This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Simard, M. J.
Right arrow Articles by Chabot, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Simard, M. J.
Right arrow Articles by Chabot, B.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, June 2002, p. 4001-4010, Vol. 22, No. 12
0270-7306/02/$04.00+0     DOI: 10.1128/MCB.22.12.4001-4010.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

SRp30c Is a Repressor of 3' Splice Site Utilization

Martin J. Simard,{dagger} and Benoit Chabot*

Département de Microbiologie et d'Infectiologie, Faculté de Médecine, Université de Sherbrooke, Sherbrooke, Québec, Canada J1H 5N4

Received 4 January 2002/ Returned for modification 21 February 2002/ Accepted 11 March 2002


arrow
ABSTRACT
 
Several intron elements influence exon 7B skipping in the mammalian hnRNP A1 pre-mRNA. We have shown previously that the 38-nucleotide CE9 element located in the intron separating alternative exon 7B from exon 8 can repress the use of a downstream 3' splice site. The ability of CE9 to act on heterologous substrates, combined with the results of competition and gel shift assays, indicates that the activity of CE9 is mediated by a trans-acting factor. UV cross-linking analysis revealed the specific association of a 25-kDa nuclear protein with CE9. Using RNA affinity chromatography, we isolated a 25-kDa protein that binds to CE9 RNA. This protein corresponds to SRp30c. Consistent with a role for SRp30c in the activity of CE9, recombinant SRp30c interacts specifically with CE9 and can promote splicing repression in vitro in a CE9-dependent manner. The closest homologue of SRp30c, ASF/SF2, does not bind to CE9 and does not repress splicing even when the intronic SRp30c binding sites are replaced with high-affinity ASF/SF2 binding sites. Only the first 7 nucleotides of CE9 are sufficient for binding to SRp30c, and mutations that abolish binding also prevent repression. Our results indicate that SRp30c can function as a repressor of 3' splice site utilization and suggest that the SRp30c-CE9 interaction may contribute to the control of hnRNP A1 alternative splicing.


arrow
INTRODUCTION
 
The number of protein-coding genes in the human genome is only about two or three times the number found in a fruit fly, a worm, or a plant. To reach the high levels of complexity that distinguishes mammals from lower organisms, alternative splicing is used to expand and diversify the repertoire of protein function. At least 60% of the human genes may be alternatively spliced (31). Since many genes have more than two, and some potentially up to several thousand, alternatively spliced mRNA isoforms (reviewed in reference 23), the identity of the majority of human proteins may be determined by alternative splicing. Understanding the mechanism controlling the selection of splice sites in mammalian cells has therefore become a pressing challenge of contemporary postgenomic biology.

Several studies have uncovered sequence elements within pre-mRNAs that positively or negatively influence splice site utilization (reviewed in references 1, 5, and 39). The interaction of cellular factors with these elements represents the most common way to modulate splice site utilization. Members of the family of SR proteins constitute one of the most important classes of cellular factors implicated in splice site selection (reviewed in reference 24). Recruitment of SR proteins on exonic splicing enhancers can increase U2AF65 or U2 snRNP binding to an upstream 3' splice site (32, 36, 55, 61). Positioning SR binding sites near a 5' splice site may also facilitate the stable recruitment of U1 snRNP (4, 14, 16, 17, 29, 34, 51).

A variety of elements repressing splice site utilization have also been reported. Some elements act by forming duplex structures that impair splice site recognition (2, 11, 13, 30). Other silencer elements require the contribution of trans-acting factors. The polypyrimidine tract binding protein (PTB) has often been associated with the activity of silencer elements (reviewed in references 58 and 60). PTB binding sites can overlap with those of U2AF65, leading to competition for binding to the 3' splice site region (37, 53). This type of repression is similar to the mechanism used by Drosophila melanogaster female-specific splicing factor SXL to prevent U2AF65 binding to the tra pre-mRNA, leading to the selection of a weaker downstream 3' splice site (22, 59). In other cases, PTB and SXL binding sites do not directly overlap with splice site regions (8-10, 20, 21, 27, 28, 46, 54). The mechanism of repression in these cases remains unclear.

Factors that have been initially identified as repressors or activators in one system can display the opposite behavior in different pre-mRNAs. This is the case for PTB, which has been reported as promoting splice site recognition in genes coding for calcitonin and the calcitonin gene-related peptide (40). Likewise, the binding of SR proteins to intron sequences can have a negative impact on splicing. For example, the binding of SR proteins to a purine-rich element located in the intron upstream of the IIIa exon of adenovirus L1 splicing unit inhibits splicing (33, 47). In this case, SR protein binding is thought to sterically interfere with the interaction of U2 snRNP with the 3' splice site region of exon IIIa. SR proteins have also been found in association with repressor elements in the Rous sarcoma virus (RSV) pre-mRNA (42) and the cystic fibrosis transmembrane regulator gene (45). In myotonic dystrophy, the overexpression of CUG-BP can promote aberrant inclusion of exon 5 in the cardiac troponin T pre-mRNA (48) or repress the inclusion of exon 11 in the insulin receptor pre-mRNA (49).

To study the control of alternative splicing, we used the hnRNP A1 gene as a model system. Exclusion and inclusion of exon 7B in the hnRNP A1 pre-mRNA generate two different mRNAs encoding the A1 and A1B proteins, respectively. We have previously identified elements capable of influencing the alternative splicing of exon 7B: CE6 base pairs with the 5' splice site region of exon 7B to decrease its use (2), CE4m represses the 3' splice site of exon 7B (3), and hnRNP A1 binding sites located on both sides of exon 7B promote exon skipping (3, 7). Our previous work on a 38-nucleotide (nt) intron element called CE9 uncovered an activity that can repress splicing to a downstream 3' splice site (52). In the present study, we identify a member of the family of SR proteins, SRp30c, as the factor that binds to CE9 and we provide evidence to support a direct role of SRp30c in the repressing activity of CE9.


arrow
MATERIALS AND METHODS
 
Plasmid constructs. To generate pC3'-/2x, the HincII-EcoRV fragment of pK9-2x (described in reference 52) was inserted into the EcoRV site of plasmid pC3'-/-, which is described by Blanchette and Chabot (3). To produce pKCE9 and derivatives, pBluescript II KS(+) was cut with HincII and reannealed oligonucleotides were inserted at this site. To generate pK9.7-2x, pK9.7-3x, and mutants, oligonucleotides were successively inserted in pBluescript II KS(+) as described by Simard and Chabot (52). To generate pA3xPu, reannealed 3xPu oligonucleotides (GGGAGGACAAGCTGGGGAGGACAAGCTGGGGAGGACAGCTG) and the complementary sequence were inserted at the StuI site of pSPAdStu (36). These reannealed 3xPu oligonucleotides were also inserted at the HincII site of pBluescript II KS(+) to produce pK3xPu. Plasmids pA3xCE9.7 and mutants were produced by insertion of a HincII and EcoRV fragment, taken from pK9.7-3x and derivatives, into pSPAdStu, previously digested with StuI. All the other constructs are described by Simard and Chabot (52). All constructs were verified by extensive restriction enzyme analysis and DNA sequencing when appropriate.

