and Andrew K. Vershon*
Waksman Institute of Microbiology and Department of Molecular Biology and Biochemistry, Rutgers University, Piscataway, New Jersey 08854-8020
Received 7 November 2001/
Returned for modification 26 December 2001/
| ABSTRACT |
|---|
|
|
|---|
1 and Ste12 cofactors, most mutations have little or no effect on Mcm1-mediated repression in combination with the
2 cofactor. Even nonconservative amino acid substitutions of residues in Mcm1 that directly contact
2 do not significantly affect repression. These results suggest that within the same region of the Mcm1 MADS box domain, there are different requirements for interaction with
2 than for interaction with either
1 or Ste12. Our results suggest how a small domain, the MADS box, interacts with multiple cofactors to achieve specificity in transcriptional regulation and how subtle differences in the sequences of different MADS box proteins can influence the interactions with specific cofactors while not affecting the interactions with common cofactors. | INTRODUCTION |
|---|
|
|
|---|
A simple example of a combinatorial network involving a MADS box protein is the transcriptional regulatory system that specifies cell mating type in the yeast Saccharomyces cerevisiae (16). Yeasts have two haploid cell types, a and
, that differ by their cell surface receptors and the pheromones they secrete. Exposure of an a or
cell to the pheromone of the opposite mating type triggers a signal transduction cascade, inducing genes that are required for mating and the formation of the diploid a/
cell type. In a cells, the MADS box protein Mcm1 binds to target sites upstream of the promoters of a-specific genes to activate their transcription (2) (Fig. 1). In
cells, Mcm1 combines with the
1 protein to activate transcription of
-specific genes (4, 20, 33, 43). Mcm1 also combines with the
2 protein in
cells to bind to the pheromone response element (PRE) to repress transcription of a-specific genes (23, 32). In addition to determining the expression of the cell type-specific genes, Mcm1 interacts with the Ste12 protein in haploid a and
cells to activate genes required for mating and cell fusion (10, 12, 13, 19, 31). The interaction of Mcm1 with its different cofactors, therefore, determines the target specificity of Mcm1 and, in the case of
2, also changes it from functioning as a transcriptional activator to functioning as a repressor.
|
2 to DNA provides an excellent model for understanding how Mcm1 binds DNA and interacts with this cofactor (44). Comparison of the Mcm1 structure with the mammalian SRF and MEF2 proteins in complex with DNA revealed that the protein conformation and many of the DNA contacts are remarkably conserved between the yeast and human proteins (34, 39). The MADS box domain forms a protein dimer composed of three layers (Fig. 2A ). The first layer consists of antiparallel coiled-coil
helices, one from each monomer, positioned above the center of the recognition site. Residues in these helices make numerous phosphate- and base-specific contacts with the major groove. The middle layer consists of a hydrophobic four-stranded antiparallel ß sheet, formed from two ß strands of each monomer, and is aligned roughly parallel to the coiled-coil
helices. The ß loop between the strands in each monomer makes phosphate contacts in the major groove at positions outside of the conserved CArG-box [CC(A/T)6GG] binding site. These contacts contribute to the observed DNA-bending activity of many of the MADS box proteins (1, 34, 44). The top layer of the protein consists of an extended coil region followed by an
helix of three turns. This
helix packs against the corresponding face of the other monomer, adding to the dimerization interface. There is also an N-terminal extension from the
I helix of each monomer that folds back toward the protein and makes several base-specific and phosphate backbone contacts with positions at the center of the recognition site. Deletion studies have shown that an 80-residue fragment of Mcm1 containing the MADS box domain is sufficient to bind DNA and mediate interactions with different cofactors (6, 9, 36, 48). In this study, we investigated how this small domain interacts with many different cofactors and how these interactions may influence the activity of the protein. Through extensive mutagenesis of the Mcm1 MADS box domain, we have identified residues that are required for transcriptional regulation in complex with the
1,
2, and Ste12 cofactors. Interaction of Mcm1 with its cofactors maps to the same region of the MADS box domain, but the requirements within this same interface are very different among the different cofactors. These results show how the same interface can specify interactions with different cofactors.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
(PAL)-lacZ::FUS1 leu2-3,112 trp1-1 ura3 his3-11,15 ade2-1 can1-100 mcm1::LEU2/pSL1574-CEN/ARS MCM1 URA3], which was provided by G. Sprague (7).
1-Mcm1-mediated activation and
2-Mcm1-mediated repression were assayed in strain JM01 (MAT
leu2-3,112 trp1-1 ura3 his3-11,15 ade2-1 can1-100 mcm1::LEU2/pSL1574-CEN/ARS MCM1 URA3), a derivative of YY1888 (6). Transcriptional activation by Mcm1 in combination with Ste12 was assayed in strain JM02 (MATa leu2-3,112 trp1-1 ura3 his3-11,15 ade2-1 can1-100 mcm1::LEU2/pSL1574-CEN/ARS MCM1 URA3). Derivatives of plasmid pJM231 containing site-directed mutations in MCM1 were transformed into the appropriate strain, and loss of plasmid pSL1574, containing the wild-type gene, was selected on medium containing 5-fluoroorotic acid (5-FOA). These strains were then transformed with pJM300 or pJR018, CYC1-lacZ transcription reporter vectors in which the CYC1 upstream activating sequence elements have been replaced with the
1-Mcm1 binding site from the STE3 promoter or the Ste12-Mcm1 binding site from the STE2 promoter.
