Previous Article | Next Article ![]()
Molecular and Cellular Biology, July 2002, p. 4522-4534, Vol. 22, No. 13
0270-7306/02/$04.00+0 DOI: 10.1128/MCB.22.13.4522-4534.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Pierre Formstecher, and Philippe Lefebvre*
INSERM U 459 and Ligue Nationale Contre le Cancer, Faculté de Médecine Henri Warembourg, 59045 Lille Cedex, France
Received 16 October 2001/ Returned for modification 13 December 2001/ Accepted 27 March 2002
|
|
|---|
|
|
|---|
AP1 regulates the expression of several genes involved in oncogenic transformation and cellular proliferation such as those coding for metalloproteases, VEGF, and transforming growth factor ß (TGF-ß), and AP1 transactivation is required for tumor promotion in vivo (54). Therefore, there is considerable interest in identification of compounds able to downregulate AP1 activity and thereby oppose unregulated cell growth leading to benign or malignant hyperplasia and cancer. A number of ligands for nuclear receptors, including glucocorticoids, retinoids, and fatty acids display such AP1 repressive activity, which seems to be the basis for their beneficial therapeutic effects. All-trans-retinoic acid receptors (RARs) exert two types of action on gene activity. The first one is referred to as transactivation and is characterized by structural transitions occurring in the receptor structure upon agonist binding. This leads to the formation of protein interaction interface(s) allowing recruitment of nuclear coactivators to the retinoid X receptor (RXR)-RAR dimer and therefore to the promoter (reviewed in reference 52). Transrepression of AP1 is the second activity of RARs, for which several observations may provide a model for transcriptional interference with membrane receptor-controlled signaling pathways. They include c-jun DNA binding inhibition (45), competitive titration by RAR and AP1 of limiting amounts of CBP (20), or downregulation of JNK activity (7, 24). Molecular determinants governing the transrepressive activity of RAR are, however, likely to be distinct from those ruling its transactivation potential. This view is supported by the description of dissociated retinoids, which are unable to elicit a transactivating response by RARs, yet induce transrepression of AP1 (9, 17, 29, 36) as well as that of receptor mutants with altered transactivation, but wild-type transrepression properties (25).
In this study, we examined the transrepressive activity of retinoids on the ERK-regulated AP1 activity in HeLa cells. We observed that atRA treatment of target cells led to the alteration of AP1 complex composition bound to an AP1 site. We report here for the first time that ERKs, CBP, and RAR
are associated with the AP1-responsive promoter in vivo under stimulating conditions. This complex underwent structural alterations under transrepressive conditions, which were correlated with the dissociation of ERKs and CBP from the promoter. Using synthetic retinoids and receptor mutants, we also demonstrate that AP1 inhibition by human RAR
(hRAR
) is independent of nuclear coactivator recruitment and other functions, such as dimerization with RXR and specific DNA binding.
|
|
|---|
Retinoids and chemicals. atRA was purchased from Sigma (St Quentin-Fallavier, France). 9-cis-Retinoic acid was obtained from Hoffman-Laroche. All CD compounds were kindly provided by U. Reichert (Galderma). CD3105 (AGN 192870) is an RAR antagonist (22); CD2409 {(4-[1-hydroxy-3-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydronaphthalen-2-yl)-prop-2-ynyl]-benzoic acid} is a dissociated anti-AP1 ligand (50). PD98059 and all other kinase inhibitors were purchased from Calbiochem (France-Biochem, Meudon, France).
Transient transfections. HeLa cells were transfected by the polyethyleneimine method (25), and the luciferase activity was assayed as previously described (35).
cDNAs, plasmids, and reporter genes.
pSG5-based expression vectors for hRAR
, hRARß, and hRAR
have been described previously (5). hRAR
mutants have been described elsewhere (26, 35). pSG5 hRAR
K380R-D383R was a kind gift from H. de Thé. The pSG5-hRAR
K244-262A double mutant was generated by site-directed mutagenesis (QuickChange; Stratagene) with pSG5-hRAR
K244A (35) as a template. The RXGRE-tk Luc reporter gene (designated DR5-tk Luc in this study) is a pGL3-based vector (Promega, Charbonnières, France) and has been described elsewhere (14). The AP1-tk Luc reporter gene is a pGL3-based vector in which the thymidine kinase (tk) promoter is hooked to four repeats of the consensus AP1 site TGAGTCA. pcDNA3-myc-His6-hRAR
was constructed by inserting the RAR
cDNA in frame within the pcDNA 3.1 myc/His vector (InVitrogen). pGEX-based expression vectors used for bacterial overexpression of glutathione S-transferase (GST)-fused coactivators have been described elsewhere (25). pSG5 c-jun, pBK c-fos, pRSV junB and pRSV junD, pRSV fra1, and the dominant-negative JNK expression vector (dnJNK) were gifts from B. Wasylik, I. Verma, M. Nemer, M. Yaniv, and J. M. Blanchard, respectively. Constitutively active ras, MEK1, wild-type MKK7, and JNK1 vectors were generous gifts from R. Davis.