In vitro transcription. Pre-mRNA substrates A, A3xPu, A2x, and A3x and derivatives were produced from plasmids linearized with HincII and transcribed with SP6 RNA polymerase (Amersham Pharmacia Biotech) in the presence of a cap analog and [{alpha}-32P]UTP (Amersham Pharmacia Biotech). The C3'-/2x transcript was obtained after linearization of the plasmid by ScaI and transcription with T3 RNA polymerase (Amersham Pharmacia Biotech). CE9, CE9.17, and CE9.12d RNAs and K+ RNA were produced from plasmids linearized with ClaI and transcribed with T3 RNA polymerase. CE9.8d RNA, CE9.7 RNA and mutated versions, and 3xPu RNA were obtained from plasmids linearized with EcoRI and transcribed with T3 RNA polymerase. Cold RNA was produced as described above except that the relative amount of [{alpha}-32P]UTP was reduced 2,000-fold. The purification of all RNA molecules was performed as described by Chabot (6).

In vitro splicing assays. HeLa nuclear extracts were prepared (15) and used in splicing reactions as previously described (7). Identification of lariat molecules and other splicing products was confirmed by performing debranching reactions in an S100 extract followed by migration relative to molecular weight standards. Competition with cold RNA was performed by preincubating the splicing mixture with the competitor RNA for 10 min at 30°C prior to the addition of the radiolabeled pre-mRNA substrate.

UV cross-linking. Radiolabeled RNA were incubated for 10 min under standard splicing conditions. One-half of the reaction mixture was irradiated for 10 min with UV and digested with RNase A as described by Côté et al. (12). The cross-linking assay in the presence of heparin was performed in the buffer used for mobility shift assays (see below). After incubation, one-half of the reaction mixture was irradiated for 10 min with UV and digested with RNase A. Cross-linking products were analyzed by electrophoresis on sodium dodecyl sulfate (SDS)-12.5% polyacrylamide gels.

Gel shift assays. RNA mobility shift assays were performed by incubating RNAs for 15 min on ice in splicing conditions prior to the addition of 1 mg of heparin/ml and incubation for 2 min on ice. The reactions were run on a 5% native acrylamide gel (29:1 acrylamide/bisacrylamide, 5% glycerol, 50 mM Tris [pH 8.8], 50 mM glycine) in Tris-glycine running buffer (50 mM Tris [pH 8.8], 50 mM glycine).

RNA affinity chromatography. Fifty nanomoles of synthetic RNA oligonucleotide corresponding to CE9 (CUGGAUUAUUCAACUG) or an adenovirus RNA (C RNA; AAUGUCUGCUACUGG; Dharmacon Research Inc.) was incubated 1 h on ice, protected from light, in a 100-µl reaction volume containing 100 mM Tris-HCl, pH 7.5, and 10 mM sodium periodate. The periodate-treated RNAs were coupled to 0.5 ml of agarose adipic acid hydrazide resin in accordance with the manufacturer's protocol (Amersham Pharmacia Biotech). The resin was washed twice with 10 ml of storage buffer (20 mM HEPES-KOH [pH 7.9], 100 mM KCl, 20% glycerol, 5.7 mM MgCl2, 1 mM dithiothreitol [DTT]) and kept as a 50% slurry at 4°C. The coupling efficiency, which was typically higher than 95%, was measured by comparing the absorbance at 260 nm of 1% of the input periodate-treated RNA to that of 10% of the unbound material. One hundred seventy-five microliters of HeLa nuclear extract containing 5.7 mM MgCl2, 0.90 mM ATP, 36 mM phosphocreatine, 3.58 mM DTT, and 1.25 U of RNAguard/ml was incubated with 50 µl of packed beads for 10 min at 30°C under agitation. The mixture was spun, and the supernatant was transferred to a second tube containing 50 µl of the same packed beads. The beads were washed four times with 1 ml of 70% buffer D (20 mM HEPES-KOH [pH 7.9], 100 mM KCl, 20% glycerol, 1 mM DTT) containing 5.7 mM MgCl2. The bound proteins were pooled and loaded on gel after the beads were boiled in 100 µl of loading dye (62.5 mM Tris-HCl [pH 6.8], 6 M urea, 10% glycerol, 2% SDS, 0.7 M mercaptoethanol, 0.003% bromophenol blue).

Recombinant protein purification. Recombinant glutathione S-transferase (GST)-ASF/SF2 and GST-SRp30c were purified with a glutathione-Sepharose column (Amersham Pharmacia Biotech) as described by the manufacturer in Rec buffer (20 mM piperazine-HCl [pH 9.5], 0.5 M NaCl, 1 mM DTT, 1 mM bacitracin, 20 µg of benzamidine/ml, 0.5 mM phenylmethylsulfonyl fluoride) in the presence of 3 mg of lysozyme/ml and 1% Triton X-100. The columns were washed with Rec buffer containing 0.1% Triton X-100 and eluted in elution buffer (200 mM piperazine-HCl [pH 9.5], 0.5 M NaCl, 1 mM DTT, 20 mM reduced glutathione). Trx (thioredoxin-His)-SRp30c was purified by standard Ni column chromatography as described by Lamontagne et al. (35). The purified proteins were extensively dialyzed against buffer D (20 mM HEPES [pH 7.9], 100 mM KCl, 20% glycerol, 0.5 mM DTT). The concentration of recombinant proteins was measured by the Bradford method using the protein assay from Bio-Rad and/or estimated from Coomassie blue-stained SDS-polyacrylamide gels, with serial dilutions of bovine serum albumin as the standard.


arrow
RESULTS
 
Repression of a downstream 3' splice site by CE9 requires a trans-acting factor in vitro. We have shown previously that the CE9 element (38 nt) can repress 3' splice site usage (52). When we use a model hnRNP A1 pre-mRNA carrying a single 5' splice site and two 3' splice sites, the insertion of two copies of CE9 between the competing 3' splice sites leads to an almost exclusive use of the proximal 3' splice site (Fig. 1C, lane 1). A similar but less dramatic shift was observed by inserting a single CE9 element (52). In contrast, the insertion of unrelated sequences of the same length yields predominant splicing to the distal 3' splice site (Fig. 1C, lane 2). In a one-intron splicing unit, three copies of CE9 strongly inhibit splicing (Fig. 1C, compare lanes 3 and 4). This inhibition of splicing suggests that the 3' splice site located downstream of CE9 was repressed in the model pre-mRNA carrying competing 3' splice sites.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 1. Multiple copies of CE9 inhibit the utilization of a downstream 3' splice site. (A) CE9 is a highly conserved 38-nt element in hnRNP A1. Shown is a schematic representation of the downstream portion of the hnRNP A1 alternative splicing unit with the distance of CE9 to the constitutive 3' splice site of exon 8 and the length of CE9 in nucleotides indicated. The alignment between the mouse and the human CE9 sequences shows a level of conservation that is greater than 90%. (B) Schematic representation of pre-mRNAs. The distance between the site of insertion and the 3' splice site in nucleotides is indicated. (C) Labeled pre-mRNAs were incubated in a HeLa nuclear extract for 2 h. C3'-/{alpha} and A3x{alpha} are identical to C3'-/2x and A3x, respectively, except that they contain insertions of sequences complementary to CE9. Splicing products were run on an 8% acrylamide-8 M urea gel (C3'-/2x and C3'-/{alpha}) or a 6.5% acrylamide-8 M urea gel (A3x and A3x{alpha}). A mixture (M) containing A3x and A3x{alpha} was analyzed to rule out the presence of a nonspecific inhibitor in the A3x RNA preparation (lane 5). (D) CE9 activity is mediated by a trans-acting factor. Splicing was performed in a HeLa nuclear extract preincubated for 10 min with increasing amounts of an RNA containing multiple copies of CE9 (3x9f) as a competitor (lanes 2 to 4 and 6 to 8). Each set of competition was performed with 0.5 fmol of pre-mRNA and 62.5, 125, and 250 fmol of 3x9f RNA. The positions of the pre-mRNAs and of various lariat products are indicated.