2-Mcm1-mediated repression was measured in strain JM01 transformed with pJM120, a CYC1-lacZ transcription reporter vector containing a consensus
2-Mcm1 binding site (50). ß-Galactosidase assays were performed as described previously (22), and the activation or repression values are averages of three independent transformants for each mutant. Plasmids. Individual alanine substitutions at each position in the MADS box domain of Mcm1 were constructed by cloning double-stranded oligonucleotides containing the desired codon changes into pJM231, a derivative of the pRS313 vector that contains an engineered MCM1 gene expressed from its native promoter (1). To express Mcm1 mutant proteins from a high-copy-number plasmid, pJM231 derivatives (CEN HIS3) were digested with SphI to yield a 3.3-kb fragment containing the entire MCM1 gene. The SphI fragments were cloned into pAB1, a modified version of the pRS423 plasmid (2µm HIS3) in which the polylinker region has been removed by digestion with PvuII and replaced with an SphI site. pDA105, a derivative of pJM231 with three copies of the hemagglutinin tag inserted at the C terminus of MCM1, was used for Western analysis of the mcm1-encoded mutant proteins.
The
1-dependent reporter plasmids were constructed by digesting pTBA23, a CYC1-lacZ transcription reporter plasmid, with XhoI and BglII and cloning in double-stranded oligonucleotides containing the
1-Mcm1 sites from the STE3 gene (5'GATCTCTGTCATTGTGACACTAATTAGGAAAC), the AGA1 gene (5'GATCTCTTCCTAATTAGGTCATCAATGACCTC), the MF
2 gene (5'GATCTTTTCCTAATTAGTCCTTCAATAGAACC), and the MF
1 gene (5'GATCTCTTCCTAATTAGGCCATCAACGACAGC). The Ste12-Mcm1 site was taken from the STE2 gene (5'-GATCTACCATGTAAATTTCCTAATTGGGTAAGTACATGATGAAACACATATG). These sites have been used previously to monitor Mcm1-dependent transcription (3, 7). All constructs were verified by sequence analysis. The
2-dependent reporter vectors containing the
2-Mcm1 binding sites from the BAR1, STE2, and ASG7 promoters were described previously (49).
Protein purification.
The mutant Mcm1 proteins used in the in vitro DNA-binding assays were purified from Escherichia coli BL21 cells transformed with pHA227, a protein expression vector in which the sequences coding for residues 1 to 97 of Mcm1 were fused in frame to the gene coding for the maltose-binding protein. The protein was purified from 100-ml cultures of the expression strain as described previously (1). The Mcm1 proteins isolated by this procedure were >95% homogeneous and consisted of two nonnative N-terminal amino acids, Gly1 and Ser2, followed by native Mcm1 residues 1 to 97. The concentrations of the wild-type and mutant proteins were determined and normalized by Bradford assays and verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Full-length
2 protein containing the six-His fusion was expressed in bacteria transformed with plasmid pJM163 and purified by Ni+2 affinity chromatography (28). The
1 protein was purified from bacteria containing the
1 expression vector pSL2187 as described previously (15).
Electrophoretic mobility shift assays.
The labeled fragment containing the STE6
2-Mcm1 binding site that was used as a probe in electrophoretic mobility shift assays was generated by isolating the 86-bp fragment from an EcoRI-HindIII restriction digest of pCK1 (22) and filling the 5' overhangs with 32P by using Klenow polymerase. A labeled fragment containing the
1-Mcm1 binding site from the STE3 promoter was generated by digesting pJM336 with KpnI and EcoRI, filling in the ends with 32P by using Klenow polymerase, and gel purification of the 84-bp fragment. DNA-binding assays were performed as described previously (47). Purified Mcm1 proteins were diluted in 50 mM Tris (pH 7.6)-500 mM NaCl-1 mM EDTA-10 mM 2-mercaptoethanol-1 mg of bovine serum albumin per ml and mixed with constant amounts of
1 or
2 diluted in the same buffer. The relative binding affinity of the mutant Mcm1 proteins was calculated by using best-fit analysis of the probe fraction bound at different protein concentrations and comparing it to that of the wild type.
Biological assays.
Mating pheromone production was monitored by measuring the sizes of the growth inhibition halos that formed around the strains when they were patched onto a dilute lawn of pheromone-sensitive strains RC634 (MATa sst1 ade2 his6 met1 ura1 rme1) and RC757 (MAT
sst2-1 met1 his6 can1 cyh2) (8). Mcm1 protein levels were determined by Western blot analysis as described previously (21). Rat monoclonal antibody specific to hemagglutinin (Roche) was used at 1:5,000 as the primary antibody, and goat anti-rabbit antiserum conjugated to horseradish peroxidase (Bio-Rad) was used as the secondary antibody.