Western blotting and antibodies. Whole-cell extracts were prepared as follows. First, 5 x 106 cells were grown and treated with retinoids and/or TPA. Monolayers were scraped rapidly in ice-cold 1x phosphate-buffered saline (PBS), and cells were lysed in 1 volume of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer and briefly sonicated. Western blotting was carried out as described previously (13, 35, 47). Anti-protein kinase C (anti-PKC), anti-JNKK1/MKK4, anti-ERK1 and -2, anti-MEK1 and -2, and anti-MKK1 antibodies were obtained from Transduction Laboratories (Lexington, Ky.). Anti-phospho ERK antibody was obtained from Promega. Antibodies recognizing JNK1, c-jun (N), junB (N), junD (329), c-fos (no. 4), fosB (102), fra1 (R-20), fra2 (L-15), and ATF2 were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.). Calbiochem and New England BioLabs were the sources of anti-c-jun and anti-phosphorylated c-jun antibodies. Anti-RNA polymerase II (pol II) antibodies were from Santa Cruz Biotechnology (total RNA pol II, sc 899) and Covance/BabCo (anti-RNA pol IIA, 8WG16), and the DRIP205 antiserum was a gift from C. Rachez and L. P. Freedman. Peroxidase-coupled antimouse, antigoat, or antirabbit immunoglobulin G was obtained from Sigma.
EMSA and GST pulldown assays. Nuclear coactivators and dimerization assays with GST-tagged proteins as baits were performed as described previously (13, 14). Electrophoretic mobility shift assays (EMSA) were run as described in reference 41 with in vitro-translated receptors.
IP-kinase assays. For immunoprecipitation (IP)-kinase assays, the activities of ERKs, JNK, and p38 were assayed with kits purchased from Cell Signaling Technologies (Beverly, Mass.) according to the manufacturer's instructions. MEK1 activity was assayed with a kit purchased from Upstate Biotechnology (Lake Placid, N.Y.), and glycogen synthase kinase 3 (GSK-3) activity was assayed similarly with an anti-GSK-3 antibody (Transduction Laboratories) by using a phospho-glycogen synthase peptide (Upstate Biotech) as a substrate.
DNA-IP assays.
For DNA-IP assays, 4 x 106 to 6 x 106 HeLa cells were transfected as described above with AP1-tk Luc and pSG5-hRAR
vectors. Forty-eight hours after transfection, cells were treated for 1 h with atRA and/or phorbol ester. Proteins were cross-linked to DNA by addition of 1% formaldehyde to the medium for 15 min at 37°C. The reaction was quenched upon addition of 100 mM glycine for 15 min at room temperature, and cells were collected in ice-cold 1x PBS. Cells were lysed in 10 mM Tris-HCl (pH 7.4), 10 mM EDTA, 1% SDS, 100 µM Na2VO3, 10 mM sodium butyrate, 1% protease inhibitor cocktail (Sigma), and soluble DNA-protein complexes were prepared by sonication of cellular lysates. After cell debris had been spun down, soluble protein-DNA complexes were diluted 10-fold in IP buffer (10 mM Tris-HCl [pH 7.4], 10 mM EDTA, 20 mM NaCl,1% Triton X-100, 100 µM Na2VO3, 10 mM NaBu, 1% protease inhibitor cocktail) and incubated with 2 to 5 µg of antibody overnight at 4°C. Immune complexes were collected by addition of 50 µl of a 50% protein A-Sepharose slurry and incubation at room temperature for 2 h. Beads were successively washed with IP buffer, IP buffer plus 1.2 M NaCl, and a mixture containing 10 mM Tris-HCl (pH 7.4), 1% NP-40, 1% deoxycholate, 1 mM EDTA, 0.25 M LiCl, and 100 µM Na2VO3. After a final wash in a mixture of 10 mM Tris-HCl (pH 7.4) and 1 mM EDTA, immune complexes were eluted from beads in 250 µl of a mixture containing 0.1 M NaHCO3 and 1% SDS. Supernatants were heated for at least 4 h at 65°C in the presence of 1 mg of proteinase K per ml to reverse cross-links. DNA was purified with the QIAquick DNA purification kit (Qiagen). Target sequences were amplified by using RV3 and GLP2 primers from Promega (25 to 28 PCR cycles) and resolved on a 1.2% agarose gel.
Real-time PCR. AP1 promoter sequences were amplified with the TaqMan PCR master mix (Applied Biosystems, Courtaboeuf, France). The FAM/TAMRA coupled-probe (+31/+52: CCCAGCGTCTTGTCATTGGGCGA), forward (-53/-31: GGTGCCAGAACATTTCTCTATCG), and backward (+81/+96: GACCTCGGACCGCGC) primers were designed to amplify a 140-bp DNA fragment encompassing the four repeats of the AP1 response element (TGACTCA) present in the reporter gene used in all experiments. Position +1 corresponds to the first base of the second AP1 response element. Reactions (40 cycles) and data analysis were carried out with an ABI Prism 770 (Applied Biosystems).
|
|
|---|
) (M. Benkoussa and P. Lefebvre, unpublished observations), suggesting that SAPK signaling modules are not fully functional in this cell line. The TPA-induced increase in luciferase activity was abrogated in the presence of GF109203X, a specific inhibitor of PKC-
, -ß, -
, -
, and -
isoforms (48) and of Gö6976, a specific inhibitor of PKC-
and -ßI (32). Since PKC-ß is not expressed in our cell line (M. Benkoussa and P. Lefebvre, unpublished), PKC-
is a likely molecular relay for TPA-mediated activation of AP1. PD98059 selectively inhibits MAPK kinases 1 and 2 (MEK1 and -2, respectively) (2), which act as an upstream activator of ERK1 and -2. The complete inhibition of the TPA-induced response by 10 µM PD98059 suggests that MEK1 and -2 is an important regulator of the TPA-induced AP1 response. Hypericin is known to inhibit PKCs and ERKs at 50% inhibitory concentrations of 3.3 µM and 4 nM, respectively. We thus used hypericin at 100 nM, a concentration affecting mostly ERK activity, and were able to block the TPA-induced AP1 response. Cotransfection of a dominant-negative mutant of JNK, dnJNK (40), led to a decrease of 15 to 20% of the TPA-induced luciferase activity, indicating that JNK activation plays a minor role in the transcriptional activation process of the promoter. The p38-specific inhibitor SB203580 was able to reduce the TPA-induced AP1 activity by about 20%. Thus, TPA triggers in HeLa cells a composite MEK1 and -2-dependent response involving mainly the MAPKERK signaling module. Both MAPKJNK and MAPKp38 also contributed to this response, albeit to a much lesser extent. Additionally, atRA was able to repress the TPA-induced AP1 activation in a receptor- and ligand-dependent manner. Indeed, the RAR-mediated repression, which ranged from 5 to 20% in the presence of endogenous RAR
, was increased to 85 to 95% when RAR
, RARß, or RAR
was overexpressed (Fig. 1A and B).
