![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, June 2002, p. 4372-4382, Vol. 22, No. 12
0270-7306/02/$04.00+0 DOI: 10.1128/MCB.22.12.4372-4382.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Genetic Engineering Laboratory, Indian Institute of Chemical Biology, Calcutta 700032, India
Received 26 November 2001/ Returned for modification 15 January 2002/ Accepted 28 February 2002
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
How mitochondria select only the required tRNA species from the cytoplasmic multitude is still a mystery. According to one school of thought, the structure of the tRNA as a whole is recognized (9). Alternatively, specific sequence motifs or short structures present on individual tRNAs could serve as the basis for discrimination. In Tetrahymena cells, the anticodon of tRNAGln apparently acts as an import determinant (20). In yeast, both the anticodon domain and the acceptor stem of tRNALys appear to play a role in import (7). In contrast, the D arm of Leishmania tRNAIle (10) and tRNATyr (13) contain import signals, but replacement of this region of tRNAIle by the D arm of tRNAGln(CUG) (which, of itself, does not contain any signal [11, 18]) produces a hybrid molecule which is still imported (10); whether tRNAIle contains more than one import signal is unresolved at present. Studies with mutant forms of the D arm of tRNATyr showed further that the RNA structural requirements are different for transfer through the outer, as opposed to the inner, membrane (2). This suggests the presence of distinct receptors at the two membranes. TAB, an outer membrane receptor (1), is immunochemically distinct from the inner membrane receptor (2), but the identity of the latter is unknown.
In this paper, we have asked the following question: are there multiple sequence motifs recognized by the import receptors, and if so, are the corresponding RNAs imported by independent pathways using distinct receptors? To identify the range of import signals recognized by mitochondrial receptors, the SELEX procedure (5) was used to isolate, from a combinatorial RNA library, those sequences (aptamers) that are imported with high efficiency. A subset of these aptamers was studied in more detail for their import characteristics alone and in combination. We show that conserved motifs in different tRNA domains can potentially act as import signals, that two types of RNAs are discernible, differing in their ability to cross the inner membrane, and that these two types interact with each other at the inner membrane in a manner suggestive of allosteric regulation at the inner membrane receptor complex.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Preparation of substrate for SELEX.
DNA templates were prepared by PCR amplification of the oligonucleotide O-58 (GGAATTCTAATACGACTCACTATAGGGACGCAGGGACTGTAN16ATGTGACTGTAGCGG), which contains a 16-base random sequence in the middle (estimated complexity, 4.29 x 109), flanked by a T7 RNA polymerase promoter sequence at the 5' end followed by a 5' anchor sequence and a 3' anchor sequence. The 5' and 3' anchors for the amplification of selected RNAs included sequences flanking the D domain of Leishmania tRNATyr(GUA) (11). The two primers used for the PCR were O-59(GGAATTCTAATACGACGACTCACTATAGGGACGCAGGGACTGTA,containing an EcoRI linker, the T7 RNA polymerase promoter, and five 3'-terminal bases identical to the D arm flanking sequence) and O-60 (GCCCAAGCTTCCGCTACAGTCACAT, complementary to the 3' end sequence of O-58 and containing a HindIII linker). For PCR, 0.1 pmol of O-58 and 25 pmol each of primers O-59 and O-60 were added to a 100-µl reaction mixture containing 10 mM Tris-HCl, pH 8, 50 mM KCl, 1.5 mM MgCl2, 0.4 mM deoxynucleoside triphosphates, and 5 U of AmpliTaq Gold DNA polymerase (Perkin-Elmer). After heat activation of the enzyme at 90°C for 10 min, amplifications were carried out for 30 cycles of 90°C for 30 s, 60°C for 30 s, and 72°C for 30 s. PCR products were gel eluted after nondenaturing 6% polyacrylamide gel electrophoresis and used for the preparation of substrate RNA. Transcription was performed with 10-µl reaction mixtures containing 40 mM Tris-HCl, pH 7.5, 6 mM MgCl2, 1 mM spermidine, 1 mM dithiothreitol (DTT), 0.5 mM concentrations (each) of CTP, ATP, and GTP, 0.25 mM UTP, 1 µCi of [
-32P]UTP, and 10 U of T7 RNA polymerase at 37°C for 90 min. Then, 1 U of RQ1 DNase (Promega) was added and the reaction mixture was further incubated at 37°C for 15 min. RNA was recovered by phenol-chloroform extraction and ethanol precipitation.