| RESULTS |
|---|
|
|
|---|
The alanine scanning mutagenesis indicated that 17 of the 75 side chains that were mutated in the Mcm1 MADS box domain are essential for cell growth (Fig. 2B and 3A ). Many of the lethal mutations were in side chains that contact the DNA (K38, R39, K40, G42, K45, and K46), and we have previously shown that these mutations cause significant reductions in the DNA-binding affinity of the protein in vitro (1). Substitutions at other conserved positions in the
helices that are not in contact with the DNA, such as R32, F36, I43, M44, and L53, also failed to complement the mcm1 null mutation and were lethal to the cell. These residues, along with another lethal mutation, I90A, are positioned along the dimer interface and are likely to be critical for stability of the dimer. In the C terminus of the MADS box domain of Mcm1, alanine substitutions at only four positions, Y70, F72, T74, and I90, were lethal. The Y70, F72, and T74 side chains lie adjacent to each other on the outer ß strand. Two of these residues, Y70 and F72, have large hydrophobic side chains that extend away from the interior of the protein and are positioned above the
helix (
I) that mediates DNA binding (Fig. 2B). These side chains are partially solvent exposed and therefore could potentially be involved in interactions with essential cofactors. However, Y70, F72, and T74 may be required to stabilize the
helix so it makes proper DNA contacts. In support of this model, we found that these mutant proteins have significantly decreased DNA-binding affinities (data not shown).
|
Interestingly, the I90A mutation allowed viability when on a high-copy-number plasmid in a MATa strain but not in a MAT
strain. The levels of available Mcm1 protein may account for the difference in viability between the two mating types. In an
strain, a significant portion of the Mcm1 protein may be sequestered into a complex with
1 and
2, whereas in an a strain, there may be more Mcm1 protein available to interact with other cofactors, such as Fkh2, to activate essential genes (17, 24, 25). This result, along with the fact that higher levels of MCM1 expression can suppress the lethality of many of the mutations, suggest that Mcm1 levels may be limiting within the cell. In further support of this model, we found that some of the mutants grew very slowly and that only a few colonies were able to survive the plasmid swap selection on 5-FOA plates. In fact, when we rescreened the inviable mutants by plating a higher number of cells on 5-FOA plates, we found a few colonies with the T54A and L59A mutations, substitutions we had previously considered to cause inviability (1). These mutants did not grow well and, as will be discussed below, were defective in many Mcm1 functions. It is possible that a small increase in the expression or activity of the mutant protein allows these clones to survive without the wild-type plasmid. We also observed differences in the viability of some of the mutations in different strain backgrounds, further suggesting subtle differences in the expression of the mutant Mcm1 proteins may influence cell viability (E. Dubois and F. Messenguy, personal communication). We have examined a number of the mutant proteins by Western blot analysis and found a three- to fourfold increase in the level of expression at high copy numbers compared to low copy numbers, further indicating that relatively small differences in the levels of some of the mutant proteins are sufficient to restore viability.
Residues required for Mcm1-mediated transcriptional activation.
Although a few mutations failed to complement the mcm1 null mutation and were therefore lethal to the cell, a large number of the alanine substitutions resulted in viability when present at either low or high copy numbers. To determine if these substitutions affect Mcm1 activity, the mutant proteins resulting in viability were assayed for the ability to autonomously activate transcription in vivo. In this assay, strain YY2052, which contains an integrated lacZ reporter gene under the control of a P(PAL) Mcm1 binding site, was transformed with all of the mcm1 mutations that result in viability and ß-galactosidase activity was measured (Fig. 3A and 4A) (7, 20). The majority of the mutations activated transcription of the P(PAL) reporter at nearly wild-type levels, suggesting that they do not dramatically alter the structure or function of the protein. There were, however, a number of mutations that produced a significant decrease in activation. As expected, several of these mutations, R19A, V34A, K38A, and K40A, are at residues that contact the DNA and, as shown previously, caused significant decreases in the DNA-binding affinity of the protein (1). Replacement of other residues, such as T54, L59, I80, and G86, that lie at the dimer interface, and T74, which forms an H bond between the ß strands in each monomer, may slightly affect the folding of the protein so that it cannot efficiently bind DNA or interact with cofactors required for activation. Residue I23 in the N-terminal extension and residues F48 and E49 in the
I helix also showed reductions in activation when mutated to alanine. Residue E49 packs up against I23 and is likely important for positioning of the N-terminal extension, which is required for DNA binding (1). Interestingly, although the protein with the F48A mutation had a threefold decrease in transcriptional activation, it bound DNA slightly better than did wild-type Mcm1, suggesting that this residue plays a role in protein-protein interactions with transactivating factors (1). The V34A mutation had the second largest effect on Mcm1-mediated autonomous activation of any of the mutations in the MADS box domain. Although this residue makes two base-specific contacts, the mutation produced only a modest (2.7-fold) decrease in DNA-binding affinity (1). However, this mutation caused a large decrease in DNA bending by the protein, suggesting that DNA bending is important for Mcm1-mediated activation at a P(PAL) site.
|
1.
While mutations at relatively few positions decreased activation by Mcm1 alone, a large number of the mutations significantly affected the ability of Mcm1 to activate transcription with
1 (Fig. 3B and 4B). Many of the mutations that had moderate (2- to 4-fold) effects on autonomous activation by Mcm1 caused large (10- to 100-fold) decreases in combination with
1. The majority of these residues are clustered and buried in the inner and outer ß strands. However, a few of these residues, Q57, Y70, and F72, are partially solvent exposed and, along with other residues that affect activation with
1, such as K40, M44, and K45, form a solvent-exposed surface in the middle layer of the protein (Fig. 4B). These residues may directly interact with
1 or, alternatively, are important for the alternative conformation when Mcm1 binds with
1 (45). The fact that so many of the mutations showed significant differences in the level of activation in combination with
1 than when Mcm1 activates transcription autonomously or in combination with Ste12 also indicates differences in the way that Mcm1 mediates transcriptional activation with these different cofactors. In further support of these differences, the mutation that produced the second greatest decrease in Mcm1-mediated activation alone, V34A, produced a relatively minor decrease in activation in combination with
l.