![]() View larger version (34K): [in a new window] |
FIG. 1. Inhibition of the MAPKERK pathway by retinoids. (A) The MAPKERK signaling pathway activates AP1 in HeLa cells. HeLa cells were transfected and treated for 6 h with the following activators and/or inhibitors of kinases: 100 nM TPA, 500 nM GF109203X, and 500 nM Gö6976 (PKCs, GF, and Gö), 10 µM PD98059 (MEK1 and -2; PD), 100 nM SB203580 (p38 and -ß; SB), 100 nM hypericin (ERKs). SAPK activators were used as follows: anisomycin, 50 ng/ml (subinhibitory concentration) (18); UV, 40 J/m2. Bar diagrams for this and the following experiments represent the average (± standard deviation) of at least five experiments carried out with six independent assays. The basal level of reporter gene expression was scaled up to 1, and all activities are expressed relative to the basal level, which did not vary significantly. dnJNK, dominant-negative mutant of JNK1. (B) Retinoid receptor expression in HeLa cells. mRNAs were analyzed by reverse transcription-PCR for RAR and RXR isoform transcripts. Actin was used as an external control. PCR products were resolved on an agarose gel and visualized by ethidium bromide staining (RNA panel). Fifty micrograms of whole-cell extract was analyzed by Western blotting with antibodies against RAR , RARß, RAR , and RXRs (HeLa). Controls were provided by RARs or RXRs extracted from cells transfected with expression vectors coding for each receptor (ttHeLa) or synthesized by coupled in vitro transcription and translation (TnT) (Proteins panel). (C) MAPK sensitivity to retinoid inhibition. HeLa cells were transfected with AP1-tk Luc and expression vectors coding for RAR , constitutively active ras (rasLG1), wild-type MKK7 and wild-type JNK1 or constituvely active MEK1. Cells were treated for 6 h with 1 µM atRA, and the resulting luciferase activities were plotted as in panel A.
|
and constitutively active protein kinases belonging to MAPK signaling pathways (Fig. 1C). Constitutively active ras (ras L61) induced a strong AP1 activity, which was highly sensitive to atRA inhibition. Similarly, overexpression of MEK1 induced a potent AP1 response sensitive to atRA inhibition. Coexpression of MKK7 and JNK1, two potent upstream activators of the jun transcription factor family, poorly activated the AP1 response, and this response was not sensitive to atRA. Similar results were obtained when a constitutive activator of the MAPKJNK pathway, SEK1 (SEK1 ED) (44), was overexpressed (M. Benkoussa and P. Lefebvre, unpublished). Thus atRA exerts its transrepressive activity through regulation of a MEK1 and -2 and/or ERK1 and -2-controlled event.
The ability of retinoids to inhibit AP1 activation may potentially be ascribed to several mechanisms, one of which is downregulation of the expression of essential relays of MAPK or SAPK signaling cascades. Preliminary experiments allowed us to rule out such a hypothesis for PKCs, c-raf, MEK-1 and -2, JNKK, JNK1 and -2, and ERK1 and -2 (M. Benkoussa, M.-H. Delmotte, and P. Lefebvre, unpublished observations). Expression of other proteins potentially involved in AP1 modulation such as p21/Waf-1 (a retinoid-regulated inhibitor of cyclin-dependent kinase and a regulator of NF-
B activity) (30) and p53 (a regulator of p21/Waf-1 gene transcription) was not significantly altered in our system (M. Benkoussa and P. Lefebvre, unpublished).
We then established HeLa-derived cell lines overexpressing hRAR
or ß-galactosidase as a control to further investigate the role of this receptor as a transrepressor. The level of expression of RAR
in the HeLa-RAR subclone was at least 10- to 15-fold higher than that of the wild-type (C. Brand and P. Lefebvre, unpublished observations) or ß-galactosidase-positive HeLa cells (Fig. 2A). Stimulation of HeLa cells by TPA led to a strong increase of ERK1 and -2 activity, as assayed by an IP-kinase assay (Fig. 2B). However, atRA was not able to counteract this upregulation in either the wild-type or RAR-overexpressing background. Similar assessments of JNK and p38 activities were carried out, and while JNK remained nondetectable in our system, p38 activity was slightly increased upon TPA treatment, with no significant effect of retinoic acid in both cellular backgrounds.