The splicing activity of the one-intron pre-mRNA containing three copies of CE9 (A3x RNA) was restored when an excess of a cold competitor RNA containing three copies of the CE9 sequence (3x9f) was preincubated in a HeLa extract (Fig. 1D, lanes 2 to 4). This competitor RNA did not affect the splicing efficiency of a control pre-mRNA lacking CE9 (lanes 6 to 8). This result is consistent with our previous demonstration that an excess of CE9 RNA can inhibit splicing to the proximal site in a model pre-mRNA carrying competing 3' splice sites (52). These results suggest that a cellular factor interacts with the CE9 element to mediate its effect.

CE9 is bound by a nuclear factor of 25 kDa. To detect the interaction of factors with CE9 in a HeLa nuclear extract, we performed a gel shift assay. 32P-labeled RNA probes were incubated in the extract, and complexes were resolved on a nondenaturing gel. An RNA containing the complete 38 nt of CE9 formed a complex in a HeLa extract (Fig. 2B, lane 4). In contrast, a control RNA carrying only plasmid sequences did not form a complex (lane 2). Complex formation occurred in a nuclear extract depleted of ATP and kept at 0°C (data not shown). A smaller RNA carrying the first 17 nt (CE9.17) was also assembled into a low-mobility complex (lane 6). Although the last 12 nt of CE9 (CE9.12d) elicited complex formation, the majority of the RNA remained free (lane 8), suggesting that the interaction of cellular factors with the 3' end of CE9 is considerably weaker. These results indicate that the HeLa nuclear extract contains one or several factors that can specifically associate with CE9.



View larger version (46K):
[in this window]
[in a new window]
  		FIG. 2. A 25-kDa protein interacts with CE9. (A) The sequence of CE9 RNA and portions of it used in gel shift assays are shown. Each RNA also contains at its 5' end 35 nt of unrelated sequence that is derived from pBluescript II KS(+) RNA. (B) Labeled transcripts were incubated for 15 min on ice in the presence (+) or absence (-) of a HeLa nuclear extract (NE). Complexes were separated on a nondenaturing 5% acrylamide gel. (C) Cross-linking assays were performed in the presence of labeled transcripts incubated for 10 min at 30°C (lanes 1 and 2) or on ice in the presence of 0.1 mg of heparin (lanes 3 and 4), followed by UV irradiation. Samples were fractionated on a 12.5% polyacrylamide-SDS gel. K+, control RNA containing 35 nt from pBluescript that are also present at the 5' end of the other transcripts.

To address the identity of the cellular factors that interact with CE9, we first performed a UV cross-linking assay. Following incubation in a nuclear extract, 32P-labeled RNA probes were digested with RNase A and the proteins were resolved by SDS-polyacrylamide gel electrophoresis. Comparing the cross-linking patterns of a control RNA with the pattern of CE9 RNA revealed specific bands migrating at 25, 46, and 65 kDa (Fig. 2C, compare lanes 1 and 2). When the cross-linking of CE9 RNA was performed under gel shift conditions (i.e., in the presence of heparin as the competitor), only the 25-kDa band remained visible (Fig. 2C, compare lanes 3 and 4). Moreover, the utilization of cold CE9 RNA as the competitor specifically prevented the appearance of this band (data not shown). These results suggest that CE9 is bound specifically by a 25-kDa protein.

A CE9 RNA column retains a 25-kDa nuclear protein: SRp30c. To address the identity of the 25-kDa protein, we performed RNA affinity chromatography using the first 16 nt of CE9 covalently linked to an adipic acid hydrazide column (Fig. 3A). After the RNA column was loaded with a HeLa nuclear extract under splicing conditions, beads were washed. Bound proteins were fractionated onto an SDS-polyacrylamide gel and stained with AgNO3. A comparison of the profiles of proteins retained by a control RNA column and by the CE9 RNA column revealed a protein of approximately 25 kDa that was specifically retained by the CE9 RNA (Fig. 3B, compare lanes 1 and 2).



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 3. A 25-kDa protein binds to a CE9 RNA column. (A) Sequences of the RNAs that were covalently linked to the agarose adipic acid column. (B) Proteins from a HeLa nuclear extract bound to the different RNA columns were resolved on a 12.5% polyacrylamide-SDS gel and stained with silver nitrate. The positions of some of the molecular weight markers are shown (lane MW).

For the purpose of identification, the band was excised and sent for matrix-assisted laser desorption ionization mass spectroscopy analysis to the W. M. Keck Facility (Yale University). The tryptic digestion of the 25-kDa protein generated 21 peptides. A search in the ProFound database using the masses of those peptides indicated that 9 out of the 21 peptides covered 32% the sequence of the human splicing factor arginine/serine-rich 9 protein, also known as SRp30c. No additional protein was identified by a second ProFound search with unmatched peptides masses. These results were confirmed by another search in the Pepsea database. These results indicate that the 25-kDa protein that specifically binds to the CE9 RNA corresponds to SRp30c, a member of the family of SR proteins.

Recombinant SRp30c binds specifically to CE9. To confirm that SRp30c can interact specifically with CE9, we used GST-tagged SRp30c (rSRp30c; kindly provided by Stefan Stamm, Erlangen, Germany) in a mobility shift assay. 32P-labeled CE9 RNA was incubated in the presence of increasing amounts of rSRp30c. Complex formation occurred with CE9 RNA but not with a control RNA (Fig. 4, compare lanes 2 to 5 with 11 to 14). The specificity of the interaction of SRp30c with CE9 was also assessed by testing the binding of ASF/SF2, a protein that displays 74% amino acid identity with SRp30c. The RS domain of SRp30c is the shortest of all those of SR proteins reported to date, an attribute that may explain why SRp30c is not as active as ASF/SF2 in its ability to confer splicing activity to a HeLa S100 extract (50). Recombinant ASF/SF2 did not form a complex with CE9 RNA (Fig. 4, lanes 6 to 9). Thus, despite the high degree of similarity between ASF/SF2 and SRp30c, only the latter can bind to CE9.



View larger version (83K):
[in this window]
[in a new window]
  		FIG. 4. Recombinant SRp30c binds specifically to CE9 RNA. Labeled transcripts (see Fig. 2) were incubated for 15 min on ice in the presence of 0.1, 0.25, 0.5, and 1.0 µg of GST-SRp30c or GST-ASF/SF2. Complexes were separated on a nondenaturing 5% acrylamide gel. Samples in lanes 1 and 10 lack recombinant proteins.