Since many of the alanine substitutions caused large decreases in activation in complex with
1 but had relatively little effect on autonomous activation, we were concerned that the
1-Mcm1 site from the STE3 promoter may be more sensitive to mutations in Mcm1 than are sites from other
-specific genes. To compare the sensitivities of the different
1-Mcm1 binding sites, we constructed lacZ reporter promoters containing
1-Mcm1 binding sites from the promoters of the MF
1 AGA
1, and MF
2
-specific genes and assayed these reporters in combination with a set of mcm1 mutations (Table 1). Although there were differences in strength between these
1-Mcm1 activator sites, we found the relative activities produced by the mcm1 mutations to be very similar at each of the
1-Mcm1 sites. These results suggested that the defects in activation caused by many of the mcm1 alanine mutations with the STE3 reporter are consistent with other
1-Mcm1 sites.
|
1 (Fig. 5). In general, there was a good correlation between the level of cooperative binding with
1 in vitro and transcriptional activation in vivo. For example, proteins with the V34A and F48A mutations cooperatively bound with
1 at levels comparable to that of the wild-type protein and these mutant proteins showed relatively minor reductions in activation of the reporter in vivo (Fig. 3B). In contrast, mutant proteins such as those with the K40A and Y70A mutations, which showed large reductions in activation, also showed reduced cooperative binding with
1. These proteins bound to the STE3 sites with reasonable affinity on their own but failed to bind cooperatively with
1, indicating that these substitutions likely affect interactions with
1. However, some of the mutations in the C-terminal region of the domain, such as V69A, F72A, T74A, and L89A, caused significant decreases in binding to the site in the absence of
1 (data not shown). However, many of these mutant proteins were able to interact with
1, although with significantly reduced binding affinity, suggesting that the reduced activation by these mutant proteins is due to the reduced binding affinity of the complex.
|
1-Mcm1-mediated transcriptional activation and DNA binding (7). In contrast, the S73A substitution produced wild-type activity in our assay system. We also observed this difference in the activity of the mutant proteins in vitro (Fig. 5). This result suggests that while the Ser side chain may not be critical for the specificity of the interaction between the proteins, the
1 protein is likely to be in close proximity to this side chain because the Arg side chain interferes with binding.
Mcm1 residues required for activation in combination with Ste12.
To monitor Ste12-Mcm1-dependent activation, we used a lacZ reporter promoter that contains the Mcm1 binding site from the STE2 promoter. Even in the absence of a mating pheromone, this construct had levels of lacZ expression that are dependent on Ste12 and that are 100-fold greater than those of a reporter promoter lacking the site (19) (data not shown). Given the high level of Ste12-dependent activation, we assayed activation of the mcm1 mutations in combination with Ste12 in the absence of a mating pheromone (Fig. 3C and 4C). Although the magnitudes differ, many of the substitutions that affect Mcm1-dependent activation of the P(PAL) site alone also decreased activation by STE2 PRE in combination with Ste12. A number of these residues are involved in DNA binding or position the N-terminal arm. Interestingly, in contrast to its effect on activation with
1, the V34A substitution caused a large decrease in transcriptional activation with Ste12, suggesting that DNA bending plays an important role in activation by this complex. As with
1, residues Q57 and T74 are important for the interaction of Mcm1 with Ste12. These residues form a solvent-exposed cleft near the ends of the ß strands.
Although we observed Ste12-dependent activation of the reporter promoter in the absence of a pheromone, in the presence of
pheromone, there was a further twofold increase in the level of lacZ expression in our reporter system. Upon induction of the mating signal transduction pathway with a mating pheromone, Ste12 is phosphorylated (18, 41). It is possible that this phosphorylation alters the conformation of Ste12 and its interactions with Mcm1. If this were the case, we might expect to see a different profile of the phenotypes produced by the alanine mutations that affect activation with Ste12 in the presence of
mating factor. However, we tested a subset of the mcm1 mutations for Ste12-dependent activation in the presence of
pheromone and although there was an increase in the levels of expression of the reporter promoter, the relative effects of each of the mcm1 mutations were roughly the same in the presence and absence of
pheromone (data not shown).
Alanine mutations of residues in Mcm1 that contact
2 in the crystal structure had little effect on repression.