In vitro selection protocol. Random-sequence RNA (pool 0; 1 pmol), prepared as described above, was incubated with 1 mg of mitochondria in a 200-µl reaction mixture containing 10 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1 mM DTT, and 4 mM ATP at 37°C for 15 min, and then RNases A and T1 were added to final concentrations of 2.5 µg/ml and 50 U/ml, respectively, and RNase digestion continued at 37°C for 15 min. The mitochondria were washed with isotonic sucrose-Tris-EDTA buffer (250 mM sucrose, 10 mM Tris-HCl, pH 8, 1 mM EDTA) by centrifugation, and imported RNA was isolated by guanidinium isothiocyanate extraction and ethanol precipitation (13). Selected RNA was annealed with 25 pmol of primer O-60 in Superscript II (BRL) reverse transcription buffer (50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2) at 65°C for 5 min, followed by slow cooling to room temperature. Then, DTT (2 mM), deoxynucleoside triphosphates (0.4 mM [each]), and 50 U of Superscript II reverse transcriptase were added and the reaction mixtures (10 µl) were incubated at 42°C for 50 min. The cDNA was amplified by PCR using primers O-59 and O-60, as described above. The selected pool (pool 1 DNA) was subjected to a second round of transcription, import, reverse transcription, and PCR. By repetition of this cycle, pools 2 to 5 were generated. At each step, the PCR product was gel purified and precautions were taken to avoid contamination of imported sequences with unimported RNA.
Complexity analysis. The complexities of selected pools were compared by partial RNase digestion, as previously described (5). 32P-labeled RNA (105 cpm) and yeast tRNA (2 µg) in 10 µl of RNase T1 digestion buffer (20 mM sodium citrate, pH 5, 1 mM EDTA, 7 M urea, 0.02% xylene cyanol, 0.02% bromophenol blue) was denatured by heating at 92°C for 5 min, followed by rapid chilling on ice. RNase T1 (1 U) was added, and the reaction mixtures were incubated at 55°C for 10 min and then placed on ice. The reaction mixtures were directly loaded on a 12% polyacrylamide sequencing gel for electrophoresis and autoradiography.
Cloning and sequencing of aptamers. Pool 4 DNA (obtained after the fourth cycle) was digested with EcoRI and HindIII and cloned into pUC19 vector. Escherichia coli XL1-Blue cells were transformed and 36 positive colonies were obtained. Twenty-one of these were sequenced manually by the dideoxy chain termination method using Klenow fragment and both forward and reverse sequencing primers.
Preparation of import assay substrates.