SRp30c is required to elicit repression by CE9. To further examine the implication of SRp30c in the activity of CE9, we carried out an in vitro splicing reaction with the one-intron model pre-mRNA used previously. In this splicing system, three copies of CE9 inhibit splicing (Fig. 5A, lane 1) and splicing activity is restored by preincubation with an excess of CE9 RNA (3x9f) (Fig. 5A, lane 2). When a Trx-tagged SRp30c (kindly provided by Göran Akusjärvi, Uppsala, Sweden) was added to a mixture containing an excess of CE9 RNA, splicing was inhibited (Fig. 5A, lanes 3 and 4). In contrast, a pre-mRNA lacking CE9 was not affected by the addition of cold CE9 (Fig. 5A, lane 7), and the addition of SRp30c promoted only a small reduction in splicing at the highest concentration (Fig. 5A, lane 9). The effect was specific for SRp30c since the addition of recombinant ASF/SF2 was not inhibitory (Fig. 5A, lanes 5 and 10).



View larger version (46K):
[in this window]
[in a new window]
  		FIG. 5. SRp30c mediates the activity of CE9 in vitro. (A) Splicing reaction mixtures with a HeLa nuclear extract were preincubated for 10 min with 250 fmol of 3x9f RNA as the competitor (lanes 2 to 5 and 7 to 10). Increasing amounts of Trx-SRp30c (0.75 and 1 µg) and 1 µg of GST-ASF/SF2 were then added to the mixture, which was further incubated for 10 min (lanes 3 to 5 and 8 to 10) before the addition of the labeled A3x or A pre-mRNA, as indicated. (B) Mixtures for splicing reactions performed in a HeLa nuclear extract were preincubated for 10 min with increasing amounts of recombinant proteins (1 and 1.5 µg of Trx-SRp30c and GST-ASF/SF2) followed by the addition of labeled A2x or the A2x{alpha} transcripts. Mock incubations were also performed as controls (lanes 1 and 6). A2x contains two copies of CE9, while A2x{alpha} contains two copies of the complementary sequence of CE9. Note that two copies of CE9 are not sufficient to promote a consistent reduction in splicing efficiency in vitro in this system (compare lane 1 with lane 6). Likewise, a single copy of CE9 had no effect in the adenovirus system (not shown). Splicing products in both panels were resolved on a 6.5% acrylamide-8 M urea gel. The positions of the pre-mRNAs and various lariat products are indicated.

The experiment presented above does not rule out the possibility that a CE9-bound repressor distinct from SRp30c might be displaced by an excess of SRp30c. To address this issue, we first tested a pre-mRNA carrying one copy of CE9 inserted between the 3' splice sites of exon 7B and adenovirus major late exon 2. Although a shift toward the proximal 3' splice site was observed with SRp30c, a similar effect was observed with ASF/SF2 (data not shown). SRp30c either could repress the distal site or may generally promote the use of the proximal site in a manner similar to ASF/SF2. To discriminate between these two possibilities, we used a one-intron pre-mRNA containing two copies of CE9 (A2x). The presence of two copies of CE9 is not sufficient to inhibit splicing (Fig. 5B, compare lanes 1 and 6). In this context, the addition of rSRp30c represses splicing in a CE9-dependent manner (Fig. 5B, compare lanes 2 and 3 with 7 and 8). Notably, no inhibition was observed with ASF/SF2 (lanes 4 and 5 and 9 and 10). These results suggest that SRp30c plays a direct and specific role in the repression mediated by CE9.

The first 7 nt of CE9 are important for SRp30c binding. We used the first 16 nt of CE9 to recover SRp30c by affinity chromatography. To further narrow the sequence requirement for binding by SRp30c, we performed a gel shift assay with smaller RNA fragments. rSRp30c could bind specifically to the first 7 nt of CE9 but not to the immediately downstream 8-nt portion (Fig. 6 compare lanes 6 to 8 with 2 to 4, respectively). To probe the sequence requirement in this 7-nt portion, mutated versions of CE9.7 were tested in a mobility shift assay. Swapping the G at position 4 for the A at position 5 (CE9.7AG) or converting the G at position 3 into an A (CE9.7A3) abolished SRp30c binding (Fig. 6B, lanes 9 to 16).



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 6. The binding of SRp30c to CE9 correlates with repression activity. (A) Sequences of the various RNAs. CE9.16 was used in RNA affinity chromatography (see Fig. 3). Underlined nucleotides indicate mutations relative to the wild-type CE9.7 sequence. (B) Radiolabeled transcripts were incubated for 15 min on ice in the absence (lanes 1, 5, 9, and 13) or the presence of increasing amounts of GST-SRp30c (0.1, 0.25, 0.5, and 1 µg). Complexes were separated on a nondenaturing 5% acrylamide gel. (C) Splicing reactions were performed with a labeled adenovirus or C3' pre-mRNA derivatives (see Fig. 1B). The adenovirus substrates contained three copies of the shortest CE9.7 minimal sequence or mutant versions, while the C3' variants contained two copies of CE9.7 or mutant versions. The adenovirus and C3' splicing products were resolved on an 8% acrylamide-8 M urea gel and an 11% acrylamide-8 M urea gel (lanes 1 to 3 and 4 to 7, respectively). The positions of the pre-mRNAs and various lariat products are indicated.

Mutations that eliminated the binding of SRp30c also eliminated the CE9-dependent repressing activity. We used an adenovirus pre-mRNA containing in its intron three copies of the first 7 nt of CE9. As expected, this pre-mRNA is poorly spliced in vitro (Fig. 6C, lane 1). Splicing was more efficient when tandem copies of the mutated version of CE9 were inserted (Fig. 6C, lanes 2 and 3). Likewise, inserting two copies of the minimal version (7 nt) of CE9 in the pre-mRNA carrying competing 3' splice sites led to an increase (from 0 to 17%) in the use of the proximal 3' splice site (Fig. 6C, lane 5). In contrast, the mutated versions were less active at promoting proximal 3' splice site usage (lanes 6 and 7). These results suggest that the binding of SRp30c to CE9 is important for the repression of splicing.

The repressing activity of SRp30c is not a general property of SR proteins bound to intron sequences. To address whether the binding of another SR protein in the intron can also promote repression, we replaced the three copies of CE9.7 with three copies of a purine-rich element that represents a high-affinity binding site for ASF/SF2 (38). A gel shift assay performed with the purine-rich element and the CE9.7 RNA reveals that recombinant ASF/SF2 binds to the purine-rich element (Fig. 7B, lanes 2 to 5). Notably, rSRp30c could bind to the purine-rich element at least as efficiently as to CE9.7 (Fig. 7B, lanes 6 to 9 and 11 to 14). The insertion of this purine-rich element at the same position as CE9 in the intron of an adenovirus pre-mRNA did not compromise splicing activity (Fig. 7C, compare lanes 2 and 3). Thus, the presence in an intron of high-affinity binding sites for ASF/SF2 did not elicit splicing inhibition. Although this element is also bound by SRp30c, its binding by the higher-abundance ASF/SF2 protein (25) may explain the lack of repression in a HeLa extract. Thus, targeting the binding of a different, yet closely related, SR protein in the intron does not promote splicing repression.



