Previous Article | Next Article ![]()
Molecular and Cellular Biology, June 2002, p. 4218-4229, Vol. 22, No. 12
0270-7306/02/$04.00+0 DOI: 10.1128/MCB.22.12.4218-4229.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Suzanna R. S. Scott-Drew, Matthew J. Hayes,,
Philip J. Howard, and James A. H. Murray*
Institute of Biotechnology, University of Cambridge, Cambridge CB2 1QT, United Kingdom
Received 8 October 2001/ Returned for modification 30 November 2001/ Accepted 10 March 2002
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
However, the mechanism by which 2µm escapes MIB resulting in equal segregation is not fully understood, nor have all of the host components involved been identified. Of the four genes carried by the plasmid, REP1 and REP2 are necessary for MIB to be overcome, and their products act at the plasmid locus STB to confer plasmid stability (2, 10, 18, 22, 33, 36). Within the nucleus, Rep1 and Rep2 proteins are localized into discrete foci (39) in which the plasmid is also colocalized (39, 52). These plasmid and protein foci are segregated in a manner similar to that of the chromosomes themselves, a finding consistent with the observation that the 2µm plasmid is packaged into nucleosomes (50). Thus, the plasmid may be exploiting the chromosomal segregation machinery indirectly by associating with specific or nonspecific chromosomal sites. It has been therefore suggested that the segregation of 2µm, and hence its overcoming of MIB, likely requires host (non-plasmid-encoded) genes (18). One candidate is the product of the SHF1 (CST6) gene, which has been shown to bind to STB in vivo and in vitro (51).
Nucleosomes regulate and modify the ability of proteins to interact with DNA, and the remodeling of chromatin and repositioning of nucleosomes is important in gene regulation and other functions of DNA. There is evidence that specific chromatin structures are important in 2µm functions, since the STB region has been reported to be relatively free of nucleosomes (15, 25), and changes occur in nucleosome positioning in the presence of 2µm gene products (50). One class of chromatin remodeling complex is typified by the SWI/SNF and RSC complexes, which contain 8 to 15 subunits (6). SWI/SNF is required for the regulated expression of about 200 yeast genes (35, 44) but is nonessential and of relatively low abundance.
Components of the RSC complex were first isolated as homologs of the SWI/SNF chromatin remodeling complex but, unlike those of the SWI/SNF complex, most of the components of RSC are essential for growth (7, 9, 24, 47). The complex is 10-fold more abundant than the SWI/SNF complex (7) and comprises at least 15 subunits. Sth1 is an essential ATPase in RSC that is required for alteration of the chromatin structure at the centromeres (13, 48), repression of the CHA1 gene (30), and maximal expression of early meiotic genes (54). In addition, both Sth1 and another component, Sfh1, are required for mitotic cell cycle progression (9, 24, 49).
At least two forms of the RSC complex have been identified that have both shared core components and unique subunits. Both Sth1 and Sfh1 are core components, but two proteins found in separate complexes are Rsc1 and Rsc2 (8). Rsc1 and Rsc2 are 45% identical and share the same domain structure, and both contain two bromodomains. Although the rsc1
rsc2
double null mutant is nonviable, the single nulls have relatively mild growth phenotypes, suggesting that there is a high level of redundancy between the two complexes as well as potential unique roles (8).
We have used a genetic screen to isolate mutants deficient in the maintenance of the 2µm plasmid. We show that, surprisingly, five of six mutants isolated have mutations in RSC2. Loss of RSC2 function results in a failure to effectively overcome MIB, and hence cells are defective in 2µm plasmid maintenance. This plasmid instability correlates with significant changes in the chromatin structure at the STB locus and a loss of the normal localization of the Rep proteins. In contrast, loss of the RSC2 homolog RSC1 does not affect 2µm plasmid maintenance. This identifies the 2µm plasmid as uniquely requiring Rsc2 and provides the first evidence for a specific molecular target for the Rsc2-containing complex.
| MATERIALS AND METHODS |
|---|
|
|
|---|
ade1 his3 leu2 trp1 ura3 [cir0] and GY18 MAT
ade1-101 leu2-3,112 his3-11,15 [cir+] (derived from LL20 [16]), A363A MATa ade1 ade2 ura1 his7 lys2 tyr1 gal1 [cir+] (19), W303 MATa ade2 his3 leu2 trp1 ura3 can1-100 (45), and mutant derivatives were grown as previously described at 30°C unless otherwise stated (39). We found only a marginal growth disadvantage for rsc2 mutants at this temperature. YPD medium (1% yeast extract, 2% Bacto Peptone, and 2% D-glucose) was supplemented with Geneticin G418 (Gibco) at 200 µg/ml for selection of KanMX gene disruptants (1). YPGal has glucose replaced by 2% D-galactose. GY59 carrying plasmid 2µm-ADE1 was mutagenized with ethyl methanesulfonate as described previously (46). Mutants were screened for plasmid loss by the qualitative colony sectoring assay described below. Plasmids. Plasmid pZ10 carries one complete copy of the 2µm genome, plus a duplication of one of the inverted repeat sequences, and a 1.4-kb fragment spanning the ADE1 gene inserted within the unique 2µm sequences at the SnaBI site which does not disrupt 2µm plasmid maintenance significantly (4, 11). In addition, pZ10 carries sequences for propagation in Escherichia coli, positioned within the plasmid such that the action of the 2µm Flp recombinase is to excise the bacterial sequences, leaving the plasmid 2µm-ADE1. 2µm-ADE1 is identical to wild-type 2µm plasmid except for the ADE1 insertion and carries no bacterium-derived or other duplicated sequences (Fig. 1A ). pCEN-ADE1 carries a 1.6-kb fragment spanning ADE1 cloned between the XhoI-HindIII sites of pRS313 (41). pASF60 (43) contains multiple copies of the lac operator cloned into the KpnI-SphI sites of plasmid YEplac181a, and pASF135 (43) carries the Lacr lac repressor encoding gene fused to green fluorescent protein (GFP) inserted between the NotI-XhoI sites of pRS303. The series of centromeric plasmids expressing RSC2 with truncated or mutated domains were a gift of B. R. Cairns (8). pCM5 and pCM13 carry RSC2 and RSC1 inserted in the galactose-controlled expression vector pYX143 (R&D Systems, Abingdon, United Kingdom).