RNA from pools 0 to 5 was prepared by transcription from PCR-amplified DNA templates using T7 RNA polymerase, as described above, except that the UTP concentration was reduced to 10 µM and 10 to 20 µCi of [-32P]UTP was used. Aptamer RNAs were prepared by runoff transcription of the corresponding HindIII-linearized clones. tRNATyr and tRNAGln(CUG) were synthesized from linearized plasmids pSKB1 and pSKB-2, respectively (1). tRNATyr D-arm oligoribonucleotide (26-mer) was prepared by oligonucleotide transcription, as described earlier (13). Effector RNAs were similarly synthesized, except that the amount of [-32P]UTP in the transcription reaction mixture was reduced to one-tenth and the UTP concentration was raised from 10 to 250 µM. Thus, the specific activity of effector RNAs is 1/250 that of substrates. tRNAIle(UAU) was obtained using DNA template generated by PCR amplification of the Leishmania tarentolae tRNAIle gene cloned in plasmid pGCN8. PCR amplification was carried out with the primers O-65 (GGAATTCTAATACGACTCACTATAG) and O- 66 (TGGTGCTCCCGGCGGGGC), corresponding to the 5' and 3' regions of the tRNA, respectively (22). tRNAIle(1-41) was synthesized by runoff transcription of the PCR-amplified gene restricted with HpaII, which cuts at positions 41 and 66 within the gene (22). To isolate tRNAIle(42-66), the intact tRNAIle transcript was annealed to the 25-nucleotide (nt) HpaII fragment spanning positions 42 to 66, in 80% formamide-40 mM PIPES [piperazine-N,N'-bis(2-ethanesulfonic acid] (pH 6.4)-0.4 M NaCl-1 mM EDTA at 55°C for 18 h, the nonhybridized RNA digested with RNase A plus RNase T1 as previously described (3) and the protected RNA recovered by proteinase K treatment, phenol extraction, and ethanol precipitation. Substrates and effectors were quantified on the basis of the specific activity of the label, the counts per minute incorporated in the transcription reaction, and the number of U residues in the RNA; in the case of complex mixtures of unknown composition (pools P0 to P5), the U content was assumed to be 25%.
In vitro import assays. Total uptake into mitochondria was assayed as described above for in vitro selection, except that 100 µg of mitochondria was incubated with high-specific-activity 32P-labeled RNA in 20-µl reaction mixtures. Separation of submitochondrial compartments was performed as previously described (17). Briefly, the outer membrane was solubilized with digitonin and the soluble outer membrane plus intermembrane space fraction was separated from mitoplasts by centrifugation. The mitoplasts were then subjected to freeze-thaw lysis to separate the matrix (soluble) and inner membrane (insoluble) fractions. Marker enzyme assays were performed as previously described (17). To study the effect of uncouplers, mitoplasts were preincubated with 50 µM carbonyl cyanide m-chlorophenylhydrazone (CCCP) for 10 min on ice before the import reaction. The recovered RNA was analyzed by urea-6% polyacrylamide gel electrophoresis and quantified by autoradiography and scintillation counting of dried gel bands.
Binding assays and determination of Kd values. Binding reactions were carried out by incubating 1.56 to 100 fmol of 32P-labeled RNA in 10-µl reaction mixtures containing 10 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1 mM EDTA, 100 mM KCl, and 50 µg of mitochondria at 0°C for 30 min; under these conditions, binding is sequence specific (2, 12). Unbound RNA was removed by washing with isotonic sucrose, and the bound RNA was recovered and quantified as described above. Scatchard plots of b/f versus b, where b = bound RNA concentration and f = free RNA concentration, yielded the following equation: Kd = -1/slope.
Import assay in transiently transfected cells. Details of this procedure have been previously described (2). Briefly, promastigotes of L. tropica strain UR6 were electroporated with 32P-labeled RNA and incubated at 22°C for 10 min. Electroporated cells were lysed by hypotonic syringe passage, the particulate fraction containing mitochondria was treated with DNase I, RNase A, and RNase T1, and RNA was isolated as described above.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Pool 4 DNA was cloned and several clones were sequenced (Table 1). About one-quarter of the clones contained the sequence CGGAUCAGAGU (aptamers 1 to 3). Aptamers 1 to 3 have identical sequences in the first 12 positions and also share the motif YAGAGY with aptamers 4 and 4A, and this motif is present in the D domain of a number of kinetoplastid tRNAs (Table 1). The D domain motif GUAGAGC, which is known to be part of an import signal (2, 13), was found in 21% of available Leishmania and Trypanosoma tRNA sequences but in only 6% of yeast tRNAs. Moreover, aptamers 1 and 2 are identical in 12 contiguous positions to the anticodon domain of Leishmania tRNAArg(ACG); this region includes the anticodon itself (Table 1; Fig. 2). Aptamers 5 and 6 constitute a second major group; they are identical to each other except for a G
