that
RB6K may fulfill a separate but comparable role in cytokinesis. In
mammalian cells, Polo-like kinase has been shown to colocalize and
interact with MKLP-1 in vivo and to phosphorylate MKLP-1 in vitro
(16). ZEN-4 and PAV-KLP, show 50 and 58% overall homology
to MKLP-1, including the C terminus that is supposed to be involved in
cargo binding. In both cases, it was speculated that, in addition to a
role in spindle function, the KLPs may also contribute to cytokinesis by transporting Polo-like kinase and Polo, respectively (1, 25). Indeed, several studies, both in Drosophila and
in cultured cells (5, 8), have established that the
spindle midzone provides stimuli for cytokinesis. Although the
underlying molecular mechanisms are only partially understood,
relocation of several proteins along microtubuli seems to be involved
(5, 33). Based on these observations, we can speculate
that RB6K is possibly involved in transport of one of the many
essential components of the cleavage furrow that are currently emerging
(4, 9, 19, 29, 30).
The failure of cytokinesis that we observed after anti-RB6K antibody
microinjection is compatible with both a function for RB6K on the
spindle midzone and a function more related to the cleavage furrow,
since both processes are intimately linked, as evidenced by Giansanti
et al. (8). These authors showed the cooperative
interaction between the contractile ring and the spindle midzone, and
if either of these stuctures is perturbed, the assembly of the other is
disrupted. A more detailed understanding of RB6K function therefore
requires knowledge of RB6K interacting proteins. At present, our data
provide evidence for a tight cell cycle-regulated expression of RB6K
and show that it is an essential, nonredundant component of the cell
cycle that is required for successful completion of cytokinesis.
 |
ACKNOWLEDGMENTS |
We thank the members of the CMO department of the Academic
Medical Center, University of Amsterdam, for their assistance with flow
cytometric analyses.
This work was supported by Molecular Cardiology grant M93.007 from the
Netherlands Heart Foundation, The Hague.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, Academic Medical Center K1-160, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands. Phone: 31-20-5665124. Fax: 31-20-6915519. E-mail: a.j.horrevoets{at}amc.uva.nl.
 |
REFERENCES |
| 1.
|
Adams, R. R.,
A. A. M. Tavares,
A. Salzberg,
H. J. Bellen, and D. M. Glover.
1998.
pavarotti encodes a kinesin-like protein required to organise the central spindle and contractile ring for cytokinesis.
Genes Dev.
12:1483-1494[Abstract/Free Full Text].
|
| 2.
|
Barton, N. R., and L. S. B. Goldstein.
1996.
Going mobile: microtubule motors and chromosome segregation.
Proc. Natl. Acad. Sci. USA
93:1735-1742[Abstract/Free Full Text].
|
| 3.
|
Brown, K. D.,
R. M. R. Coulson,
T. J. Yen, and D. W. Cleveland.
1994.
Cyclin-like accumulation and loss of the putative kinetochore motor CENP-E results from coupling continuous synthesis with specific degradation at the end of mitosis.
J. Cell Biol.
125:1303-1312[Abstract/Free Full Text].
|
| 4.
|
Carmena, M.,
M. G. Riparbelli,
G. Minestrini,
A. M. Tavares,
R. Adams,
G. Callaini, and D. M. Glover.
1998.
Drosophila polo kinase is required for cytokinesis.
J. Cell Biol.
143:659-671[Abstract/Free Full Text].
|
| 5.
|
Cao, L. G., and Y. L. Wang.
1996.
Signals from the spindle midzone are required for the stimulation of cytokinesis in cultured epithelial cells.
Mol. Biol. Cell
7:225-232[Abstract].
|
| 6.
|
Echard, A.,
F. Jollivet,
O. Martinez,
J.-J. Lacapère,
A. Rouselet,
I. Janoueix-Lerosey, and B. Goud.
1998.
Interaction of a Golgi-associated kinesin-like protein with Rab6.
Science
279:580-585[Abstract/Free Full Text].
|
| 7.
|
Fontijn, R. D.,
C. Hop,
H.-J. Brinkman,
R. Slater,
A. Westerveld,
J. A. van Mourik, and H. Pannekoek.
1995.
Maintenance of vascular endothelial cell-specific properties after immortalisation with an amphotrophic replication-deficient retrovirus containing human papillomavirus E6/E7 DNA.
Exp. Cell Res.