![]() View larger version (24K): [in a new window] |
FIG. 2. Components of MAPK signaling modules in HeLa cells. (A) Expression of hRAR in HeLa-ßgal or HeLa-RAR cell lines. Whole-cell extracts (50 µg of protein) were analyzed by Western blotting with an anti-RAR antibody. (B) MAPK activities in the wild-type HeLa or HeLa-RAR background. Cells were treated for 6 h with the indicated compounds, and cell extracts were assayed for ERK1 and -2 (P-Elk), JNK1 and -2 (P-c-jun) and p38 (P-ATF2) activities by IP-kinase assays. Representative results are shown. The GST-c-jun fusion protein, used as a substrate in the JNK assay, was detected with a specific anti-c-jun antibody to ensure that the negative result was not due to aberrant loading of gels. For the experiment shown, the numbers indicate the fold induction over the reference set to 1. (C) Expression levels of c-fos, c-jun, and related transcription factors. Western blot analyses were carried out with specific antibodies for c-fos- and c-jun-related proteins. Results were quantified and expressed as in panel B.
|
From these data, we conclude that AP1 inhibition is unlikely to proceed through modulation of levels of MAPK activity or AP1 factors, a conclusion strengthened by the observation that protein synthesis inhibitors did not prevent AP1 activation and retinoid-mediated AP1 repression (M. Benkoussa and P. Lefebvre, unpublished).
GSK-3 is involved in atRA-mediated inhibition of AP1.
The activation state of several protein kinases known to potentially regulate AP-1 was further evaluated as a function of time by an IP-kinase assay in response to TPA and/or retinoids. Both ERK1 and -2 and MEK1 were activated in response to TPA treatment, but atRA did not inhibit this activation process (Fig. 3A). GSK-3 has been identified as an ERK-regulated negative modulator of c-jun and junD DNA binding activity, acting by phosphorylation of serine residues in the DNA binding domain of these transcription factors (12, 38). The activation state of GSK-3 was found to be insensitive to MAPKERK pathway activation by TPA, but significantly enhanced after a 30-min treatment with atRA. Note that each kinase underwent a sustained activation in time, likely due to the metabolic stability of TPA. Finally, the phosphorylation state of junD at S100, reflecting its transcriptional activation, was assayed by Western blotting with a specific anti-phospho junD antibody. As expected, TPA promoted a strong hyperphosphorylation of this transcription factor, which was abrogated in the presence of atRA. To confirm these kinase assays, the activation state of ERK1 and -2, MEK1 and -2, and of GSK-3 was also assessed after a 6-h treatment with antiphosphokinase antibodies (Fig. 3B). As it could be predicted from the IP-kinase assays, ERK1 and -2 and MEK1 were hyperphosphorylated (activated) upon TPA treatment, and insensitive to atRA. GSK-3 exists in most cell lines as two isoforms,
and ß, and phosphorylation of these kinases leads to the inactivation of their catalytic properties. In our system, both isoforms were phosphorylated (inactive) in control cells, but atRA treatment lowered specifically the phosphate content of the ß isoform. This shows that GSK-3ß activation is positively regulated by atRA, in agreement with the IP-kinase assay. Finally, junD was strongly phosphorylated in the N-terminal transactivation domain (Ser 100) upon TPA treatment, and Ser 100 phosphorylation was abrogated in the presence of atRA.
![]() View larger version (33K): [in a new window] |
FIG. 3. GSK-3 is a retinoid-dependent partial inhibitor of AP1 transcriptional activity. (A) Activity of protein kinases in response to phorbol ester and/or atRA. HeLa-RAR cells were treated for the indicated times with the indicated combination of retinoid and TPA and whole-cell extracts were prepared. One hundred micrograms of proteins was subjected to IP with anti-ERK, anti-MEK1, or GSK-3 antibodies (1 µg), and immunoprecipitates were incubated with Elk-1, ERK2, and MBP, and phospho-glycogen synthase peptide, respectively, as substrates. junD phosphorylation was assayed by Western blotting as below and quantified by densitometric analysis of fluorograms. Each assay was performed in duplicate. (B) Phosphorylation of protein kinases in response to TPA and/or atRA. HeLa cell extracts, prepared from cells treated for 6 h with the indicated combination of retinoid and TPA, were probed for their content in phosphorylated adducin (as a control), GSK and -ß, ERK1 and -2, MEK1 and -2 and junD. Representative fluorograms are shown. (B) Lithium partially inhibits atRA-induced AP1 repression. HeLa cells were transfected with the AP1-tk Luc reporter gene and pSG5-hRAR . Cells were treated 2 days after transfection with the indicated combinations of 1 µM atRA, 100 nM TPA, 10 mM NaCl, or 10 mM LiCl. The resulting luciferase activity was assayed 6 h later, and the results are expressed as described in the legend to Fig. 1.
|
and -ß are related protein serine kinases having a critical role in the dorsoventral patterning of vertebrates (15, 19), and severe effects of lithium on embryonic development are probably due to its ability to inhibit specifically GSK-3 (23, 46). To determine whether GSK-3 activity affects the retinoid-mediated inhibition of AP1, we incubated HeLa cells transfected with the AP1 reporter gene and the RAR
expression vector with 10 mM lithium chloride or 10 mM sodium chloride and challenged them with TPA and/or atRA (Fig. 3C). Neither lithium nor NaCl had a significant effect on AP1 activity. However, the transrepressive activity of atRA was partially blunted in the presence of lithium, suggesting a contribution of GSK-3 to retinoid-controlled AP1 inhibition. These data indicate that GSK-3 activity is required for full inhibition of AP1 activity by retinoids. Characterization of AP1 complexes bound to the TPA response element in intact cells. We then attempted to characterize the composition of AP1 complexes binding to DNA by EMSA. Although informative, EMSAs did not reflect the alteration of the expression of AP1 components, as revealed by Western blot analysis of whole-cell extracts. We thus used an immunoprecipitation assay to quantify the biochemical composition of AP1 complexes bound to the AP1-responsive reporter gene promoter in vivo.