A transition at the sixth position of the selected sequence. They share the motif YGGUARR with the conserved D arm motif on tRNAs (Table 1). More extensive homology with available kinetoplastid sequences was not observed, possibly due to the incomplete nature of the current database (containing only 14 tRNA sequences from Leishmania and 14 from trypanosomes; http://www.uni-bayreuth.da/departments/biochemie/tRNA). However, these aptamers potentially form a hairpin structure which closely resembles the D domain hairpin, especially in the positioning of the shared motif in the loop and stem regions (Fig. 2); in the absence of more tRNA sequence information, these aptamers were therefore tentatively grouped with the D domain homologues. The motif UAGGAC in aptamer 7 was identified in the D domain of two Leishmania tRNAs. Aptamers 8 and 9 constitute another group with the motif CUG3-4U and form similar secondary structures with pyrimidine-rich eight-base loops, a base-paired GGG motif in the stem flanked on the 5' side by a UC or CU dinucleotide. A similar GU-rich motif, UC(G/A)(U/C/G)GGGUU, was present in the V-T region of 5 out of 14 (36%) of Leishmania or Trypanosoma tRNAs (Table 1) but was relatively rare in yeast tRNA (2 out of 51, or 4%). The above secondary structural features were also present in the V-T regions of the corresponding tRNAs, but the alignment of the loop was different (Fig. 2). Aptamer 10 is homologous to the V-T region of the two tRNAArg isoacceptors. Aptamers 11 and 12 contained runs of GY; similar but shorter runs were present in the acceptor stems of a number of tRNAs (Table 1).
|
|
Truncated derivatives of tRNAIle were prepared (see Materials and Methods) and tested for import into isolated mitochondria. About 3.4% of the 77-nt tRNAIle was imported in an ATP-dependent manner (Fig. 3). In contrast, the import efficiency of tRNAIle(1-41), which contains the D and anticodon domains, was 0.8%, i.e., one-quarter of that of the intact molecule. This low level of RNase protection was ATP stimulated and completely sensitive to treatment of the mitochondria with Triton X-100 (Fig. 3D). Conversely, the 25-nt tRNAIle(42-66), containing the variable and T domains, was imported three times more efficiently than the intact molecule. This enhanced import is not due simply to nonspecific uptake of short oligonucleotides since the system is sequence specific, as shown by the sensitivity of import to a single point mutation in the 27-nt tRNATyr D arm oligonucleotide (Fig. 3E; see also reference 2). Moreover, similar truncation experiments with tRNATyr showed the lack of importability of the 3' half of the molecule, including the V and T domains (13). These results therefore indicate the presence of a previously unknown, strong import signal in the V-T region of tRNAIle, as predicted by the homology analysis.
|
|
|
Selection of sorted RNAs. The foregoing SELEX experiment was performed with total RNA internalized into intact mitochondria. It was shown previously that the import process can be kinetically and biochemically subdivided into outer and inner membrane transfer steps (2, 17). Moreover, structural variants of the D arm import signal have defined intrinsic inner membrane transfer efficiencies; some are transferred with high efficiency, and others remain stuck to the inner membrane (2). It was therefore expected that in a SELEX-type situation involving a mixture of sequences, the inner membrane would filter out those that have a low inner membrane transfer efficiency, resulting in purification of the matrix-associated pools to an efficiency approaching 100%. To test this, SELEX pool P4, a mixture of aptamers (Table 1), was incubated with intact mitochondria, and after RNase treatment, the mitochondria were fractionated into inner membrane and matrix compartments and the RNA contained in each fraction was amplified separately and tested for intramitochondrial localization (Fig. 6A). The parental pool had an inner membrane transfer efficiency of about 50%. The inner membrane-associated pool had a lower efficiency (30%), but surprisingly, the efficiency of the matrix-associated pool was about the same as that of the parental pool (Fig. 6A). Repetition of the cycle of fractionation and amplification of the matrix-associated fraction did not result in further enhancement of inner membrane transfer efficiency (data not shown). One possible explanation of this result is that the inner membrane is leaky, leading to failure of the fractionation; this leakiness could be intrinsic to the membrane preparation, or somehow induced by the fractionation-amplification procedure. To test for leakiness, a control experiment was performed with a single RNA (aptamer 8, C1), which was predominantly retained at the inner membrane (see below). If the membrane is leaky, the matrix localization of C1 should increase upon repeated fractionation-amplification. In fact, the inner membrane transfer efficiency of C1 continued to be low after repeated cycles, arguing against any obvious leakiness of the inner membrane (Fig. 6B).
