Retinoic Acid Receptors Inhibit AP1 Activation by Regulating Extracellular Signal-Regulated Kinase and CBP Recruitment to an AP1-Responsive Promoter

Retinoids exhibit antineoplastic activities that may be linkedto retinoid receptor-mediated transrepression of activatingprotein 1 (AP1), a heterodimeric transcription factor composedof fos- and jun-related proteins. Here we show that transcriptionalactivation of an AP1-regulated gene through the mitogen-activatedprotein kinase (MAPK)-extracellular signal-regulated kinase(ERK) pathway (MAPK^ERK) is characterized, in intact cells, bya switch from a fra2-junD dimer to a junD-fosB dimer loadingon its promoter and by simultaneous recruitment of ERKs, CREB-bindingprotein (CBP), and RNA polymerase II. All-trans-retinoic acid(atRA) receptor (RAR) was tethered constitutively to the AP1promoter. AP1 transrepression by retinoic acid was concomitantto glycogen synthase kinase 3 activation, negative regulationof junD hyperphosphorylation, and to decreased RNA polymeraseII recruitment. Under these conditions, fra1 loading to theAP1 response element was strongly increased. Importantly, CBPand ERKs were excluded from the promoter in the presence ofatRA. AP1 transrepression by retinoids was RAR and ligand dependent,but none of the functions required for RAR-mediated transactivationwas necessary for AP1 transrepression. These results indicatethat transrepressive effects of retinoids are mediated througha mechanism unrelated to transcriptional activation, involvingthe RAR-dependent control of transcription factors and cofactorassembly on AP1-regulated promoters.

INTRODUCTION

Top

Introduction

AP1 response elements are cis-acting DNA sequences mediatingtranscriptional responses to many physiological and pharmacologicalstimuli, including phorbol esters, growth factors, mitogenichormones, and UV and other cellular stresses. These DNA sequences,originally defined as 12-O-tetradecanoylphorbol-13-acetate (TPA)response elements, preferentially bind heterodimers of proteinsbelonging to the bZIP transcription factor family (3). Thesetranscription factors include products of immediate-early genes,such as members of the fos (c-fos, fosB, fra1, and fra2) andjun (c-jun, junB, and junD) (21) families. The transcriptionalactivity of the AP1 complex is regulated through different modes.First, its activity is determined by the composition of theAP1 dimer, which may display a different affinity for a givenresponse element (10, 33, 34). The level of expression of AP1factors is thus one key step of AP1 regulation through modulationof the number of possible combinations of dimers. Second, posttranslationalmodifications exert a strong control on AP1 activity. Notably,phosphorylation of c-jun at Ser 63 and Ser 73 increases itsaffinity for the coactivator CREB-binding protein (CBP) withoutaltering its DNA binding activity (4). This posttranslationalmodification is regulated mostly through the mitogen-activatedprotein kinase (MAPK)-jun N-terminal kinase (JNK) signalingmodule (MAPK^JNK), which controls the activity of JNK. Thus,activation of the AP1 complex is regulated through a complexnetwork of protein kinases, which renders this transcriptionfactor highly reactive to extracellular stimuli (21). Indeed,10 MAPK families have been identified in mammalian cells, twoof them (ERK1 and -2) being preferentially activated throughgrowth factor receptors and by phorbol esters such as TPA. Stress-activatedprotein kinases (SAPKs) are predominantly activated throughstressful stimulis and proinflammatory cytokines (such as JNKand p38s), but cross-regulation between the MAPK^ERK, MAPK^JNK,and MAPK^p38 pathways has been reported (16, 28).

AP1 regulates the expression of several genes involved in oncogenictransformation and cellular proliferation such as those codingfor metalloproteases, VEGF, and transforming growth factor ß(TGF-ß), and AP1 transactivation is required for tumorpromotion in vivo (54). Therefore, there is considerable interestin identification of compounds able to downregulate AP1 activityand thereby oppose unregulated cell growth leading to benignor malignant hyperplasia and cancer. A number of ligands fornuclear receptors, including glucocorticoids, retinoids, andfatty acids display such AP1 repressive activity, which seemsto be the basis for their beneficial therapeutic effects. All-trans-retinoicacid receptors (RARs) exert two types of action on gene activity.The first one is referred to as transactivation and is characterizedby structural transitions occurring in the receptor structureupon agonist binding. This leads to the formation of proteininteraction interface(s) allowing recruitment of nuclear coactivatorsto the retinoid X receptor (RXR)-RAR dimer and therefore tothe promoter (reviewed in reference 52). Transrepression ofAP1 is the second activity of RARs, for which several observationsmay provide a model for transcriptional interference with membranereceptor-controlled signaling pathways. They include c-jun DNAbinding inhibition (45), competitive titration by RAR and AP1of limiting amounts of CBP (20), or downregulation of JNK activity(7, 24). Molecular determinants governing the transrepressiveactivity of RAR are, however, likely to be distinct from thoseruling its transactivation potential. This view is supportedby the description of dissociated retinoids, which are unableto elicit a transactivating response by RARs, yet induce transrepressionof AP1 (9, 17, 29, 36) as well as that of receptor mutants withaltered transactivation, but wild-type transrepression properties(25).

In this study, we examined the transrepressive activity of retinoidson the ERK-regulated AP1 activity in HeLa cells. We observedthat atRA treatment of target cells led to the alteration ofAP1 complex composition bound to an AP1 site. We report herefor the first time that ERKs, CBP, and RAR ${alpha}$ are associated withthe AP1-responsive promoter in vivo under stimulating conditions.This complex underwent structural alterations under transrepressiveconditions, which were correlated with the dissociation of ERKsand CBP from the promoter. Using synthetic retinoids and receptormutants, we also demonstrate that AP1 inhibition by human RAR ${alpha}$ (hRAR ${alpha}$ ) is independent of nuclear coactivator recruitment andother functions, such as dimerization with RXR and specificDNA binding.

MATERIALS AND METHODS

Top

Materials and Methods

Cell line and culture conditions. The HeLa cells used were from a subclone isolated from a HeLaTet-On (Clontech) cell population. They were routinely maintainedin Dulbecco's modified Eagle medium (Glutamax-1; Gibco-BRL,Cergy-Pontoise, France) supplemented with 10% fetal calf serum,50 U (each) of penicillin and streptomycin per ml, and 100 µgof G418 per ml.

Retinoids and chemicals. atRA was purchased from Sigma (St Quentin-Fallavier, France).9-cis-Retinoic acid was obtained from Hoffman-Laroche. All CDcompounds were kindly provided by U. Reichert (Galderma). CD3105(AGN 192870) is an RAR antagonist (22); CD2409 {(4-[1-hydroxy-3-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydronaphthalen-2-yl)-prop-2-ynyl]-benzoicacid} is a dissociated anti-AP1 ligand (50). PD98059 and allother kinase inhibitors were purchased from Calbiochem (France-Biochem,Meudon, France).