|
Loss of native 2µm plasmid was monitored by PCR. Plasmid 2µm was detected by the REP1 amplifying primers (forward primer, ACAGCGCTGATATACAATG; reverse primer, CTGTCGGCTATTATCTCCG) and the presence of the disruption (KanMX) sequence by using internal primers (forward, TAGCCCATACATCCCCATGT; reverse, ACAGGAATCGAATGCAACCG). Single colonies were picked as a template for the amplification reactions, resuspended in a PCR mixture containing 2.5 U of Taq DNA polymerase (Roche), Taq buffer 1, 0.2 µM concentrations of each deoxynucleoside triphosphate, and a 1 µM concentration of each primer, and then cycled as follows: 94°C (10 min), followed by 30 cycles of 94°C (30 s), 55°C (1 min), and 72°C (5 min), with a final 7 min at 72°C.
Complementation of the dpm19 mutant. The dpm19 mutant was complemented with a yeast genomic library in the centromere-containing plasmid YCp50 (37). Since dpm19 loses 2µm-ADE1 rapidly, pZ10 and the library plasmid were used to cotransform dpm19 as described previously (17). Transformants were plated on minimal medium lacking adenine and uracil to select for both 2µm-ADE1 and YCp50. A complementing fragment of 9.3 kb was isolated and designated pMW1. Deletion derivatives identified the complementing gene as RSC2 (Fig. 2A).
|
Chromatin analysis.
Micrococcal nuclease (MNase) analysis of plasmid DNA was carried out as described previously (29, 50) with minor modifications. Yeast cells were washed once with cold water, resuspended in 5 ml of lysis buffer (1 M sorbitol plus 5 mM 2-mercaptoethanol containing 2 mg of 100T Zymolyase [Seikagaku Corp., Tokyo, Japan]) per 1 g (wet weight) of cells, and incubated at 30°C for 20 min. Pelleted cells were washed and resuspended in 7 ml of Ficoll solution (18 [wt/vol] Ficoll type 400 [Sigma], 20 mM KH2PO4 [pH 6.8], 1 mM MgCl2, 0.25 mM EGTA, 0.25 mM EDTA) per 1 g (wet weight) of cells. Cells were centrifuged at 16,000 rpm in a Sorvall SS34 rotor (30 min at 5°C). The nuclear pellet was digested in 1.2 ml of digestion buffer (15 mM Tris-HCl [pH 7.5], 75 mM NaCl, 3 mM MgCl2, 1.5 mM CaCl2, 1 mM 2-mercaptoethanol). Then, 200-µl aliquots were transferred to microfuge tubes, digested with 0.125 to 1 U of MNase (Worthington Biochemical Corp. catalog no. 4797; stock solution dissolved in MNase buffer [50 mM Tris-HCl, pH 8.0; 0.5 mM CaCl2; 20% glycerol] to a concentration of 100 U/µl), and digested for 10 min at 37°C. Digestion was terminated with 30 µl of stop solution (1% sodium dodecyl sulfate [SDS] and 5 mM EDTA, final concentration) and 30 µl of proteinase K (0.5 mg/ml) at 55°C for 2 h. Purified DNA was resuspended in 100 to 200 µl of Tris-EDTA buffer and digested to completion with an appropriate restriction enzyme that cleaves DNA at a site adjacent to the region to be mapped. DNA was electrophoresed on a 1.5% SeaKem LE agarose at 45 V overnight in Tris-borate-EDTA buffer. DNA was transferred to Genescreen (Du Pont) by using the method of Sambrook et al. (38). DNA probes immediately proximal to the chosen restriction enzyme site were used (see Fig. 5 legend). Then, 25 ng of probe was radiolabeled by using [
-32P]dCTP with the Rediprime II kit (Amersham Pharmacia Biotech, Amersham, United Kingdom). Filters were hybridized in 0.5 M NaH2PO4-0.5 M NaH2PO4-7% SDS (pH 7.2) (12) for 48 h at 60°C and washed twice with 2x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate) at 60°C for 5 min and once with 2x SSC-0.1% SDS at 60°C for 30 min.
|
Immunostaining for Rep1 and Rep2 protein was as described previously (39). Images were captured by using a Nikon Optiphot2 with a Hamamatsu Orca2 digital camera and then processed by using Openlab software (Improvision, Ltd., Warwick, United Kingdom).
