Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) A retraction has been published A retraction has been published Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tanaka, K. Articles by Yamada, Y. Search for Related Content PubMed PubMed Citation Articles by Tanaka, K. Articles by Yamada, Y.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, June 2002, p. 4256-4267, Vol. 22, No. 12
0270-7306/02/$04.00+0     DOI: 10.1128/MCB.22.12.4256-4267.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

A Krüppel-Associated Box-Zinc Finger Protein, NT2, Represses Cell-Type-Specific Promoter Activity of the 2(XI) Collagen Gene

Kazuhiro Tanaka,^1,2 Noriyuki Tsumaki,¹ Christine A. Kozak,³ Yoshihiro Matsumoto,² Fumihiko Nakatani,² Yukihide Iwamoto,² and Yoshihiko Yamada^1*

Craniofacial Developmental Biology and Regeneration Branch, National Institute of Dental and Craniofacial Research,¹ Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892,³ Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan²

Received 4 January 2002/ Returned for modification 8 February 2002/ Accepted 13 March 2002

Top Abstract Introduction Materials and Methods Results Discussion References

 
Type XI collagen is composed of three chains, 1(XI), 2(XI), and 3(XI), and plays a critical role in the formation of cartilage collagen fibrils and in skeletal morphogenesis. It was previously reported that the -530-bp promoter segment of the 2(XI) collagen gene (Col11a2) was sufficient for cartilage-specific expression and that a 24-bp sequence from this segment was able to switch promoter activity from neural tissues to cartilage in transgenic mice when this sequence was placed in the heterologous neurofilament light gene (NFL) promoter. To identify a protein factor that bound to the 24-bp sequence of the Col11a2 promoter, we screened a mouse limb bud cDNA expression library in the yeast one-hybrid screening system and obtained the cDNA clone NT2. Sequence analysis revealed that NT2 is a zinc finger protein consisting of a Krüppel-associated box (KRAB) and is a homologue of human FPM315, which was previously isolated by random cloning and sequencing. The KRAB domain has been found in a number of zinc finger proteins and implicated as a transcriptional repression domain, although few target genes for KRAB-containing zinc finger proteins has been identified. Here, we demonstrate that NT2 functions as a negative regulator of Col11a2. In situ hybridization analysis of developing mouse cartilage showed that NT2 mRNA is highly expressed by hypertrophic chondrocytes but is minimally expressed by resting and proliferating chondrocytes, in an inverse correlation with the expression patterns of Col11a2. Gel shift assays showed that NT2 bound a specific sequence within the 24-bp site of the Col11a2 promoter. We found that Col11a2 promoter activity was inhibited by transfection of the NT2 expression vector in RSC cells, a chondrosarcoma cell line. The expression vector for mutant NT2 lacking the KRAB domain failed to inhibit Col11a2 promoter activity. These results demonstrate that KRAB-zinc finger protein NT2 inhibits transcription of its physiological target gene, suggesting a novel regulatory mechanism of cartilage-specific expression of Col11a2.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cartilage is a highly specialized tissue and serves as the template for the growth and development of most bones. Cartilage development is initiated by mesenchymal cell condensation, followed by a series of chondrocyte maturation processes including resting, proliferative, and hypertrophic stages. Cartilage contains an extensive extracellular matrix which includes type II, IX, and XI collagens and provides mechanical strength to resist compression in joints. Type II collagen, a major collagen in cartilage, forms collagen fibrils and provides a structural framework for cartilage matrix. Type XI collagen coassembles stoichiometrically with type II collagen in the fibrils, whereas the type IX collagen is associated with the surface of the fibrils (30, 46).

The type XI collagen molecule is composed of three subunits: 1(XI), 2(XI), and 3(XI) (32). The 3(XI) chain is a posttranslational variant of the 1(II) chain (14), whereas the 1(XI) and 2(XI) chains are distinct gene products (5, 22). Type XI collagen plays a critical role in regulating the formation of the collagen fibrils (30, 38). It has been reported that a null mutation in the gene for the 1(XI) chain results in chondrodysplasia in cho/cho mice (27). Mutations in the 2(XI) chain cause chondrodysplasias in humans, such as Stickler syndrome and otospondylomegaepiphyseal dysplasia, indicating that type XI collagen is intimately involved in skeletal morphogenesis (47). These observations indicate that the fidelity of type XI collagen expression is essential for maintaining normal cartilage structure and function.

Expression of Col11a2 appears to be predominantly restricted to cartilage (43). Transcriptional regulation of Col11a2 is mediated by tissue-specific regulatory elements within the -742-bp promoter of Col11a2 (44). It was shown that the -530-bp promoter sequence is sufficient for cartilage-specific expression of Col11a2 (45). It has been suggested that SOX9, a member of the transcription factor family with an high-mobility-group (HMG)-type DNA binding domain homologous to that of SRY (17, 54), plays an important role in the regulation of Col11a2 expression. Mutations in the gene for SOX9 cause campomelic dysplasia, a severe dwarfism syndrome, which affects all cartilage-derived structures (12, 49, 52). SOX9 binds to HMG-box-like sequences in the Col11a2 promoter and increases the promoter activity (6). It has been shown that a 24-bp sequence from -530 to -507 in the Col11a2 promoter is able to switch the activity of the heterologous neurofilament light gene (NFL) promoter from neural tissues to cartilage (45). It was also found that the deletion of a sequence between -530 and -500 abolished reporter gene expression in cartilage in transgenic mice and induced neural tissue-specific expression (45). These observations suggest that Col11a2 expression is regulated by both positive and negative regulators.

A number of genes encoding the C₂H₂-type zinc finger domain have been identified (4, 23). The Krüppel-associated box (KRAB) is a highly conserved motif of 75 amino acids that is found in approximately one-third of the C₂H₂-type zinc finger proteins (3). It has been suggested that the KRAB domain acts as a potent transcriptional repression domain (9, 29, 34, 37, 48, 53, 58); however, these studies were done using artificial DNA binding motifs fused to the KRAB domains and target DNA sequences such as the GAL4 binding domain and GAL4 upstream activation sequence to demonstrate repressor activity of the KRAB domains. Therefore, little is known about physiological target genes for KRAB domain-containing proteins and their functional interactions.

Previous observation using reporter gene constructs in transgenic mice suggested that a 24-bp sequence in the Col11a2 promoter inhibits Col11a2 expression in neural tissues but is necessary for cartilage-specific expression of the gene (45). To understand the cartilage-specific regulatory mechanism involved in the 24-bp sequence, we screened a mouse limb bud cDNA library using the yeast one-hybrid system (26, 50) and identified KRAB-zinc finger protein factor NT2, which bound to the 24-bp sequence. We found that NT2 expression was inversely correlated with expression of Col11a2 and that it inhibited Col11a2 promoter activity via binding to the 24-bp site through the KRAB domain. Our results suggest a novel mechanism by which cartilage-specific expression of Col11a2 is negatively regulated during embryonic development and chondrocyte differentiation.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Yeast strains and gene constructs. Saccharomyces cerevisiae YM4271 (MATa ura3-52 his3-200 leu2-3,112 trp1-903) and reporter vectors pHISi and pLacZi were obtained from Clontech (Palo Alto, Calif.). The reporter construct was generated by inserting three head-to-tail copies of the 24-bp sequence (5'-CAGGGAGGAGGGAGAGCGGCTGCT-3'), which corresponds to the mouse Col11a2 promoter sequence (-530 to -507) (44), into the EcoRI and XbaI sites of pHISi or the EcoRI and XhoI sites of pLacZi. These plasmids were linearized and integrated into yeast YM4271 genomes. The yeast host strain was maintained by selection on synthetic dextrose medium lacking histidine and uracil.

For a GAL4 activation domain-tagged cDNA library, poly(A)⁺ RNA was extracted from the limb buds of 13.5-day-old mouse embryos using the Micro-FastTrack kit (Invitrogen, Carlsbad, Calif.). An oligo(dT)-primed cDNA library was constructed with the HybriZap phage vector (Stratagene, La Jolla, Calif.). The plasmid (pAD-GAL4) library was obtained by in vivo excision according to the manufacturer's instructions (Stratagene). The library had a complexity of 2.2 x 10⁶ PFU and an average insert size of about 1.7 kb.

Screening of the GAL4 activation domain cDNA library. Screening of the cDNA library was performed with a yeast strain carrying the HIS3 and lacZ reporter genes containing three copies of the 24-bp sequence of the Col2a1 promoter (described above) by a lithium acetate method (40). The transformed yeast cells were plated under selective conditions with synthetic dextrose medium lacking histidine and leucine. The cells grown on the selective plates were transferred onto nitrocellulose filters. The membranes were frozen in liquid nitrogen and assayed for ß-galactosidase activity. An estimated 2.7 x 10⁶ transformants were selected, and 44 positive clones were obtained from the first screening. Twenty positive clones were recovered in the secondary screening.