View larger version (35K):
[in this window]
[in a new window]
  		FIG. 7. A purine-rich element bound by SR protein ASF/SF2 does not elicit repression when positioned in the intron. (A) Sequences of 3xPu and 3xCE9.7. (B) Radiolabeled transcripts were incubated for 15 min on ice in the absence (lanes 1 and 10) or presence of GST-SRp30c and GST-ASF/SF2 (0.1, 0.5, and 1 µg). Complexes were separated on a nondenaturing 5% acrylamide gel. (C) Splicing reactions were performed with labeled adenovirus containing either three copies of CE9.7 or three copies of the purine-rich element. Adenovirus splicing products were resolved on an 8% acrylamide-8 M urea gel. Note that the difference in the migration of pre-mRNAs and lariat products between A3xCE9.7 and A3xPu is due to extra nucleotides from pBluescript II KS(+) in the A3xCE9.7 substrate.


arrow
DISCUSSION
 
In a previous study we reported the identification of CE9, an intron element that can repress the 3' splice site of exon 8 in the hnRNP A1 pre-mRNA (52). The capacity of CE9 to act on heterologous substrates combined with the loss of repression obtained while using a molar excess of a CE9 RNA implicated a cellular factor in the repressing activity of CE9. Here we show that a 25-kDa protein specifically cross-links to the CE9 RNA element. We have isolated a 25-kDa protein by RNA affinity chromatography and identified it as SRp30c. In vitro assays support the implication of SRp30c in the activity of CE9. First, recombinant SRp30c specifically interacts with CE9 in gel mobility shift assays. Second, the addition of recombinant SRp30c to a HeLa nuclear extract specifically represses the splicing of pre-mRNAs containing CE9. Third, mutations in CE9 that abolish the binding of SRp30c also eliminate splicing inhibition. Collectively, these results indicate that SRp30c mediates the repressing activity of CE9. We have not ruled out the possibility that other factors collaborate with SRp30c to silence a downstream 3' splice site. Additional proteins may interact with the conserved portion of CE9 that is not bound by SRp30c. It also will be worthwhile to test whether proteins that can interact with SRp30c in a yeast two-hybrid assay (43, 56, 57, 62) can potentiate the activity of CE9.

The contribution of SR proteins to splicing has been associated principally with activation, either as generic splicing factors or as proteins that bind to exon enhancer elements to stimulate the use of an adjacent splice site (24). However, there are a few cases of splicing repression implicating the SR proteins. The binding of an SR protein to the RSV intron silencer element may be important to elicit repression but is not sufficient by itself (41, 42). As is the case with CE9, the RSV intron silencer does not affect U2 snRNP-dependent complex formation (19). It was proposed that the binding of SR proteins enhances U1 snRNP binding to another region of the RSV silencer, leading to the formation of a nonproductive spliceosome (26, 41, 44). Whether a similar mechanism is taking place with CE9 remains to be demonstrated.

The activity of CE9 is also reminiscent of the activity of intron silencer element 3RE, found in the adenovirus IIIa pre-mRNA (33, 47). Although recombinant SRp30c can also bind to 3RE to repress splicing, the natural contribution of SRp30c to splicing inhibition in this case remains unclear because the more abundant ASF/SF2 protein can also bind to 3RE and elicit repression (33, 47). In contrast, we have shown that ASF/SF2 does not strongly bind to CE9 and does not promote splicing repression of a CE9-containing pre-mRNA. CE9 does not appear to be functionally equivalent to 3RE. First, 3RE but not CE9 can function as an enhancer when placed downstream from a 3'splice site (33) (data not shown). Second, the proximity of 3RE to the branch site is apparently responsible for the interference with U2 snRNP binding to the branch site (33). In contrast, the assembly of U2-dependent complexes is not compromised by CE9 (52). CE9 is naturally located 100 nt upstream from the putative branch site of exon 8, and we have observed a similar level of inhibition when CE9 is positioned up to 300 nt from the adenovirus branch site (data not shown). Based on these considerations we conclude that the activity of 3RE and CE9 is likely mediated by different factors which use different mechanisms of splicing inhibition.

Finally, it is worth noting that the presence of binding sites for SR proteins in introns is not always associated with splicing inhibition. For tropomyosin, natural intron binding sites for SR proteins have been associated with enhancer activity (18). We have also shown previously that positioning the exonic splicing enhancer from the human fibronectin ED1 exon in the intron does not inhibit splicing (36). Finally, we have shown here that inserting several copies of a purine-rich element bound by ASF/SF2 at the same position as CE9 does not repress splicing.

Several observations suggest that CE9 may play a role in the control of hnRNP A1 alternative splicing. We have identified several elements that prevent efficient exon 7B inclusion in the hnRNP A1 pre-mRNA (3, 7). Among these, CE6 impairs the use of the 5' splice site of exon 7B by forming a stable duplex structure with this splice site (2). Duplex formation acting on the hnRNP A1 alternative splicing unit essentially creates a situation where the 3' splice sites of exon 7B and exon 8 are in competition for pairing with the 5' splice site of exon 7. By repressing the 3' splice site of exon 8, CE9 may therefore favor the production of the A1B mRNA.

At this point, however, the true contribution of the SRp30c-CE9 interaction to A1 splicing control in HeLa cells remains unclear. While a single copy of CE9 has an impact on exon skipping in vivo in a heterologous system, the expression of a minigene carrying a deletion of CE9 does not significantly affect the frequency of exon 7B inclusion (52). Moreover, the addition of several copies of CE9 in the A1 minigene is required to eliminate splicing to the 3' splice site of exon 8 in vivo (52). Likewise, whereas a single CE9 element is sufficient to shift splicing in vitro when a pre-mRNA containing the 3' splice sites of exon 7B and adenovirus major late exon 2 is used (52), two CE9 elements are required to affect exon 7B/exon 8 splicing in vitro when a simple one-intron pre-mRNA is used. We could not use a pre-mRNA containing the 3' splice sites of exon 7B and exon 8 to measure the effect of a single CE9 element on its natural downstream 3' splice site because splicing to exon 7B occurred exclusively even in the absence of CE9 (data not shown). The impact of a single CE9 element in its natural context may be difficult to observe in HeLa cells and extracts because the 3' splice site of exon 8 is weak and because CE9 may not be sufficiently robust to offset the activity of other elements (e.g., CE6, CE4, and CE1) that all favor exon 7B skipping. The contribution of CE9 to splicing control may become more important at higher concentrations of SRp30c. Notably, the abundance of SRp30c mRNA varies in a tissue-specific manner (50). It will be worth testing whether modifying the abundance of SRp30c can affect the inclusion frequency of exon 7B in HeLa cells and in other cell types.


arrow
ACKNOWLEDGMENTS
 
We thank Stefan Stamm for GST-ASF/SF2 and GST-SRp30c plasmids and Göran Akusjärvi for providing the Trx-SRp30c plasmid. We thank Bruno Lamontagne for help with the purification of Trx-SRp30c. We thank Aline Simoneau and Annie Leroux for preparing nuclear extracts, and Serge Gravel and members of the laboratory for comments on the manuscript.