Transient transfections. HeLa cells were transfected by the polyethyleneimine method(25), and the luciferase activity was assayed as previouslydescribed (35).

cDNAs, plasmids, and reporter genes. pSG5-based expression vectors for hRAR ${alpha}$ , hRARß, andhRAR ${gamma}$ have been described previously (5). hRAR ${alpha}$ mutants have beendescribed elsewhere (26, 35). pSG5 hRAR ${alpha}$ K380R-D383R was a kindgift from H. de Thé. The pSG5-hRAR ${alpha}$ K244-262A double mutantwas generated by site-directed mutagenesis (QuickChange; Stratagene)with pSG5-hRAR ${alpha}$ K244A (35) as a template. The RXGRE-tk Luc reportergene (designated DR5-tk Luc in this study) is a pGL3-based vector(Promega, Charbonnières, France) and has been describedelsewhere (14). The AP1-tk Luc reporter gene is a pGL3-basedvector in which the thymidine kinase (tk) promoter is hookedto four repeats of the consensus AP1 site TGAGTCA. pcDNA3-myc-His6-hRAR ${alpha}$ was constructed by inserting the RAR ${alpha}$ cDNA in frame within thepcDNA 3.1 myc/His vector (InVitrogen). pGEX-based expressionvectors used for bacterial overexpression of glutathione S-transferase(GST)-fused coactivators have been described elsewhere (25).pSG5 c-jun, pBK c-fos, pRSV junB and pRSV junD, pRSV fra1, andthe dominant-negative JNK expression vector (dnJNK) were giftsfrom B. Wasylik, I. Verma, M. Nemer, M. Yaniv, and J. M. Blanchard,respectively. Constitutively active ras, MEK1, wild-type MKK7,and JNK1 vectors were generous gifts from R. Davis.

Western blotting and antibodies. Whole-cell extracts were prepared as follows. First, 5 x 10⁶cells were grown and treated with retinoids and/or TPA. Monolayerswere scraped rapidly in ice-cold 1x phosphate-buffered saline(PBS), and cells were lysed in 1 volume of sodium dodecyl sulfate-polyacrylamidegel electrophoresis (SDS-PAGE) loading buffer and briefly sonicated.Western blotting was carried out as described previously (13,35, 47). Anti-protein kinase C (anti-PKC), anti-JNKK1/MKK4,anti-ERK1 and -2, anti-MEK1 and -2, and anti-MKK1 antibodieswere obtained from Transduction Laboratories (Lexington, Ky.).Anti-phospho ERK antibody was obtained from Promega. Antibodiesrecognizing JNK1, c-jun (N), junB (N), junD (329), c-fos (no.4), fosB (102), fra1 (R-20), fra2 (L-15), and ATF2 were purchasedfrom Santa Cruz Biotechnology (Santa Cruz, Calif.). Calbiochemand New England BioLabs were the sources of anti-c-jun and anti-phosphorylatedc-jun antibodies. Anti-RNA polymerase II (pol II) antibodieswere from Santa Cruz Biotechnology (total RNA pol II, sc 899)and Covance/BabCo (anti-RNA pol IIA, 8WG16), and the DRIP205antiserum was a gift from C. Rachez and L. P. Freedman. Peroxidase-coupledantimouse, antigoat, or antirabbit immunoglobulin G was obtainedfrom Sigma.

EMSA and GST pulldown assays. Nuclear coactivators and dimerization assays with GST-taggedproteins as baits were performed as described previously (13,14). Electrophoretic mobility shift assays (EMSA) were run asdescribed in reference 41 with in vitro-translated receptors.

IP-kinase assays. For immunoprecipitation (IP)-kinase assays, the activities ofERKs, JNK, and p38 were assayed with kits purchased from CellSignaling Technologies (Beverly, Mass.) according to the manufacturer'sinstructions. MEK1 activity was assayed with a kit purchasedfrom Upstate Biotechnology (Lake Placid, N.Y.), and glycogensynthase kinase 3 (GSK-3) activity was assayed similarly withan anti-GSK-3 antibody (Transduction Laboratories) by usinga phospho-glycogen synthase peptide (Upstate Biotech) as a substrate.

DNA-IP assays. For DNA-IP assays, 4 x 10⁶ to 6 x 10⁶ HeLa cells were transfectedas described above with AP1-tk Luc and pSG5-hRAR ${alpha}$ vectors. Forty-eighthours after transfection, cells were treated for 1 h with atRAand/or phorbol ester. Proteins were cross-linked to DNA by additionof 1% formaldehyde to the medium for 15 min at 37°C. Thereaction was quenched upon addition of 100 mM glycine for 15min at room temperature, and cells were collected in ice-cold1x PBS. Cells were lysed in 10 mM Tris-HCl (pH 7.4), 10 mM EDTA,1% SDS, 100 µM Na₂VO₃, 10 mM sodium butyrate, 1% proteaseinhibitor cocktail (Sigma), and soluble DNA-protein complexeswere prepared by sonication of cellular lysates. After celldebris had been spun down, soluble protein-DNA complexes werediluted 10-fold in IP buffer (10 mM Tris-HCl [pH 7.4], 10 mMEDTA, 20 mM NaCl,1% Triton X-100, 100 µM Na₂VO₃, 10 mMNaBu, 1% protease inhibitor cocktail) and incubated with 2 to5 µg of antibody overnight at 4°C. Immune complexeswere collected by addition of 50 µl of a 50% protein A-Sepharoseslurry and incubation at room temperature for 2 h. Beads weresuccessively washed with IP buffer, IP buffer plus 1.2 M NaCl,and a mixture containing 10 mM Tris-HCl (pH 7.4), 1% NP-40,1% deoxycholate, 1 mM EDTA, 0.25 M LiCl, and 100 µM Na₂VO₃.After a final wash in a mixture of 10 mM Tris-HCl (pH 7.4) and1 mM EDTA, immune complexes were eluted from beads in 250 µlof a mixture containing 0.1 M NaHCO₃ and 1% SDS. Supernatantswere heated for at least 4 h at 65°C in the presence of1 mg of proteinase K per ml to reverse cross-links. DNA waspurified with the QIAquick DNA purification kit (Qiagen). Targetsequences were amplified by using RV3 and GLP2 primers fromPromega (25 to 28 PCR cycles) and resolved on a 1.2% agarosegel.

Real-time PCR. AP1 promoter sequences were amplified with the TaqMan PCR mastermix (Applied Biosystems, Courtaboeuf, France). The FAM/TAMRAcoupled-probe (+31/+52: CCCAGCGTCTTGTCATTGGGCGA), forward (-53/-31:GGTGCCAGAACATTTCTCTATCG), and backward (+81/+96: GACCTCGGACCGCGC)primers were designed to amplify a 140-bp DNA fragment encompassingthe four repeats of the AP1 response element (TGACTCA) presentin the reporter gene used in all experiments. Position +1 correspondsto the first base of the second AP1 response element. Reactions(40 cycles) and data analysis were carried out with an ABI Prism770 (Applied Biosystems).