Cell lines. Chondrogenic cells (ATDC5) (41) and rat chondrosarcoma cells (RCS) (33) were from Yuji Hiraki and James H. Kimura. Mouse cells (BALB/3T3 and 10T1/2), rat myoblast cells (L6), mouse myoblast cells (C2C12), mouse osteoblastic cells (MC3T3), and rat osteosarcoma cells (ROS17/2.7) were obtained from the American Type Culture Collection (Manassas, Va.).

Northern hybridization. Total RNA was extracted from various cell lines and newborn mouse tissues using the RNeasy Mini kit (Qiagen). Northern blot analysis was performed by electrophoresis of 20 µg of total RNA or 2 µg of poly(A)⁺ RNA, and RNA was transferred onto Nytran membranes (Schleicher & Schuell) as described (39). cDNAs were labeled with [-³²P]dCTP using the Prime-it II kit (Stratagene). The membranes were hybridized with the labeled probes at 42°C in 50% formamide, washed first at room temperature in 1x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and 0.1% sodium dodecyl sulfate (SDS) and then at 60°C in 0.1x SSC and 0.1% SDS and exposed to autoradiography film.

Western blotting. Cell lysates and nuclear extracts were prepared as described previously (25). Two micrograms of protein samples was fractionated by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred onto a nylon membrane. The blots were incubated with anti-NT2 or anti-Flag antibody, and signals were detected with an ECL kit (Amersham). The anti-Flag antibodies were obtained from Sigma (St. Louis, Mo.). The anti-NT2 polyclonal antibodies were raised against the C-terminal portion of NT2 (amino acid residues 323 to 345) (Fig. 1) by immunizing rabbits. The antibodies were purified using an ImmunoPure IgG Purification kit (Pierce, Rockford, Ill.). The immunoglobulin G fractions were also passed through an NT2-Sepharose affinity column to deplete reactivity to NT2 and were used to demonstrate specific reactivity of the anti-NT2 antibodies.

View larger version (78K): [in this window] [in a new window]

FIG. 1. Alignment of mouse NT2 and human FPM315 amino acid sequences. The sequence of the mouse clone NT2 (upper sequence, M; GenBank no. AF499776) is compared with that of human FPM315 (lower sequence, H; GenBank no. AC004232) (56). Numbers refer to amino acid positions in the mouse protein. Vertical lines denote amino acid identities. Boxes outline nine conserved zinc finger motifs. The boldface underlining indicates the KRAB-A subdomain, and the thin underlining indicates the LeR domain.

In situ hybridization. Digoxigenin-11-UTP-labeled single-strand antisense RNA probes for Col11a2, Col10a1, and NT2 were prepared using the DIG RNA labeling kit (Boehringer Mannheim, Indianapolis, Ind.) according to the manufacturer's instructions. The sense riboprobes for Col11a2 and NT2 were also prepared and used as negative controls. In situ hybridization was performed as described previously (18). After deparaffinization, the sections were treated with 10 µg of proteinase K/ml for 15 min at room temperature and subjected to 0.2 N HCl to inactivate endogenous alkaline phosphatase. Hybridization was performed at 50°C with 50% formamide, and washes were carried out at a stringency of 2x SSC containing 50% formamide at 55°C. Then, the slides were subjected to 10 mg of RNase A/ml in TNE (10 mM Tris-HCl [pH 8.0], 500 mM NaCl, 1 mM EDTA) at 37°C for 30 min for the digestion of nonhybridized transcripts and washed. A Genius Detection system (Boehringer Mannheim) was used to detect signals according to the manufacturer's instructions.

Electrophoretic mobility shift assays (EMSAs). The expression vectors pCA1F (42) and pcDNA3.1 (Invitrogen) were used to express Flag-tagged or nontagged NT2 proteins. A PCR product for full-length NT2 was cloned into the EcoRI and XhoI sites of pCA1F or pcDNA3.1. In vitro-translated NT2 protein was prepared by the TNT Coupled Reticulocyte Lysate system (Promega, Madison, Wis/). WT, a 24-bp, double-stranded, wild-type probe (5'-GGCAGGGAGGAGGGAGAGCGGCTGCT) corresponding to the Col11a2 promoter sequence, was used for the yeast screening described above. G residues were added for labeling with [-³²P]dCTP by Klenow fragment (Life Technologies, Gaithersburg, Md.). Substitution mutation probes, used as competitors, were prepared and their plus strand sequences are as follows (mutated nucleotides are underlined): M1, 5'-CATTTGTTAGGGAGAGCGGCTGCT-3'; M2, 5'-CAGGGAGGAGTTGTGTCGGCTGCT3'; M3, 5'-CAGGGAGGAGGGAGAGCTTACTAT3'; M4, 5'-AGGGGAGGAGGGAGAGCGGCTGCT-3'; M5, 5'-CATTGAGGAGGGAGAGCGGCTGCT-3'; M6, 5'-CAGGTGGGAGGGAGAGCGGCTGCT-3'; M7, 5'-CAGGGATTAGGGAGAGCGGCTGCT-3'; M8, 5'-CAGGGAGGGTGGAGAGCGGCTGCT-3'; M9, 5'-CAGGGAGGAGTTAGAGCGGCTGCT-3'; M10, 5'-CAGGGAGGAGGGGTAGCGGCTGCT-3'; M11, 5'-CAGGGAGGAGGGAGGTCGGCTGCT-3'; and M12, 5'-CAGGGAGGAGGGAGAGATGCTGCT-3'.

EMSA was performed using the GelShift assay kit (Stratagene) according to the manufacturer's instructions.

DNA transfection assays. DNA was transfected into various cells using Fugene 6 (Boehringer Mannheim) according to the manufacturer's instructions. The expression vector pCA1F-NT2 was transiently transfected into RCS cells to express Flag-tagged NT2 protein. To express deletion mutants of pNT2, pNT21 (amino acids 130 to 680), pNT22 (amino acids 210 to 680), and pNT23 (amino acids 300 to 680) were generated by subcloning EcoRI/XhoI PCR fragments from NT2 into the corresponding sites of the pCA1F vector. pNT24 was generated by subcloning EcoRI/SalI (amino acids 1 to 216) and SalI/XhoI (amino acids 258 to 680) PCR fragments of NT2 into the corresponding sites of the pCA1F vector. The anti-Flag antibodies were used to detect the expression of Flag-tagged NT2 proteins. The reporter constructs p742luc, p530luc, p518luc, and p500luc contained the 742, 530, 518, and 500 bp of the Col11a2 promoter, respectively, and these were linked to the luciferase reporter gene (44, 45). The reporter construct p530Mluc is the same as p530luc except for a substitution mutation at the NT2 binding site. The reporter constructs containing the promoter of human NFL (hNF-L), pNFluc, and three tandem copies of the 24-bp sequence (-530 to -507) of Col11a2 fused to the hNF-L, p24 x 3-NFluc, were linked to the luciferase reporter gene. pGL3-Control and pRL-SV40 (Promega) were used as a positive control and an internal control for normalization of transfection efficiency, respectively. The transfected cells were harvested 48 h after transfection and assayed for luciferase activity using the Dual-Luciferase Reporter assay system (Promega).

Genetic mapping. NT2 was mapped by Southern blot analysis of two genetic crosses: (NFS/N or C58/J x M. musculus musculus) x M. m. musculus (23a) and (NFS/N x Mus spretus) x M. spretus or C58/J (1a). Digestion of parental mouse DNAs with EcoRI produced NT2 fragments of 9.4 kb in NFS/N and 8.2 kb in M. spretus and M. m. musculus.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Isolation of cDNA clones for proteins interacting with the Col11a2 promoter. We previously identified a 24-bp sequence (-530 to -507) as a regulatory site for Col11a2 transcription. To identify a nuclear factor that bound to the sequence, we screened a 13.5-day-old mouse embryo limb bud cDNA library by the yeast one-hybrid screening method using a yeast strain harboring three tandem copies of the 24-bp sequence as a target. After secondary screening, 20 positive clones were isolated and sequenced. Seventeen of them were found to encode the NT2 protein and were further characterized, whereas the remaining 3 clones were nonspecific clones. DNA sequence analysis revealed that NT2 encodes a 690-amino acid polypeptide with the KRAB-A subdomain, a leucine-rich region (LeR) at the N terminus, and nine C₂H₂-type zinc finger motifs at its carboxyl terminus. The LeR domain is rich in leucine and glutamic acid residues and contains alpha helices. The LeR is often found in KRAB-containing zinc finger proteins (2, 7, 10, 24, 35, 36, 51, 55). The NT2 clone appears to be a homologue of a human cDNA clone, FPM315, previously identified by random cloning and sequencing (56). Chromosomal mapping supported this notion. FPM315 is mapped on chromosome 16p13.3 (56) (GenBank number AC004232). We have mapped the NT2 gene at the centromeric end of mouse chromosome 16 with the following gene order and recombinational distances: Ftl-rs8 - 3.4 ± 1.1 - Znf263 - 5.1 ± 1.4 - Igl, Hcf2. The gene maps to regions of conserved synteny in the human and mouse genomes. Sequence comparison between NT2 and human FPM315 revealed that overall nucleotide and amino acid identities were 85.0 and 84.1%, respectively (Fig. 1). The LeR and KRAB domains are highly conserved between human and mouse species: 97.4% amino acid identity in zinc finger motifs, 97.0% in the LeR domain, and 90.2% in the KRAB-A subdomain, respectively.