| RESULTS |
|---|
|
|
|---|
A total of 225,000 colonies were examined after ethyl methanesulfonate mutagenesis of strain GY59 (2µm-ADE1), and six independent colonies exhibited consistent frequent sectoring. 2µm-ADE1 was reintroduced into plasmid-free segregants of each putative mutant, and formation of sectored colonies was observed with all six mutants after the fresh transformation, confirming that a genomic mutation was responsible for the defect in plasmid maintenance (Fig. 1C). These mutants were named dpm (defective in plasmid maintenance) mutants, i.e., the dpm1, dpm3, dpm12, dpm16, dpm18, and dpm19 mutants.
dpm mutants are defective in escaping MIB. Plasmid loss from dpm mutant cells could be caused either by defective plasmid replication or by plasmid missegregation as a consequence of failure to escape MIB. In order to distinguish between these possibilities, we introduced into the dpm mutants the minichromosome (centromeric) plasmid pCEN-ADE1, which replicates by using a 2µm plasmid replication origin but is stably maintained at one to two copies per cell as a consequence of carrying the centromere of chromosome IV. If dpm mutants were affected in plasmid replication, a more severe loss phenotype would be predicted for pCEN-ADE1 than 2µm-ADE1 due to the lower copy number of pCEN-ADE1.
Introduction of pCEN-ADE1 into all six dpm mutants resulted in a mild plasmid loss phenotype with reduced sectoring of colonies (Fig. 1C). A quantitative plasmid stability assay comparing the stability of the centromeric and 2µm plasmids in dpm and wild-type cells showed that all dpm mutants lose 2µm-ADE1 at frequencies of between 15 and 26% per cell per generation (Fig. 1D). In contrast, the loss rate of the centromeric plasmid pCEN-ADE1 was ca. 5% or less per cell per generation. The parent strain GY59 loses both plasmids at ca. 1% per generation.
The results indicate that the stability of a low-copy-number centromeric minichromosome was mildly affected, whereas the stability of the high-copy-number 2µm-ADE1 plasmid carrying the same replication origin was severely affected. Therefore, elevated loss of 2µm-ADE1 in dpm mutants was likely due to a failure of normal 2µm plasmid segregation.
RSC2 complements the mutant phenotype of dpm19.
The dpm19 mutant was cotransformed with a yeast genomic library in the centromeric vector YCp50 (37) and plasmid pZ10, which disintegrates to produce 2µm-ADE1 in yeast cells. Transformants were plated on medium lacking adenine and uracil to select for the presence of both 2µm-ADE1 and YCp50. From about 500 transformed colonies, eight nonsectoring white colonies were obtained. The library plasmids from two of these colonies were found on retransformation to confer a stable ADE+ phenotype on the dpm19 mutant only in the presence of 2µm-ADE1, confirming that these clones reestablished plasmid stability rather than carrying ADE1 genomic sequences. Restriction mapping indicated that both plasmids carried the same fragment of
10 kb, and they were designated pMW1. We note that the frequency of rescuing library clones is high (2/500), which may reflect the extreme instability of 2µm-ADE1 in dpm19 cells, resulting in a low frequency of colony development of noncomplemented transformants.
Partial sequencing of the genomic insert in pMW1 showed that it comprises 9.3 kb of genomic sequence from the right arm of chromosome XII, encompassing five complete (TAL1, ILV5, YLR356W, RSC2, and YLR358C) and two incomplete (BUD8 and ADE13) open reading frames. Deletion and subcloning analysis showed that plasmid pMW4, containing RSC2 and YLR358c complemented the mutant phenotype, whereas pMW5, which contains YLR358c and a partial deletion of RSC2, failed to complement (Fig. 2). Sequencing of the rsc2 allele of the dpm19 mutant showed a single nucleotide deletion at position 871, causing a frameshift mutation. These results indicate that RSC2 is required for normal segregation of 2µm-ADE1.
All dpm mutants except the dpm1 mutant carry alleles of rsc2. Plasmid pMW4, carrying RSC2, was introduced into the five other dpm mutants, together with pZ10. pMW4 was found to complement the mutant phenotype of all of the dpm mutants except the dpm1 mutant, resulting in stable maintenance of the 2µm-ADE1 plasmid. Sequencing of the RSC2 alleles from other dpm mutants confirmed that all mutants except the dpm1 mutant have mutations in RSC2. The dpm16 and dpm19 mutants both have a single base deletion at position 871, but the dpm16 mutant carries an additional A-G base substitution at position 260. The dpm3 mutant has a single base substitution from G to A at position 1402, causing a glutamate residue to be replaced by lysine. The dpm12 mutant has a single C-T base substitution at position 235, converting a glutamine codon to a premature stop. The dpm18 mutant has a single G-to-A base substitution at position 1802, changing the glycine residue to a glutamate.
These results indicate that RSC2 plays a significant role in overcoming MIB in 2µm plasmid maintenance, since five independent rsc2 alleles were identified in our screen. dpm1 was not complemented by RSC2, indicating that at least one other genomic gene is required for 2µm plasmid maintenance.
RSC2 is essential for native 2µm plasmid maintenance.