Using antibodies directed against each potential component of the AP1 complex, immunoprecipitation from untreated cells with each antibody followed by real-time PCR detection (DNA-IP) of the promoter region (including the AP1 site and the thymidine kinase [tk] promoter) showed that junD, c-fos, and fra2 were prominently bound to this promoter (Fig. 4A). After treatment for 1 h with 100 nM TPA, the composition of the AP1 complex was shifted towards a junD-fosB dimer. Surprisingly, c-fos was not found to be a major component of the AP1 complex under these conditions. When cells were challenged with TPA plus 1 µM atRA, junD, fosB, and fra1 were associated with the promoter, consistent with the reported inhibitory effect of fra1 on AP1-mediated transcription (33, 51). In contrast to untreated cells, junD binding was weaker, strengthening the hypothesis that atRA-regulated GSK-3 activation may play a role in AP1 transrepression. As a negative control, a reporter gene (AP1 mut) containing a mutated AP1 site that does not confer responsiveness to TPA was used, showing that loading of AP1 factors is strictly dependent on the AP1 site integrity.
![]() View larger version (40K): [in a new window] |
FIG. 4. Transcription factor assembly on the AP1 consensus response element in intact cells. (A) AP1 protein binding to the AP1 response element. HeLa cells were transfected with the AP1-tk Luc reporter gene together with the pcDNA myc-His hRAR expression vector. DNA-IP assays were performed after a 1-h treatment with TPA and/or atRA with antibodies (Ab) against AP1 proteins. As a control, a reporter gene containing an inactivated AP1 site and displaying no activity upon TPA treatment was used (AP1mut-tk Luc). Immunoprecipitated DNA was analyzed by semiquantitative PCR (top panels, 28 PCR cycles) and quantified by real-time PCR. Results are expressed as femtograms of DNA and displayed in the bar graph (bottom panel). The input lanes show that equivalent amounts of plasmid DNA were used for each DNA-IP. (B) atRA prevents RNA pol II loading on the AP1-responsive promoter. DNA-IP assays were performed as in panel A with either a nonphosphorylated RNA pol II CTD monoclonal antibody (RNA pol IIA, clone 8WG16, BaBCo) or a polyclonal antibody against total (phosphorylated and nonphosphorylated) RNA pol II (RNA pol II, total, sc899; Santa Cruz Biotechnology). (C) RAR is constitutively tethered to the AP1 binding site. DNA-IP assays were performed after transfection of cells with either the AP1-tk Luc or the DR5-tk Luc reporter genes together with RAR or RAR and RXR expression vectors, respectively. Antibodies directed against total RNA pol II or the RAR C terminus were used, and immunoprecipitates were analyzed for the presence of RARE or AP1 response element sequences.
|
To determine whether RAR
could be recruited to the AP1 response element, we performed DNA-IP assays with an antibody against the C terminus of RAR
. The ability of RAR
to bind to a DR5 retinoic acid response element (RARE) was evaluated in parallel by transfecting cells with RAR and RXR expression vectors together with a reporter gene (DR5-tk Luc), the sequence of which is strictly identical to that of the AP1 reporter gene (AP1-tk Luc), except for the response element (Fig. 4C). In naive cells, no RNA pol II was bound to the AP1 site, but RAR
was found to be associated with the promoter, whereas under conditions of stimulation by TPA, both RNA pol II and RAR
were associated with DNA. Under conditions of transrepression, only RAR
was detected. This differential loading was response element specific, since atRA-induced recruitment of RAR
to the DR5 RARE, which was concomitant to a strongly increased RNA pol II loading. Thus, transrepression by atRA may be attributed to decreased RNA pol II recruitment at the AP1-responsive promoter. RAR
is also associated to this promoter under any condition, suggesting that ligand binding triggers an event leading to AP1 transcriptional inactivation. This unexpected finding prompted us to characterize more extensively the binding of RAR
and other putative components of the transcriptional machinery to the promoter.
We therefore constructed a N-terminal fusion protein between the c-myc epitope and RAR
, which displays wild-type transrepressive activity (M. Benkoussa and P. Lefebvre, unpublished) and performed the DNA-IP assay as described above. Antibodies directed against the C terminus of RAR
, the c-myc epitope located at the N terminus of RAR
, the NR2 box of DRIP205, the CREB binding domain of CBP, and the C terminus of ERK1 and -2 were thus used in the DNA-IP assay (Fig. 5). As described above, RAR
was consistently detected in all conditions when an antibody directed against its C terminus was used. More surprisingly, the accessibility of the RAR
N terminus was decreased to basal levels under transrepressive conditions. This decreased accessibility was also observed in the presence of a retinoid antagonist (CD3105), which displays an anti-AP1 activity similar to that of atRA (Fig. 6). This result demonstrates that the RAR
N-terminus region is either masked or undergoes structural transitions when AP1 is transcriptionally active. ERKs have been shown to phosphorylate c-jun at Ser 63 and Ser 73 and to regulate its transcriptional activity (28). junD is, by homology, a likely substrate for ERK, and we asked whether this kinase could be detected at the AP1-regulated promoter. Very interestingly, ERK was detected under basal conditions, and this recruitment was strongly increased in TPA-stimulated cells. Both a retinoid agonist and a retinoid antagonist were able to downregulate ERK recruitment, and this behavior paralleled exactly that of CBP, a coactivator for AP1 (20). DRIP205, a nuclear receptor coactivator (42), was recruited to the AP1 promoter only in the presence of atRA and not CD3105, suggesting that this interaction occurs through RAR
. Thus, incorporation of ERK and CBP at the AP1 promoter is affected negatively by retinoids, irrespective of their activity in transactivation assays.