Inverse correlation of the expression pattern of NT2 and Col11a2 in chondrocyte differentiation and developing cartilage. The expression of mouse NT2 mRNA was analyzed in tissues from newborns and various cell types by Northern blotting and in mouse embryos by in situ hybridization. Northern analysis of total RNA from newborn mice revealed that NT2 mRNA was strongly expressed in the brain, thymus, and spleen and in rib cartilage, whereas little expression was found in skeletal muscle or in the heart, liver, or kidney (Fig. 2A). NT2 mRNA was highly expressed in chondrogenic cell lines ATDC5, BALB/3T3, and 10T1/2 and an osteoblastic cell line, MC3T3 (Fig. 2B), which did not synthesize Col11a2 mRNA. In contrast, the level of NT2 mRNA was weak in chondrocytic RCS cells, a rat chondrosarcoma cell line which produces a large amount of Col11a2 mRNA. A low level of NT2 mRNA was observed in muscle cell lines L6 and C2C12 and osteosarcoma cell line ROS17/2.7; Col11a2 expression was also weak. We also examined the protein expression of NT2 in RCS, NIH 3T3, and undifferentiated ATDC5 cells by Western blotting with anti-NT2 antibodies (Fig. 2C). In RCS cells, although some expression of NT2 mRNA was observed, the level of NT2 protein was very low (Fig. 2C, lane 4). On the other hand, high levels of NT2 protein, approximately 75 kDa in size, were found in NIH 3T3 and undifferentiated ATDC5 cells (Fig. 2C, lanes 2 and 3), corresponding to strong expression of NT2 mRNA. In vitro-translated NT2 protein also showed a single band of 75 kDa (Fig. 2C, lane 1). This protein band was not detected when the antibodies had depleted reactivity against purified NT2 synthesized in vitro (Fig. 2C, lanes 5 and 6), indicating specificity of the NT2 antibodies.

View larger version (83K): [in this window] [in a new window]

FIG. 2. mRNA and protein expressions of NT2 in various tissues and cell types. (A) Analysis of NT2 expression in newborn mouse tissues by Northern blotting. For each lane, 20 µg of total RNA from various tissues was loaded, transferred to the nylon membrane, and hybridized with labeled NT2 cDNA. NT2 mRNA was strongly expressed in the brain, thymus, spleen, and rib cartilage. Lane 1, brain; lane 2, thymus; lane 3, heart; lane 4, liver; lane 5, spleen; lane 6, kidney; lane 7, skeletal muscle; lane 8, rib cartilage. (B) Total RNA (20 µg/lane) extracted from various cells was analyzed by Northern blotting using the NT2 cDNA probe. NT2 mRNA was highly expressed in BALB/3T3, 10T1/2, undifferentiated ATDC5, and MC3T3 cells (ATDC5 is a chondrocytic cell line and MC3T3 is an osteoblastic cell line), whereas low expression was seen with RCS cells (RCS is a rat chondrosarcoma cell line). Lane 1, BALB/3T3; lane 2, 10T1/2; lane 3, undifferentiated ATDC5; lane 4, RCS; lane 5, MC3T3; lane 6, ROS17/2.7; lane 7, L6; lane 8, C2C12. The lower panels show ethidium bromide-stained gels. (C) Western blot analysis of NT2 protein expression in cell lines. Nuclear extracts (2 µg) from cells were fractionated by SDS-PAGE, blotted, and incubated with NT2 antibodies. In vitro-translated NT2 (2 µg) was also subjected to Western blot analysis. To show the specificity of NT2 antibodies, the antibodies with NT2 reactivity depleted by NT2-Sepharose affinity column chromatography were also used as a control (NT2 antibody). Lane 1, in vitro-translated NT2; lane 2, NIH 3T3; lane 3, undifferentiated ATDC5; lane 4, RCS; lane 5, NIH 3T3 with NT2 antibody; lane 6, undifferentiated ATDC5 with NT2 antibody. Protein standards are indicated on the left. The arrowhead indicates the NTZ protein band. (D) DNA binding of NT2 in cells to the labeled wild-type Col11a2 promoter. The 24-bp DNA sequence CAGGGAGGAGGGAGAGCGGCTGCT was used to prepare a double-stranded probe. EMSAs were performed with nuclear extracts from RCS (lanes 1 and 2), NIH 3T3 (lanes 3 and 4), and undifferentiated ATDC5 (lanes 5 and 6) cells. The presence (+) or absence (-) of antibodies against NT2 is indicated. The large arrow indicates NT2-promoter complexes (lanes 3 and 5). The small arrow marks supershifted NT2-promoter complexes by the anti-NT2 antibodies (lanes 4 and 6). The arrowheads indicate RCS cell-specific protein-promoter complexes (lanes 1 and 2). These complexes are specific to RCS cells and are not found in either NIH 3T3 or undifferentiated ATDC5 cells and are not supershifted by anti-NT2 antibodies.

We next examined nuclear factor binding to the 24 bp of the Col11a2 promoter by EMSA (Fig. 2D). The nuclear extracts from NIH 3T3 and undifferentiated ATDC5 cells formed a protein complex with the 24-bp probe (Fig. 2D). The complex was supershifted by the addition of anti-NT2 antibodies, suggesting that it contains NT2 protein (Fig. 2, lanes 3 to 6). RCS cell nuclear extracts formed two protein-DNA complexes whose gel mobilities were different from those obtained with extracts from NIH 3T3 and undifferentiated ATDC5 cells (lanes 1 to 2) and were not supershifted by anti-NT2 antibodies, indicating that the complexes did not contain NT2.

In situ hybridization in the forearm of 16.5-day-old mouse embryos revealed that NT2 mRNA was expressed in the hypertrophic zone, whereas its expression was very low in the resting and proliferative zones (Fig. 3A and D). As expected, strong signals for Col11a2 mRNA were detected in the proliferating and prehypertrophic zones (Fig. 3B), while Col10a1 mRNA was expressed predominantly in the prehypertrophic and hypertrophic zones (Fig. 3C). The expression of NT2 mRNA was strong in the prehypertrophic and hypertrophic zones but weak in the proliferating zone (Fig. 3D), similar to that of Col10a1, a marker of hypertrophic chondrocytes. Since the 24-bp sequence has the ability to switch promoter activity of the neurofilament gene from neural tissues to cartilage, we also examined the expression pattern of NT2 in brain. In the frontal cortex of the brain of 16.5-day-old mouse embryos, the expression of NT2 mRNA was observed in the marginal zone, cortical plate, and ventricular zone where NFL mRNA was found (Fig. 3F and G). Sense NT2 probes showed no staining in the limb and brain sections (Fig. 3E and H). NT2 mRNA expression during chondrogenesis was next examined by in situ hybridization using sections of mouse embryos at various stages. The signals for NT2 mRNA were ubiquitous except in the neural tube and somites in 8.5- and 9.5-day-old mouse embryos (Fig. 4A and B). The mesenchymal condensation was observed in 12.5-day-old embryos with Col11a2 mRNA expression in the ribs and vertebral cartilage primordia (Fig. 4D), whereas NT2 mRNA expression was almost absent in these locations (Fig. 4F). Sense NT2 and Col11a2 probes showed no staining in these tissues (Fig. 4C, E, and G). These results also indicate an inverse correlation between the expression patterns of NT2 and those of Col11a2.

