MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jabrane-Ferrat, N.
Right arrow Articles by Peterlin, B. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jabrane-Ferrat, N.
Right arrow Articles by Peterlin, B. M.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, August 2002, p. 5616-5625, Vol. 22, No. 15
0270-7306/02/$04.00+0     DOI: 10.1128/MCB.22.15.5616-5625.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Major Histocompatibility Complex Class II Transcriptional Platform: Assembly of Nuclear Factor Y and Regulatory Factor X (RFX) on DNA Requires RFX5 Dimers

Nabila Jabrane-Ferrat,1 Nada Nekrep,2,3,4 Giovanna Tosi,2,3 Laura J. Esserman,1 and B. Matija Peterlin2,3*

Departments of Surgery,,1 Medicine, and,2 Microbiology and Immunology, University of California San Francisco, San Francisco, California 94115-0703,3 Institute of Biochemistry, Medical Faculty of the University of Ljubljana, 1000 Ljubljana, Republic of Slovenia4

Received 31 October 2001/ Returned for modification 23 January 2002/ Accepted 16 April 2002


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Major histocompatibility complex class II (MHC-II) genes are regulated in a B-cell-specific and gamma interferon-inducible manner. Conserved upstream sequences (CUS) in their compact promoters bind nuclear factor Y (NFY) and regulatory factor X (RFX) complexes. These DNA-bound proteins form a platform that attracts the class II transactivator, which initiates and elongates MHC-II transcription. In this report, we analyzed the complex assembly of these DNA-bound proteins. First, we found that NFY can interact with RFX in cells. In particular, NFYA and NFYC bound RFXANK/B in vitro. Next, RFX5 formed dimers in vivo and in vitro. Within a leucine-rich stretch N-terminal to the DNA-binding domain in RFX5, the leucine at position 66 was found to be critical for this self-association. Mutant RFX5 proteins that could not form dimers also did not support the formation of higher-order DNA-protein complexes on CUS in vitro or MHC-II transcription in vivo. We conclude that the MHC-II transcriptional platform begins to assemble off CUS and then binds DNA via multiple, spatially constrained interactions. These findings offer one explanation of why in the Bare Lymphocyte Syndrome, which is a congenital severe combined immunodeficiency, MHC-II promoters are bare when any subunit of RFX is mutated or missing.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Major histocompatibility complex class II (MHC-II) determinants play a central role in the selection of the T-cell receptor repertoire and in the initiation, propagation, and duration of antigen-specific immune responses by CD4-positive T cells (9, 45). They are expressed constitutively on the surface of mature B cells, dendritic, and thymic epithelial cells and can be induced on many somatic cells by gamma interferon (IFN-{gamma}) (3, 35, 39). Since the expression of MHC-II genes is critical for the function of the immune system, it is not surprising that the congenital lack of these determinants results in an autosomal and recessive severe combined immunodeficiency called the Bare Lymphocyte Syndrome (BLS) (35). Moreover, the inappropriate expression of MHC-II determinants on target tissues facilitates organ-specific autoimmunity (5).

The expression of the classical, polymorphic MHC-II determinants (DR, DQ, and DP) and the accessory molecules (DM, Ii) involved in antigen processing and presentation is regulated at the transcriptional level (3, 35, 39). They are transcribed from compact promoters, which contain conserved upstream sequences (CUS) from positions -135 to -60 (DRA promoter) (4, 40, 41) and variable promoter proximal sequences that lack a functional TATA box (2, 26). From the 5' to the 3' direction, CUS contain S, X, and Y boxes which bind different protein complexes to mediate B-cell-specific and IFN-{gamma}-inducible expression of MHC-II genes (3, 35, 39). Additionally, the spacing between CUS cannot be varied, suggesting that trans-acting factors interact with each other and DNA for the formation of the MHC-II enhanceosome (13, 42, 43).