To determine which positions in Mcm1 affect cooperative binding with
2 and repression of a-specific genes, we assayed the mcm1 mutations in combination with
2. Previously, we performed alanine scanning mutagenesis of the residues in the linker region of
2 and identified a small patch of hydrophobic residues that are required for interaction with Mcm1 (28). The crystal structure of the
2-Mcm1-DNA ternary complex verified that these residues in
2 contact a hydrophobic surface in Mcm1 (44) (Fig. 4D). We therefore wanted to determine if alanine substitutions for these residues in Mcm1 also cause significant reductions in cooperative interaction with
2 and repression of a-specific genes. Surprisingly, we found that replacement of only three residues, K40, I43, and E49, with alanine produced significant (greater-than-twofold) decreases in repression (Fig. 3D and 4D). Replacement of residues that directly contact
2 in the crystal structure of the ternary complex, such as S51, V69, and R87, with alanine had a less-than-twofold effect on repression. The K40, I43, and E49 residues do not contact
2 in the crystal structure, but all of the proteins with mutations at these sites showed reductions in binding affinity of 50-fold or greater. However, the decreased repression by these mutant proteins is not simply due to a reduction in DNA-binding affinity because mutant proteins with even greater losses of DNA-binding affinity, such as those with the F25A, K38A, M44A, K45A, and T54A mutations, had nearly wild-type activity. The I43 and E49 residues are buried in the core of the protein, and it is possible that their replacement lowers the level of the protein so that there is not sufficient Mcm1 for full repression. The K40A mutation not only caused a decrease in the DNA-binding affinity of the protein but also caused a significant reduction in DNA bending (1). Although it is possible that bending by this residue may be required for cooperative binding with
2, other mutations that affect DNA bending (but to a lesser degree), such as V34A and S37A, have wild-type repression activity in combination with
2.
The
2-Mcm1 binding site used to assay the different mutations in Mcm1 is a consensus site derived by alignment of all of the natural binding sites found in the promoter of a-specific genes (50). This site functions as a very strong repressor site in the context of the heterologous promoter. It is therefore possible that the strong nature of this site makes it insensitive to partial decreases in Mcm1 activity, possibly explaining why replacement of residues contacted by
2 had little effect on repression. We therefore tested the repression of several mcm1 mutations with transcription reporters containing
2-Mcm1 binding sites from the BAR1, STE2, and ASG7 promoters (49). All of the mcm1 mutations tested produced levels of repression through these sites roughly similar to those achieved with the consensus
2-Mcm1 site (Table 2). This indicates that the failure to observe derepression by the mcm1 mutations is not due to the specific
2-Mcm1 binding site used in our assay system.
|
2 to the
2-Mcm1 binding site from the STE6 promoter (Fig. 6). Although some of the mutations, such as E49A, Y70A, and I90A, caused a decrease in the formation of the cooperative
2-Mcm1 complex, they also produced a similar reduction in the DNA-binding affinity of the protein alone and did not affect the cooperative interactions with
2. Mutant proteins with substitutions of residues that directly contact
2, such as S51A, V52A, V69A, V81A, and R87A, showed roughly wild-type DNA-binding affinity alone (data not shown) and in complex with
2. These results are in agreement with the in vivo transcription assay and indicate that these mutations do not cause a significant decrease in cooperative interactions with
2.
|
2 do not affect repression.
The alanine scanning experiments showed that removal of individual side chains in the Mcm1 MADS box domain, even in residues that directly contact
2 in the crystal structure of the ternary complex, do not affect repression of a-specific genes or cooperative binding with
2. To determine if this interaction can be disrupted, we made radical substitutions with larger or charged amino acids at the residues in Mcm1 that directly contact
2 (Table 3). A few of the radical mutations were lethal to the cell and therefore could not be assayed in vivo. Although some of the single mutations caused significant reductions in transcriptional activation through the P(PAL) site, with the exception of the S51F mutation, none had a more-than-twofold decrease in repression with
2. We therefore constructed a series of double-mutant proteins to determine if removal or disruption of multiple contacts would affect the interaction. Removal of two side chains that form the hydrophobic pocket in Mcm1 that accommodates the
2 F116 residue, such as R87A/V69A or R87A/V81A, had little effect on repression. However, removal of a side chain that contacts a different residue in
2, such as S51A or T71A, in addition to the mutation in the pocket (R87A), reduced repression. Finally, radical double substitutions, such as R87F/S51F and R87F/V69F, caused significant decreases in the level of repression at levels similar to those that we observed with mutations in the
2 linker region (28).
|
2-Mcm1-mediated repression were due to decreased binding by the complex, we purified the mutant proteins and assayed their ability to bind DNA alone and in complex with
2 (Fig. 7). Even though some of the substitutions are at solvent-exposed residues away from the DNA-binding surface, some of the mutations caused a decrease in DNA-binding affinity in the absence of
2. It is possible that these changes affect the ability of the protein to fold properly and dimerize. These mutant proteins also showed significant decreases in cooperative binding with
2, indicating why these substitutions cause decreases in repression in vivo.
|
mating type backgrounds were tested for pheromone production by patching of colonies onto lawns of strains of the opposite mating type. Pheromone secretion from the cell being tested causes cell cycle arrest in the lawn of cells of the opposite mating type, thereby forming a halo of nongrowth around the strain being tested. All of the mutants in the a cell type background produced a halo when patched onto a lawn of
cells, indicating that they retained sufficient activity to activate the endogenous a-specific genes in the cell (Fig. 8A). However, for some mutants, such as those with the R87F/V69F and R87F/S51F mutations, the size of the halo was decreased, indicating that lower pheromone levels were produced by these strains. These results correlate well with the reduced activation by these mutants in the lacZ reporter assays (Table 3). In
cells, the relative size of the halo correlates with the level of activation by the
1-Mcm1 complex of the MF
1 and MF
2 genes coding for the
pheromone. In agreement with the transcription reporter assays, mutants of the
cell type that were defective in activating transcription of the
1-Mcm1-dependent lacZ reporter produced little or no halo when patched onto a lawn of a cells (Fig. 8B). None of the mcm1 mutants of the
strain produced a halo when patched onto a lawn of
cells (Fig. 8C). This result indicates that although some of the mutants showed decreased repression of the lacZ reporter in combination with
2, they still retained sufficient activity to repress transcription of the endogenous a-specific genes.
|
| DISCUSSION |
|---|
|
|
|---|
1,
2, and Ste12 cofactors.