RESULTS

Top

Results

Retinoids repress the MEK1-dependent AP1 response in HeLa cells. We first investigated which signaling module or modules mediatethe TPA-induced AP1 activity by monitoring the activity of atransiently transfected AP1-responsive reporter gene in HeLacells(Fig. 1A). The activity of the AP1-tk Luc reporter geneincreased 10- to 15-fold when cells were treated for 6 h with100 nM TPA. Specific activators of SAPKs, such as anisomycinand UV, were unable to activate the AP1-tk Luc reporter gene(Fig. 1A), as well as tumor necrosis factor alpha (TNF- ${alpha}$ ) (M.Benkoussa and P. Lefebvre, unpublished observations), suggestingthat SAPK signaling modules are not fully functional in thiscell line. The TPA-induced increase in luciferase activity wasabrogated in the presence of GF109203X, a specific inhibitorof PKC- ${alpha}$ , -ß, - ${gamma}$ , - ${delta}$ , and - ${epsilon}$ isoforms (48) and of Gö6976,a specific inhibitor of PKC- ${alpha}$ and -ßI (32). Since PKC-ßis not expressed in our cell line (M. Benkoussa and P. Lefebvre,unpublished), PKC- ${alpha}$ is a likely molecular relay for TPA-mediatedactivation of AP1. PD98059 selectively inhibits MAPK kinases1 and 2 (MEK1 and -2, respectively) (2), which act as an upstreamactivator of ERK1 and -2. The complete inhibition of the TPA-inducedresponse by 10 µM PD98059 suggests that MEK1 and -2 isan important regulator of the TPA-induced AP1 response. Hypericinis known to inhibit PKCs and ERKs at 50% inhibitory concentrationsof 3.3 µM and 4 nM, respectively. We thus used hypericinat 100 nM, a concentration affecting mostly ERK activity, andwere able to block the TPA-induced AP1 response. Cotransfectionof a dominant-negative mutant of JNK, dnJNK (40), led to a decreaseof 15 to 20% of the TPA-induced luciferase activity, indicatingthat JNK activation plays a minor role in the transcriptionalactivation process of the promoter. The p38-specific inhibitorSB203580 was able to reduce the TPA-induced AP1 activity byabout 20%. Thus, TPA triggers in HeLa cells a composite MEK1and -2-dependent response involving mainly the MAPK^ERK signalingmodule. Both MAPK^JNK and MAPK^p38 also contributed to this response,albeit to a much lesser extent. Additionally, atRA was ableto repress the TPA-induced AP1 activation in a receptor- andligand-dependent manner. Indeed, the RAR-mediated repression,which ranged from 5 to 20% in the presence of endogenous RAR ${alpha}$ ,was increased to 85 to 95% when RAR ${alpha}$ , RARß, or RAR ${gamma}$ was overexpressed (Fig. 1A and B).

View larger version (34K):
[in this window]
[in a new window]
FIG. 1. Inhibition of the MAPK^ERK pathway by retinoids. (A) The MAPK^ERK signaling pathway activates AP1 in HeLa cells. HeLa cells were transfected and treated for 6 h with the following activators and/or inhibitors of kinases: 100 nM TPA, 500 nM GF109203X, and 500 nM Gö6976 (PKCs, GF, and Gö), 10 µM PD98059 (MEK1 and -2; PD), 100 nM SB203580 (p38 ${alpha}$ and -ß; SB), 100 nM hypericin (ERKs). SAPK activators were used as follows: anisomycin, 50 ng/ml (subinhibitory concentration) (18); UV, 40 J/m². Bar diagrams for this and the following experiments represent the average (± standard deviation) of at least five experiments carried out with six independent assays. The basal level of reporter gene expression was scaled up to 1, and all activities are expressed relative to the basal level, which did not vary significantly. dnJNK, dominant-negative mutant of JNK1. (B) Retinoid receptor expression in HeLa cells. mRNAs were analyzed by reverse transcription-PCR for RAR and RXR isoform transcripts. Actin was used as an external control. PCR products were resolved on an agarose gel and visualized by ethidium bromide staining (RNA panel). Fifty micrograms of whole-cell extract was analyzed by Western blotting with antibodies against RAR ${alpha}$ , RARß, RAR ${gamma}$ , and RXRs (HeLa). Controls were provided by RARs or RXRs extracted from cells transfected with expression vectors coding for each receptor (ttHeLa) or synthesized by coupled in vitro transcription and translation (TnT) (Proteins panel). (C) MAPK sensitivity to retinoid inhibition. HeLa cells were transfected with AP1-tk Luc and expression vectors coding for RAR ${alpha}$ , constitutively active ras (rasLG1), wild-type MKK7 and wild-type JNK1 or constituvely active MEK1. Cells were treated for 6 h with 1 µM atRA, and the resulting luciferase activities were plotted as in panel A.

We next sought to identify at which step or steps atRA interfereswith the signal transduction process. AP1 activity was monitoredin the presence or absence of retinoids as described above incells overexpressing RAR ${alpha}$ and constitutively active protein kinasesbelonging to MAPK signaling pathways (Fig. 1C). Constitutivelyactive ras (ras L61) induced a strong AP1 activity, which washighly sensitive to atRA inhibition. Similarly, overexpressionof MEK1 induced a potent AP1 response sensitive to atRA inhibition.Coexpression of MKK7 and JNK1, two potent upstream activatorsof the jun transcription factor family, poorly activated theAP1 response, and this response was not sensitive to atRA. Similarresults were obtained when a constitutive activator of the MAPK^JNKpathway, SEK1 (SEK1 ED) (44), was overexpressed (M. Benkoussaand P. Lefebvre, unpublished). Thus atRA exerts its transrepressiveactivity through regulation of a MEK1 and -2 and/or ERK1 and-2-controlled event.

The ability of retinoids to inhibit AP1 activation may potentiallybe ascribed to several mechanisms, one of which is downregulationof the expression of essential relays of MAPK or SAPK signalingcascades. Preliminary experiments allowed us to rule out sucha hypothesis for PKCs, c-raf, MEK-1 and -2, JNKK, JNK1 and -2,and ERK1 and -2 (M. Benkoussa, M.-H. Delmotte, and P. Lefebvre,unpublished observations). Expression of other proteins potentiallyinvolved in AP1 modulation such as p21/Waf-1 (a retinoid-regulatedinhibitor of cyclin-dependent kinase and a regulator of NF- ${kappa}$ Bactivity) (30) and p53 (a regulator of p21/Waf-1 gene transcription)was not significantly altered in our system (M. Benkoussa andP. Lefebvre, unpublished).

We then established HeLa-derived cell lines overexpressing hRAR ${alpha}$ or ß-galactosidase as a control to further investigatethe role of this receptor as a transrepressor. The level ofexpression of RAR ${alpha}$ in the HeLa-RAR subclone was at least 10-to 15-fold higher than that of the wild-type (C. Brand and P.Lefebvre, unpublished observations) or ß-galactosidase-positiveHeLa cells (Fig. 2A). Stimulation of HeLa cells by TPA led toa strong increase of ERK1 and -2 activity, as assayed by anIP-kinase assay (Fig. 2B). However, atRA was not able to counteractthis upregulation in either the wild-type or RAR-overexpressingbackground. Similar assessments of JNK and p38 activities werecarried out, and while JNK remained nondetectable in our system,p38 activity was slightly increased upon TPA treatment, withno significant effect of retinoic acid in both cellular backgrounds.