216:199-207[CrossRef][Medline].
|
| 8.
|
Giansanti, M. G.,
S. Bonaccorsi,
B. Williams,
E. V. Williams,
C. Santolamazza,
M. L. Goldberg, and M. Gatti.
1998.
Cooperative interactions between the central spindle and the contractile ring during Drosophila cytokinesis.
Genes Dev.
12:396-410[Abstract/Free Full Text].
|
| 9.
|
Glover, D. M.,
I. M. Hagan, and A. A. M. Tavares.
1998.
Polo-like kinases: a team that plays throughout mitosis.
Genes Dev.
12:3777-3787[Free Full Text].
|
| 10.
|
Goldstein, L. S. B., and A. V. Philp.
1999.
The road less traveled: emerging principles of kinesin motor utilisation.
Annu. Rev. Cell Dev. Biol.
15:141-183[CrossRef][Medline].
|
| 11.
|
Horrevoets, A. J. G.,
R. D. Fontijn,
A. J. van Zonneveld,
C. M. de Vries,
J. W. ten Cate, and H. Pannekoek.
1999.
Vascular endothelial cells that are responsive to tumor necrosis factor- in vitro are expressed in atherosclerotic lesions, including inhibtor of apoptosis protein-1, stannin and two novel genes.
Blood
93:3418-3431[Abstract/Free Full Text].
|
| 12.
|
King, R. W.,
R. J. Deshaies,
J. M. Peters, and M. W. Kirschner.
1996.
How proteolysis drives the cell cycle.
Science
274:1652-1659[Abstract/Free Full Text].
|
| 13.
|
Koepp, D. M.,
J. W. Harper, and S. J. Elledge.
1999.
How the cyclin became a cyclin: regulated proteolysis in the cell cycle.
Cell
97:431-434[CrossRef][Medline].
|
| 14.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during tht assembly of the head of bacteriophage T4.
Nature
227:680-685[CrossRef][Medline].
|
| 15.
|
Lai, F.,
A. A. Fernald,
N. Zhao, and M. M. Le Beau.
2000.
cDNA cloning, expression pattern, genomic structure and chromosomal localisation of RAB6KIFL, a human kinesin-like gene.
Gene
248:117-125[CrossRef][Medline].
|
| 16.
|
Lee, K. S.,
Y.-L. O. Yuan,
R. Kuriyama, and R. L. Erikson.
1995.
PLK is an M-phase specific protein kinase and interacts with a kinesin-like protein, CHO/MKLP-1.
Mol. Cell. Biol.
15:7143-7151[Abstract].
|
| 17.
|
Lennon, G.,
C. Auffray,
M. Polymeropoulos, and M. B. Soares.
1996.
The I.M.A.G.E. consortium: an integrated molecular analysis of genomes and their expression.
Genomics
33:151-152[CrossRef][Medline].
|
| 18.
|
Lucibello, F. C.,
M. Truss,
J. Zwicker,
F. Ehlert,
M. Beato, and R. Müller.
1995.
Periodic cdc25C transcription is mediated by a novel cell cycle-regulated repressor element (CDE).
EMBO J.
14:132-142[Medline].
|
| 19.
|
Madaule, P.,
M. Eda,
N. Watanabe,
K. Fujisawa,
T. Matsuoka,
H. Bito,
T. Ishizaki, and S. Narumiya.
1998.
Role of citron kinase as a target of the small GTPase Rho in cytokinesis.
Nature
394:491-494[CrossRef][Medline].
|
| 20.
|
Moore, J. D., and S. A. Endow.
1996.
Kinesin proteins: a phylum of motors for microtubule-based mobility.
Bioessays
18:207-219[CrossRef][Medline].
|
| 21.
|
Nislow, C.,
C. Sellito,
R. Kuriyama, and J. R. McIntosh.
1990.
A monoclonal antibody to a mitotic microtubule-associated protein blocks mitotic progression.
J. Cell Biol.
111:511-522[Abstract/Free Full Text].
|
| 22.
|
Nislow, C.,
V. A. Lombillo,
R. Kuriyama, and J. R. McIntosh.
1992.
A plus-end-directed motor enzyme that moves antiparallel microtubules in vitro localizes to the interzone of mitotic spindles.
Nature
359:543-547[CrossRef][Medline].
|
| 23.
|
Pines, J., and T. Hunter.
1989.