On the basis of their effects on viability, the mcm1 alanine mutations can be divided into three classes: (i) those that cause inviability at low or high copy numbers, (ii) those that cause inviability at low copy numbers but allow viability at high copy numbers, and (iii) those that allow viability at low copy numbers. Eight mutant proteins, those with the I26A, R32A, F36A, R39A, G42A, K46A, L53A, and I90A mutations, are in the first class of mutant proteins. Six of these eight have amino acid substitutions in the coiled-coil
I helix. Residues R39, G42, and K46 make direct contacts with the DNA, and alanine substitutions at these positions completely destroy the ability of the proteins to bind DNA (1). Residues I26, R32, F36, L53, and I90 are mostly buried and are likely to be essential for dimerization. With the exception of I90, all of the residues in this class are virtually invariant throughout all of the MADS box proteins and cluster at the dimer interface on either end of the long
I helix (40, 44). The high conservation of these residues, along with the strong phenotype of the alanine substitutions at these positions, indicates that these residues are likely to be essential for the function of most MADS box proteins. It is possible that these residues are important for binding by the ends of the two
I helices at the dimer interface. In contrast, buried residues at the dimer interface in the center of the
I helix, such as I43, or in the inner ßI strand, such as V58 to V63, are more accommodating to removal of the side chain. These residues are not as well conserved among the MADS box proteins.
We were surprised by the number and positions of the mutations in the second class, which are inviable at low copy numbers but viable at high copy numbers. Many of the mutations in this class are at residues that are strongly conserved among the different MADS box proteins. For example, two of the residues in this class, K38 and K45, are invariant in all of the MADS box proteins and these side chains directly contact the DNA in the MADS box crystal structures (34, 39, 44). Residue K38 makes several base-specific contacts in the
2-Mcm1-DNA crystal structure, and the K38A mutant protein fails to bind DNA (1). The K45A mutant protein binds DNA with 1,000-fold decreased affinity compared to that of wild-type Mcm1. The K40 residue also directly contacts DNA in the crystal structures, and an alanine substitution at this position not only causes a decrease in the DNA-binding affinity of the protein but also causes a large reduction in the degree of DNA bending. Even though the other residues in this class of mutations do not directly contact DNA, alanine substitutions at these positions cause significant decreases in DNA-binding affinity. Although these residues are critical for DNA binding by Mcm1, the lethality of removal of these side chains can be suppressed by high-level expression of the mutant proteins. This suggests that these mutant proteins are expressed and are able to fold into a structure that, at high copy numbers, is sufficient to overcome the decreased activity caused by the mutation.
It is not clear why the lethal effects of the mutant proteins in the second class can be suppressed if the protein is present at high copy numbers while mutant proteins in the first class that show similar decreases in DNA-binding affinity are not viable at high copy numbers. Interestingly, the R39A, G42A, and K46A mutant proteins in the first class all contact the phosphate backbone, suggesting that these contacts are more important than the specific base pair contacts or DNA bending by other residues. It is possible that the cofactors that bind with Mcm1 to activate expression of essential genes provide a large portion of the DNA-binding specificity of the complex, so the base-specific contacts made by these residues are not essential. On the other hand, the phosphate backbone contacts made by R39, G42, and K46 may be essential for proper docking of the protein to the DNA.
Almost all of the mutations that cause a lethal phenotype at low or high copy numbers either directly contact the DNA or are buried and likely to be involved in folding or dimerization. In theory, there should also be solvent-exposed side chains that interact with other DNA-binding proteins to bind to target sites upstream of essential genes or that interact with transacting cofactors to recruit the basic transcription machinery. It is possible that the surface of Mcm1 that interacts with these putative cofactors is extensive, such that any single-alanine point mutation has little or no effect on the interaction. This would be similar to the effects of single-amino-acid substitutions on interaction with
2 that we observed. Alternatively, Mcm1 may serve as an architectural protein that binds to the promoters of essential genes and alters the chromatin structure by bending the DNA, allowing other transcription factors to bind to the promoter and thereby serving to indirectly activate transcription.
The majority of mcm1 alanine substitutions (58 of 75) fall into the third class, those that allow viability at low copy numbers. These mutations were tested for their effects on autonomous transcriptional activation through the P(PAL) site and activation with the
1 and Ste12 cofactors. Although most of the mutations caused greater effects on activation with
1, a comparison of the mutant proteins alone and in combination with
1 and Ste12 revealed some features that they have in common and are required for activation by the protein. In the C terminus of the MADS box domain, alanine substitutions at residues G67, T71, G86, R87, and L89 caused decreases in the level of activation by sites from the STE3 and STE2 promoters, while the same mutations had only small effects with activation on a P(PAL) site. This result suggests that there may be a region of Mcm1 that is involved in interaction with both
1 and Ste12. Alternatively, these residues may be involved in the interaction with a transcription cofactor that is recruited by both the
1-Mcm1 and Ste12-Mcm1 complexes and not by Mcm1 on its own. Of these residues, G67, T71, and R87 are partially solvent exposed and map to the hydrophobic pocket and groove on one surface of Mcm1. This is also the region that interacts with
2 in the crystal structure of the
2-Mcm1-DNA ternary complex (44). These results are in good agreement with previous findings that identified residues 69 to 81 of Mcm1 as important for both
1 and Ste12 interactions (7). Many of the mutations that affect the interactions with the different cofactors could alter the folding and dimerization of the protein. However, since most of these mutant proteins allow viability and show wild-type levels of repression and DNA binding with
2, these changes in folding are likely to be subtle.