View larger version (131K): [in this window] [in a new window]

FIG. 3. In situ hybridization of longitudinal sections of the radius or forebrain of 16.5-day-old mouse embryos with antisense Col11a2, Col10a1, and NT2 or with sense NT2 riboprobes labeled with digoxigenin-11-UTP. (A) Staining with hematoxylin and eosin of the radius in the forelimb. h, hypertrophic chondrocytes; r, resting chondrocytes; p, proliferating chondrocytes. (B) Expression of Col11a2 in a semiserial section. Strong signals of Col11a2 were detected in the resting and proliferating chondrocytes. (C) Expression of Col10a1 was observed in hypertrophic chondrocytes. (D) NT2 mRNA was highly expressed in the hypertrophic zone; however, its expression was very weak in the resting and proliferative zones. The localization of NT2 mRNA was similar to that of Col10a1, a marker gene of hypertrophic chondrocytes. (E) Sense NT2 riboprobes showed no signals in the serial section. (F) Expression of NT2 mRNA in the forebrain of 16.5-day-old mouse embryos. Expression of NT2 was observed in the frontal cortex (fc) of the forebrain. (G) Higher magnification of the frontal cortex demonstrates that the signal for NT2 mRNA was detected in the marginal zone (mz), cortical plate (cp), and ventricular zone (vz) but was weak in the intermediate zone (im). (H) Sense NT2 riboprobes showed no signals in the brain section.

View larger version (109K): [in this window] [in a new window]

FIG. 4. In situ hybridization of axial sections of 8.5- (A), 9.5- (B), and 12.5- (C and D)day-old mouse embryos with antisense or sense NT2 and Col11a2 riboprobes labeled with digoxigenin-11-UTP. The signals for NT2 mRNA were ubiquitous but were almost absent in the neural tube and somites in the 8.5- and 9.5-day-old mouse embryos (A and B). The sense NT2 probes showed no signals in the serial section of 9.5-day-old embryos (C). In the 12.5-day-old embryo, Col11a2 mRNA was strongly expressed at the mesenchymal condensations for rib and vertebral cartilage primordia (D), whereas NT2 mRNA was not expressed in these locations (F). Negative controls using sense Col11a2 (E) and NT2 (G) showed no signals in the semiserial sections. lb, limb bud; nt, neural tube; r, rib cartilage primordia; s, somite; v, vertebral cartilage primordia.

Next, expression patterns of NT2 mRNA were examined during differentiation of ATDC5 cells (Fig. 5). In the presence of insulin, ATDC5 cells differentiate into a proliferating chondrocyte phenotype and subsequently into a hypertrophic chondrocyte phenotype concomitant with the formation of cellular nodules (41). After 1 week in cultures in a confluent condition with insulin, the cells began to form nodules and to express Col11a2, at which time NT2 expression was downregulated. We separated the nodule- and non-nodule-forming ATDC5 cell populations, because these cells are mixed populations, with nodule-forming cells representing the chondrocytic phenotype. In 2-week cultures, NT2 expression was not detectable in the nodule-forming cells where Col11a2 mRNA was expressed at high levels (Fig. 5, lane 2). In the non-nodule-forming cells, NT2 mRNA was expressed at high levels, whereas Col11a2 mRNA was not present (Fig. 5, lane 1). Further culturing for 3 to 5 weeks switched the expression of Col11a2 to Col10a1, indicative of terminal differentiation of ATDC5 cells. As the expression of the collagen types was switched from Col11a2 to Col10a1 in differentiating ATDC5 cells, NT2 expression was induced again. In 5-week cultures, the nodule-forming cells expressed Col10a1 and NT2, whereas Col11a2 mRNA was not detectable in these cells (Fig. 5, lane 3). These results indicate an inverse correlation in the expression pattern between NT2 and Col11a2.

View larger version (65K): [in this window] [in a new window]

FIG. 5. Expression of NT2 in differentiating ATDC5 cells in vitro. ATDC5 cells were cultured with 10-µg/ml bovine insulin for differentiation. After 2 weeks in culture under confluent conditions, the cells differentiated into the proliferative chondrocyte phenotype and formed nodules. The nodule- and nonnodule-forming cell populations were separated using sharp forceps under a stereomicroscope, and total RNA (20 µg/lane) from the two cell populations was electrophoresed in each lane, transferred to a nylon membrane, and hybridized with NT2, Col11a2, and Col10a1 cDNA probes as indicated at the left of the panels (lanes 1 and 2). The nodule-forming cells then differentiated into the hypertrophic chondrocyte phenotype after the cells were incubated for 5 weeks. The total RNA was extracted and subjected to Northern blot analysis (lane 3). NT2 mRNA was strongly detected in undifferentiated cells (lane 1), but the expression level was decreased when the cells differentiated into the proliferative chondrocyte and began to express Col11a2 (lane 2). As the expression of the collagen types was switched from Col11a2 to Col10a1 in differentiating ATDC5 cells, NT2 expression was induced again (lane 3). The lower panels show the ethidium bromide staining of the gel.

NT2 protein specifically binds to the Col11a2 promoter sequence. The Flag-tagged, full-length NT2 protein was synthesized by an in vitro transcription-translation system and examined for its binding activity to the Col11a2 promoter (Fig. 6). NT2 was able to bind to the 24-bp sequence from the Col11a2 promoter (WT) (Fig. 6B, lane 2). We performed competition experiments with unlabeled oligonucleotides with substitution mutations to determine a target sequence within the 24-bp sequence for NT2 binding. An excess of the unlabeled WT abolished binding of NT2 to the 24-bp site (Fig. 6B, lane 3). Mutated oligonucleotide M3 inhibited the binding similar to WT, whereas M1 and M2 failed to block NT2 binding to the 24-bp site (Fig. 6B, lanes 4 to 6). These results suggest that the sequences used to create the M1 and M2 substitution mutations are critical for the NT2 binding site. Binding of NT2 to the labeled WT was also inhibited by excess unlabeled M4, M5, M11, and M12 (Fig. 6B, lanes 9, 10, 16, and 17) but not by M6 to M10 (Fig. 6B, lanes 11 to 15). These results indicate that the NT2 protein binds specifically to the Col11a2 promoter and that the core binding sequence is GAGGAGGGAG.

View larger version (46K): [in this window] [in a new window]

FIG. 6. Specific DNA binding of NT2 to Col11a2 promoter analyzed by EMSA. (A) The gene structure of the promoter (-742 to +1) and exon 1 of Col11a2. The 3'-portion of the retinoid X receptor ß gene (Rxrb) was indicated. The coding strand sequences of the WT oligonucleotide probes corresponding to the target sequence (-530 to -507) for the yeast one-hybrid screening and the competitors with substitution mutations (M1 through M12) used in EMSA were also indicated. Only mutated nucleotides are shown. (B) In the left panel, lane 2 shows that NT2 bound to the WT Col11a2 promoter sequence. Lanes 3 to 6 show competition between the labeled WT probe and the 50-fold molar excess of cold probes. Lane 1, no competitor. DNA binding of NT2 was inhibited by the addition of WT or M3, whereas M1 and M2 probes showed minimal inhibition. The right panel shows that the DNA binding of NT2 to labeled WT oligonucleotides (lane 7) was inhibited by addition of cold WT (lane 8), M4 (lane 9), M5 (lane 10), M11 (lane 16), and M12 (lane 17) probes. The M6, M7, M8, M9, and M10 probes did not affect the binding of NT2 to the promoter (lanes 11 to 15), indicating that the core binding sequence of NT2 in the promoter is GAGGAGGGAG. Lane 7, no competitor.

NT2 represses chondrocyte-specific Co1l1a2 promoter activity via KRAB-A subdomain. An expression vector of NT2 (pCA1F-NT2) was cotransfected with Col11a2 promoter-luciferase reporter gene constructs into RCS cells to examine whether NT2 exerts its inhibitory activity on the Col11a2 promoter. The reporter constructs p742luc and p530luc, which contain different sizes of the functional promoter, were both active in RCS cells but inactive in BALB/3T3, 10T1/2, or NIH 3T3 cells, indicating cell type specificity of promoter activity. p500luc was inactive in all cell types (data not shown). When pCA1F-NT2 was cotransfected with p530luc into RCS cells, Col11a2 promoter activity was reduced in a dose-dependent manner to approximately 20% of that of the control (Fig. 7). The repression by NT2 was not due to a general suppressive effect on transcriptional regulation, since NT2 showed no significant effects on the luciferase activity of the pGL3-Control plasmid driven by the simian virus 40 (SV40) promoter (Fig. 7). NT2 also failed to repress the luciferase activity of p530Mluc, which contained substitution mutations in the NT2 binding site (Fig. 7). These results suggest that NT2 specifically inhibits Col11a2 promoter activity.