To confirm that RSC2 is involved in plasmid maintenance, RSC2 was deleted in the haploid strain GY59 carrying 2µm-ADE1 and in strains A364A [cir+] and GY18 [cir+], which harbor the native 2µm plasmid. The GY59 rsc2
(2µm-ADE1) null mutant formed highly sectored colonies identical to dpm19 colonies, indicating high-frequency loss of 2µm-ADE1 (not shown). Since native 2µm plasmid does not confer a phenotype, colonies of A364A rsc2
[cir+] and GY18 rsc2
[cir+] mutants were screened for the presence of native 2µm plasmid by PCR. Immediately after deletion of RSC2, most colonies still contained cells carrying 2µm, a finding consistent with a defect in segregation. After several subcultures, four of six rsc2
colonies contained no plasmid-bearing cells, while all of the colonies of the control RSC2 strain maintained plasmid (Fig. 3). Similar results were obtained with W303 rsc2
and with spores germinated from a diploid GY59 rsc2
x W303 cross (not shown). We conclude that RSC2 is essential for normal 2µm plasmid maintenance.
|
strains.
In GY59 (RSC2), the plasmids were detected in ca. 60 to 80% of cells, and the fluorescent intensity indicated relatively even distribution of the copy number between cells. Plasmids were observed to be concentrated in clusters within the nucleus, and plasmid segregation into daughter buds was generally observed concomitantly with bulk chromatin, as previously reported (Fig. 4A and B) (39, 52). In contrast, in GY59 rsc2
plasmids were found in ca. 5% of cells, which predominantly showed intense fluorescent signals (Fig. 4C and D). Some mother-bud pairs enter mitosis failing to transmit plasmids to the daughter bud (Fig. 4E and F). This is indicative of a high plasmid copy number accumulating in a subset of cells, a finding consistent with the appearance of MIB in rsc2
cells. These observations confirm that RSC2 is required for 2µm to overcome MIB.
|
Formation of Rep foci was examined in GY59 rsc2
by indirect immunofluorescence (39). In wild-type GY59 cells, Rep1 immunofluorescence was observed in the majority of cells and is clearly present in discrete foci (Fig. 4G), which in merged images overlies the bulk of DAPI (4',6'-diamidino-2-phenylindole)-stained chromatin (Fig. 4H). In GY59 rsc2
, Rep1 and Rep2 immunofluorescence was observed in ca. 5% of cells, a finding consistent with the number previously found to contain plasmid, indicating that the loss of segregation of 2µm plasmids in rsc2 mutants is not due to a failure to express the REP genes. However, Rep1 was no longer predominantly observed in foci (Fig. 4I), and the distribution of Rep1 is no longer coincident with the bulk DAPI-stained chromatin (Fig. 4J). Similar observations were made for Rep2 (not shown).
The extreme instability of 2µm-ADE1 in GY59 rsc2
makes it technically difficult to assess colocalization of GFP-labeled plasmid with Rep protein foci. Strain GY18 rsc2
has a less-severe loss rate of native 2µm plasmid than GY59 rsc2
(see above). As expected from previously published data (39, 52), the majority of GFP foci colocalize with Rep1 protein foci in GY18 cells (Fig. 4K to N). In GY18 rsc2
the proportion of cells carrying plasmid is 25% lower than in GY18 and, although the Rep protein has a similar overall staining intensity to GY18 cells, it appears to be less concentrated in foci. In addition, MIB can be observed in some division events (Fig. 4O to R).
The MIB and lack of Rep foci seen in rsc2
mutant cells suggest that Rep proteins may be unable to form productive complexes with STB in the absence of Rsc2. This could be explained by a direct interaction of Rsc2 with the Rep proteins. Two-hybrid analysis between Rep1, Rep2, and Rsc2 confirmed the Rep1-Rep2 interactions previously reported (39, 51), but no interaction between Rsc2 and Rep1 or Rep2 was detected in this assay (data not shown).
Altered STB chromatin structure in rsc2 mutants. Our previous results have shown that Rep protein focus formation requires the presence of plasmids carrying the STB locus (39). An alternative explanation to the MIB and failure to form normal Rep complexes is therefore that Rsc2 is required to create a chromatin structure amenable to Rep protein interaction with plasmid DNA.
The RSC complex perturbs nucleosome structure in vitro (7), and mutation of the RSC component Nps1/Sth1 alters the chromatin structure of centromeres (48), suggesting a possible role for Rsc2 in establishing specific chromatin structures. The chromatin structure of the STB locus, Flp target sites (FRT), and the promoter regions of FLP, REP1, REP2, and RAF were examined by MNase digestion and indirect end labeling in wild-type and rsc2
mutant GY18 [cir+] cells. No changes in the chromatin structure in the promoter regions of the genes (Fig. 5C and D) or the FRT sites (not shown) were observed, demonstrating that Rsc2 is not required for the general nucleosomal structure of 2µm plasmid.
In contrast, a significant difference in the chromatin pattern at the STB region was observed (Fig. 5A). The essential region of STB consists of two repeats of 124 bp superimposed on five repeats of 62 bp located between the plasmid HpaI and AvaI sites (32). In wild-type cells, strong MNase cleavage sites are observed at the borders of STB and a weaker site is seen at the center, together with a general background smear over STB, indicative of partial protection by two protein complexes. In contrast, in rsc2
cells no bands were observed over the STB region, and the central and border cleavage sites were absent or very strongly diminished. The cleavage pattern in rsc2
cells was distinct from that observed with naked DNA (Fig. 5B), indicating that STB continues to interact with proteins in rsc2
cells. We conclude that RSC2 is needed for normal protein-DNA interactions at STB but not for the general chromatin structure of the remainder of the 2µm plasmid.
RSC1 is not required for 2µm plasmid segregation.