Although many of the mutations in the Mcm1 MADS box domain have similar effects on activation with
1 and Ste12, there are some significant differences in the effects of mutations at the N terminus of the domain. For example, residues R31, T35, I43, V52, G55, L60 to T66, Y70, and F72 appear to be important for
1-mediated activation, while these residues have little effect on activation by Mcm1 alone or in complex with Ste12. Many of these mutations are at buried residues, and replacement of some of them may cause minor structural alterations. Although these changes do not appear to affect the essential role of the protein or strongly affect its interaction with Ste12 or
2, they do appear to affect interaction with
1. There are several explanations for this difference. In contrast to
2, the interaction of Mcm1 with
1 may be very specific, such that it cannot tolerate these small changes. It is also possible that the interaction between these proteins is relatively weak so that loss of any single contact is enough to significantly reduce the affinity and therefore activation by the complex. Another explanation is based on the differences in the mechanisms by which these complexes bind DNA. Even in the absence of the Ste12 and
2 cofactors, Mcm1 is bound to sites in the promoters of pheromone-responsive and a-specific genes, respectively. The Ste12 and
2 cofactors may therefore recognize contacts on the DNA, as well as binding surfaces on the Mcm1 protein. In contrast, the Mcm1 protein does not bind to sites in the
-specific genes in the absence of
1. The two proteins may therefore have to first form a complex in solution before binding to their target site. The formation of this complex may be more stringent and sensitive to mutations than interactions of Mcm1 with its other cofactors when bound to DNA.
The most striking difference between Mcm1 activation with
1 and that with Ste12 is shown by the protein with the V34A mutation. This mutant protein showed a greater-than-50-fold decrease in activation with Ste12 but, in complex with
1, activated
-specific genes nearly as well as the wild-type protein (Fig. 3). Residue V34 is critical for production of the large Mcm1-dependent bend in DNA (1). The fact that the V34A mutation has such profound effects on Ste12-dependent activation but has little effect on
1-mediated activation suggests that the mechanisms by which Mcm1 binds DNA when it is in complex with these two cofactors are likely very different. It is possible that DNA bending is required for activation by Mcm1 on its own or in complex with Ste12 but is not required when activating in complex with
1. Therefore, even in the absence of the V34 contact with the DNA, the
1-Mcm1 complex may produce a bend in the DNA that is similar to that produced by Mcm1 on its own. Alternatively, it is possible that DNA bending by Mcm1 produces a conformational change in the protein that is similar to the change induced by interaction with
1 (43).
Many of the mutations we have tested affect autonomous transcriptional activation or activation in complex with
1 or Ste12. We were therefore surprised to find that only a few mutations affect repression in complex with
2. Even residues within the hydrophobic pocket and along the hydrophobic groove that make direct contacts with
2 in the crystal structure have only minimal effects on repression when replaced with alanine. The observation that these mutations have similar effects on different
2-Mcm1 reporter promoters, do not alter cooperative binding with
2 in vitro, or affect repression of endogenous a-specific genes in vivo further supports our findings on the effects of these mutations. Even more surprising is the finding that most of the radical replacements of residues in Mcm1 that contact
2 did not significantly affect repression or cooperative binding with
2. It is possible that
2 interacts with Mcm1 in a manner different from that observed in the crystal structure. However, this is unlikely because, despite significant structural differences in residues in the linker region that do not contact Mcm1, the contacts by residues that do interact with Mcm1 are virtually identical in both of the
2 monomers (44). Furthermore, the effects of mutations in residues in the
2 linker region agree very well with predictions based on the crystal structure (28). The fact that most of the Mcm1 mutations do not affect repression indicates that the roles of the
2 and Mcm1 proteins in formation of the protein complex are very different. The region of interaction on
2 is relatively small, so that any single substitution changes a large percentage of the total contacts made by the protein. In comparison, Mcm1 appears to provide a large hydrophobic surface, in which multiple side chains, along with groups in the peptide backbone, contact each amino acid in the
2 linker. This model is supported by the fact that mutation of any single residue in Mcm1 has a minor effect on the interaction, while substitutions of residues in the linker region of
2 have a large effect on repression (28). Only when multiple contacts are disrupted by substitutions in Mcm1 with large amino acids is there an effect on repression. These results suggest that the overall structure of the Mcm1 interface, as opposed to individual contacts, plays an important role in the interaction with
2. The type of interaction between Mcm1 and
2 is therefore significantly different from the interaction between Mcm1 and
1 or Ste12, in which our mutational analysis has shown that individual side chains have important roles in the activity of the complex.