![]() View larger version (39K): [in a new window] |
FIG. 5. Transcription factors and cofactors loading at the AP1 response element in vivo. HeLa cells were transfected as described in the legend to Fig. 4. DNA-IP assays were carried out with anti-c-myc (RAR N terminus), anti-RAR AF2 (RAR C terminus), anti-pan-ERK, anti-DRIP205, and anti-CBP antibodies. atRA and CD3105 were both used at a final concentration of 1 µM, and TPA was used at a final concentration of 100 nM.
|
![]() View larger version (23K): [in a new window] |
FIG. 6. Transactivation and transrepression by retinoids. (A) Transactivation by retinoids. The activity of the DR5 RARE-driven reporter gene was monitored by assaying luciferase activity in HeLa cells transiently transfected with RGXR alone (left panel) or RGXR and hRAR . Cells were treated with the indicated ligand for 6 h. (B) Transrepression by retinoids. HeLa cells were transfected with receptor expression vectors as described above and the AP1-tk Luc reporter gene. TPA was used as the AP1 inducer (100 nM). The basal level of reporter gene expression was scaled up to 1, and all activities are expressed relative to the basal level, which did not vary significantly. The following concentrations were used in both assays: 50 nM atRA, 1 µM CD3105, 10 µM CD2409, and 100 nM TPA.
|
by using retinoids with different chemical structures and distinct biological properties. atRA is used as the reference compound, whereas CD3105 is an RAR antagonist (22) and CD2409 is a dissociated, anti-AP1 retinoid (50).
We first tested these three retinoids in a standard transactivation assay by using the DR5-tk Luc reporter gene and expression vectors coding for RAR
and RXR
. This assay confirmed the biological properties of these three representative retinoids in our system. atRA elicited a strong response (12- to 15-fold induction), whereas neither the antagonist CD3105 nor the dissociated anti-AP1 CD2409 retinoid stimulated luciferase activity after a 6-h treatment (Fig. 6A). HeLa cells were treated simultaneously with TPA and retinoids to assess whether activation of the PKC-MAPK pathway could affect hRAR
function. A modest decrease of the responsiveness to atRA was observed in the presence of overexpressed hRAR
under these conditions, in agreement with our previous results obtained in COS cells (47).
The ability of these three retinoids to promote RAR
-mediated AP1 transrepression was assessed. In the absence of overexpressed hRAR
, TPA strongly activated AP1 (10- to 15-fold induction). Retinoids alone were inactive, and a very weak inhibition of the TPA-induced luciferase activity was observed, suggesting a minor contribution of endogenous RAR
. A moderate constitutive repression was observed in the presence of overexpressed RAR
(Fig. 6A) and for hRARß and hRAR
in this cell line and others (M. Benkoussa and P. Lefebvre, unpublished). Retinoids abrogated the TPA-induced luciferase activity, irrespective of their ability (or inability) to transactivate the DR5-driven promoter (Fig. 6B). Transcriptional interference is thus unlikely to require a function or functions necessary for receptor-mediated transcriptional activation
Coactivator recruitment is not a prerequisite for AP1 repression by hRAR
.
We showed recently that mutation of K244 or K262 in hRAR
partially abolished nuclear receptor coactivator (NCoA) recruitment by hRAR
and strongly impaired its transactivating activity (35). We therefore introduced a double K244-to-A and K262-to-A mutation in wild-type hRAR
to generate a transcriptionally inactive receptor. The ligand-binding and DNA-binding activities of K244-262A were not altered, as judged from the limited proteolysis assay (Fig. 7A) and EMSA, respectively (Fig. 8B). The ability of K244-262A to interact with NCoAs in vitro was assessed by an in vitro protein-protein interaction assay (Fig. 7B). As expected, monomeric wild-type hRAR
was able, when challenged with atRA, to interact with members of the p160 class of NCoAs, such as GRIP1, RIP140, and SRC1, and others, such as DRIP205 and CBP. On the contrary, ligands unable to elicit transactivation by hRAR
(CD3105 and CD2409) were unable to promote a detectable interaction of hRAR
with these coactivators (Fig. 7B). When the K244-262A mutant was used in a similar assay, none of the ligands used above promoted interaction of hRAR
with any of these coactivators (Fig. 7B). Structural transitions leading to NCoA recruitment are thus completely abrogated by the K244-262A mutation, as well as corepressor binding (M. Benkoussa and P. Lefebvre, unpublished). Thus, the K244-262A mutation selectively inactivated NCoA and NCoR recruitment without compromising ligand and DNA binding activities of the receptor. Predictably, the K244-262A mutant did not activate transcription from a DR5-driven promoter (Fig. 7C), yet acted as a transrepressor in the presence of agonists, antagonists, and dissociated retinoids. Thus, NCoA recruitment is not required for AP1 transrepression. This conclusion is further strengthened by results obtained with hRAR
403, a C-terminally-truncated RAR
mutant. This truncation removes both the F domain and the AF2-AD region of hRAR
and yields a receptor exhibiting wild-type ligand binding activity (26), unaltered DNA binding activity (Fig. 8B), and impaired NCoA recruitment and is transcriptionally inactive (25) However, hRAR
403 displays full anti-AP1 activity (Fig. 8C).