RSC2 has previously been shown to be a nonessential component of the RSC complex due to the existence of RSC1, a closely related RSC complex member with 45% identity (62% similarity) to RSC2. Deletion of either RSC1 or RSC2 creates only mild growth phenotypes under specific stress conditions, whereas the deletion of both is lethal. Rsc1 and Rsc2 have been shown to be present in separate subcomplexes that have separate and common targets (7, 8). RSC1 was disrupted in strain GY59 (2µm-ADE1), and the stability of 2µm-ADE1 was assessed in rsc1
and rsc2
strains. 2µm-ADE1 MIB was only observed in the rsc2
strain and not in the rsc1
mutant (Fig. 6A). GAL1-directed expression of RSC2 was able to complement the rsc2
plasmid instability phenotype (Fig. 6B), but GAL1-directed expression of RSC1, which resulted in its accumulation to the same level as that observed with GAL1-RSC2 expression, was unable to complement the MIB phenotype of rsc2
and stabilize 2µm-ADE1. We conclude that Rsc1 is not required for 2µm plasmid segregation, and thus Rsc2 has a unique role in this process.
|
by using plasmids described by Cairns et al. (8), which have previously been shown to result in the approximately equal accumulation of each protein. We found that all domains of Rsc2 are important in its function in 2µm maintenance. Rsc2 derivatives lacking both bromodomains or the CT domain were nonfunctional, indicating that the presence of a BD and the CT domain is essential. Loss of either BD#2 or the BAH had severe effects but the protein retained limited function, whereas Rsc2 with a mutated AT-hook motif or BD#1 resulted in intermediate stability of 2µm-ADE1 (Fig. 7B).
|
| DISCUSSION |
|---|
|
|
|---|
(21). Mechanisms that allow circular DNA molecules to be efficiently transmitted generally involve their association with segregated nuclear structures (5, 14, 23, 27, 28). The 2µm plasmid of S. cerevisiae is a rare example of a widespread high-copy-number eukaryotic nuclear extrachromosomal element. In order to be maintained in yeast populations, 2µm must therefore possess a mechanism allowing it to overcome MIB. Although the 2µm plasmid contains only four open reading frames, the molecular details of how this is achieved are not clear. The plasmid proteins Rep1 and Rep2 associate with the STB locus (18, 51) and result in the localization of plasmid and Rep proteins to discrete subnuclear foci which are segregated at mitosis and appear to be associated with bulk nuclear chromatin (39, 52).
Here we show that chromatin structure is central to plasmid stability and demonstrate that 2µm plasmid is a novel target for Rsc2, which contains two bromodomains (34, 53) and is a component of the RSC complex (7, 8). The related protein Rsc1 is unable to substitute for Rsc2. This is the first example of a phenotype attributed to RSC2 that is correlated with specific changes in chromatin structure in vivo.
Six chromosomal mutants were isolated that maintain the 2µm-like plasmid 2µm-ADE1 poorly and, by complementation with a genomic library, RSC2 was found to rescue the mutant phenotype of the dpm19 mutant and four other dpm mutants. RSC2 disruption in other strains revealed a phenotype similar to that of the dpm19 mutant, affecting not only 2µm-ADE1 but also the native 2µm plasmid. A failure of RSC2 to complement dpm1 indicates that there is at least one other gene that is required for 2µm plasmid maintenance.
RSC1, a homologue of RSC2, has 45% identity (62% similarity), and both RSC1 and RSC2 have been shown to be present in different subcomplexes that have both separate and common targets (8). The combined loss of both RSC1 and RSC2 is lethal, but loss of either results in mild growth defects (8). We have shown that the role of RSC2 in 2µm plasmid stability is unique, since loss of RSC1 has no effect on 2µm maintenance.
A high plasmid loss rate could be due to a failure either in plasmid replication or in the segregation of the replicated molecules. Plasmid replication failure would be predicted to produce a low average plasmid copy number across the cell population, whereas segregation failure would lead to a high plasmid copy number in a small population of cells. We believe that it is unlikely that the failure of plasmid maintenance in rsc2 mutants is due to a failure in DNA replication, since the loss rate of the high-copy-number 2µm-ADE1 is substantially higher than that of a low-copy-number centromere-containing plasmid, pCEN-ADE1. This is supported by the visualization of plasmids with a GFP-Lacr fusion that shows accumulation of plasmid at a high copy number in a small proportion of rsc2 cells. In certain instances plasmids were observed failing to segregate, despite the presence of a significant plasmid signal. This demonstrates that plasmid segregation rather than replication is primarily affected in rsc2 mutants.
2µm plasmid is condensed into 21 to 34 nucleosomes per plasmid that closely resemble those of chromosomal DNA (26). The protection of 2µm chromatin from nuclease digestion is not random within the plasmid (25), and in particular the STB region has an abnormal structure (15, 50). Our analysis of the 2µm chromatin structure in rsc2 mutants suggests the following. First, the chromatin structure is only altered within STB, and no changes were observed in the promoter regions of the four open reading frames. This indicates that loss of RSC2 does not perturb the overall chromatin structure of 2µm plasmid but rather has a specific effect on STB. Second, RSC2 does not seem to form a stable complex with the STB region, since there is no increase in sensitivity at STB when RSC2 is absent. Finally, we found no interaction between either Rep1 or Rep2 and Rsc2 in two-hybrid assays (not shown).