The differences in the types of interactions that we describe for Mcm1 with its mating cofactors may apply to the cofactor interactions of MADS box proteins from other organisms. As shown with
1 and Ste12 single mutations in Mcm1 affect transcriptional activation and DNA binding, indicating that subtle differences in the amino acid sequences of two MADS box proteins may provide determinants by which to distinguish which specific cofactors interact with each protein. However, as was shown by the effects of mutations in Mcm1 on the interaction with
2, the differences in sequence may not affect interactions with other cofactors that are common to both MADS box proteins. As an example, both the SRF and MEF2 MADS box proteins form a heterodimeric complex with myogenic cofactors such as the basic helix-loop-helix E12/MyoD heterodimer while also maintaining interactions with their own set of specific cofactors (14, 29, 30). By having different requirements within the same interface, as we have described for Mcm1 and its cofactors, MADS box proteins may be able to interact with the same set of cofactors, as well as with cofactors that only interact with specific MADS box proteins. This may explain how MADS box proteins with apparently similar DNA-binding specificities and the same cofactors are also able to interact with specific cofactors to differentially regulate distinct sets of genes.
| ACKNOWLEDGMENTS |
|---|
M.G and A.S. are recipients of a Howard Hughes Medical Institute Undergraduate Summer Research Fellowship and Rutgers Undergraduate Research Fellowships. M.G. is a recipient of a New Jersey Cancer Commission Undergraduate Fellowship. This research was supported by a grant from the National Institutes of Health (GM49265) to A.K.V.
| FOOTNOTES |
|---|
Present address: Center for Advanced Biotechnology and Medicine, Piscataway, NJ 08854. ![]()
| REFERENCES |
|---|
|
|
|---|
2.
Ammerer, G. 1990. Identification, purification, and cloning of a polypeptide (PRTF/GRM) that binds to mating-specific promoter elements in yeast. Genes Dev. 4:299-312.
3. Baur, M., R. K. Esch, and B. Errede. 1997. Cooperative binding interactions required for function of the Ty1 sterile responsive element. Mol. Cell. Biol. 17:4330-4337.[Abstract]
4.
Bender, A., and G. F. Sprague, Jr. 1987. MAT
1 protein, a yeast transcription activator, binds synergistically with a second protein to a set of cell-type-specific genes. Cell 50:681-691.[CrossRef][Medline]
5. Boeke, J. D., J. Trueheart, G. Natsoulis, and G. R. Fink. 1987. 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154:164-175.[Medline]
6.
Bruhn, L., J.-J. Hwang-Shum, and G. F. Sprague, Jr. 1992. The N-terminal 96 residues of MCM1, a regulator of cell type-specific genes in Saccharomyces cerevisiae, are sufficient for DNA binding, transcription activation, and interaction with
1 Mol. Cell. Biol. 12:3563-3572.
7.
Bruhn, L., and G. F. Sprague, Jr. 1994. MCM1 point mutants deficient in expression of
-specific genes: residues important for interaction with
1. Mol. Cell. Biol. 14:2534-2544.
8.
Chan, R. K., and C. A. Otte. 1982. Isolation and genetic analysis of Saccharomyces cerevisiae mutants supersensitive to G1 arrest by a factor and
factor pheromones. Mol. Cell. Biol. 2:11-20.
9.
Christ, C., and B. K. Tye. 1991. Functional domains of the yeast transcription/replication factor MCM1. Genes Dev. 5:751-763.
10.
Dolan, J. W., C. Kirkman, and S. Fields. 1989. The yeast STE12 protein binds to the DNA sequence mediating pheromone induction. Proc. Natl. Acad. Sci. USA 86:5703-5707.
11.
Dubois, E., and F. Messenguy. 1991. In vitro studies of the binding of the ARGR proteins to the ARG5,6 promoter. Mol. Cell. Biol. 11:2162-2168.
12.
Errede, B., and G. Ammerer. 1989. STE12, a protein involved in cell-type-specific transcription and signal transduction in yeast, is part of protein-DNA complexes. Genes Dev. 3:1349-1361.
13. Fields, S., and I. Herskowitz. 1985. The yeast STE12 product is required for expression of two sets of cell-type specific genes. Cell 42:923-930.[CrossRef][Medline]
14.
Groisman, R., H. Masutani, M. P. Leibovitch, P. Robin, I. Soudant, D. Trouche, and A. Harel-Bellan. 1996. Physical interaction between the mitogen-responsive serum response factor and myogenic basic-helix-loop-helix proteins. J. Biol. Chem. 271:5258-5264.
15.
Hagen, D. C., L. Bruhn, C. A. Westby, and G. F. Sprague, Jr. 1993. Transcription of
-specific genes in Saccharomyces cerevisiae: DNA sequence requirements for activity of the coregulator
1. Mol. Cell. Biol. 13:6866-6875.
16. Herskowitz, I., J. Rine, and J. Strathern. 1992. Mating-type determination and mating-type interconversion in Saccharomyces cerevisiae, vol. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
17.
Hollenhorst, P. C., M. E. Bose, M. R. Mielke, U. Muller, and C. A. Fox. 2000. Forkhead genes in transcriptional silencing, cell morphology and the cell cycle. Overlapping and distinct functions for FKH1 and FKH2 in Saccharomyces cerevisiae. Genetics 154:1533-1548.
18. Hung, W., K. A. Olson, A. Breitkreutz, and I. Sadowski. 1997. Characterization of the basal and pheromone-stimulated phosphorylation states of Ste12p. Eur. J. Biochem. 245:241-251.