![]() View larger version (34K): [in a new window] |
FIG. 7. Inactivation of nuclear coactivator recruitment by RAR does not prevent retinoid-mediated AP1 transrepression. (A) Ligand-receptor interaction assay. Wild-type hRAR and hRAR K244-262A were translated in vitro and incubated with 1 µM atRA for 2 h at 4°C. Complexes were then incubated with trypsin, and products were resolved by SDS-10% PAGE. Representative autoradiographs are shown for each receptor. The 28-kDa band represents the trypsin-resistant receptor domain, which encompass most of the ligand binding domain. (B) Interaction of wild-type hRAR and hRAR K244-262A with nuclear coactivators. 35S-labeled hRAR was incubated in the presence of the indicated GST fusion proteins for 2 h and with retinoids. Coactivator-receptor complexes were isolated by adsorption of the GST moiety on agarose beads coupled to glutathione. After washing of the beads, complexes were analyzed by SDS-8% PAGE, and bound receptor was assayed by autoradiography. The affinity of the mutant receptor hRAR K244-262A for NCoAs was assayed as for wild-type RAR . (C) Transactivation and transrepression by the hRAR K244-262A mutant. The activity of the DR5-driven reporter gene was monitored by assaying luciferase activity in HeLa cells transiently transfected with RGXR and hRAR . Cells were treated with 1 µM atRA for 6 h (left panel). HeLa cells were transfected with RAR expression vectors and the AP1-tk Luc reporter gene. TPA was used as the AP1 inducer at 100 nM, and atRA was used at 1 µM (right panel).
|
![]() View larger version (47K): [in a new window] |
FIG. 8. Dimerization of hRAR with RXR and DNA-specific recognition are not required for RAR-mediated AP1 inhibition. (A) Dimerization of hRAR with hRXR in the presence of an agonist, an antagonist, or a dissociated retinoid. 35S-labeled hRAR was produced by in vitro coupled transcription-translation, incubated for 2 h with DMSO or 1 µM retinoids, and adsorbed on a Sepharose-GST-hRXR affinity matrix. Bound receptors were visualized by autoradiography of the dried SDS-PAGE (8% polyacrylamide) gel. (B) DNA binding activities of hRAR mutants. hRAR or derivatives and hRXR were obtained by in vitro translation. Receptors were then incubated for 30 min with the labeled DR5 probe, and complexes were resolved by nondenaturing 5% PAGE. Receptor-DNA complexes were then visualized by autoradiography of dried gels. The specific nature of the binding was assessed with a 50-fold excess of cold DR5 or SP1 oligonucleotide in the binding reaction mixture (M. Benkoussa and P. Lefebvre, unpublished). Receptor concentrations were adjusted in order to obtain a 1:1 stoichiometric ratio of RAR to RXR and to avoid significant binding of hRAR homodimers to the DR5 probe. (C) Transrepression and transactivation properties of hRAR mutants. The transactivation (RGXRE tk Luc) and transrepression (AP1-tk Luc) activities of hRGAR (mutated in the P box) of the dimerization-defective RAR (K380-D388RR) and of the truncated hRAR 403 were compared. (D) Expression levels of RAR and RAR mutants in transfected HeLa cells. Whole-cell extracts (25 µg of protein) were analyzed by Western blot analysis for their content in overexpressed receptor. Note that RAR 403 was not detectable because the antibody is directed against the F domain of RAR .
|
with hRXR
and specific DNA binding are not required for AP1 inhibition.
AP1 transrepression by hRAR
does not require coexpression of RXR, leading to the prediction that RAR might act as a monomer. We thus wanted to test this hypothesis by first comparing the capacity of representative retinoids to promote hRAR
interaction with hRXR
, independently of DNA binding (Fig. 8A). A GST pulldown assay was used, allowing the detection of DNA-independent, ligand-induced heterodimer formation (14). As previously reported, atRA stabilized efficiently hRAR
interaction with hRXR
under these conditions. On the contrary, both CD3105 and CD2409 were unable to trigger heterodimer formation, both in vitro, as shown by GST-pulldown assays (Fig. 8A), and in vivo, as shown by a two-hybrid assay in mammalian cells (14). The RXR-RAR dimerization interface is defined by 25 conserved amino acids located in helices 7 to 11 (6, 41). Ten out of 25 RAR
amino acid side chains, including those of K380 and D383, are engaging into salt bridges and contribute to 35% of the 967-Å2 RXR-RAR dimerization interface (6). The double mutation yields a receptor mutant that is unable to form heterodimers in solution (Fig. 8A). Consequently, hRAR
K380R-D383R does not bind DNA (Fig. 8B) and displays no transactivation potential when tested on a DR5 RARE-driven reporter gene (Fig. 8C) and DR2- and TREpal-driven reporters (P. Lefebvre, unpublished data). However, this mutant fully repressed AP1 activity in a ligand-dependent manner (Fig. 8C). Taken together, these results strongly suggest that dimerization with RXR is not mandatory for transrepression.
We then wished to test whether the ability of the receptor to bind a RARE is required for transrepression. The P box of hRAR
, which contains three amino acids essential for specific DNA recognition, was thus mutated to confer specific binding of hRAR
to a GRE. As expected, the RAR mutant RGAR did not bind to a DR5 response element in the presence of hRXR
(Fig. 8B) and was inactive in the transactivation assay (Fig. 8C). However, this mutant was fully active in the transrepression assay (Fig. 8C), demonstrating that the ability to bind specifically to cognate response elements is not required for AP1 transrepression.
|
|
|---|
as an AP1 inhibitor and the characterization of AP1 activation and transrepression processes in a defined cellular background. We also observed that AP1-responsive reporter genes driven by distinct AP1 response elements (from the collagenase A promoter and the atrial natriuretic factor [ANF] promoter) were equally sensitive to retinoid inhibition (M. Benkoussa and P. Lefebvre, unpublished). JNK inhibition has been proposed to be a key step in AP1 repression by glucocorticoids and retinoids (7). In our model, however, the MEK1 and -2-ERK pathway is the main signaling module regulating AP1 activation and sensitive to inhibition by atRA, while the MAPKJNK pathway is poorly active and not sensitive to retinoids. Our results also suggest that transrepression is not a reciprocal phenomenon. This conclusion is consistent with our earlier findings demonstrating that okadaic acid, a protein phosphatase inhibitor, strongly potentiated retinoid-induced transcription (27), whereas it is a known activator of MAPKs, including ERK1 and -2 and JNK (43).