View larger version (24K):
[in this window]
[in a new window]
FIG. 2. Components of MAPK signaling modules in HeLa cells. (A) Expression of hRAR ${alpha}$ in HeLa-ßgal or HeLa-RAR cell lines. Whole-cell extracts (50 µg of protein) were analyzed by Western blotting with an anti-RAR ${alpha}$ antibody. (B) MAPK activities in the wild-type HeLa or HeLa-RAR background. Cells were treated for 6 h with the indicated compounds, and cell extracts were assayed for ERK1 and -2 (P-Elk), JNK1 and -2 (P-c-jun) and p38 (P-ATF2) activities by IP-kinase assays. Representative results are shown. The GST-c-jun fusion protein, used as a substrate in the JNK assay, was detected with a specific anti-c-jun antibody to ensure that the negative result was not due to aberrant loading of gels. For the experiment shown, the numbers indicate the fold induction over the reference set to 1. (C) Expression levels of c-fos, c-jun, and related transcription factors. Western blot analyses were carried out with specific antibodies for c-fos- and c-jun-related proteins. Results were quantified and expressed as in panel B.

Expression levels of AP1 components were examined by Westernblot analysis of whole cell extracts (Fig. 2C). TPA treatmentstrongly increased c-fos expression levels (Fig. 2C), consistentwith the reported upregulation of the c-fos promoter by ERK-phosphorylatedElk1 (31). atRA, however, did not significantly alter this effectin either in the wild-type or HeLa-RAR background. This is incontrast to a previous report showing that retinoids opposeTPA-induced upregulation of c-fos in pituitary cells (39). fra1responded similarly to c-fos in both cases, whereas fosB andfra2 were barely detectable under these conditions. While c-junwas weakly expressed in our cellular model, the expression levelof junD was high under all conditions and was not regulatedby retinoids and/or TPA. junB turned out to be strongly inducedby TPA, but not downregulated by retinoids

From these data, we conclude that AP1 inhibition is unlikelyto proceed through modulation of levels of MAPK activity orAP1 factors, a conclusion strengthened by the observation thatprotein synthesis inhibitors did not prevent AP1 activationand retinoid-mediated AP1 repression (M. Benkoussa and P. Lefebvre,unpublished).

GSK-3 is involved in atRA-mediated inhibition of AP1. The activation state of several protein kinases known to potentiallyregulate AP-1 was further evaluated as a function of time byan IP-kinase assay in response to TPA and/or retinoids. BothERK1 and -2 and MEK1 were activated in response to TPA treatment,but atRA did not inhibit this activation process (Fig. 3A).GSK-3 has been identified as an ERK-regulated negative modulatorof c-jun and junD DNA binding activity, acting by phosphorylationof serine residues in the DNA binding domain of these transcriptionfactors (12, 38). The activation state of GSK-3 was found tobe insensitive to MAPK^ERK pathway activation by TPA, but significantlyenhanced after a 30-min treatment with atRA. Note that eachkinase underwent a sustained activation in time, likely dueto the metabolic stability of TPA. Finally, the phosphorylationstate of junD at S100, reflecting its transcriptional activation,was assayed by Western blotting with a specific anti-phosphojunD antibody. As expected, TPA promoted a strong hyperphosphorylationof this transcription factor, which was abrogated in the presenceof atRA. To confirm these kinase assays, the activation stateof ERK1 and -2, MEK1 and -2, and of GSK-3 was also assessedafter a 6-h treatment with antiphosphokinase antibodies (Fig.3B). As it could be predicted from the IP-kinase assays, ERK1and -2 and MEK1 were hyperphosphorylated (activated) upon TPAtreatment, and insensitive to atRA. GSK-3 exists in most celllines as two isoforms, ${alpha}$ and ß, and phosphorylationof these kinases leads to the inactivation of their catalyticproperties. In our system, both isoforms were phosphorylated(inactive) in control cells, but atRA treatment lowered specificallythe phosphate content of the ß isoform. This showsthat GSK-3ß activation is positively regulated byatRA, in agreement with the IP-kinase assay. Finally, junD wasstrongly phosphorylated in the N-terminal transactivation domain(Ser 100) upon TPA treatment, and Ser 100 phosphorylation wasabrogated in the presence of atRA.

View larger version (33K):
[in this window]
[in a new window]
FIG. 3. GSK-3 is a retinoid-dependent partial inhibitor of AP1 transcriptional activity. (A) Activity of protein kinases in response to phorbol ester and/or atRA. HeLa-RAR cells were treated for the indicated times with the indicated combination of retinoid and TPA and whole-cell extracts were prepared. One hundred micrograms of proteins was subjected to IP with anti-ERK, anti-MEK1, or GSK-3 antibodies (1 µg), and immunoprecipitates were incubated with Elk-1, ERK2, and MBP, and phospho-glycogen synthase peptide, respectively, as substrates. junD phosphorylation was assayed by Western blotting as below and quantified by densitometric analysis of fluorograms. Each assay was performed in duplicate. (B) Phosphorylation of protein kinases in response to TPA and/or atRA. HeLa cell extracts, prepared from cells treated for 6 h with the indicated combination of retinoid and TPA, were probed for their content in phosphorylated adducin (as a control), GSK ${alpha}$ and -ß, ERK1 and -2, MEK1 and -2 and junD. Representative fluorograms are shown. (B) Lithium partially inhibits atRA-induced AP1 repression. HeLa cells were transfected with the AP1-tk Luc reporter gene and pSG5-hRAR ${alpha}$ . Cells were treated 2 days after transfection with the indicated combinations of 1 µM atRA, 100 nM TPA, 10 mM NaCl, or 10 mM LiCl. The resulting luciferase activity was assayed 6 h later, and the results are expressed as described in the legend to Fig. 1.

Our observations suggested that atRA-mediated activation ofGSK-3 could potentially inhibit AP1 through phosphorylationof junD and impaired DNA binding of AP1 complexes. GSK-3 ${alpha}$ and-ß are related protein serine kinases having a criticalrole in the dorsoventral patterning of vertebrates (15, 19),and severe effects of lithium on embryonic development are probablydue to its ability to inhibit specifically GSK-3 (23, 46). Todetermine whether GSK-3 activity affects the retinoid-mediatedinhibition of AP1, we incubated HeLa cells transfected withthe AP1 reporter gene and the RAR ${alpha}$ expression vector with 10mM lithium chloride or 10 mM sodium chloride and challengedthem with TPA and/or atRA (Fig. 3C). Neither lithium nor NaClhad a significant effect on AP1 activity. However, the transrepressiveactivity of atRA was partially blunted in the presence of lithium,suggesting a contribution of GSK-3 to retinoid-controlled AP1inhibition. These data indicate that GSK-3 activity is requiredfor full inhibition of AP1 activity by retinoids.