M.J.S. was the recipient of a studentship from the FCAR/FRSQ. This work was supported by a grant from the Canadian Institutes of Health Research (CIHR) to B.C. B.C. is a Canada Research Chair in Functional Genomic and is a member of the Sherbrooke RNA/RNP group supported by the Université de Sherbrooke, the FCAR, and the CIHR (grant no. MGC-48372).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Département de Microbiologie et d'Infectiologie, Faculté de Médecine, Université de Sherbrooke, Sherbrooke, 3001 12e Ave. Nord, Sherbrooke, Québec, Canada J1H 5N4. Phone: (819) 564-5295. Fax: (819) 564-5392. E-mail: b.chabot{at}courrier.usherb.ca. Back

{dagger} Present address: Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, MA 01605. Back


arrow
REFERENCES
 
    1
  1. Black, D. L. 1995. Finding splice sites within a wilderness of RNA. RNA 1:763-771.[Medline]
    2. 2
  2. Blanchette, M., and B. Chabot. 1997. A highly stable duplex structure sequesters the 5' splice site region of hnRNP A1 alternative exon 7B. RNA 3:405-419.[Abstract]
    3. 3
  3. Blanchette, M., and B. Chabot. 1999. Modulation of exon skipping by high-affinity hnRNP A1-binding sites and by intron elements that repress splice site utilization. EMBO J. 18:1939-1952.[CrossRef][Medline]
    4. 4
  4. Bourgeois, C. F., M. Popielarz, G. Hildwein, and J. Stevenin. 1999. Identification of a bidirectional splicing enhancer: differential involvement of SR proteins in 5' or 3' splice site activation. Mol. Cell. Biol. 19:7347-7356.[Abstract/Free Full Text]
    5. 5
  5. Chabot, B. 1996. Directing alternative splicing: cast and scenarios. Trends Genet. 12:472-478.[CrossRef][Medline]
    6. 6
  6. Chabot, B. 1994. Synthesis and purification of RNA substrates, p. 1-29. In D. Hames, and S. Higgins (ed.), RNA processing, vol. 1. Oxford University Press, Oxford, United Kingdom.
    7. 7
  7. Chabot, B., M. Blanchette, I. Lapierre, and H. La Branche. 1997. An intron element modulating 5' splice site selection in the hnRNP A1 pre-mRNA interacts with hnRNP A1. Mol. Cell. Biol. 17:1776-1786.[Abstract]
    8. 8
  8. Chan, R. C., and D. L. Black. 1995. Conserved intron elements repress splicing of a neuron-specific c-src exon in vitro. Mol. Cell. Biol. 15:6377-6385. (Erratum, 17:2970, 1997.)
    9. 9
  9. Chan, R. C., and D. L. Black. 1997. The polypyrimidine tract binding protein binds upstream of neural cell-specific c-src exon N1 to repress the splicing of the intron downstream. Mol. Cell. Biol. 17:4667-4676.[Abstract]
    10. 10
  10. Chou, M. Y., J. G. Underwood, J. Nikolic, M. H. Luu, and D. L. Black. 2000. Multisite RNA binding and release of polypyrimidine tract binding protein during the regulation of c-src neural-specific splicing. Mol. Cell 5:949-957.[CrossRef][Medline]
    11. 11
  11. Clouet d'Orval, B., Y. d'Aubenton Carafa, P. Sirand-Pugnet, M. Gallego, E. Brody, and J. Marie. 1991. RNA secondary structure repression of a muscle-specific exon in HeLa cell nuclear extracts. Science 252:1823-1828.[Abstract/Free Full Text]
    12. 12
  12. Côté, J., J. Beaudoin, R. Tacke, and B. Chabot. 1995. The U1 small nuclear ribonucleoprotein/5' splice site interaction affects U2AF65 binding to the downstream 3' splice site. J. Biol. Chem. 270:4031-4036.[Abstract/Free Full Text]
    13. 13
  13. Côté, J., and B. Chabot. 1997. Natural base-pairing interactions between 5' splice site and branch site sequences affect mammalian 5' splice site selection. RNA 3:1248-1261.[Abstract]
    14. 14
  14. Côté, J., M. J. Simard, and B. Chabot. 1999. An element in the 5' common exon of the NCAM alternative splicing unit interacts with SR proteins and modulates 5' splice site selection. Nucleic Acids Res. 27:2529-2537.[Abstract/Free Full Text]
    15. 15
  15. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475-1489.[Abstract/Free Full Text]
    16. 16
  16. Elrick, L. L., M. B. Humphrey, T. A. Cooper, and S. M. Berget. 1998. A short sequence within two purine-rich enhancers determines 5' splice site specificity. Mol. Cell. Biol. 18:343-352.[Abstract/Free Full Text]
    17. 17
  17. Eperon, I. C., D. C. Ireland, R. A. Smith, A. Mayeda, and A. R. Krainer. 1993. Pathways for selection of 5' splice sites by U1 snRNPs and SF2/ASF. EMBO J. 12:3607-3617.[Medline]
    18. 18
  18. Gallego, M. E., R. Gattoni, J. Stevenin, J. Marie, and A. Expert-Bezancon. 1997. The SR splicing factors ASF/SF2 and SC35 have antagonistic effects on intronic enhancer-dependent splicing of the beta-tropomyosin alternative exon 6A. EMBO J. 16:1772-1784.[CrossRef][Medline]
    19. 19
  19. Gontarek, R. R., M. T. McNally, and K. Beemon. 1993. Mutation of an RSV intronic element abolishes both U11/U12 snRNP binding and negative regulation of splicing. Genes Dev. 7:1926-1936.[Abstract/Free Full Text]
    20. 20
  20. Gooding, C., G. C. Roberts, G. Moreau, B. Nadal-Ginard, and C. W. Smith. 1994. Smooth muscle-specific switching of alpha-tropomyosin mutually exclusive exon selection by specific inhibition of the strong default exon. EMBO J. 13:3861-3872.[Medline]
    21. 21
  21. Gooding, C., G. C. Roberts, and C. W. Smith. 1998. Role of an inhibitory pyrimidine element and polypyrimidine tract binding protein in repression of a regulated alpha-tropomyosin exon. RNA 4:85-100.[Abstract]
    22. 22
  22. Granadino, B., L. O. F. Penalva, M. R. Green, J. Valcárcel, and L. Sanchez. 1997. Distinct mechanisms of splicing regulation in vivo by the Drosophila protein Sex-lethal. Proc. Natl. Acad. Sci. USA 94:7343-7348.[Abstract/Free Full Text]
    23. 23
  23. Graveley, B. R. 2001. Alternative splicing: increasing diversity in the proteomic world. Trends Genet. 17:100-107.[CrossRef][Medline]
    24. 24
  24. Graveley, B. R. 2000. Sorting out the complexity of SR protein functions. RNA 6:1197-1211.[CrossRef][Medline]
    25. 25
  25. Hanamura, A., J. F. Caceres, A. Mayeda, B. R. Franza, Jr., and A. R. Krainer. 1998. Regulated tissue-specific expression of antagonistic pre-mRNA splicing factors. RNA 4:430-444.[Abstract]
    26. 26
  26. Hibbert, C. S., R. R. Gontarek, and K. L. Beemon. 1999. The role of overlapping U1 and U11 5' splice site sequences in a negative regulator of splicing. RNA 5:333-343.[Abstract]
    27. 27
  27. Horabin, J. I., and P. Schedl. 1993. Regulated splicing of the Drosophila Sex-lethal male exon involves a blockage mechanism. Mol. Cell. Biol. 13:1408-1414.[Abstract/Free Full Text]
    28. 28
  28. Horabin, J. I., and P. Schedl. 1993. Sex-lethal autoregulation requires multiple cis-acting elements upstream and downstream of the male exon and appears to depend largely on controlling the use of the male exon 5' splice site. Mol. Cell. Biol. 13:7734-7746.[Abstract/Free Full Text]
    29. 29
  29. Humphrey, M. B., J. Bryan, T. A. Cooper, and S. M. Berget. 1995. A 32-nucleotide exon-splicing enhancer regulates usage of competing 5' splice sites in a differential internal exon. Mol. Cell. Biol. 15:3979-3988.[Abstract]
    30. 30
  30. Hutton, M., C. L. Lendon, P. Rizzu, M. Baker, S. Froelich, H. Houlden, S. Pickering-Brown, S. Chakraverty, A. Isaacs, A. Grover, J. Hackett, J. Adamson, S. Lincoln, D. Dickson, P. Davies, R. C. Petersen, M. Stevens, E. de Graaff, E. Wauters, J. van Baren, M. Hillebrand, M. Joosse, J. M. Kwon, P. Nowotny, P. Heutink, et al. 1998. Association of missense and 5'-splice-site mutations in tau with the inherited dementia FTDP-17. Nature 393:702-705.[CrossRef][Medline]