The S and the X boxes contain palindromic sequences: both bind the regulatory factor X (RFX) (17). RFX is a complex of three subunits: RFXANK/B, RFX5, and RFXAP (35). It is required for the constitutive and the IFN-{gamma}-inducible expression of MHC-II determinants. Mutations in RFX explain several complementation groups of BLS: those in RFXANK/B, group B; those in RFX5, group C; and those in RFXAP, group D (35). The X2 box binds AP1, X2BP, and CREB (31, 36). The Y box is composed of the CCAAT sequence and binds nuclear factor Y (NFY). NFY consists of three subunits as well: NFYA, NFYB, and NFYC (25). NFYC and NFYB share a conserved core sequence that contains a histone fold similar to that in the nucleosomal subunits H2A and H2B (25). Mutations of the Y box in DRA and Ii promoters also abolished the occupancy of these promoters in cells (24, 28). Indeed, via the histone acetyltransferases GCN5, p300, and P-CAF, NFY can open chromatin for other transcriptional coactivators (10). NFY and RFX are expressed constitutively, and their presence alone is not sufficient for the B-cell-specific, IFN-{gamma}-inducible and developmental expression of MHC-II genes. Furthermore, none of these trans-acting factors contains an activation domain. Thus, the expression cloning of the class II transactivator (CIITA) (38) constituted a major advance in our understanding of MHC-II transcription. By itself, CIITA does not bind DNA. Rather, it interacts with proteins that bind DNA. Then, CIITA directs the initiation and elongation of MHC-II transcription (14, 18). Thus, complex DNA-protein and protein-protein interactions are required for the assembly of the MHC-II enhanceosome (28, 46).

Despite extensive study, many DNA-protein and protein-protein interactions, as well as the assembly of the MHC-II enhanceosome, remain unclear. Previous data suggested that the assembly of RFX requires CUS and that DNA is essential for the interaction between NFY and RFX and the formation of higher-order complexes (7, 44). Furthermore, the binding of RFX to DNA was necessary for the interaction between RFX and CIITA (12, 28). In contrast, the binding between RFXANK/B and RFXAP, which is required for the nucleation of RFX and recruitment of RFX5, can occur in the absence of DNA (34). This early step is defective in genetic complementation groups B and D of BLS (33). Importantly, the formation of a platform on DNA, rather than the complete MHC-II enhanceosome on CUS, requires direct interactions between NFY and RFX. In this scenario, NFY selects for and against the binding of RFX5 and RFX1, respectively, to S and X boxes (13, 17). We now propose that this assembly of specific complexes begins off DNA. To this end, we investigated DNA-protein and protein-protein interactions between individual proteins and complexes, combining in vitro and in vivo approaches. These studies allowed us to map the binding between subunits of NFY and RFX and between RFX5 and demonstrate that these interactions can occur off and on DNA. Furthermore, we demonstrated that RFX5, which lacks the dimerization motif of RFX1, not only forms dimers off and on DNA but that mutations that prevent this self-association and DNA binding also block the expression of MHC-II determinants in cells. Thus, functional interactions between subunits of NFY and RFX were established in vitro and in vivo.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids. Plasmid target pG5bCAT and plasmid effectors RFX1VP16 and RFX5VP16 were described previously (13, 16). Mammalian and bacterial expression vectors that contained cDNA for RFXANK/B, RFXAP, GSTRFXANK/B, and GSTRFXAP have been described elsewhere (34). Plasmids coding for NFYA, NFYB, and NFYC were a generous gift from R. Montovani. Myc epitope-tagged proteins were generated by PCR using high-fidelity TaKaRa LA Taq DNA polymerase (Pan Vera Corp., Madison, Wis.). PCR products were cloned into pCR3.1 vector and sequenced. To construct GSTRFX5, GSTNFYB, and GSTNYC, cDNA were excised from PCR3.1 and cloned in frame with glutathione S-transferase (GST) in the modified pGEX2TK vector. Mammalian expression vector for GSTRFX5 was generated by fusion of RFX5 downstream of GST in the pCDNA3GST vector. GalRFX5 and GalNFYC were generated by fusion of Myc epitope-tagged RFX5 or NFYC downstream of the Gal4 DNA-binding domain (DBD) in pSG424. Constructions with point mutations in RFX5 were generated by site-directed mutagenesis using the following primers: CTGACAATGACAAGGTTTATGTCTACGTACAGGTGCCCTCAGGACCCACCACTG for all four leucine mutations (L62-68A), CTGACAATGACAAGCTGTATCTCTACCACCAGCTCCCCTCAGGACCCACCACTG for the leucine 66 to alanine mutation (L66A), and CTGACAATGACAAGCTGTATCTCTACGTTCAGCTCCCCTCAGGACCCACCACTG for the leucine 66 to valine mutation (L66V).