Characterization of AP1 complexes bound to the TPA response element in intact cells. We then attempted to characterize the composition of AP1 complexesbinding to DNA by EMSA. Although informative, EMSAs did notreflect the alteration of the expression of AP1 components,as revealed by Western blot analysis of whole-cell extracts.We thus used an immunoprecipitation assay to quantify the biochemicalcomposition of AP1 complexes bound to the AP1-responsive reportergene promoter in vivo.

Using antibodies directed against each potential component ofthe AP1 complex, immunoprecipitation from untreated cells witheach antibody followed by real-time PCR detection (DNA-IP) ofthe promoter region (including the AP1 site and the thymidinekinase [tk] promoter) showed that junD, c-fos, and fra2 wereprominently bound to this promoter (Fig. 4A). After treatmentfor 1 h with 100 nM TPA, the composition of the AP1 complexwas shifted towards a junD-fosB dimer. Surprisingly, c-fos wasnot found to be a major component of the AP1 complex under theseconditions. When cells were challenged with TPA plus 1 µMatRA, junD, fosB, and fra1 were associated with the promoter,consistent with the reported inhibitory effect of fra1 on AP1-mediatedtranscription (33, 51). In contrast to untreated cells, junDbinding was weaker, strengthening the hypothesis that atRA-regulatedGSK-3 activation may play a role in AP1 transrepression. Asa negative control, a reporter gene (AP1 mut) containing a mutatedAP1 site that does not confer responsiveness to TPA was used,showing that loading of AP1 factors is strictly dependent onthe AP1 site integrity.

View larger version (40K):
[in this window]
[in a new window]
FIG. 4. Transcription factor assembly on the AP1 consensus response element in intact cells. (A) AP1 protein binding to the AP1 response element. HeLa cells were transfected with the AP1-tk Luc reporter gene together with the pcDNA myc-His hRAR ${alpha}$ expression vector. DNA-IP assays were performed after a 1-h treatment with TPA and/or atRA with antibodies (Ab) against AP1 proteins. As a control, a reporter gene containing an inactivated AP1 site and displaying no activity upon TPA treatment was used (AP1mut-tk Luc). Immunoprecipitated DNA was analyzed by semiquantitative PCR (top panels, 28 PCR cycles) and quantified by real-time PCR. Results are expressed as femtograms of DNA and displayed in the bar graph (bottom panel). The input lanes show that equivalent amounts of plasmid DNA were used for each DNA-IP. (B) atRA prevents RNA pol II loading on the AP1-responsive promoter. DNA-IP assays were performed as in panel A with either a nonphosphorylated RNA pol II CTD monoclonal antibody (RNA pol IIA, clone 8WG16, BaBCo) or a polyclonal antibody against total (phosphorylated and nonphosphorylated) RNA pol II (RNA pol II, total, sc899; Santa Cruz Biotechnology). (C) RAR ${alpha}$ is constitutively tethered to the AP1 binding site. DNA-IP assays were performed after transfection of cells with either the AP1-tk Luc or the DR5-tk Luc reporter genes together with RAR or RAR and RXR expression vectors, respectively. Antibodies directed against total RNA pol II or the RAR ${alpha}$ C terminus were used, and immunoprecipitates were analyzed for the presence of RARE or AP1 response element sequences.

By using a similar approach, we then assessed RNA pol II recruitmentto the AP1-tk Luc promoter (Fig. 4B). We first used an antibodydirected against the N terminus of the rpb1-encoded subunit,which recognizes this polypeptide irrespective of posttranslationalmodifications (Fig. 4B, RNA pol II total). In nonstimulatedcells, little association of RNA pol II was detected on thepromoter, as well as under atRA stimulation. As expected, avery strong increase in RNA pol II recruitment was observedafter a 1-h stimulation with TPA. Surprisingly, atRA stronglyinhibited TPA-induced RNA pol II loading to basal levels. TheTFIIE-dependent, TFIIH-mediated phosphorylation of the C-terminaldomain (CTD) of pol II is in many instances correlated to transcriptionalactivation of genes (8, 53). Conversely, hypophosphorylationis associated to the DNA-bound, elongation-incompetent formof pol II (RNA pol IIA). In nonstimulated cells, DNA-IP withan antibody recognizing the nonphosphorylated form of RNA polII did not reveal any association of this enzyme with the promoter(RNA pol IIA; Fig. 4B). As expected, this transcriptionallyinactive form was absent in TPA-treated cells. However, atRAwas able to promote, alone or in the presence of TPA, a detectableinteraction of RNA pol IIA with the promoter. Thus, atRA islikely to repress transcriptional activation of the AP1-responsivereporter gene by decreasing the overall level of RNA pol IIrecruitment, as well as by favoring the stalling of a smallfraction of RNA pol II as a nonphosphorylated enzyme.

To determine whether RAR ${alpha}$ could be recruited to the AP1 responseelement, we performed DNA-IP assays with an antibody againstthe C terminus of RAR ${alpha}$ . The ability of RAR ${alpha}$ to bind to a DR5 retinoicacid response element (RARE) was evaluated in parallel by transfectingcells with RAR and RXR expression vectors together with a reportergene (DR5-tk Luc), the sequence of which is strictly identicalto that of the AP1 reporter gene (AP1-tk Luc), except for theresponse element (Fig. 4C). In naive cells, no RNA pol II wasbound to the AP1 site, but RAR ${alpha}$ was found to be associated withthe promoter, whereas under conditions of stimulation by TPA,both RNA pol II and RAR ${alpha}$ were associated with DNA. Under conditionsof transrepression, only RAR ${alpha}$ was detected. This differentialloading was response element specific, since atRA-induced recruitmentof RAR ${alpha}$ to the DR5 RARE, which was concomitant to a stronglyincreased RNA pol II loading. Thus, transrepression by atRAmay be attributed to decreased RNA pol II recruitment at theAP1-responsive promoter. RAR ${alpha}$ is also associated to this promoterunder any condition, suggesting that ligand binding triggersan event leading to AP1 transcriptional inactivation. This unexpectedfinding prompted us to characterize more extensively the bindingof RAR ${alpha}$ and other putative components of the transcriptionalmachinery to the promoter.

We therefore constructed a N-terminal fusion protein betweenthe c-myc epitope and RAR ${alpha}$ , which displays wild-type transrepressiveactivity (M. Benkoussa and P. Lefebvre, unpublished) and performedthe DNA-IP assay as described above. Antibodies directed againstthe C terminus of RAR ${alpha}$ , the c-myc epitope located at the N terminusof RAR ${alpha}$ , the NR2 box of DRIP205, the CREB binding domain of CBP,and the C terminus of ERK1 and -2 were thus used in the DNA-IPassay (Fig. 5). As described above, RAR ${alpha}$ was consistently detectedin all conditions when an antibody directed against its C terminuswas used. More surprisingly, the accessibility of the RAR ${alpha}$ Nterminus was decreased to basal levels under transrepressiveconditions. This decreased accessibility was also observed inthe presence of a retinoid antagonist (CD3105), which displaysan anti-AP1 activity similar to that of atRA (Fig. 6). Thisresult demonstrates that the RAR ${alpha}$ N-terminus region is eithermasked or undergoes structural transitions when AP1 is transcriptionallyactive. ERKs have been shown to phosphorylate c-jun at Ser 63and Ser 73 and to regulate its transcriptional activity (28).junD is, by homology, a likely substrate for ERK, and we askedwhether this kinase could be detected at the AP1-regulated promoter.Very interestingly, ERK was detected under basal conditions,and this recruitment was strongly increased in TPA-stimulatedcells. Both a retinoid agonist and a retinoid antagonist wereable to downregulate ERK recruitment, and this behavior paralleledexactly that of CBP, a coactivator for AP1 (20). DRIP205, anuclear receptor coactivator (42), was recruited to the AP1promoter only in the presence of atRA and not CD3105, suggestingthat this interaction occurs through RAR ${alpha}$ . Thus, incorporationof ERK and CBP at the AP1 promoter is affected negatively byretinoids, irrespective of their activity in transactivationassays.