STB has been divided into two domains, lying on either side of the unique HpaI site. STB-distal is the region further from the replication origin (Ori) and corresponds to the transcription termination region of the RAF gene. STB-proximal is made up of five direct tandem repeats of an AT-rich 62-bp consensus sequence which can also be aligned as two tandem repeats of 124 bp (32) and is the binding site of Rep1-Rep2 complexes (51). Our results suggest that, in wild-type cells, STB-proximal is protected by two protein complexes that bind to the tandem repeat sequences and are separated by a nuclease-sensitive spacer sequence and flanked by hypersensitive sites. These may represent complexes on each of the 124-bp repeats. In the absence of RSC2, a more extensive complex is formed that is able to bind the spacer region and protects the whole of STB-proximal from nuclease digestion. The two sensitive sites at the border of the STB-proximal are displaced and have reduced nuclease sensitivity. This change in chromatin structure is coincident with the failure of plasmid segregation.
rsc2 mutant cells therefore exhibit MIB of 2µm despite the presence of Rep1 and Rep2. We propose that the altered STB chromatin structure observed in rsc2 mutants is due to the failure of productive Rep protein-STB complexes to form. In rsc2 mutant cells, Rep1 is nuclear but is less distinctly localized into discrete foci. We have previously shown that the ability of Rep1 to form normal subnuclear foci requires the presence of plasmids carrying STB (39). The absence of such Rep1 foci in rsc2 mutants is therefore consistent with a failure of Rep1 to interact correctly with STB. We therefore propose that in wild-type cells RSC2 functions to maintain the correct nucleosome positioning at the STB so that a productive segregation protein complex can bind the STB and effect plasmid segregation. In the absence of Rsc2, STB chromatin is not maintained in the correct form, and thus the protein complexes may bind, randomly producing an unproductive complex. Alternatively, a different complex may be able to bind to the STB sequence, preventing efficient plasmid segregation.
Recently, Sengupta et al. (40) have shown that specific domains of Rep1 and Rep2 mediate dimerization, interaction, and DNA binding. They proposed that competition between Rep1 and Rep2 for association with Rep1 determines the formation or disassembly of the segregation complex. Changes in the chromatin structure at STB may influence this competition, promoting disassembly or otherwise changing the segregation complex and leading to segregation failure.
Surprisingly, five of six of the dpm mutants that we generated contain a mutation in RSC2. dpm12, dpm16, and dpm19 mutants have mutations which cause frameshifts of premature termination and hence abolish the function of the C terminus of the RSC2 gene and produce a phenotype similar to that of an rsc2 null mutant. dpm3 and dpm18 mutants have point mutations within the BAH and C terminus, respectively, and identify E467 and G600 as key residues in Rsc2 function.
Overall, the structure of 2µm-derived plasmid constructs has long been suspected to be important in influencing their stability. For example, Futcher and Cox (16) found that plasmids that carry very similar regions of the 2µm genome, but in different DNA contexts, can differ substantially in stability. Moreover, the plasmid chromatin structure is dependent on the plasmid proteins present (50). Here we present strong evidence that the chromatin structure of STB is of key importance in allowing the plasmid to escape MIB and show that Rsc2 is essential for maintaining that chromatin structure. Remaining challenges include the characterization of the complexes that bind STB in both wild-type and rsc2 backgrounds.
| ADDENDUM IN PROOF |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Present address: Department of Biotechnology, Faculty of Food Science and Biotechnology, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. ![]()
Present address: Department of Cell Biology, Institute of Ophthalmology, University College London, London EC1V 9EL, United Kingdom. ![]()
| REFERENCES |
|---|
|
|
|---|
2.
Ahn, Y. T., X. L. Wu, S. Biswal, S. Velmurugan, F. C. Volkert, and M. Jayaram. 1997. The 2µm plasmid-encoded Rep1 and Rep2 proteins interact with each other and colocalize to the Saccharomyces cerevisiae nucleus. J. Bacteriol. 179:7497-7506.
3.
Baudin, A., O. Ozier-Kalogeropoulos, A. Denouel, F. Lacroute, and C. Cullin. 1993. A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res. 21:3329-3330.
4. Bijvoet, J. F. M., A. L. Van der Zanden, N. Goosen, J. Brouwer, and P. Van de Putte. 1991. DNA insertions in the "silent" regions of the 2µ plasmid of Saccharomyces cerevisiae influence plasmid stability. Yeast 7:347-356.[CrossRef][Medline]
5. Brand, A. H., G. Micklem, and K. Nasmyth. 1987. A yeast silencer contains sequences that can promote autonomous plasmid replication and transcriptional activation. Cell 51:709-719.[CrossRef][Medline]
6. Cairns, B. R. 1998. Chromatin remodeling machines: similar motors, ulterior motives. Trends Biochem. Sci. 23:20-25.[CrossRef][Medline]
7. Cairns, B. R., Y. Lorch, Y. Li, M. Zhang, L. Lacomis, H. Erdjument-Bromage, P. Tempst, J. Du, B. Laurent, and R. D. Kornberg. 1996. RSC, an essential, abundant chromatin-remodeling complex. Cell 87:1249-1260.[CrossRef][Medline]
8. Cairns, B. R., A. Schlichter, H. Erdjument-Bromage, P. Tempst, R. D. Kornberg, and F. Winston. 1999. Two functionally distinct forms of the RSC nucleosome-remodeling complex, containing essential AT hook, BAH, and bromodomains. Mol. Cell 4:715-723.[CrossRef][Medline]
9. Cao, Y., B. R. Cairns, R. D. Kornberg, and B. C. Laurent. 1997. Sfh1p, a component of a novel chromatin-remodeling complex, is required for cell cycle progression. Mol. Cell. Biol. 17:3323-3334.[Abstract]
10. Cashmore, A. M., M. S. Albury, C. Hadfield, and P. A. Meacock. 1986. Genetic analysis of partitioning functions encoded by the 2µ circle of Saccharomyces cerevisiae. Mol. Gen. Genet. 203:154-162.[CrossRef]
11. Chinery, S. A., and E. Hinchliffe. 1989. A novel class of vector for yeast transformation. Curr. Genet. 16:21-25.[CrossRef][Medline]
12. Church, G. M., and W. Gilbert. 1984. Genomic sequencing. Proc. Natl. Acad. Sci. USA 81:1991-1995.
13.