Cell culture, transient transfection, chloramphenicol acetyltransferase (CAT) assay, and fluorescence-activated cell sorter (FACS) analysis. COS cells were maintained in Dulbecco's modified Eagle's medium, and B cells (Bequit, SJO) were maintained in RPMI supplemented with 10% (vol/vol) heat-inactivated fetal calf serum, 100 mM L-glutamine, and 50 mg each of penicillin and streptomycin per ml. All cells were grown in the presence of 5% (vol/vol) CO2 at 37°C.

COS cells were plated for 12 h and transfected with Lipofectamine reagent (Life Technologies, Grand Island, N.Y.) by using 0.5 µg of plasmid target and 1 µg of each plasmid effector. The total amount of DNA was held at 5 µg. Transfection efficiency was monitored as described (17). Bequit cells (107 cells) were transfected with 40 µg of total plasmid DNA by electroporation with a Bio-Rad electropulser using 280 V and 975 µF capacitance. Transfected cells were harvested 48 h later and lysed, and CAT assays were performed as described elsewhere (13). For FACS analyses, SJO cells were cotransfected by electroporation with 20 µg of plasmid effector coding for the wild-type or mutant RFX5 proteins and 5 µg of the red fluorescent protein (RFP) expression vector pDsRed1-N1 as control (Clontech, Palo Alto, Calif.). Cells were harvested 36 h after the transfection and analyzed for the expression of DR determinants (HLA-DR). Cells were stained with fluorescein isothiocyanate (FITC)-conjugated HLA-DR monoclonal antibody (Becton Dickinson, Mt. View, Calif.) and analyzed on a FACScalibur (Becton Dickinson). RFP-positive cells were selected and analyzed for HLA-DR expression on the FL3 channel. Dead cells were excluded by their strong fluorescence (light scatter) after staining with propidium iodide.

Protein extracts and Western blotting. Total protein extracts were prepared from transfected COS cells as described before (34). Sodium dodecyl sulfate (SDS)-polyacrylamide gels (10 or 12%) were loaded with an equivalent amount of protein, as determined with the Bradford assay (Bio-Rad, Hercules, Calif.). After electrophoresis, proteins were blotted to nitrocellulose (Amersham-Pharmacia, Arlington Heights, Ill.) using wet transfer. Membranes were washed and blocked with 5% blocking buffer. Membranes were incubated with specific first antibody for 4 h at 4°C. After extensive washes, membranes were incubated with the secondary antibody coupled to horseradish peroxidase for 1 h, and proteins were visualized by a chemiluminescence assay using the ECL-Plus substrate solution (NEN Life Science Products, Boston, Mass.).

In vivo pull-down assays. Twenty-four hours after the transfection, COS cells were harvested in 1 ml of lysis buffer for immunoprecipitations (1% [wt/vol] NP-40, 10 mM Tris-HCl [pH 7.4], 150 mM NaCl, 2 mM EDTA, 0.1% protease inhibitors) for 45 min at 4°C. Equivalent amounts of protein lysates were incubated with glutathione-Sepharose beads (Amersham-Pharmacia Biotech) overnight at 4°C. After extensive washing under stringent conditions (250 mM NaCl), bound proteins were revealed by Western blotting using the 9E10 monoclonal antibody directed against the Myc epitope tag (Santa Cruz Biotechnology, Santa Cruz, Calif.) and visualized with the ECL plus system (Amersham-Pharmacia Biotech).