Isolation of a human cyclin cDNA: evidence for cyclin mRNA and protein regulation in the cell cycle and for interaction with p34cdc2.
Cell
58:833-846[CrossRef][Medline].
|
| 24.
|
Pines, J.
1996.
Cyclin from sea urchins to HeLas: making the human cell cycle.
Biochem. Soc. Trans.
24:15-33[Medline].
|
| 25.
|
Raich, W. B.,
A. N. Moran,
J. H. Rothman, and J. Hardin.
1998.
Cytokinesis and midzone microtubule organisation in Caenorhabditis elegans require the kinesin-like protein zen-4.
Mol. Biol. Cell
9:2037-2049[Abstract/Free Full Text].
|
| 26.
|
Sambrook, J.,
F. T. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual.
Cold Spring Harbour Laboratory Press, Cold Spring Harbor, N.Y.
|
| 27.
|
Schaar, B. T.,
G. K. T. Chan,
P. Maddox,
E. D. Salmon, and T. J. Yen.
1997.
CENP-E function at kinetochores is essential for chromosome alignment.
J. Cell Biol.
139:1373-1382[Abstract/Free Full Text].
|
| 28.
|
Shima, D. T.,
N. Cabrera-Poch,
R. Pepperkok, and G. Warren.
1998.
An ordered inheritance strategy for the Golgi apparatus: visualisation of mitotic disassembly reveals a role for the mitotic spindle.
J. Cell Biol.
141:955-966[Abstract/Free Full Text].
|
| 29.
|
Tatsumoto, T.,
X. Xie,
R. Blumenthal,
I. Okamoto, and T. Miki.
1999.
Human ECT2 is an exchange factor for Rho GTPases, phosphorylated in G2/M phases, and involved in cytokinesis.
J. Cell Biol.
147:921-927[Abstract/Free Full Text].
|
| 30.
|
Terada, Y.,
M. Tatsuka,
F. Suzuki,
Y. Yasuda,
S. Fujita, and M. Otsu.
1998.
AIM-1: a mammalian midbody-associated protein required for cytokinesis.
EMBO J.
17:667-676[CrossRef][Medline].
|
| 31.
|
Thompson, J.,
L. Hayes, and D. Lloyd.
1991.
Modulation of firefly luciferase stability and impact on studies of gene regulation.
Gene
103:171-177[CrossRef][Medline].
|
| 32.
|
Uchiumi, T.,
D. L. Longo, and D. K. Ferris.
1997.
Cell cycle regulation of the human Polo-like kinase (PLK) promotor.
J. Biol. Chem.
272:9166-9174[Abstract/Free Full Text].
|
| 33.
|
Wheatly, S. P.,
C. B. O'Connel, and Y.-L. Wang.
1998.
Inhibition of chromosomal separation provides insights into cleavage furrow stimulation in cultured epithelial cells.
Mol. Biol. Cell
9:2173-2148[Abstract/Free Full Text].
|
| 34.
|
White, J.,
L. Johannes,
F. Mallard,
A. Girod,
S. Grill,
S. Reinsh,
P. Kellen,
B. Tzschaschel,
A. Echard,
B. Goud, and E. Stelzer.
1999.
Rab6 coordinates a novel Golgi to ER retrograde transport pathway in live cells.
J. Cell Biol.
147:1-17[Abstract/Free Full Text].
|
| 35.
|
Wilkinson, D., and J. Green.
1990.
In situ hybridisation and the three-dimensional reconstruction of serial sections, p. 155-171.
In
A. J. Copp, and D. L. Cockroft (ed.), Postimplantation mammalian embryos: a practical approach. Oxford University Press, Oxford, United Kingdom.
|
| 36.
|
Zachariae, W.
1999.
Progression into and out of mitosis.
Curr. Opin. Cell Biol.
11:708-716[CrossRef][Medline].
|
| 37.
|
Zwicker, J.,
F. C. Lucibello,
L. A. Wolfraim,
C. Gross,
M. Truss,
K. Engeland, and R. Müller.
1995.
Cell cycle regulation of the cyclin A, cdc25C, and cdc2 genes is based on a common mechanism of transcriptional repression.
EMBO J.
14:4514-4522[Medline].
|
Molecular and Cellular Biology, April 2001, p. 2944-2955, Vol. 21, No. 8
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.8.2944-2955.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Seidl, C., Port, M., Gilbertz, K.-P., Morgenstern, A., Bruchertseifer, F., Schwaiger, M., Roper, B., Senekowitsch-Schmidtke, R., Abend, M.