View larger version (39K):
[in this window]
[in a new window]
FIG. 5. Transcription factors and cofactors loading at the AP1 response element in vivo. HeLa cells were transfected as described in the legend to Fig. 4. DNA-IP assays were carried out with anti-c-myc (RAR ${alpha}$ N terminus), anti-RAR ${alpha}$ AF2 (RAR ${alpha}$ C terminus), anti-pan-ERK, anti-DRIP205, and anti-CBP antibodies. atRA and CD3105 were both used at a final concentration of 1 µM, and TPA was used at a final concentration of 100 nM.

View larger version (23K):
[in this window]
[in a new window]
FIG. 6. Transactivation and transrepression by retinoids. (A) Transactivation by retinoids. The activity of the DR5 RARE-driven reporter gene was monitored by assaying luciferase activity in HeLa cells transiently transfected with RGXR alone (left panel) or RGXR and hRAR ${alpha}$ . Cells were treated with the indicated ligand for 6 h. (B) Transrepression by retinoids. HeLa cells were transfected with receptor expression vectors as described above and the AP1-tk Luc reporter gene. TPA was used as the AP1 inducer (100 nM). The basal level of reporter gene expression was scaled up to 1, and all activities are expressed relative to the basal level, which did not vary significantly. The following concentrations were used in both assays: 50 nM atRA, 1 µM CD3105, 10 µM CD2409, and 100 nM TPA.

AP1 transrepression by retinoids does not correlate with their transactivating properties. Several pieces of evidence suggest that RAR-mediated transrepressionand transactivation are distinct and unrelated phenomena (seethe introduction). We thus assayed the transactivating and transrepressingactivities of hRAR ${alpha}$ by using retinoids with different chemicalstructures and distinct biological properties. atRA is usedas the reference compound, whereas CD3105 is an RAR antagonist(22) and CD2409 is a dissociated, anti-AP1 retinoid (50).

We first tested these three retinoids in a standard transactivationassay by using the DR5-tk Luc reporter gene and expression vectorscoding for RAR ${alpha}$ and RXR ${alpha}$ . This assay confirmed the biologicalproperties of these three representative retinoids in our system.atRA elicited a strong response (12- to 15-fold induction),whereas neither the antagonist CD3105 nor the dissociated anti-AP1CD2409 retinoid stimulated luciferase activity after a 6-h treatment(Fig. 6A). HeLa cells were treated simultaneously with TPA andretinoids to assess whether activation of the PKC-MAPK pathwaycould affect hRAR ${alpha}$ function. A modest decrease of the responsivenessto atRA was observed in the presence of overexpressed hRAR ${alpha}$ underthese conditions, in agreement with our previous results obtainedin COS cells (47).

The ability of these three retinoids to promote RAR ${alpha}$ -mediatedAP1 transrepression was assessed. In the absence of overexpressedhRAR ${alpha}$ , TPA strongly activated AP1 (10- to 15-fold induction).Retinoids alone were inactive, and a very weak inhibition ofthe TPA-induced luciferase activity was observed, suggestinga minor contribution of endogenous RAR ${alpha}$ . A moderate constitutiverepression was observed in the presence of overexpressed RAR ${alpha}$ (Fig. 6A) and for hRARß and hRAR ${gamma}$ in this cell lineand others (M. Benkoussa and P. Lefebvre, unpublished). Retinoidsabrogated the TPA-induced luciferase activity, irrespectiveof their ability (or inability) to transactivate the DR5-drivenpromoter (Fig. 6B). Transcriptional interference is thus unlikelyto require a function or functions necessary for receptor-mediatedtranscriptional activation

Coactivator recruitment is not a prerequisite for AP1 repression by hRAR ${alpha}$ . We showed recently that mutation of K244 or K262 in hRAR ${alpha}$ partiallyabolished nuclear receptor coactivator (NCoA) recruitment byhRAR ${alpha}$ and strongly impaired its transactivating activity (35).We therefore introduced a double K244-to-A and K262-to-A mutationin wild-type hRAR ${alpha}$ to generate a transcriptionally inactive receptor.The ligand-binding and DNA-binding activities of K244-262A werenot altered, as judged from the limited proteolysis assay (Fig.7A) and EMSA, respectively (Fig. 8B). The ability of K244-262Ato interact with NCoAs in vitro was assessed by an in vitroprotein-protein interaction assay (Fig. 7B). As expected, monomericwild-type hRAR ${alpha}$ was able, when challenged with atRA, to interactwith members of the p160 class of NCoAs, such as GRIP1, RIP140,and SRC1, and others, such as DRIP205 and CBP. On the contrary,ligands unable to elicit transactivation by hRAR ${alpha}$ (CD3105 andCD2409) were unable to promote a detectable interaction of hRAR ${alpha}$ with these coactivators (Fig. 7B). When the K244-262A mutantwas used in a similar assay, none of the ligands used abovepromoted interaction of hRAR ${alpha}$ with any of these coactivators(Fig. 7B). Structural transitions leading to NCoA recruitmentare thus completely abrogated by the K244-262A mutation, aswell as corepressor binding (M. Benkoussa and P. Lefebvre, unpublished).Thus, the K244-262A mutation selectively inactivated NCoA andNCoR recruitment without compromising ligand and DNA bindingactivities of the receptor. Predictably, the K244-262A mutantdid not activate transcription from a DR5-driven promoter (Fig.7C), yet acted as a transrepressor in the presence of agonists,antagonists, and dissociated retinoids. Thus, NCoA recruitmentis not required for AP1 transrepression. This conclusion isfurther strengthened by results obtained with hRAR ${alpha}$ ${Delta}$ 403, a C-terminally-truncatedRAR ${alpha}$ mutant. This truncation removes both the F domain and theAF2-AD region of hRAR ${alpha}$ and yields a receptor exhibiting wild-typeligand binding activity (26), unaltered DNA binding activity(Fig. 8B), and impaired NCoA recruitment and is transcriptionallyinactive (25) However, hRAR ${alpha}$ ${Delta}$ 403 displays full anti-AP1 activity(Fig. 8C).