Coupled transcription and translation reactions using RRL in vitro. RFXANK/B, RFXAP, RFX5, NFYA, NFYB, NFYC, and mutant RFX5 proteins were synthesized from the TnT T7- or T3-coupled transcription and translation reactions using rabbit reticulocyte lysate (RRL) (Promega, Madison, Wis.) in vitro according to the manufacturer's protocol. For labeled proteins the reaction was performed in the presence of excess 35S-labeled cysteine or 35S-labeled methionine (NEN Life Science Products). Translated proteins were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE).

GST pull-down assay. GST fusion proteins were produced in Escherichia coli BL21(DE3) pLysS competent cells (Novagen, Madison, Wis.). After 3 h of induction with 0.1 mM isopropyl-ß-D-thiogalactopyranoside, proteins were purified from bacterial lysates using glutathione-Sepharose beads. GST pull-down assays were carried out by incubating the same amounts of GST or GST-fusion proteins (1 µg) from E. coli and those synthesized from RRL in vitro. Proteins were allowed to bind in 500 µl of binding buffer (50 mM Tris-HCl [pH 8.0], 5% glycerol, 0.5 mM EDTA, 5 mM MgCl2, 1% bovine serum albumin, 137 mM NaCl, 1% Triton X-100, 0.5% NP-40) for 4 h at 4°C. After extensive washing in the presence of 250 to 500 mM salt, bound proteins were denatured, resolved on SDS-PAGE, and revealed by autoradiography.

EMSAs. Electrophoretic mobility shift assays (EMSAs) were performed as described previously (34).


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NFY and RFX associate in cells. To determine if NFY and RFX assemble independently of MHC-II promoters in vivo, we used a mammalian two-hybrid system. COS cells were chosen because they do not express CIITA. In these cells, the exogenous expression of CIITA results in the optimal transcription from the DRA promoter (46). Thus, other proteins that are required for the expression of MHC-II genes are not limiting in COS cells (17). The plasmid target pG5bCAT contained five binding sites for the Saccharomyces cerevisiae Gal4 protein (upstream activation sequence [UAS]) upstream of TATA and initiator (I) sequences. This minimal promoter directed the expression of the CAT reporter gene. Hybrid proteins that contained the Gal4 DBD were used as the bait. Prey proteins were hybrid proteins that contained the VP16 activation domain (AD). Any protein-protein interactions that brought this AD into the close proximity of UAS would be reflected by the activation of transcription from pG5bCAT (Fig. 1B).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 1. NFY and RFX interact in cells. (A) The interaction between NFY and RFX activates transcription from a synthetic target promoter. As indicated by + signs on the top, COS cells were cotransfected with the plasmid reporter pSG5bCAT (0.5 µg) (lanes 1 to 7) with or without 1 µg of the plasmid effector coding for the hybrid GalNFYC protein as the bait (lanes 2 to 6). Additional combinations of the following prey proteins were used: the hybrid RFX1VP16 (lane 3) and RFX5VP16 (lanes 4 and 5) proteins or NFYA (lanes 5 and 6) and NFYB (lanes 5 and 6). The GalVP16 chimera (lane 7) was used as the positive control. The total amount of DNA was held constant at 5 µg. CAT assays were performed 48 h after the transfection. Relative CAT values are represented in the bar graph. They represent the average of two experiments performed in duplicate, and the standard error of the mean is represented by error bars. The bottom panel shows the expression levels of the GalNFYC chimera as monitored by Western blotting using the anti-Myc monoclonal antibody 9E10. (B) Schematic representation of our mammalian two-hybrid system. pG5bCAT plasmid reporter contained five Gal4 DNA-binding sites (UAS) upstream of a minimal promoter containing a TATA box (T) and an initiator (I) sequence and directed the expression of the CAT reporter gene (CAT), which terminated with a poly(A) signal (pA). The GalNFYC chimera was used as the bait. The hybrid RFX5VP16 protein was used as the prey. Exogenous expression of NFYA and NFYB was under the control of a cytomegalovirus promoter. All subunits of NFY carried the Myc epitope tag.