|
Inter-RNA interactions. To test this possibility, mitochondria were incubated with high-specific-activity, 32P-labeled aptamer (substrate) in the presence or absence of one-tenth the concentration of a second aptamer (effector) of low-specific activity and total uptake was assayed. In the presence of C32 effector, the uptake of C1 was stimulated; the effect was more pronounced at lower concentrations of substrate (Fig. 7A ). By contrast, C1 effector had no significant effect on import of C32 substrate (Fig. 7A). No signal was detected in presence of effector alone, a result of the combination of low concentration and low specific activity of the effector. Moreover, treatment of effector with micrococcal nuclease resulted in the loss of stimulatory activity, indicating that the effector is RNA in nature (data not shown). Titration with effector showed that there was a sharp rise in C1 uptake between 0.15 and 0.3 nM C32; comparable concentrations of nonspecific RNAs such as yeast tRNA had no significant effect (Fig. 7B). Binding of C1 to intact mitochondria was also stimulated by C32 (Fig. 7C); the Kd value for C1 was reduced from 1.0 to 0.25 nM in presence of 1 nM C32 (data not shown). Thus, C32 was able to stimulate binding as well as uptake of C1 through the outer membrane. However, the magnitude of stimulation was low (about twofold in most experiments) and the total uptakes of C16 and C20 were not affected by C32 (Fig. 8). Thus, with these particular combinations of RNAs, allosteric effects at the outer membrane are marginal or insignificant.
|
|
These results indicate the occurrence of both positive and negative interactions between RNAs at the inner membrane. Those RNAs that can, by themselves, be transferred to the matrix may stimulate others, while the ones that are intrinsically poor matrix localizers have an inhibitory effect.
Since the interacting aptamers are homologous to different domains of tRNAs (Table 1), we tested the possibility that the corresponding tRNAs themselves interact in this manner. Two tRNAs were chosen: tRNATyr, containing the D domain homology, and tRNAIle, with the conserved V-T sequence (Table 1). As shown in Fig. 9, translocation of tRNATyr to the matrix was inhibited by low concentrations of tRNAIle but not by tRNAGln(CUG), which is not imported (11). Conversely, tRNAIle by itself or in presence of tRNAGln(CUG) was restricted to the inner membrane, whereas about 50% was relocated to the matrix in presence of tRNATyr (Fig. 9). These results show that, like the aptamers, intact tRNAs interact specifically at the inner membrane.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Previous studies have shown that mitochondria from kinetoplastid protozoa (Leishmania and trypanosomes) do not require cytoplasmic fractions to import tRNAs (12, 19, 25), implying that selectivity resides at the mitochondrial surface and not in soluble factors. This was borne out in the present instance by the ease with which a large number of import aptamers were selected: only four cycles of selection-amplification were necessary to achieve saturation of import efficiency by using a 16-mer library (Fig. 1). The aptamers had nanomolar affinities for mitochondria, in the same range as that of natural sequences, and were imported in vitro as well as in transfected cells (Fig. 4, 5, 7, and 8). The ease of selection may be attributed to the presence of high-affinity mitochondrial receptors, recognition of small rather than large RNA structures, and efficient removal of background sequences by RNase treatment. We also attempted to separate a preselected pool into distinct populations based on their intrinsic inner membrane transfer efficiencies (Fig. 6) but were unsuccessful because of the apparent leakiness of the inner membrane caused by allosteric interactions (see below).