View larger version (15K): [in this window] [in a new window]

FIG. 7. Cotransfection experiments showing the suppressive effect of NT2 on Col11a2 promoter activity. RCS cells were transiently transfected with 2 µg of reporter plasmid (pGL3-Control, p530luc, or p530Mluc) along with a total of 4 µg of pCA1F expression vector that either did or did not contain the NT2 cDNA as indicated. NT2 reduced Col11a2 promoter activity of p530luc to 21% of the control in a dose-dependent manner, whereas it did not affect the luciferase activity of the pGL3-Control plasmid driven by the SV40 promoter. NT2 did not affect the luciferase activity of p530Mluc, which has substitution mutations at the NT2 binding site. A Renilla luciferase expression vector, pRL-SV40, was used as an internal control for transfection efficiency. The relative luciferase activities are average values ± the standard errors for three independent transfected cultures from two repeated experiments.

To examine which region of the NT2 protein is important for the suppression of the promoter activity, we prepared NT2 expression constructs with deletion mutations (Fig. 8A). The protein expression from each plasmid was confirmed by Western blotting with anti-Flag antibody (Fig. 8B). The mutant proteins containing zinc finger motifs were active for DNA binding (data not shown). When pCA1F-NT2 or NT21 was cotransfected with p530luc in RCS cells, inhibition of promoter activity was observed. However, NT22 and NT23 did not exhibit any inhibitory effect on Col11a2 promoter activity. Moreover, NT24, in which only the KRAB-A subdomain was missing, also lost the inhibitory effect on Col11a2 promoter activity. These data indicate that the suppressive effect of NT2 on Col11a2 promoter activity is mediated, at least in part, through the KRAB-A subdomain.

View larger version (37K): [in this window] [in a new window]

FIG. 8. The effect of deletions in NT2 on the inhibition of Col11a2 promoter activity. (A) Full-length FPM315 has an LeR domain, a KRAB-A subdomain and nine zinc finger motifs as reported by Yokoyama et al. (56). In NT24, the KRAB-A subdomain of NT2 is deleted. The predicted molecular weight of each protein is indicated at the right of the panel. (B) Western blot analysis of deletion mutant NT2 proteins. In vitro-translated proteins (2 µg) were fractionated by SDS-PAGE, blotted, and incubated with anti-Flag antibodies. Lane 1, full-length NT2; lane 2, NT21; lane 3, NT22; lane 4, NT23; lane 5, NT24. Protein standards are indicated on the left. (C) Cotransfection experiments showing the effect of the KRAB-A subdomain in NT2 on Col11a2 promoter activity. RCS cells were transiently transfected with 2 µg of p530luc along with a total of 4 µg of pCA1F expression vector that either did or did not contain the deleted NT2 cDNA as indicated. Full-length NT2 and NT21 significantly inhibited Col11a2 promoter activity, consistent with the data shown in Fig. 7. However, NT22 and NT23 did not affect the luciferase activity of p530luc. Furthermore, NT24 also failed to inhibit Col11a2 promoter activity. pRL-SV40 was used as an internal control for transfection efficiency. The relative luciferase activities are average values ± the standard errors for three independent transfected cultures from two repeated experiments.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Transcriptional factors play central roles in gene regulation and cellular differentiation. Cumulative evidence has demonstrated that transcriptional repression plays crucial roles in regulating cell-type-specific gene expression and that a number of genes are controlled by a balance between activation and repression factors (15, 20). While much attention has been focused on understanding transcriptional activation, the precise mechanisms of transcriptional repression are not well understood. Compared to the number of activation elements, only a few DNA motifs that mediate transcriptional repression have been identified (3, 8, 11, 16). The KRAB domain was originally identified as a conserved motif consisting of 75 amino acids that is present in about one-third of the Krüppel-type C₂H₂ zinc finger proteins. The KRAB domain is subdivided into two subdomains, KRAB-A and -B. The KRAB-A subdomain is always present in the KRAB-containing proteins, whereas the KRAB-B subdomain is not always there (3). It has been shown that several KRAB-A domains act as potent transcriptional repressors when heterologously tethered to promoters (29, 37, 53) and that KRAB-B potentiates the repression exerted by the KRAB-A domain (48). Recently, the KRAB domain has been shown to associate with a KRAB-binding protein, KAP-1/TIF1ß/KRIP-1, that acts as a universal corepressor for the KRAB domain and plays an important role in KRAB-mediated transcriptional repression (1, 13, 21, 31, 34). Although it has been well demonstrated that the KRAB domain is a potent DNA binding-dependent repressor domain, these studies were performed by using heterologous DNA binding motifs fused to the KRAB domain (9, 58). Few physiological target genes of the KRAB-containing zinc finger proteins have been identified. It has been shown that a KRAB-zinc finger protein, AJ18, bound to a CCACA motif that is also the binding site for Runx2/Cbfa-1/Osf2, a master gene for osteogenic differentiation, and that AJ18 suppressed Runx2-mediated transactivation of osteocalcin promoter construct (19). However, these studies used the promoter with six copies of the consensus binding sequence utilized by Runx2, and the direct interaction of AJ18 with the osteocalcin promoter has not been demonstrated (19). Zheng et al. recently reported that a novel KRAB protein, ZBRK1, repressed transcriptional activity of the GADD45 gene by binding to a specific sequence within intron 3 of GADD45 (57). In the present study, we identified a KRAB-containing zinc finger protein, NT2, that bound to the 24-bp sequence in the Col11a2 promoter that is critical for tissue-specific expression of Col11a2. NT2 showed an inverse correlation of expression patterns with Col11a2 and inhibited Col11a2 promoter activity via the KRAB domain. Our finding is the first demonstration that the KRAB-zinc finger protein is involved in the control of cartilage-specific gene expression.

We previously reported that Col11a2 is regulated by modular arrangement of several cis-acting elements, the cartilage-specific element (-530 to -501), a neural tissue-specific element (-501 to -454), and a basal promoter element without any tissue specificity (distal to -453) (45). The deletion of a sequence between -530 and -500 abolished reporter gene expression in cartilage and induced neural tissue-specific expression in transgenic mice. We have also shown that the 24-bp sequence (-530 to -507) is able to switch promoter activity of the NFL gene from neural tissues to cartilage (45). In the present study, the reporter construct pNFluc containing the functional neurofilament promoter showed no activity in RCS cells; however, p24 x 3-Nfluc, containing three copies of the 24-bp Col11a2 sequence in the neurofilament promoter, had activity in RCS cells (data not shown), consistent with the results with transgenic mice (45). These results suggest that the 24-bp cartilage-specific cis element has dual activities, one for inactivation of transcription in certain Col11a2-nonexpressing tissues, such as neural tissues, and the other for activation of transcription in cartilage. In this study, we showed that NT2 functions as a suppressor to inactivate cartilage-specific activity of the Col11a2 promoter through binding to the 24-bp site. Since the expression pattern of the reporter gene bearing the -500-bp promoter of Col11a2 in neural tissues in transgenic mice was very similar to that of NT2 (45) (Fig. 3F and G), NT2 may inhibit promoter activity in these neural tissues.

The most prominent cell types where NT2 is expressed are mesenchymal cells and hypertrophic chondrocytes. NT2 is strongly expressed in undifferentiated ATDC5 cells, whereas it is downregulated during differentiation of ATDC5 cells into the chondrocytic phenotype where Col11a2 is expressed. Little expression of NT2 was also observed in RCS cells, which express Col11a2 (Fig. 2). When ATDC5 cells further differentiate into hypertrophic chondrocytes, in which Col11a2 expression is downregulated, the expression level of NT2 is increased again (Fig. 5). These observations are consistent with the in situ hybridization data, in which expression of NT2 is weak in the resting and proliferating chondrocytes in developing cartilage but is expressed strongly in the hypertrophic zones where Col11a2 is downregulated (Fig. 3). In 8.5- and 9.5-day-old mouse embryos, NT2 mRNA showed very low levels of expression in the somites and sclerotomes (Fig. 4A and B), suggesting that downregulation of NT2 occurs during early mesoderm differentiation. The level of NT2 expression is very reduced in mesenchymal condensations in 12.5-day-old embryos, indicating an inverse relationship of the expression patterns in vivo between NT2 and Col11a2 (Fig. 4D and F). These findings support the notion that NT2 is involved in both the early and late stages of chondrocyte differentiation.

Although SOX9 has been shown to interact with both the promoter and enhancer elements of Col11a2 (6, 28), the 24-bp Col11a2 sequence used in the present study does not contain HMG consensus sites for SOX9 binding. EMSA with nuclear extracts from RCS cells demonstrated cell-type-specific protein binding to the 24-bp sequence (Fig. 2D). The supershift assay using anti-NT2 antibodies revealed that the DNA-protein complexes did not contain NT2, consistent with the data from Northern blotting that NT2 expression was weak in RCS cells. Interestingly, anti-SOX9 antibodies also failed to supershift the cell-type-specific complex (data not shown). Therefore, in RCS cells, positive chondrocyte-specific factors other than SOX9 are likely to interact with the 24-bp site.