Du, J., I. Nasir, B. K. Benton, M. P. Kladde, and B. C. Laurent. 1998. Sth1p, a Saccharomyces cerevisiae Snf2p/Swi2p homolog, is an essential ATPase in RSC and differs from Snf/Swi in its interactions with histones and chromatin-associated proteins. Genetics 150:987-1005.
14. Enomoto, S., M. S. Longtine, and J. Berman. 1994. Enhancement of telomere-plasmid segregation by the X-telomere associated sequence in Saccharomyces cerevisiae involves SIR2, SIR3, SIR4 and ABF1. Genetics 136:757-767.[Abstract]
15. Fagrelius, T. J., and D. M. Livingston. 1984. Location of DNase I-sensitive cleavage sites in the yeast 2µ plasmid DNA chromosome. J. Mol. Biol. 173:1-13.[CrossRef][Medline]
16.
Futcher, A. B., and B. S. Cox. 1983. Maintenance of the 2µ circle plasmid in populations of Saccharomyces cerevisiae. J. Bacteriol. 154:612-622.
17. Gietz, R. D., and R. H. Schiestl. 1995. Transforming yeast with DNA. Methods Mol. Cell. Biol. 5:255-269.
18.
Hadfield, C., R. C. Mount, and A. M. Cashmore. 1995. Protein binding interactions at the STB locus of the yeast 2µ plasmid. Nucleic Acids Res. 23:995-1002.
19. Hartley, J. L., and J. E. Donelson. 1980. Nucleotide sequence of the yeast plasmid. Nature 286:860-864.[CrossRef][Medline]
20. Hieter, P., D. Pridmore, J. H. Hegemann, M. Thomas, R. W. Davis, and P. Philippsen. 1985. Functional selection and analysis of yeast centromeric DNA. Cell 42:913-921.[CrossRef][Medline]
21.
Houtteman, S. W., and R. T. Elder. 1993. A DNA polymerase mutation that suppresses the segregation bias of an ARS plasmid in Saccharomyces cerevisiae. Mol. Cell. Biol. 13:1489-1496.
22. Kikuchi, Y. 1983. Yeast plasmid requires a cis-acting locus and two plasmid proteins for its stable maintenance. Cell 35:487-493.[CrossRef][Medline]
23.
Kimmerly, W. J., and J. Rine. 1987. Replication and segregation of plasmids containing cis-acting regulatory sites of silent mating-type genes in Saccharomyces cerevisiae are controlled by the SIR genes. Mol. Cell. Biol. 7:4225-4237.
24.
Laurent, B. C., X. Yang, and M. Carlson. 1992. An essential Saccharomyces cerevisiae gene homologous to SNF2 encodes a helicase-related protein in a new family. Mol. Cell. Biol. 12:1893-1902.
25. Livingston, D. M. 1982. A sequence of the yeast 2µm DNA plasmid chromosome near the origin of replication is exposed to restriction endonuclease digestion. J. Mol. Biol. 160:397-410.[CrossRef][Medline]
26.
Livingston, D. M., and S. Hahne. 1979. Isolation of a condensed, intracellular form of the 2µ DNA plasmid of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 76:3727-3731.
27.
Longtine, M. S., S. Enomoto, S. L. Finstad, and J. Berman. 1992. Yeast telomere repeat sequence (TRS) improves circular plasmid segregation, and TRS plasmid segregation involves the RAP1 gene product. Mol. Cell. Biol. 12:1997-2009.
28. Longtine, M. S., S. Enomoto, S. L. Finstad, and J. Berman. 1993. Telomere-mediated plasmid segregation in Saccharomyces cerevisiae involves gene products required for transcriptional repression at silencers and telomeres. Genetics 133:171-182.[Abstract]
29. Moreira, J. M., and S. Holmberg. 1998. Nucleosome structure of the yeast CHA1 promoter: analysis of activation-dependent chromatin remodeling of an RNA-polymerase-II-transcribed gene in TBP and RNA pol II mutants defective in vivo in response to acidic activators. EMBO J. 17:6028-6038.[CrossRef][Medline]
30. Moreira, J. M., and S. Holmberg. 1999. Transcriptional repression of the yeast CHA1 gene requires the chromatin-remodeling complex RSC. EMBO J. 18:2836-2844.[CrossRef][Medline]
31. Murray, A. W., and J. W. Szostak. 1983. Pedigree analysis of plasmid segregation in yeast. Cell 34:961-970.[CrossRef][Medline]
32. Murray, J. A. H., and G. Cesareni. 1986. Functional analysis of the yeast 2µ plasmid partition locus STB. EMBO J. 5:3391-3399.[Medline]
33. Murray, J. A. H., M. Scarpa, N. Rossi, and G. Cesareni. 1987. Antagonistic controls regulate copy number of the yeast 2µ plasmid. EMBO J. 6:4205-4212.[Medline]
34. Ornaghi, P., P. Ballario, A. M. Lena, A. Gonzalez, and P. Filetici. 1999. The bromodomain of Gcn5p interacts in vitro with specific residues in the N terminus of histone H4. J. Mol. Biol. 287:1-7.[CrossRef][Medline]
35. Peterson, C. L., and J. L. Workman. 2000. Promoter targeting and chromatin remodeling by the SWI/SNF complex. Curr. Opin. Genet. Dev. 10:187-192.[CrossRef][Medline]
36.