Examination of the nucleotide sequences (Table 1) and putative secondary structures (Fig. 2) of the aptamers showed the occurrence of a number of groups, each composed of molecules that are related to each other and to specific domains in kinetoplastid tRNAs. The significance of these homologies with regard to the physiological tRNA import process is indicated by the following findings. (i) The motif YAGAGY, present in the D domain of several kinetoplastid tRNAs and previously shown to be important for import (2, 13), was independently recovered in the major group of aptamers (numbers 1 to 4). A second D domain motif, shared by tRNAIle and tRNAVal(CAC), was found in aptamer 7. An import signal in the D arm of tRNAIle has been previously observed (10, 19). We note that the 5' half of tRNAIle, containing the D domain, is significantly less efficient than the intact molecule (Fig. 3), whereas the 5' half of tRNATyr, with a similar secondary structure, is more efficient than intact tRNATyr (13). The lower efficiency of the tRNAIle D domain may be due to the presence of a different sequence motif (UAGGAC) from that in tRNATyr (UAGAGC; Table 1). (ii) Aptamer C32 is almost identical in sequence to the anticodon arm of tRNAArg(ACG) (Fig. 2). This is an indication of the possible involvement of the A domain as a trypanosomatid import signal. The anticodon is known to be an import determinant in Tetrahymena (20). (iii) The motif CUG3-4U, present in aptamers 8 and 9, pointed to the possible role of the V-T region of some tRNAs, and this was verified for the case of tRNAIle (Fig. 3). The presence of a signal in the V-T region offers an explanation for the observation that a hybrid tRNAIle molecule containing the D arm of tRNAGln(CUG)—which, by itself, does not contain a signal—is nonetheless imported in vivo (10). A role for the variable region of tRNAThr in mitochondrial targeting in Leishmania was also indicated by mutagenesis experiments (4); this tRNA contains the motif UCAG4UU in the V-T region (Table 1). (iv) Finally, no aptamers were obtained which share motifs with tRNAGln(CUG) or tRNAHis. These species, which are poorly or not all imported in vivo (11, 24), have D and V-T sequences that lack the conserved motifs in Table 1. With the limited information currently available, it is becoming evident that different tRNAs may present different domains to the import receptor(s) and, furthermore, that some tRNAs may contain multiple signals.
Using aptamers and intact tRNAs, we show for the first time the occurrence of regulation of mitochondrial RNA import through positive and negative interactions between different RNAs (Fig. 8 to 10). Based on their effector properties, the four aptamers studied could be classified into two types. Type I aptamers (C16 and C32) have high intrinsic efficiencies of inner membrane transfer, while type II aptamers (C1 and C20) have low inner membrane transfer efficiencies. Type I RNAs stimulate matrix transfer of type II but are themselves inhibited by type II. The relevance of these findings to tRNA import is suggested by the finding that tRNATyr interacts with the aptamers as a type I molecule (Fig. 8). Moreover, similar interactions between tRNATyr and tRNAIle were observed (Fig. 9). The results confirm the type I character of tRNATyr and show further that tRNATle is a type II molecule with respect to inner membrane translocation. All three type I RNAs, i.e., C16, C32, and tRNATyr, contain the motif YGG followed by YAGAGY or YAAGY, which is present in the D or A domain of many tRNAs (Table 1). On the other hand, type II RNAs (C1, C20, and tRNAIle) contain the conserved V-T motif UG3-4U (Table 1).