 
COS cells were cotransfected with plasmid target and effectors, pSG5bCAT, GalNFYC, and RFX5VP16. Compared to pG5bCAT alone, the expression of the hybrid GalNFYC protein resulted in an insignificant activation of transcription (Fig. 1A, compare lanes 1 and 2). Moreover, the coexpression of the RFX1VP16 fusion protein had the same effect (Fig. 1A, lane 3). However, the coexpression of the RFX5VP16 chimera resulted in a 14-fold increase in CAT activity (Fig. 1A, compare lanes 2 and 4). The additional overexpression of NFYA and NFYB with this chimera resulted in a 22-fold increase in transcription from pG5bCAT (Fig. 1A, compare lanes 4 and 5). Importantly, no effect was observed with the coexpression of RFX1VP16, NFYA, NFYB, and GalNFYC fusion proteins (Fig. 1A, compare lanes 3 and 6). The hybrid GalVP16 protein that bound and activated transcription from pG5bCAT was used as a positive control and resulted in a 50-fold increase in CAT activity (Fig. 1A, lane 7). Thus, when tethered to DNA via the hybrid GalNFYC protein, NFY recruits RFX. We conclude that NFY and RFX interact in cells.

These data suggested that complexes between NFY and RFX form in solution. Thus, inactivating mutations in any subunit of RFX or NFY should prevent the activation of transcription in our mammalian two-hybrid system. To examine this notion, we also cotransfected Bequit cells from the complementation group B of BLS that carries the mutation in the RFXANK/B gene (27, 32). pG5bCAT, hybrid GalNFYC, and RFX5VP16 proteins were coexpressed in these cells. Indeed, no activation was observed when Bequit cells were cotransfected with pG5bCAT, GalNFYC, and RFX1VP16 or RFX5VP16 (Fig. 2, lanes 2, 3, 5, and 6). However, the addition of RFXANK/B to our plasmid target and effectors restored this activation of transcription in these cells (Fig. 2, lane 4). We conclude that RFX5 and NFYC do not interact directly but are bridged by at least one or more subunits of RFX or NFY. This subunit could be RFXANK/B.



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 2. Complementation of Bequit cell line with RFXANK/B restored transcription from pG5bCAT. As indicated by + signs on the top, Bequit cells were cotransfected by electroporation with 4 µg of pSG5bCAT and 10 µg of each plasmid effector. The total amount of DNA was constant (40 µg). CAT activity was determined as described in the legend for Fig. 1. The bottom panel shows expression levels of the GalNFYC chimera as monitored by Western blotting using the 9E10 monoclonal antibody.

 
RFX5 interacts with NFY in vivo. To characterize further subunits of NFY that interact with RFX5 in vivo, COS cells were cotransfected with plasmid effectors that directed the expression of the hybrid GSTRFX5 protein and N-terminal Myc epitope-tagged NFYA, NFYB, or NFYC proteins. Forty-eight hours later, total cell lysates were incubated with glutathione-Sepharose beads under stringent binding conditions. Bound proteins were separated on SDS-PAGE and examined by Western blotting with the anti-Myc monoclonal antibody 9E10 (8). In parallel, 10% of total cell lysates were assayed for the expression of subunits of NFY by Western blotting with 9E10 (Fig. 3, Input). In COS cells, the expression of the hybrid GSTRFX5 fusion protein alone or the coexpression of GST with NFYA, NFYB, and NFYC gave no bands with the anti-Myc antibody (Fig. 3, lanes 1 and 5). However, in cells that coexpressed the GSTRFX5 chimera and different subunits of NFY, the GSTRFX5 fusion protein was able to pull down NFYA, NFYB, and NFYC (Fig. 3, lanes 2, 3, and 4). These data indicate that RFX5 interacts with all the subunits of the NFY complex in vivo.