NT2 is likely a homologue of the human protein FPM315, based on DNA and protein homology and chromosomal map location. The overall nucleotide and amino acid identities between NT2 and FPM315 were 85.0 and 84.1%, respectively. The LeR, KRAB-A, and nine zinc-finger motifs are highly conserved between humans and mice: 97.0% amino acid identity in the LeR domain, 90.2% in the KRAB-A domain, and 97.4% in zinc finger motifs (Fig. 1). The LeR domain is rich in leucine and highly conserved in a number of other zinc finger proteins (2, 7, 10, 24, 35, 36, 51, 55). The LeR domain is sometimes found in zinc finger proteins containing KRAB; however, our deletion experiments suggest that this domain is not involved in the KRAB-mediated suppression of Col11a2 promoter by NT2 (Fig. 8). The LeR domain is also enriched in glutamic acid residues and contains alpha helices. Although the function of the LeR domain is not known, the conservation of the domain and its alpha-helical structures suggest that it mediates interactions with other proteins containing similar motifs. The highly conserved, nine zinc finger motifs are found in the C-terminal portion of NT2. The DNA binding of NT2 is mediated by five zinc finger motifs at the C terminus, since this portion still retains binding activity to the 24-bp sequence (data not shown). The four remaining zinc finger motifs may not play a central role in DNA binding; however, they may stabilize the protein-DNA interaction.

Recently, a zinc finger transcription factor, CRYBP1, was identified as a repressor for Col2a1 enhancer activity through binding to the enhancer with a yeast one-hybrid screening system (42). The CRYBP1-binding sequence on the Col2a1 enhancer is located just 1 bp upstream from the SOX9 binding sequence (25). Although CRYBP1 does not contain the KRAB domain, CRYBP1 competes for binding to the Col2a1 enhancer with SOX9 and inhibits transcriptional activation by SOX9 (42). Cotransfection experiments revealed that CRYBP1 did not inhibit promoter activity of Col11a2 and that NT2 could not reduce enhancer activity of Col2a1 (data not shown). Since the 24-bp sequence of Col11a2 does not contain the SOX9 binding site, it is likely that NT2 and CRYBP1 suppress promoter activity of two different cartilage collagen genes through distinct mechanisms.

These observations indicate that these two zinc finger proteins may have different target genes and functions. On the other hand, in situ hybridization and Northern blot assays demonstrated that CRYBP1 and NT2 almost coexpressed in developing mouse embryos, tissues in newborn mice, and various cell lines. Both CRYBP1 and NT2 are expressed in undifferentiated mesenchymal cells in early stages of mouse embryos, downregulated during the mesenchymal condensations, and strongly expressed in hypertrophic chondrocytes (42). Thus, these two zinc finger proteins might coordinately function in the development of cartilaginous tissues.

In conclusion, we have identified a repressor protein, NT2, that inhibits the chondrocyte-specific activity of the Col11a2 promoter via the KRAB-A subdomain. Our results suggest that this negative regulatory factor plays a role in controlling the expression of Col11a2 and underscore the importance of both positive and negative control mechanisms in cartilage development.

 
This work was supported by NIH intramural funds; a Health Science Research Grant for Research on Human Genome, Tissue Engineering, and Food Biotechnology from the Ministry of Health, Labour, and Welfare, Japan; and a grant from the Japan Orthopaedics and Traumatology Foundation (no. 0116).