Reynolds, A. E., A. W. Murray, and J. W. Szostak. 1987. Roles of the 2µm gene products in stable maintenance of the 2µm plasmid of Saccharomyces cerevisiae. Mol. Cell. Biol. 7:3566-3573.
37. Rose, M. D., P. Novick, J. H. Thomas, D. Botstein, and G. R. Fink. 1989. A Saccharomyces cerevisiae genomic plasmid bank based on a centromere-containing shuttle vector. Gene 60:237-243.
38. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
39. Scott-Drew, S. R. S., and J. A. H. Murray. 1998. Localization and interaction of the protein components of the yeast 2µ circle plasmid partitioning system suggest a mechanism for plasmid inheritance. J. Cell Sci. 111:1779-1789.[Abstract]
39. Scott-Drew, S. R. S., M. V. L. Wong, and J. A. H. Murray. DNA plasmid transmission in yeast is associated with specific subnuclear localization during cell division. Cell Biol. Int., in press.
40.
Sengupta, A., K. Blomqvist, A. J. Pickett, Y. Zhang, J. S. Chew, and M. J. Dobson. 2001. Functional domains of yeast plasmid-encoded Rep proteins. J. Bacteriol. 183:2306-2315.
41.
Sikorski, R. S., and P. Hieter. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27.
42. Stinchcomb, D. T., K. Struhl, and R. W. Davis. 1979. Isolation and characterisation of a yeast chromosomal replicator. Nature 282:39-43.[CrossRef][Medline]
43. Straight, A. F., A. S. Belmont, C. C. Robinett, and A. W. Murray. 1996. GFP tagging of budding yeast chromosomes reveals that protein-protein interactions can mediate sister chromatid cohesion. Curr. Biol. 6:1599-1608.[CrossRef][Medline]
44.
Sudarsanam, P., V. R. Iyer, P. O. Brown, and F. Winston. 2000. Whole-genome expression analysis of snf/swi mutants of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 97:3364-3369.
45.
Thomas, B. J., and R. Rothstein. 1989. The genetic control of direct-repeat recombination in Saccharomyces: the effect of rad52 and rad1 on mitotic recombination at GAL10, a transcriptionally regulated gene. Genetics 123:725-738.
46.
Thrash-Bingham, C., and W. L. Fangman. 1989. A yeast mutation that stabilizes a plasmid bearing a mutated ARS1 element. Mol. Cell. Biol. 9:809-816.
47. Treich, I., and M. Carlson. 1997. Interaction of a Swi3 homolog with Sth1 provides evidence for a Swi/Snf-related complex with an essential function in Saccharomyces cerevisiae. Mol. Cell. Biol. 17:1768-1775.[Abstract]
48.
Tsuchiya, E., T. Hosotani, and T. Miyakawa. 1998. A mutation in NPS1/STH1, an essential gene encoding a component of a novel chromatin-remodeling complex RSC, alters the chromatin structure of Saccharomyces cerevisiae centromeres. Nucleic Acids Res. 26:3286-3292.
49. Tsuchiya, E., M. Uno, A. Kiguchi, K. Masuoka, Y. Kanemori, S. Okabe, and T. Mikayawa. 1992. The Saccharomyces cerevisiae NPS1 gene, a novel CDC gene which encodes a 160-kDa nuclear protein involved in G2 phase control. EMBO J. 11:4017-4026.[Medline]
50.
Veit, B. E., and W. L. Fangman. 1985. Chromatin organization of the Saccharomyces cerevisiae 2µm plasmid depends on plasmid-encoded products. Mol. Cell. Biol. 5:2190-2196.
51.
Velmurugan, S., Y. T. Ahn, X. M. Yang, X. L. Wu, and M. Jayaram. 1998. The 2µm plasmid stability system: analyses of the interactions among plasmid- and host-encoded components. Mol. Cell. Biol. 18:7466-7477.
52.
Velmurugan, S., X. M. Yang, C. S. Chan, M. Dobson, and M. Jayaram. 2000. Partitioning of the 2µ circle plasmid of Saccharomyces cerevisiae: functional coordination with chromosome segregation and plasmid-encoded Rep protein distribution. J. Cell Biol. 149:553-566.
53. Winston, F., and C. D. Allis. 1999. The bromodomain: a chromatin-targeting module? Nat. Struct. Biol. 6:601-604.[CrossRef][Medline]
54. Yukawa, M., S. Katoh, T. Miyakawa, and E. Tsuchiya. 1999. Nps1/Sth1p, a component of an essential chromatin-remodeling complex of Saccharomyces cerevisiae, is required for the maximal expression of early meiotic genes. Genes Cells 4:99-110.[Abstract]
This article has been cited by other articles:
| |||||||||||||||||||||||||||