(2007). 213Bi-induced death of HSC45-M2 gastric cancer cells is characterized by G2 arrest and up-regulation of genes known to prevent apoptosis but induce necrosis and mitotic catastrophe. Molecular Cancer Therapeutics
6: 2346-2359
[Abstract]
[Full Text]
-
Fledderus, J. O., van Thienen, J. V., Boon, R. A., Dekker, R. J., Rohlena, J., Volger, O. L., Bijnens, A.-P. J. J., Daemen, M. J. A. P., Kuiper, J., van Berkel, T. J. C., Pannekoek, H., Horrevoets, A. J. G.
(2007). Prolonged shear stress and KLF2 suppress constitutive proinflammatory transcription through inhibition of ATF2. Blood
109: 4249-4257
[Abstract]
[Full Text]
-
Myslinski, E., Gerard, M.-A., Krol, A., Carbon, P.
(2007). Transcription of the human cell cycle regulated BUB1B gene requires hStaf/ZNF143. Nucleic Acids Res
35: 3453-3464
[Abstract]
[Full Text]
-
Yu, T., Peng, Y.-C., Androphy, E. J.
(2007). Mitotic Kinesin-Like Protein 2 Binds and Colocalizes with Papillomavirus E2 during Mitosis. J. Virol.
81: 1736-1745
[Abstract]
[Full Text]
-
Cesario, J. M., Jang, J. K., Redding, B., Shah, N., Rahman, T., McKim, K. S.
(2006). Kinesin 6 family member Subito participates in mitotic spindle assembly and interacts with mitotic regulators. J. Cell Sci.
119: 4770-4780
[Abstract]
[Full Text]
-
Zhao, W.-m., Seki, A., Fang, G.
(2006). Cep55, a Microtubule-bundling Protein, Associates with Centralspindlin to Control the Midbody Integrity and Cell Abscission during Cytokinesis. Mol. Biol. Cell
17: 3881-3896
[Abstract]
[Full Text]
-
Dekker, R. J., Boon, R. A., Rondaij, M. G., Kragt, A., Volger, O. L., Elderkamp, Y. W., Meijers, J. C. M., Voorberg, J., Pannekoek, H., Horrevoets, A. J. G.
(2006). KLF2 provokes a gene expression pattern that establishes functional quiescent differentiation of the endothelium. Blood
107: 4354-4363
[Abstract]
[Full Text]
-
Carleton, M., Mao, M., Biery, M., Warrener, P., Kim, S., Buser, C., Marshall, C. G., Fernandes, C., Annis, J., Linsley, P. S.
(2006). RNA Interference-Mediated Silencing of Mitotic Kinesin KIF14 Disrupts Cell Cycle Progression and Induces Cytokinesis Failure. Mol. Cell. Biol.
26: 3853-3863
[Abstract]
[Full Text]
-
Schmidt, S., Rainer, J., Riml, S., Ploner, C., Jesacher, S., Achmuller, C., Presul, E., Skvortsov, S., Crazzolara, R., Fiegl, M., Raivio, T., Janne, O. A., Geley, S., Meister, B., Kofler, R.
(2006). Identification of glucocorticoid-response genes in children with acute lymphoblastic leukemia. Blood
107: 2061-2069
[Abstract]
[Full Text]
-
Jang, J. K., Rahman, T., McKim, K. S.
(2005). The Kinesinlike Protein Subito Contributes to Central Spindle Assembly and Organization of the Meiotic Spindle in Drosophila Oocytes. Mol. Biol. Cell
16: 4684-4694
[Abstract]
[Full Text]
-
Zhu, C., Zhao, J., Bibikova, M., Leverson, J. D., Bossy-Wetzel, E., Fan, J.-B., Abraham, R. T., Jiang, W.
(2005). Functional Analysis of Human Microtubule-based Motor Proteins, the Kinesins and Dyneins, in Mitosis/Cytokinesis Using RNA Interference. Mol. Biol. Cell
16: 3187-3199
[Abstract]
[Full Text]
-
Wonsey, D. R., Follettie, M. T.
(2005). Loss of the Forkhead Transcription Factor FoxM1 Causes Centrosome Amplification and Mitotic Catastrophe. Cancer Res.