    31. 31
  31. International Human Genome Sequencing Consortium. 2001. Initial sequencing and analysis of the human genome. Nature 409:860-921.[CrossRef][Medline]
    32. 32
  32. Kan, J. L., and M. R. Green. 1999. Pre-mRNA splicing of IgM exons M1 and M2 is directed by a juxtaposed splicing enhancer and inhibitor. Genes Dev. 13:462-471.[Abstract/Free Full Text]
    33. 33
  33. Kanopka, A., O. Mühlemann, and G. Aküsjarvi. 1996. Inhibition by SR proteins of splicing of a regulated adenovirus pre-mRNA. Nature 381:535-538.[CrossRef][Medline]
    34. 34
  34. Kohtz, J. D., S. F. Jamison, C. L. Will, P. Zuo, R. Lührmann, M. A. Garcia-Blanco, and J. L. Manley. 1994. Protein-protein interactions and 5'-splice-site recognition in mammalian mRNA precursors. Nature 368:119-124.[CrossRef][Medline]
    35. 35
  35. Lamontagne, B., A. Tremblay, and S. Abou Elela. 2000. The N-terminal domain that distinguishes yeast from bacterial RNase III contains a dimerization signal required for efficient double-stranded RNA cleavage. Mol. Cell. Biol. 20:1104-1115.[Abstract/Free Full Text]
    36. 36
  36. Lavigueur, A., H. La Branche, A. R. Kornblihtt, and B. Chabot. 1993. A splicing enhancer in the human fibronectin alternate ED1 exon interacts with SR proteins and stimulates U2 snRNP binding. Genes Dev. 7:2405-2417.[Abstract/Free Full Text]
    37. 37
  37. Lin, C. H., and J. G. Patton. 1995. Regulation of alternative 3' splice site selection by constitutive splicing factors. RNA 1:234-245.[Abstract]
    38. 38
  38. Liu, H. X., M. Zhang, and A. R. Krainer. 1998. Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins. Genes Dev. 12:1998-2012.[Abstract/Free Full Text]
    39. 39
  39. Lopez, A. J. 1998. Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation. Annu. Rev. Genet. 32:279-305.[CrossRef][Medline]
    40. 40
  40. Lou, H., D. M. Helfman, R. F. Gagel, and S. M. Berget. 1999. Polypyrimidine tract-binding protein positively regulates inclusion of an alternative 3'-terminal exon. Mol. Cell. Biol. 19:78-85.[Abstract/Free Full Text]
    41. 41
  41. McNally, L. M., and M. T. McNally. 1998. An RNA splicing enhancer-like sequence is a component of a splicing inhibitor element from Rous sarcoma virus. Mol. Cell Biol. 18:3103-3111.[Abstract/Free Full Text]
    42. 42
  42. McNally, L. M., and M. T. McNally. 1996. SR protein splicing factors interact with the Rous sarcoma virus negative regulator of splicing element. J. Virol. 70:1163-1172.[Abstract]
    43. 43
  43. Nayler, O., W. Stratling, J. P. Bourquin, I. Stagljar, L. Lindemann, H. Jasper, A. M. Hartmann, F. O. Fackelmayer, A. Ullrich, and S. Stamm. 1998. SAF-B protein couples transcription and pre-mRNA splicing to SAR/MAR elements. Nucleic Acids Res. 26:3542-3549.[Abstract/Free Full Text]
    44. 44
  44. Paca, R. E., C. S. Hibbert, C. T. O'Sullivan, and K. L. Beemon. 2001. Retroviral splicing suppressor requires three nonconsensus uridines in a 5' splice site-like sequence. J. Virol. 75:7763-7768.[Abstract/Free Full Text]
    45. 45
  45. Pagani, F., E. Buratti, C. Stuani, M. Romano, E. Zuccato, M. Niksic, L. Giglio, D. Faraguna, and F. E. Baralle. 2000. Splicing factors induce cystic fibrosis transmembrane regulator exon 9 skipping through a nonevolutionary conserved intronic element. J. Biol. Chem. 275:21041-21047.[Abstract/Free Full Text]
    46. 46
  46. Perez, I., J. G. McAfee, and J. G. Patton. 1997. Multiple RRMs contribute to RNA binding specificity and affinity for polypyrimidine tract binding protein. Biochemistry 36:11881-11890.[CrossRef][Medline]
    47. 47
  47. Petersen-Mahrt, S. K., C. Estmer, C. Ohrmalm, D. A. Matthews, W. C. Russell, and G. Akusjarvi. 1999. The splicing factor-associated protein, p32, regulates RNA splicing by inhibiting ASF/SF2 RNA binding and phosphorylation. EMBO J. 18:1014-1024.[CrossRef][Medline]
    48. 48
  48. Philips, A. V., L. T. Timchenko, and T. A. Cooper. 1998. Disruption of splicing regulated by a CUG-binding protein in myotonic dystrophy. Science 280:737-741.[Abstract/Free Full Text]
    49. 49
  49. Savkur, R. S., A. V. Philips, and T. A. Cooper. 2001. Aberrant regulation of insulin receptor alternative splicing is associated with insulin resistance in myotonic dystrophy. Nat. Genet. 29:40-47.[CrossRef][Medline]
    50. 50
  50. Screaton, G. R., J. F. Cáceres, A. Mayeda, M. V. Bell, M. Plebanski, D. G. Jackson, J. I. Bell, and A. R. Krainer. 1995. Identification and characterization of three members of the human SR family of pre-mRNA splicing factors. EMBO J. 14:4336-4349.[Medline]
    51. 51
  51. Selvakumar, M., and D. M. Helfman. 1999. Exonic splicing enhancers contribute to the use of both 3' and 5' splice site usage of rat beta-tropomyosin pre-mRNA. RNA 5:378-394.[Abstract]
    52. 52
  52. Simard, M. J., and B. Chabot. 2000. Control of hnRNP A1 alternative splicing: an intron element represses use of the common 3' splice site. Mol. Cell. Biol. 20:7353-7362.[Abstract/Free Full Text]
    53. 53
  53. Singh, R., J. Valcárcel, and M. R. Green. 1995. Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins. Science 268:1173-1176.[Abstract/Free Full Text]
    54. 54
  54. Southby, J., C. Gooding, and C. W. J. Smith. 1999. Polypyrimidine tract binding protein functions as a repressor to regulate alternative splicing of {alpha}-actinin mutually exclusive exons. Mol. Cell. Biol. 19:2699-2711.[Abstract/Free Full Text]
    55. 55
  55. Staknis, D., and R. Reed. 1994. SR proteins promote the first specific recognition of pre-mRNA and are present together with the U1 small nuclear ribonucleoprotein particle in a general splicing enhancer complex. Mol. Cell. Biol. 14:7670-7682.[Abstract/Free Full Text]
    56. 56
  56. Stoss, O., M. Olbrich, A. M. Hartmann, H. Konig, J. Memmott, A. Andreadis, and S. Stamm. 2001. The STAR/GSG family protein rSLM-2 regulates the selection of alternative splice sites. J. Biol. Chem. 276:8665-8673.[Abstract/Free Full Text]
    57. 57
  57. Stoss, O., F. W. Schwaiger, T. A. Cooper, and S. Stamm. 1999. Alternative splicing determines the intracellular localization of the novel nuclear protein Nop30 and its interaction with the splicing factor SRp30c. J. Biol. Chem. 274:10951-10962.[Abstract/Free Full Text]
    58. 58
  58. Valcárcel, J., and F. Gebauer. 1997. Post-transcriptional regulation: the dawn of PTB. Curr. Biol. 7:R705-R708.[CrossRef][Medline]
    59. 59
  59. Valcárcel, J., R. Singh, P. D. Zamore, and M. R. Green. 1993. The protein Sex-lethal antagonizes the splicing factor U2AF to regulate alternative splicing of transformer pre-mRNA. Nature 362:171-175.[CrossRef][Medline]
    60. 60
  60. Wagner, E. J., and M. A. Garcia-Blanco. 2001. Polypyrimidine tract binding protein antagonizes exon definition. Mol. Cell. Biol. 21:3281-3288.[Free Full Text]
    61. 61
  61. Wang, Z., H. M. Hoffmann, and P. J. Grabowski. 1995. Intrinsic U2AF binding is modulated by exon enhancer signals in parallel with changes in splicing activity. RNA 1:21-35.[Abstract]
    62. 62
  62. Yuan, Y., D. M. Li, and H. Sun. 1998. PIR1, a novel phosphatase that exhibits high affinity to RNA. ribonucleoprotein complexes. J. Biol. Chem. 273:20347-20353.