By modulating the affinities of different RNAs for the inner membrane receptor, cooperative and antagonistic interactions enable a balanced pool of RNAs to be obtained in the matrix for mitochondrial translation. Thus, the import efficiency of an individual RNA when present alone (i.e., the intrinsic value) and the efficiency of the same RNA present in a mixture (the in vivo situation) may be different; furthermore, since type I RNAs are inhibited by others whereas type II RNAs are stimulated, the net result of these interactions would be to bring the actual transfer efficiencies of different RNAs closer to one another, i.e., to reduce the variation observed with intrinsic transfer efficiencies. To examine whether this is the case for the four aptamers, their intrinsic outer membrane (Fig. 4) and inner membrane (Fig. 8) transfer efficiencies were used to compare the ratio of the aptamers expected to be transferred to the matrix in the absence of allosteric interactions (the noninteractive model) or in the presence of such interactions (the interactive model), with the corresponding ratios observed in vivo (Fig. 5). Two points may be noted from the analysis presented in Table 2. First, the noninteractive ratios of pairs of type I and type II RNAs, e.g., C16-C20 or C32-C20, were significantly higher than those observed in vivo. This is consistent with the occurrence of positive interactions on type II and/or negative interactions on type I in vivo, thereby reducing the ratio. Second, the large variations in noninteractive efficiencies could be reduced by considering allosteric effects. Thus, the expected noninteractive ratio of C1:C16:C20:C32:tRNATyr in the matrix was estimated to be 3.4:8.6:1:19.8:6.3, with a large statistical variance of more than 40 (Table 2). If the positive and negative interactions observed in Fig. 8 were factored in, the corresponding ratio was altered to 2.8:0.7:1:1.2:0.5 and the variance was dramatically reduced to 0.8. In vivo, the observed ratio was 1.8:2.5:1:4.5:1.8:2.2 and the variance was only 1.4. Thus, the low variance observed in vivo is in accord with the interactive model. However, the in vivo ratio is different from the interactive ratio; this is probably due to the fact that the in vitro value was calculated on the basis of interaptamer interactions at a substrate-to-effector ratio of 10:1 (Fig. 8), whereas in vivo, the effector would be a complex mixture of tRNAs of indeterminate composition. Preliminary experiments also support the existence of allosteric regulation in vivo (our unpublished data).
|
|
ACKNOWLEDGMENTS |
|---|
We thank Andre Schneider for the gift of the pGCN8 plasmid.
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2.
Bhattacharyya, S. N., S. Mukherjee, and S. Adhya. 2000. Mutations in a tRNA import signal define distinct receptors at the two membrane of Leishmania mitochondria. Mol. Cell. Biol. 20:7410-7417.
3. Bhaumik, M., S. Das, and S. Adhya. 1991. Evidence for translation control of ß-tubulin synthesis during differentiation of Leishmania donovani. Parasitology 103:197-205.
4. Chen, D.-H. T., X. Shi, and Y. Suyama. 1994. In vivo expression and mitochondrial import of normal and mutated tRNAthr in Leishmania. Mol. Biochem. Parasitol. 64:121-133.[CrossRef][Medline]
5. Ciesiolka, J., M. Illangasekare, I. Majerfeld, T. Nickles, M. Welch, M Yarus, and S. Zinnen. 1996. Affinity selection-amplification from randomized ribooligonucleotide pools. Methods Enzymol. 267:315-335.[Medline]
6. Das, S., and S. Adhya. 1990. Organization and chromosomal localization of ß-tubulin genes in Leishmania donovani. J. Biosci. 15:239-248.
7.
Entelis, N., S. Kieffer, O. A. Kolesnikova, R. P. Martin, and I. A. Tarassov. 1998. Structural requirements of tRNALys for its import into yeast mitochondria. Proc. Natl. Acad. Sci. USA 95:2838-2843.
8. Hancock, K., and S. L. Hajduk. 1990. The mitochondrial tRNAs of Trypanosoma brucei are nuclear encoded. J. Biol. Chem. 265:19203-19215.
9. Hauser, R., and A. Schneider. 1995. tRNAs are imported into the mitochondria of Trypanosoma brucei independent of their genomic context and of their genetic origin. EMBO J. 14:4212-4220.[Medline]
10. Lima, B. D., and L. Simpson. 1996. Sequence dependent in vivo importation of tRNAs into the mitochondrion of Leishmania tarentolae. RNA 2:429-440.[Abstract]
11. Lye, L. F., D. H. T. Chen, and Y. Suyama. 1993. Selective import of nuclear encoded tRNAs into mitochondria of the protozoan Leishmania tarentolae. Mol. Biochem. Parasitol. 58:233-246.[CrossRef][Medline]
12.