 
* Corresponding author. Mailing address: Building 30, Room 405, NIDCR, NIH, Bethesda, MD 20892. Phone: (301) 496-2111. Fax: (301) 402-0897. E-mail: yoshi.yamada{at}nih.gov.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Abrink, M., J. A. Ortiz, C. Mark, C. Sanchez, C. Looman, L. Hellman, P. Chambon, and R. Losson. 2001. Conserved interaction between distinct Kruppel-associated box domains and the transcriptional intermediary factor 1 beta. Proc. Natl. Acad. Sci. USA 98:1422-1426.[Abstract/Free Full Text]
1
2. Adamson, M. C., J. Silver, and C. A. Kozak. 1991. The mouse homolog of the Gibbon ape leukemia virus receptor: genetic mapping and a possible receptor function in rodents. Virology 183:778-781.[CrossRef][Medline]
2
3. Attar, R. M., and M. Z. Gilman. 1992. Expression cloning of a novel zinc finger protein that binds to the c-fos serum response element. Mol. Cell. Biol. 12:2432-2443.[Abstract/Free Full Text]
3
4. Bellefroid, E. J., D. A. Poncelet, P. J. Lecocq, O. Revelant, and J. A. Martial. 1991. The evolutionarily conserved Kruppel-associated box domain defines a subfamily of eukaryotic multifingered proteins. Proc. Natl. Acad. Sci. USA 88:3608-3612.[Abstract/Free Full Text]
4
5. Berg, J. M., and Y. Shi. 1996. The galvanization of biology: a growing appreciation for the roles of zinc. Science 271:1081-1085.[Abstract]
5
6. Bernard, M., H. Yoshioka, E. Rodriguez, M. Van der Rest, T. Kimura, Y. Ninomiya, B. R. Olsen, and F. Ramirez. 1988. Cloning and sequencing of pro-alpha 1 (XI) collagen cDNA demonstrates that type XI belongs to the fibrillar class of collagens and reveals that the expression of the gene is not restricted to cartilaginous tissue. J. Biol. Chem. 263:17159-17166.[Abstract/Free Full Text]
6
7. Bridgewater, L. C., V. Lefebvre, and B. de Crombrugghe. 1998. Chondrocyte-specific enhancer elements in the Col11a2 gene resemble the Col2a1 tissue-specific enhancer. J. Biol. Chem. 273:14998-15006.[Abstract/Free Full Text]
7
8. Chowdhury, K., M. Goulding, C. Walther, K. Imai, and H. Fickenscher. 1992. The ubiquitous transactivator Zfp-38 is upregulated during spermatogenesis with differential transcription. Mech. Dev. 39:129-142.[CrossRef][Medline]
8
9. Dawson, S. R., D. L. Turner, H. Weintraub, and S. M. Parkhurst. 1995. Specificity for the hairy/enhancer of split basic helix-loop-helix (bHLH) proteins maps outside the bHLH domain and suggests two separable modes of transcriptional repression. Mol. Cell. Biol. 15:6923-6931.[Abstract]
9
10. de Haan, G., S. Chusacultanachai, C. Mao, B. S. Katzenellenbogen, and D. J. Shapiro. 2000. Estrogen receptor-KRAB chimeras are potent ligand-dependent repressors of estrogen-regulated gene expression. J. Biol. Chem. 275:13493-13501.[Abstract/Free Full Text]
10
11. Denny, P., and A. Ashworth. 1991. A zinc finger protein-encoding gene expressed in the post-meiotic phase of spermatogenesis. Gene 106:221-227.[CrossRef][Medline]
11
12. Deweindt, C., O. Albagli, F. Bernardin, P. Dhordain, S. Quief, D. Lantoine, J. P. Kerckaert, and D. Leprince. 1995. The LAZ3/BCL6 oncogene encodes a sequence-specific transcriptional inhibitor: a novel function for the BTB/POZ domain as an autonomous repressing domain. Cell Growth Differ. 6:1495-1503.
12
13. Foster, J. W., M. A. Dominguez-Steglich, S. Guioli, G. Kowk, P. A. Weller, M. Stevanovic, J. Weissenbach, S. Mansour, I. D. Young, P. N. Goodfellow, et al. 1994. Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene. Nature 372:525-530.[CrossRef][Medline]
13
14. Friedman, J. R., W. J. Fredericks, D. E. Jensen, D. W. Speicher, X. P. Huang, E. G. Neilson, and F. J. Rauscher III. 1996. KAP-1, a novel corepressor for the highly conserved KRAB repression domain. Genes Dev. 10:2067-2078.[Abstract/Free Full Text]
14
15. Furuto, D. K., and E. J. Miller. 1983. Different levels of glycosylation contribute to the heterogeneity of alpha 1(II) collagen chains derived from a transplantable rat chondrosarcoma. Arch. Biochem. Biophys. 226:604-611.[CrossRef][Medline]
15
16. Gray, S., and M. Levine. 1996. Transcriptional repression in development. Curr. Opin. Cell Biol. 8:358-364.[CrossRef][Medline]
16
17. Grimes, H. L., T. O. Chan, P. A. Zweidler-McKay, B. Tong, and P. N. Tsichlis. 1996. The Gfi-1 proto-oncoprotein contains a novel transcriptional repressor domain, SNAG, and inhibits G₁ arrest induced by interleukin-2 withdrawal. Mol. Cell. Biol. 16:6263-6272.[Abstract]
17
18. Harley, V. R., R. Lovell-Badge, and P. N. Goodfellow. 1994. Definition of a consensus DNA binding site for SRY. Nucleic Acids Res. 22:1500-1501.[Free Full Text]
18
19. Hirota, S., A. Ito, E. Morii, A. Wanaka, M. Tohyama, Y. Kitamura, and S. Nomura. 1992. Localization of mRNA for c-kit receptor and its ligand in the brain of adult rats: an analysis using in situ hybridization histochemistry. Brain Res. Mol. Brain Res. 15:47-54.[Medline]
19
20. Jheon, A. H., B. Ganss, S. Cheifetz, and J. Sodek. 2001. Characterization of a novel KRAB/C2H2 zinc finger transcription factor involved in bone development. J. Biol. Chem. 276:18282-18289.[Abstract/Free Full Text]
20
21. Johnson, A. D. 1995. The price of repression. Cell 81:655-658.[CrossRef][Medline]
21
22. Kim, S. S., Y. M. Chen, E. O'Leary, R. Witzgall, M. Vidal, and J. V. Bonventre. 1996. A novel member of the RING finger family, KRIP-1, associates with the KRAB-A transcriptional repressor domain of zinc finger proteins. Proc. Natl. Acad. Sci. USA 93:15299-15304.[Abstract/Free Full Text]
22
23. Kimura, T., K. S. Cheah, S. D. Chan, V. C. Lui, M. G. Mattei, M. van der Rest, K. Ono, E. Solomon, Y. Ninomiya, and B. R. Olsen. 1989. The human alpha 2(XI) collagen (COL11A2) chain. Molecular cloning of cDNA and genomic DNA reveals characteristics of a fibrillar collagen with differences in genomic organization. J. Biol. Chem. 264:13910-13916.[Abstract/Free Full Text]
23
24. Klug, A., and J. W. Schwabe. 1995. Protein motifs 5. Zinc fingers. FASEB J. 9:597-604.
23
25. Kozak, C. A., M. Peyser, M. Krall, T. M. Mariano, C. S. Kumar, S. Pestka, and B. A. Mock. 1990. Molecular genetic markers spanning mouse chromosome 10. Genomics 8:519-524.[CrossRef][Medline]
24
26. Lee, P. L., T. Gelbart, C. West, M. Adams, R. Blackstone, and E. Beutler. 1997. Three genes encoding zinc finger proteins on human chromosome 6p21.3: members of a new subclass of the Kruppel gene family containing the conserved SCAN box domain. Genomics 43:191-201.[CrossRef][Medline]
25
27. Lefebvre, V., W. Huang, V. R. Harley, P. N. Goodfellow, and B. de Crombrugghe. 1997. SOX9 is a potent activator of the chondrocyte-specific enhancer of the proá1(II) collagen gene. Mol. Cell. Biol. 17:2336-2346.[Abstract]
26
28. Li, J. J., and I. Herskowitz. 1993. Isolation of ORC6, a component of the yeast origin recognition complex by a one-hybrid system. Science 262:1870-1874.[Abstract/Free Full Text]
27
29. Li, Y., D. A. Lacerda, M. L. Warman, D. R. Beier, H. Yoshioka, Y. Ninomiya, J. T. Oxford, N. P. Morris, K. Andrikopoulos, F. Ramirez, et al. 1995. A fibrillar collagen gene, Col11a1, is essential for skeletal morphogenesis. Cell 80:423-430.[CrossRef][Medline]
28
30. Liu, Y., H. Li, K. Tanaka, N. Tsumaki, and Y. Yamada. 2000. Identification of an enhancer sequence within the first intron required for cartilage-specific transcription of the alpha2(XI) collagen gene. J. Biol. Chem. 275:12712-12718.[Abstract/Free Full Text]
29
31. Margolin, J. F., J. R. Friedman, W. K. Meyer, H. Vissing, H. J. Thiesen, and F. J. Rauscher III. 1994. Kruppel-associated boxes are potent transcriptional repression domains. Proc. Natl. Acad. Sci. USA 91:4509-4513.[Abstract/Free Full Text]
30
32. Mendler, M., S. G. Eich-Bender, L. Vaughan, K. H. Winterhalter, and P. Bruckner. 1989. Cartilage contains mixed fibrils of collagen types II, IX, and XI. J. Cell Biol. 108:191-197.[Abstract/Free Full Text]
31
33. Moosmann, P., O. Georgiev, B. Le Douarin, J. P. Bourquin, and W. Schaffner. 1996. Transcriptional repression by RING finger protein TIF1 beta that interacts with the KRAB repressor domain of KOX1. Nucleic Acids Res. 24:4859-4867.[Abstract/Free Full Text]
32
34. Morris, N. P., and H. P. Bachinger. 1987. Type XI collagen is a heterotrimer with the composition (1 alpha, 2 alpha, 3 alpha) retaining non-triple-helical domains. J. Biol. Chem. 262:11345-11350.[Abstract/Free Full Text]
33
35. Mukhopadhyay, K., V. Lefebvre, G. Zhou, S. Garofalo, J. H. Kimura, and B. de Crombrugghe. 1995. Use of a new rat chondrosarcoma cell line to delineate a 119-base pair chondrocyte-specific enhancer element and to define active promoter segments in the mouse pro-alpha 1(II) collagen gene. J. Biol. Chem. 270:27711-27719.[Abstract/Free Full Text]
34
36. Peng, H., G. E. Begg, D. C. Schultz, J. R. Friedman, D. E. Jensen, D. W. Speicher, and F. J. Rauscher III. 2000. Reconstitution of the KRAB-KAP-1 repressor complex: a model system for defining the molecular anatomy of RING-B box-coiled-coil domain-mediated protein-protein interactions. J. Mol. Biol. 295:1139-1162.[CrossRef][Medline]
35
37. Pengue, G., V. Calabro, P. C. Bartoli, A. Pagliuca, and L. Lania. 1994. Repression of transcriptional activity at a distance by the evolutionarily conserved KRAB domain present in a subfamily of zinc finger proteins. Nucleic Acids Res. 22:2908-2914.[Abstract/Free Full Text]
36
38. Pengue, G., V. Calabro, P. Cannada-Bartoli, P. De Luca, T. Esposito, P. Taillon-Miller, S. LaForgia, T. Druck, K. Huebner, M. D'Urso, et al. 1993. YAC-assisted cloning of transcribed sequences from the human chromosome 3p21 region. Hum. Mol. Genet. 2:791-796.[Abstract/Free Full Text]
37
39. Pengue, G., and L. Lania. 1996. Kruppel-associated box-mediated repression of RNA polymerase II promoters is influenced by the arrangement of basal promoter elements. Proc. Natl. Acad. Sci. USA 93:1015-1020.[Abstract/Free Full Text]
38
40. Petit, B., M. C. Ronziere, D. J. Hartmann, and D. Herbage. 1993. Ultrastructural organization of type XI collagen in fetal bovine epiphyseal cartilage. Histochemistry 100:231-239.[CrossRef][Medline]
39
41. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Extraction, purification, and analysis of messenger RNA from eukaryotic cells, p. 7.1-7.87. In C. Noran (ed.), Molecular cloning: a laboratory manual. Cold Spring Harbor Press, New York, N.Y.
40
42. Schiestl, R. H., and R. D. Gietz. 1989. High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet. 16:339-346.[CrossRef][Medline]
41
43. Shukunami, C., C. Shigeno, T. Atsumi, K. Ishizeki, F. Suzuki, and Y. Hiraki. 1996. Chondrogenic differentiation of clonal mouse embryonic cell line ATDC5 in vitro: differentiation-dependent gene expression of parathyroid hormone (PTH)/PTH-related peptide receptor. J. Cell Biol. 133:457-468.[Abstract/Free Full Text]
42
44. Tanaka, K., Y. Matsumoto, F. Nakatani, Y. Iwamoto, and Y. Yamada. 2000. A zinc finger transcription factor, áA-crystallin binding protein 1, is a negative regulator of the chondrocyte-specific enhancer of the á1(II) collagen gene. Mol. Cell. Biol. 20:4428-4435.[Abstract/Free Full Text]
43
45. Tsumaki, N., and T. Kimura. 1995. Differential expression of an acidic domain in the amino-terminal propeptide of mouse pro-alpha 2(XI) collagen by complex alternative splicing. J. Biol. Chem. 270:2372-2378.[Abstract/Free Full Text]
44
46. Tsumaki, N., T. Kimura, Y. Matsui, K. Nakata, and T. Ochi. 1996. Separable cis-regulatory elements that contribute to tissue- and site- specific alpha 2(XI) collagen gene expression in the embryonic mouse cartilage. J. Cell Biol. 134:1573-1582.[Abstract/Free Full Text]
45
47. Tsumaki, N., T. Kimura, K. Tanaka, J. H. Kimura, T. Ochi, and Y. Yamada. 1998. Modular arrangement of cartilage- and neural tissue-specific cis-elements in the mouse alpha2(XI) collagen promoter. J. Biol. Chem. 273:22861-22864.[Abstract/Free Full Text]
46
48. Vaughan, L., M. Mendler, S. Huber, P. Bruckner, K. H. Winterhalter, M. I. Irwin, and R. Mayne. 1988. D-Periodic distribution of collagen type IX along cartilage fibrils. J. Cell Biol. 106:991-997.[Abstract/Free Full Text]
47
49. Vikkula, M., E. C. Mariman, V. C. Lui, N. I. Zhidkova, G. E. Tiller, M. B. Goldring, S. E. van Beersum, M. C. de Waal Malefijt, F. H. van den Hoogen, H. H. Ropers, et al. 1995. Autosomal dominant and recessive osteochondrodysplasias associated with the COL11A2 locus. Cell 80:431-437.[CrossRef][Medline]
48
50. Vissing, H., W. K. Meyer, L. Aagaard, N. Tommerup, and H. J. Thiesen. 1995. Repression of transcriptional activity by heterologous KRAB domains present in zinc finger proteins. FEBS Lett. 369:153-157.[CrossRef][Medline]
49
51. Wagner, T., J. Wirth, J. Meyer, B. Zabel, M. Held, J. Zimmer, J. Pasantes, F. D. Bricarelli, J. Keutel, E. Hustert, et al. 1994. Autosomal sex reversal and campomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9. Cell 79:1111-1120.[CrossRef][Medline]
50
52. Wang, M. M., and R. R. Reed. 1993. Molecular cloning of the olfactory neuronal transcription factor Olf-1 by genetic selection in yeast. Nature 364:121-126.[CrossRef][Medline]
51
53. Williams, A. J., L. M. Khachigian, T. Shows, and T. Collins. 1995. Isolation and characterization of a novel zinc-finger protein with transcription repressor activity. J. Biol. Chem. 270:22143-22152.[Abstract/Free Full Text]
52
54. Wirth, J., T. Wagner, J. Meyer, R. A. Pfeiffer, H. U. Tietze, W. Schempp, and G. Scherer. 1996. Translocation breakpoints in three patients with campomelic dysplasia and autosomal sex reversal map more than 130 kb from SOX9. Hum. Genet. 97:186-193.[CrossRef][Medline]
53
55. Witzgall, R., E. O'Leary, A. Leaf, D. Onaldi, and J. V. Bonventre. 1994. The Kruppel-associated box-A (KRAB-A) domain of zinc finger proteins mediates transcriptional repression. Proc. Natl. Acad. Sci. USA 91:4514-4518.[Abstract/Free Full Text]
54
56. Wright, E., M. R. Hargrave, J. Christiansen, L. Cooper, J. Kun, T. Evans, U. Gangadharan, A. Greenfield, and P. Koopman. 1995. The Sry-related gene Sox9 is expressed during chondrogenesis in mouse embryos. Nat. Genet. 9:15-20.[CrossRef][Medline]
55
57. Yang, X. W., R. Zhong, and N. Heintz. 1996. Granule cell specification in the developing mouse brain as defined by expression of the zinc finger transcription factor RU49. Development 122:555-566.[Abstract]
56
58. Yokoyama, M., M. Nakamura, K. Okubo, K. Matsubara, Y. Nishi, T. Matsumoto, and A. Fukushima. 1997. Isolation of a cDNA encoding a widely expressed novel zinc finger protein with the LeR and KRAB-A domains. Biochim. Biophys. Acta 1353:13-17.[Medline]
57
59. Zheng, L., H. Pan, S. Li, A. Flesken-Nikitin, P. L. Chen, T. G. Boyer, and W. H. Lee. 2000. Sequence-specific transcriptional corepressor function for BRCA1 through a novel zinc finger protein, ZBRK1. Mol. Cell 6:757-768.[CrossRef][Medline]
58
60. Zhu, Z., B. Ma, R. J. Homer, T. Zheng, and J. A. Elias. 2001. Use of the tetracycline-controlled transcriptional silencer (tTS) to eliminate transgene leak in inducible overexpression transgenic mice. J. Biol. Chem. 276:25222-25229.[Abstract/Free Full Text]