Molecular and Cellular Biology, June 2002, p. 4001-4010, Vol. 22, No. 12
0270-7306/02/$04.00+0     DOI: 10.1128/MCB.22.12.4001-4010.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Cloutier, P., Toutant, J., Shkreta, L., Goekjian, S., Revil, T., Chabot, B. (2008). Antagonistic Effects of the SRp30c Protein and Cryptic 5 ' Splice Sites on the Alternative Splicing of the Apoptotic Regulator Bcl-x. J. Biol. Chem. 283: 21315-21324 [Abstract] [Full Text]  
  • Gromak, N., Talotti, G., Proudfoot, N. J., Pagani, F. (2008). Modulating alternative splicing by cotranscriptional cleavage of nascent intronic RNA. RNA 14: 359-366 [Abstract] [Full Text]  
  • Driver, K. E., Song, H., Lesueur, F., Ahmed, S., Barbosa-Morais, N. L., Tyrer, J. P., Ponder, B. A.J., Easton, D. F., Pharoah, P. D.P., Dunning, A. M., for the Studies in Epidemiology and Risks of Cance, (2008). Association of single-nucleotide polymorphisms in the cell cycle genes with breast cancer in the British population. Carcinogenesis 29: 333-341 [Abstract] [Full Text]  
  • Paradis, C., Cloutier, P., Shkreta, L., Toutant, J., Klarskov, K., Chabot, B. (2007). hnRNP I/PTB can antagonize the splicing repressor activity of SRp30c. RNA 13: 1287-1300 [Abstract] [Full Text]  
  • Buratti, E., Stuani, C., De Prato, G., Baralle, F. E. (2007). SR protein-mediated inhibition of CFTR exon 9 inclusion: molecular characterization of the intronic splicing silencer. Nucleic Acids Res 35: 4359-4368 [Abstract] [Full Text]  
  • Ni, J. Z., Grate, L., Donohue, J. P., Preston, C., Nobida, N., O'Brien, G., Shiue, L., Clark, T. A., Blume, J. E., Ares, M. Jr. (2007). Ultraconserved elements are associated with homeostatic control of splicing regulators by alternative splicing and nonsense-mediated decay. Genes Dev. 21: 708-718 [Abstract] [Full Text]  
  • Qi, J., Su, S., Mattox, W. (2007). The doublesex Splicing Enhancer Components Tra2 and Rbp1 Also Repress Splicing through an Intronic Silencer. Mol. Cell. Biol. 27: 699-708 [Abstract] [Full Text]  
  • Wang, Y., Wang, J., Gao, L., Lafyatis, R., Stamm, S., Andreadis, A. (2005). Tau Exons 2 and 10, Which Are Misregulated in Neurodegenerative Diseases, Are Partly Regulated by Silencers Which Bind a SRp30c{middle dot}SRp55 Complex That Either Recruits or Antagonizes htra2{beta}1. J. Biol. Chem. 280: 14230-14239 [Abstract] [Full Text]  
  • Ibrahim, E. C., Schaal, T. D., Hertel, K. J., Reed, R., Maniatis, T. (2005). From the Cover: Serine/arginine-rich protein-dependent suppression of exon skipping by exonic splicing enhancers. Proc. Natl. Acad. Sci. USA 102: 5002-5007 [Abstract] [Full Text]  
  • Boisvert, F.-M., Cote, J., Boulanger, M.-C., Cleroux, P., Bachand, F., Autexier, C., Richard, S. (2002). Symmetrical dimethylarginine methylation is required for the localization of SMN in Cajal bodies and pre-mRNA splicing. JCB 159: 957-969 [Abstract] [Full Text]  
  • Hutchison, S., LeBel, C., Blanchette, M., Chabot, B. (2002). Distinct Sets of Adjacent Heterogeneous Nuclear Ribonucleoprotein (hnRNP) A1/A2 Binding Sites Control 5' Splice Site Selection in the hnRNP A1 mRNA Precursor. J. Biol. Chem. 277: 29745-29752 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Simard, M. J.
Right arrow Articles by Chabot, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Simard, M. J.
Right arrow Articles by Chabot, B.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»