View larger version (34K):
[in this window]
[in a new window]
FIG. 7. Inactivation of nuclear coactivator recruitment by RAR ${alpha}$ does not prevent retinoid-mediated AP1 transrepression. (A) Ligand-receptor interaction assay. Wild-type hRAR ${alpha}$ and hRAR ${alpha}$ K244-262A were translated in vitro and incubated with 1 µM atRA for 2 h at 4°C. Complexes were then incubated with trypsin, and products were resolved by SDS-10% PAGE. Representative autoradiographs are shown for each receptor. The 28-kDa band represents the trypsin-resistant receptor domain, which encompass most of the ligand binding domain. (B) Interaction of wild-type hRAR ${alpha}$ and hRAR ${alpha}$ K244-262A with nuclear coactivators. ³⁵S-labeled hRAR ${alpha}$ was incubated in the presence of the indicated GST fusion proteins for 2 h and with retinoids. Coactivator-receptor complexes were isolated by adsorption of the GST moiety on agarose beads coupled to glutathione. After washing of the beads, complexes were analyzed by SDS-8% PAGE, and bound receptor was assayed by autoradiography. The affinity of the mutant receptor hRAR ${alpha}$ K244-262A for NCoAs was assayed as for wild-type RAR ${alpha}$ . (C) Transactivation and transrepression by the hRAR ${alpha}$ K244-262A mutant. The activity of the DR5-driven reporter gene was monitored by assaying luciferase activity in HeLa cells transiently transfected with RGXR ${alpha}$ and hRAR ${alpha}$ . Cells were treated with 1 µM atRA for 6 h (left panel). HeLa cells were transfected with RAR expression vectors and the AP1-tk Luc reporter gene. TPA was used as the AP1 inducer at 100 nM, and atRA was used at 1 µM (right panel).

View larger version (47K):
[in this window]
[in a new window]
FIG. 8. Dimerization of hRAR ${alpha}$ with RXR and DNA-specific recognition are not required for RAR-mediated AP1 inhibition. (A) Dimerization of hRAR ${alpha}$ with hRXR ${alpha}$ in the presence of an agonist, an antagonist, or a dissociated retinoid. ³⁵S-labeled hRAR ${alpha}$ was produced by in vitro coupled transcription-translation, incubated for 2 h with DMSO or 1 µM retinoids, and adsorbed on a Sepharose-GST-hRXR ${alpha}$ affinity matrix. Bound receptors were visualized by autoradiography of the dried SDS-PAGE (8% polyacrylamide) gel. (B) DNA binding activities of hRAR ${alpha}$ mutants. hRAR ${alpha}$ or derivatives and hRXR ${alpha}$ were obtained by in vitro translation. Receptors were then incubated for 30 min with the labeled DR5 probe, and complexes were resolved by nondenaturing 5% PAGE. Receptor-DNA complexes were then visualized by autoradiography of dried gels. The specific nature of the binding was assessed with a 50-fold excess of cold DR5 or SP1 oligonucleotide in the binding reaction mixture (M. Benkoussa and P. Lefebvre, unpublished). Receptor concentrations were adjusted in order to obtain a 1:1 stoichiometric ratio of RAR to RXR and to avoid significant binding of hRAR ${alpha}$ homodimers to the DR5 probe. (C) Transrepression and transactivation properties of hRAR ${alpha}$ mutants. The transactivation (RGXRE tk Luc) and transrepression (AP1-tk Luc) activities of hRGAR ${alpha}$ (mutated in the P box) of the dimerization-defective RAR ${alpha}$ (K380-D388RR) and of the truncated hRAR ${alpha}$ ${Delta}$ 403 were compared. (D) Expression levels of RAR ${alpha}$ and RAR ${alpha}$ mutants in transfected HeLa cells. Whole-cell extracts (25 µg of protein) were analyzed by Western blot analysis for their content in overexpressed receptor. Note that RAR ${alpha}$ ${Delta}$ 403 was not detectable because the antibody is directed against the F domain of RAR ${alpha}$ .

Dimerization of hRAR ${alpha}$ with hRXR ${alpha}$ and specific DNA binding are not required for AP1 inhibition. AP1 transrepression by hRAR ${alpha}$ does not require coexpression ofRXR, leading to the prediction that RAR might act as a monomer.We thus wanted to test this hypothesis by first comparing thecapacity of representative retinoids to promote hRAR ${alpha}$ interactionwith hRXR ${alpha}$ , independently of DNA binding (Fig. 8A). A GST pulldownassay was used, allowing the detection of DNA-independent, ligand-inducedheterodimer formation (14). As previously reported, atRA stabilizedefficiently hRAR ${alpha}$ interaction with hRXR ${alpha}$ under these conditions.On the contrary, both CD3105 and CD2409 were unable to triggerheterodimer formation, both in vitro, as shown by GST-pulldownassays (Fig. 8A), and in vivo, as shown by a two-hybrid assayin mammalian cells (14). The RXR-RAR dimerization interfaceis defined by 25 conserved amino acids located in helices 7to 11 (6, 41). Ten out of 25 RAR ${alpha}$ amino acid side chains, includingthose of K380 and D383, are engaging into salt bridges and contributeto 35% of the 967-Å² RXR-RAR dimerization interface (6).The double mutation yields a receptor mutant that is unableto form heterodimers in solution (Fig. 8A). Consequently, hRAR ${alpha}$ K380R-D383R does not bind DNA (Fig. 8B) and displays no transactivationpotential when tested on a DR5 RARE-driven reporter gene (Fig.8C) and DR2- and TREpal-driven reporters (P. Lefebvre, unpublisheddata). However, this mutant fully repressed AP1 activity ina ligand-dependent manner (Fig. 8C). Taken together, these resultsstrongly suggest that dimerization with RXR is not mandatoryfor transrepression.

We then wished to test whether the ability of the receptor tobind a RARE is required for transrepression. The P box of hRAR ${alpha}$ ,which contains three amino acids essential for specific DNArecognition, was thus mutated to confer specific binding ofhRAR ${alpha}$ to a GRE. As expected, the RAR mutant RGAR did not bindto a DR5 response element in the presence of hRXR ${alpha}$ (Fig. 8B)and was inactive in the transactivation assay (Fig. 8C). However,this mutant was fully active in the transrepression assay (Fig.8C), demonstrating that the ability to bind specifically tocognate response elements is not required for AP1 transrepression.

DISCUSSION

Top

Discussion

One of the most fascinating question regarding nuclear receptorfunctions is how a single polypeptide can exhibit distinct transcriptionalactivities and how the ligand may selectively dictate theseactivities. Here we report the functional analysis of RAR ${alpha}$ asan AP1 inhibitor and the characterization of AP1 activationand transrepression processes in a defined cellular background.We also observed that AP1-responsive reporter genes driven bydistinct AP1 response elements (from the collagenase A promoterand the atrial natriuretic factor [ANF] promoter) were equallysensitive to retinoid inhibition (M. Benkoussa and P. Lefebvre,unpublished). JNK inhibition has been proposed to be a key stepin AP1 repression by glucocorticoids and retinoids (7). In ourmodel, however, the MEK1 and -2-ERK pathway is the main signalingmodule regulating AP1 activation and sensitive to inhibitionby atRA, while the MAPK^JNK pathway is poorly active and notsensitive to retinoids. Our results also suggest that transrepressionis not a reciprocal phenomenon. This conclusion is consistentwith our earlier findings demonstrating that okadaic acid, aprotein phosphatase inhibitor, strongly potentiated retinoid-inducedtranscription (27), whereas it is a known activator of MAPKs,including ERK1 and -2 and JNK (43).