Mahapatra, S., and S. Adhya. 1996. Import of RNA into Leishmania mitochondria occurs through direct interaction with membrane bound receptors. J. Biol. Chem. 271:20432-20437.
13.
Mahapatra, S., S. Ghosh, S. K. Bera, T. Ghosh, A. Das, and S. Adhya. 1998. The D arm of tRNATyr is necessary and sufficient for import into Leishmania mitochondria in vitro. Nucleic Acids Res. 26:2037-2041.
14.
Mahapatra, S., T. Ghosh, and S. Adhya. 1994. Import of small RNAs into Leishmania mitochondria in vitro. Nucleic Acids Res. 22:3381-3386.
15.
Marechal-Drouard, L., P. Guillemaut, A. Cosset, M. Arbogast, F. Weiber, J. H. Weil, and A. Dietrich. 1990. Transfer RNA of potato (Solanum tuberosum) mitochondria have different genetic origins. Nucleic Acids Res. 18:3689-3696.
16. Martin, R. P., J. M. Schneller, A. J. Stahl, and G. Dirheimer. 1979. Import of nuclear deoxyribonucleic acid coded lysine-accepting transfer ribonucleic acid (anticodon C-U-U) into yeast mitochondria. Biochemistry 18:4600-4605.[CrossRef][Medline]
17.
Mukherjee, S., S. N. Bhattacharyya, and S. Adhya. 1999. Stepwise transfer of tRNA through the double membrane of Leishmania mitochondria. J. Biol. Chem. 274:31249-31255.
18.
Nabhoiz, C. E., R. Hauser, and A. Schneider. 1997. Leishmania tarentolae contains distinct cytosolic and mitochondrial glutaminyl tRNA synthetase activities. Proc. Natl. Acad. Sci. USA 94:7903-7908.
19. Rubio, M. A., X. Liu, H. Yuzawa, J. D. Alfonzo, and L. Simpson. 2000. Selective importation of RNA into isolated mitochondria from Leishmania tarentolae. RNA 6:988-1003.[Abstract]
20.
Rusconi, C. P., and T. R. Cech. 1996. The anticodon is the signal sequence for mitochondrial import of glutamine tRNA in Tetrahymena. Genes Dev. 10:2870-2880.
21. Scheinder, A., and L. Marechal-Drouard. 2000. Mitochondrial tRNA import: are there distinct mechanisms? Trends Cell. Biol. 10:509-513.[CrossRef][Medline]
22. Shi, X., D. H.-T. Chen, and Y. Suyama. 1994. A nuclear tRNA gene cluster in the protozoan Leishmania tarentolae and differential distribution of nuclear encoded tRNAs between the cytosol and mitochondria. Mol. Biochem. Parasitol. 65:23-37.[CrossRef][Medline]
23.
Simpson, A. M., Y. Suyama, H. Dewes, D. Cambell, and L. Simpson. 1989. Kinetoplastid mitochondria contain functional tRNAs which are encoded in nuclear DNA and also contain small minicircle and maxicircle transcripts of unknown function. Nucleic Acids Res. 17:5427-5445.
24. Suyama, Y., S. Wong, and D. A. Campbell. 1998. Regulated tRNA import in Leishmania mitochondria. Biochim. Biophys. Acta 1396:138-142.[Medline]
25. Yermovsky-Kammerer, A. E., and S. L. Hajduk. 1999. In vitro import of a nuclear encoded tRNA into the mitochondria of Trypanosoma brucei. Mol. Cell. Biol. 9:6253-6259.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
mfold/rna/
G values) at 37°C and 1 M Na+ are shown. In each aptamer, the selected region (positions 18 to 33) is flanked by the 5' anchor (positions 1 to 17) and 3' anchor (positions 34 to 48). Aptamers are placed with the homologous tRNA domain shown at the right; conserved bases are shown in italics.