---

Molecular and Cellular Biology, June 2002, p. 4256-4267, Vol. 22, No. 12
0270-7306/02/$04.00+0     DOI: 10.1128/MCB.22.12.4256-4267.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Briers, S., Crawford, C., Bickmore, W. A., Sutherland, H. G. (2009). KRAB zinc-finger proteins localise to novel KAP1-containing foci that are adjacent to PML nuclear bodies. J. Cell Sci. 122: 937-946 [Abstract] [Full Text]  
• Huntley, S., Baggott, D. M., Hamilton, A. T., Tran-Gyamfi, M., Yang, S., Kim, J., Gordon, L., Branscomb, E., Stubbs, L. (2006). A comprehensive catalog of human KRAB-associated zinc finger genes: Insights into the evolutionary history of a large family of transcriptional repressors. Genome Res 16: 669-677 [Abstract] [Full Text]  
• Oh, H. J., Li, Y., Lau, Y.-F. C. (2005). Sry Associates with the Heterochromatin Protein 1 Complex by Interacting with a KRAB Domain Protein. Biol. Reprod. 72: 407-415 [Abstract] [Full Text]  
• Ganss, B., Jheon, A. (2004). ZINC FINGER TRANSCRIPTION FACTORS IN SKELETAL DEVELOPMENT. CROBM 15: 282-297 [Abstract] [Full Text]  
• Ponticos, M., Partridge, T., Black, C. M., Abraham, D. J., Bou-Gharios, G. (2004). Regulation of Collagen Type I in Vascular Smooth Muscle Cells by Competition between Nkx2.5 and {delta}EF1/ZEB1. Mol. Cell. Biol. 24: 6151-6161 [Abstract] [Full Text]  
• Waxman, D. J., Celenza, J. L. (2003). Sexual dimorphism of hepatic gene expression: novel biological role of KRAB zinc finger repressors revealed. Genes Dev. 17: 2607-2613 [Full Text]  
• Krebs, C. J., Larkins, L. K., Price, R., Tullis, K. M., Miller, R. D., Robins, D. M. (2003). Regulator of sex-limitation (Rsl) encodes a pair of KRAB zinc-finger genes that control sexually dimorphic liver gene expression. Genes Dev. 17: 2664-2674 [Abstract] [Full Text]  
• Watanabe, K., Okada, K. (2003). Two Discrete cis Elements Control the Abaxial Side-Specific Expression of the FILAMENTOUS FLOWER Gene in Arabidopsis. Plant Cell 15: 2592-2602 [Abstract] [Full Text]  
• Matsuo, N., Yu-Hua, W., Sumiyoshi, H., Sakata-Takatani, K., Nagato, H., Sakai, K., Sakurai, M., Yoshioka, H. (2003). The Transcription Factor CCAAT-binding Factor CBF/NF-Y Regulates the Proximal Promoter Activity in the Human {alpha}1(XI) Collagen Gene (COL11A1). J. Biol. Chem. 278: 32763-32770 [Abstract] [Full Text]  
• Ayyanathan, K., Lechner, M. S., Bell, P., Maul, G. G., Schultz, D. C., Yamada, Y., Tanaka, K., Torigoe, K., Rauscher, F. J. III (2003). Regulated recruitment of HP1 to a euchromatic gene induces mitotically heritable, epigenetic gene silencing: a mammalian cell culture model of gene variegation. Genes Dev. 17: 1855-1869 [Abstract] [Full Text]  
• Matsui, Y., Chansky, H. A., Barahmand-Pour, F., Zielinska-Kwiatkowska, A., Tsumaki, N., Myoui, A., Yoshikawa, H., Yang, L., Eyre, D. R. (2003). COL11A2 Collagen Gene Transcription Is Differentially Regulated by EWS/ERG Sarcoma Fusion Protein and Wild-type ERG. J. Biol. Chem. 278: 11369-11375 [Abstract] [Full Text]  
• HAMILTON, A.T., HUNTLEY, S., KIM, J., BRANSCOMB, E., STUBBS, L. (2003). Lineage-specific Expansion of KRAB Zinc-finger Transcription Factor Genes: Implications for the Evolution of Vertebrate Regulatory Networks. Cold Spring Harb Symp Quant Biol 68: 131-140 [Abstract]  

This Article Abstract Full Text (PDF) A retraction has been published A retraction has been published Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tanaka, K. Articles by Yamada, Y. Search for Related Content PubMed PubMed Citation Articles by Tanaka, K. Articles by Yamada, Y.