These observations therefore hinted at a new target or targetsfor retinoids within the MAPK^ERK signaling module. RAR ${alpha}$ remainsnuclear upon TPA treatment (M. Benkoussa and P. Lefebvre, unpublishedobservations), excluding a possible direct interaction of RARwith cytoplasmic components of signaling cascades. Moreover,neither the intracellular concentration, activation status,nor subcellular localization of key components of MAPK signalingmodules was affected by retinoids (M. Benkoussa and P. Lefebvre,unpublished), suggesting that transcriptional interference islikely to take place in the nuclear compartment.

Activation of the MAPK^ERK pathway led to preferential loadingof junD and fosB on the AP1 response element and to recruitmentof RNA pol II, whereas fra2-junD are dimers assembled on theAP1 response element in nonstimulated cells. Activation of theAP1-responsive promoter thus results from displacement of fra1and preferential binding of fosB to DNA in intact cells. Treatmentby atRA led to a favored recruitment of fra1 to the promoter,thus appearing as a competitor of fosB for the access to theAP1 response element, in agreement with the reported transcriptionalinactivity of fra1, which, unlike and c-fos and fosB, does notharbor a C-terminal transactivation domain (34, 51).

In vitro protein-protein interaction assays suggested that RAR-c-juninteraction might be responsible for transrepression (45). Similarly,c-jun interacts physically with VDR and represses the granulocye-macrophagecolony-stimulating factor gene (49). junD, highly homologousto c-jun, is a common component of AP1 complexes in our system,as well as RAR ${alpha}$ . Thus, a direct interaction between junD andRAR ${alpha}$ may occur in intact cells. However, neither supershift experimentsnor in vitro protein-protein interaction assays showed an interactionbetween AP1 components and RAR ${alpha}$ (M. Benkoussa and P. Lefebvre,unpublished observations), in agreement with a previous report(37). The possibility that weak interactions are not detectedby standard in vitro assays is likely; alternatively, a stableRAR-AP1 interaction might occur only in the presence of eachcomponent of the complex. AP1, RAR ${alpha}$ , and ERK1 and -2 are indeedlikely to form a multiprotein complex the activity of whichis regulated through RAR. Most notably, the transition froman apo RAR-containing complex to a holo RAR-containing complexwas accompanied by ERK and CBP displacement. This is an unprecedentedobservation, suggesting that ERK regulates AP1 activity by phosphorylatingeither fosB or junD when bound to DNA. Leppä and colleagues(28) have elegantly demonstrated that c-jun is a downstreamtarget for ERKs in both PC12 and NIH 3T3 cells and that activationof these kinases resulted in c-jun phosphorylation at Ser 63and 73. While this possibility remains to be formally establishedin our model, this would suggest that retinoids are able tomodify junD transcriptional activity by regulating ERK accessto its substrate (Ser 100 of junD) in a receptor- and ligand-dependentmanner. This retinoid-controlled hypophosphorylation of junDcould lead, in analogy with c-jun (4), to a decreased affinityfor CBP and therefore to transcriptional inhibition. This hypothesisis supported by our data showing that CBP is, like ERKs, excludedfrom the AP1-regulated promoter under repressive conditions.In addition, CBP tethering to the promoter is unlikely to resultfrom CBP-RAR interaction, since the RAR ${alpha}$ K244-262A mutant, unableto recruit various coactivators in vitro, also displays fulltransrepressive activity.

Functional domains necessary for RAR ${alpha}$ transrepressive activityare yet to be characterized. However, our results show thatheterodimerization with RXR and specific DNA binding are notrequired. Importantly, coactivator recruitment to RAR ${alpha}$ is alsodispensable as shown by the wild-type anti-AP1 activity of RAR ${alpha}$ K244-262A and the ability of a retinoid antagonist to fullyelicit AP1 transrepression. We cannot, however, formally ruleout, at this stage, that an yet unknown coactivator may be implicatedin this process. We, however, do not favor this hypothesis inlight of the high conservation of the receptor-coactivator interactionmotif and of recent results reported for the glucocorticoidreceptor (GR) (11). Preliminary results showed that isolatedRAR ${alpha}$ AF1 or AF2 domains are weakly active in the transrepressionassay (M. Benkoussa and P. Lefebvre, unpublished), suggestingthat RAR ${alpha}$ structural integrity has to be maintained for fullAP1 inhibition.

Our results thus provide strong support for the proposal thatretinoids are able to trigger qualitative differences of AP1complexes assembled onto an AP1 response element. More importantly,RAR ${alpha}$ appeared as a regulator of ERK access to its substrate boundto DNA, thereby altering AP1 transcriptional properties by regulatingCBP association to the AP1 complex. In this respect, we notethat p38, another MAPK, was recently described as part of thetranscriptional machinery in yeast (1). Thus, kinase incorporationinto the transcriptional machinery may be a general propertyof these enzymes. Furthermore, our data identify a new paradigmfor transcriptional interference mediated by nuclear receptors,which act as monomeric entities and independently of their well-characterizedtransactivation activity.

ACKNOWLEDGMENTS

We thank R. M. Evans (Salk Institute), J. D. Chen (Universityof Massachussetts), V. Cavailles (INSERM U148, Montpellier,France), D. D. Moore and B. W. O'Malley (Baylor College of Medicine),S. Michel and U. Reichert (CIRD-Galderma), L. P. Freedman andC. Rachez (MSKCC, New York, N.Y.), M. Yaniv (Institut Pasteur,Paris, France), J. M. Blanchard (I.G.M., C.N.R.S. Montpellier),Jim Woodgett (Ontario Cancer Institute), R. G. Davis (H.H.M.I.,University of Massachusetts Medical School), and M. Nemer (I.R.C.M,Canada) for providing us with DNAs, retinoids, and antibodies.We thank C. Rachez and P. Sacchetti for careful reading of themanuscript and B. Masselot for technical help.

INSERM U459 is part of IFR 22 (INSERM, C.H. and U. de Lille,C.O.L. and University of Lille 2). This work was supported bygrants from INSERM, Association pour la Recherche sur le Cancerand Ligue Nationale contre le Cancer (Comité du Nord-Pasde Calais).

FOOTNOTES

* Corresponding author. Mailing address: INSERM U 459, Faculté de Médecine Henri Warembourg, 1 Place de Verdun, 59045 Lille Cedex, France. Phone: 33-3-20-62-68-87. Fax: 33-3-20-62-68-84. E-mail: p.lefebvre{at}lille.inserm.fr.

Present address: Department of Biochemistry and Molecular Biology,Howard Hughes Medical Institute, University of MassachusettsMedical School, Worcester, MA 01605.

REFERENCES

Top