These observations therefore hinted at a new target or targets for retinoids within the MAPKERK signaling module. RAR
remains nuclear upon TPA treatment (M. Benkoussa and P. Lefebvre, unpublished observations), excluding a possible direct interaction of RAR with cytoplasmic components of signaling cascades. Moreover, neither the intracellular concentration, activation status, nor subcellular localization of key components of MAPK signaling modules was affected by retinoids (M. Benkoussa and P. Lefebvre, unpublished), suggesting that transcriptional interference is likely to take place in the nuclear compartment.
Activation of the MAPKERK pathway led to preferential loading of junD and fosB on the AP1 response element and to recruitment of RNA pol II, whereas fra2-junD are dimers assembled on the AP1 response element in nonstimulated cells. Activation of the AP1-responsive promoter thus results from displacement of fra1 and preferential binding of fosB to DNA in intact cells. Treatment by atRA led to a favored recruitment of fra1 to the promoter, thus appearing as a competitor of fosB for the access to the AP1 response element, in agreement with the reported transcriptional inactivity of fra1, which, unlike and c-fos and fosB, does not harbor a C-terminal transactivation domain (34, 51).
In vitro protein-protein interaction assays suggested that RAR-c-jun interaction might be responsible for transrepression (45). Similarly, c-jun interacts physically with VDR and represses the granulocye-macrophage colony-stimulating factor gene (49). junD, highly homologous to c-jun, is a common component of AP1 complexes in our system, as well as RAR
. Thus, a direct interaction between junD and RAR
may occur in intact cells. However, neither supershift experiments nor in vitro protein-protein interaction assays showed an interaction between AP1 components and RAR
(M. Benkoussa and P. Lefebvre, unpublished observations), in agreement with a previous report (37). The possibility that weak interactions are not detected by standard in vitro assays is likely; alternatively, a stable RAR-AP1 interaction might occur only in the presence of each component of the complex. AP1, RAR
, and ERK1 and -2 are indeed likely to form a multiprotein complex the activity of which is regulated through RAR. Most notably, the transition from an apo RAR-containing complex to a holo RAR-containing complex was accompanied by ERK and CBP displacement. This is an unprecedented observation, suggesting that ERK regulates AP1 activity by phosphorylating either fosB or junD when bound to DNA. Leppä and colleagues (28) have elegantly demonstrated that c-jun is a downstream target for ERKs in both PC12 and NIH 3T3 cells and that activation of these kinases resulted in c-jun phosphorylation at Ser 63 and 73. While this possibility remains to be formally established in our model, this would suggest that retinoids are able to modify junD transcriptional activity by regulating ERK access to its substrate (Ser 100 of junD) in a receptor- and ligand-dependent manner. This retinoid-controlled hypophosphorylation of junD could lead, in analogy with c-jun (4), to a decreased affinity for CBP and therefore to transcriptional inhibition. This hypothesis is supported by our data showing that CBP is, like ERKs, excluded from the AP1-regulated promoter under repressive conditions. In addition, CBP tethering to the promoter is unlikely to result from CBP-RAR interaction, since the RAR
K244-262A mutant, unable to recruit various coactivators in vitro, also displays full transrepressive activity.
Functional domains necessary for RAR
transrepressive activity are yet to be characterized. However, our results show that heterodimerization with RXR and specific DNA binding are not required. Importantly, coactivator recruitment to RAR
is also dispensable as shown by the wild-type anti-AP1 activity of RAR
K244-262A and the ability of a retinoid antagonist to fully elicit AP1 transrepression. We cannot, however, formally rule out, at this stage, that an yet unknown coactivator may be implicated in this process. We, however, do not favor this hypothesis in light of the high conservation of the receptor-coactivator interaction motif and of recent results reported for the glucocorticoid receptor (GR) (11). Preliminary results showed that isolated RAR
AF1 or AF2 domains are weakly active in the transrepression assay (M. Benkoussa and P. Lefebvre, unpublished), suggesting that RAR
structural integrity has to be maintained for full AP1 inhibition.
Our results thus provide strong support for the proposal that retinoids are able to trigger qualitative differences of AP1 complexes assembled onto an AP1 response element. More importantly, RAR
appeared as a regulator of ERK access to its substrate bound to DNA, thereby altering AP1 transcriptional properties by regulating CBP association to the AP1 complex. In this respect, we note that p38, another MAPK, was recently described as part of the transcriptional machinery in yeast (1). Thus, kinase incorporation into the transcriptional machinery may be a general property of these enzymes. Furthermore, our data identify a new paradigm for transcriptional interference mediated by nuclear receptors, which act as monomeric entities and independently of their well-characterized transactivation activity.
INSERM U459 is part of IFR 22 (INSERM, C.H. and U. de Lille, C.O.L. and University of Lille 2). This work was supported by grants from INSERM, Association pour la Recherche sur le Cancer and Ligue Nationale contre le Cancer (Comité du Nord-Pas de Calais).
Present address: Department of Biochemistry and Molecular Biology, Howard Hughes Medical Institute, University of Massachusetts Medical School, Worcester, MA 01605. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»