65: 5181-5189
[Abstract]
[Full Text]
-
Jackson, M. W., Agarwal, M. K., Yang, J., Bruss, P., Uchiumi, T., Agarwal, M. L., Stark, G. R., Taylor,, W. R.
(2005). p130/p107/p105Rb-dependent transcriptional repression during DNA-damage-induced cell-cycle exit at G2. J. Cell Sci.
118: 1821-1832
[Abstract]
[Full Text]
-
D'Avino, P. P., Savoian, M. S., Glover, D. M.
(2005). Cleavage furrow formation and ingression during animal cytokinesis: a microtubule legacy. J. Cell Sci.
118: 1549-1558
[Abstract]
[Full Text]
-
Barr, F. A., Egerer, J.
(2005). Golgi positioning: are we looking at the right MAP?. J. Cell Biol.
168: 993-998
[Abstract]
[Full Text]
-
Mollinari, C., Kleman, J.-P., Saoudi, Y., Jablonski, S. A., Perard, J., Yen, T. J., Margolis, R. L.
(2005). Ablation of PRC1 by Small Interfering RNA Demonstrates that Cytokinetic Abscission Requires a Central Spindle Bundle in Mammalian Cells, whereas Completion of Furrowing Does Not. Mol. Biol. Cell
16: 1043-1055
[Abstract]
[Full Text]
-
Taniuchi, K., Nakagawa, H., Nakamura, T., Eguchi, H., Ohigashi, H., Ishikawa, O., Katagiri, T., Nakamura, Y.
(2005). Down-regulation of RAB6KIFL/KIF20A, a Kinesin Involved with Membrane Trafficking of Discs Large Homologue 5, Can Attenuate Growth of Pancreatic Cancer Cell. Cancer Res.
65: 105-112
[Abstract]
[Full Text]
-
Young, J., Stauber, T., del Nery, E., Vernos, I., Pepperkok, R., Nilsson, T.
(2005). Regulation of Microtubule-dependent Recycling at the Trans-Golgi Network by Rab6A and Rab6A'. Mol. Biol. Cell
16: 162-177
[Abstract]
[Full Text]
-
Lele, K. M., Wolgemuth, D. J.
(2004). Distinct Regions of the Mouse Cyclin A1 Gene, Ccna1, Confer Male Germ-Cell Specific Expression and Enhancer Function. Biol. Reprod.
71: 1340-1347
[Abstract]
[Full Text]
-
DeBonis, S., Skoufias, D. A., Lebeau, L., Lopez, R., Robin, G., Margolis, R. L., Wade, R. H., Kozielski, F.
(2004). In vitro screening for inhibitors of the human mitotic kinesin Eg5 with antimitotic and antitumor activities. Molecular Cancer Therapeutics
3: 1079-1090
[Abstract]
[Full Text]
-
Gruneberg, U., Neef, R., Honda, R., Nigg, E. A., Barr, F. A.
(2004). Relocation of Aurora B from centromeres to the central spindle at the metaphase to anaphase transition requires MKlp2. J. Cell Biol.
166: 167-172
[Abstract]
[Full Text]
-
Harvey, S. A. K., Anderson, S. C., SundarRaj, N.
(2004). Downstream Effects of ROCK Signaling in Cultured Human Corneal Stromal Cells: Microarray Analysis of Gene Expression. IOVS
45: 2168-2176
[Abstract]
[Full Text]
-
Vanstraelen, M., Torres Acosta, J. A., De Veylder, L., Inze, D., Geelen, D.
(2004). A Plant-Specific Subclass of C-Terminal Kinesins Contains a Conserved A-Type Cyclin-Dependent Kinase Site Implicated in Folding and Dimerization. Plant Physiol.
135: 1417-1429
[Abstract]
[Full Text]
-
Fan, J., Beck, K. A.
(2004). A role for the spectrin superfamily member Syne-1 and kinesin II in cytokinesis. J. Cell Sci.
117: 619-629
[Abstract]
[Full Text]
-
Neef, R., Preisinger, C., Sutcliffe, J., Kopajtich, R., Nigg, E. A., Mayer, T. U., Barr, F. A.
(2003). Phosphorylation of mitotic kinesin-like protein 2 by polo-like kinase 1 is required for cytokinesis. J. Cell Biol.
162: 863-876
[Abstract]
[Full Text]
-
Abaza, A., Soleilhac, J.-M., Westendorf, J., Pie