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 3. RFX5 interacts with NFY subunits in COS cells. As indicated by + signs on the top, the GSTRFX5 fusion protein was expressed alone (lane 1) or in combination with the Myc epitope-tagged NFYA (lane 2), NFYB (lane 3), or NFYC (lane 4) proteins. GST was also used as a control with the cocktail of NFYA, NFYB, and NFYC (lane 5). At 48 h after the transfection, total cell lysates were used for a GST pull-down assay using glutathione-Sepharose beads. Western blotting with the anti-Myc monoclonal antibody 9E10 revealed bound proteins after SDS-PAGE. Additionally, expression levels of NFYA, NFYB, and NFYC were determined from 10% of cell lysates by Western blotting with 9E10 monoclonal antibody (Input). Arrows indicate the position of different NFY proteins.

 
NFYA and NFYC bind RFXANK/B in vitro. To pinpoint the specific subunits of NFY and RFX that contact each other, we used a GST pull-down assay in vitro. GST fusion proteins were expressed in E. coli, and NFYA and NFYB were synthesized from the coupled transcription and translation system using RRL in the presence of [35S]cysteine in vitro. In vitro-translated proteins were combined with GST alone or GST fusion proteins (RFX5, RFXAP, NFYB, or NFYC). Under our conditions, no interaction could be detected between GST (Fig. 4A, lane 1), hybrid GSTRFX5 (lane 2), GSTRFXAP (lane 3), or GSTNFYB (lane 4) proteins and 35S-labeled NFYA, NFYB (lanes 1 to 4), or NFYC proteins (data not shown). However, the GSTNFYC fusion protein interacted with 35S-labeled NFYA and NFYB proteins (Fig. 4A, lane 5) and, conversely, the 35S-labeled NFYC protein interacted with the GSTNFYA and GSTNFYB fusion proteins (data not shown). Thus, although subunits of NFY bind each other they do not bind RFX5 or RFXAP in vitro.



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 4. The interaction between RFX5 and NFY subunits is mediated through other subunits of the RFX complex. (A) Neither RFX5 nor RFXAP binds subunits of NFY in a cell-free system. GST, GSTRFX5, and GSTRFXAP fusion proteins were produced in E. coli. 35S-labeled NFYA (top panel) or NFYB (bottom panel), which were produced from RRL in vitro, were combined with GST alone or with the GST fusion proteins (1 µg) and selected on glutathione-Sepharose beads. Bound proteins were resolved with SDS-PAGE and revealed by autoradiography. The + signs in the grids indicate the presence of different proteins in the assay. (B) RFXANK/B interacts with subunits of NFY in vitro. Labeled subunits of NFY produced from RRL were incubated with GST alone (lanes 1, 3, and 5) or the GSTRFXANK/B chimera (lanes 2, 4, and 6), and bound proteins were analyzed as described for panel A. The presence of NFYA (lanes 1 and 2), NFYB (lanes 3 and 4), and NFYC (lanes 5 and 6) is indicated by the + signs. (C) Ten percent of input NFYA, NFYB, and NFYC proteins were separated on SDS-PAGE and revealed by autoradiography. Arrows point to positions of different proteins.

 
To determine if RFXANK/B could mediate the interaction between NFY and RFX, we also examined its binding to subunits of NFY. GST and GSTRFXANK/B fusion proteins were combined with NFYA, NFYB, or NFYC as in Fig. 4A. Bound proteins were revealed by autoradiography. In contrast to GST, GSTRFX5, and GSTRFXAP fusion proteins, the GSTRFANK/B chimera bound NFYA (Fig. 4B, lane 2) and NFYC (lane 6). We conclude that NFY and RFX interact via RFXANK/B, NFYA, and NFYC, which was suggested by the mammalian two-hybrid data (Fig. 1 and 2) and immunoprecipitation results (Fig. 3) in vivo.

The hybrid GalRFX5 protein recruits the RFX5VP16 chimera in the mammalian two-hybrid system. The binding between NFY and RFX could also explain the constraint on the spacing between X and Y boxes, which can be moved full helical turns and still retain activity (13, 42). The more stringent constraints were observed with S and X boxes, which do not tolerate the change or subtraction of even one nucleotide (13, 43). The most likely explanation for this observation would be that RFX forms dimers or multimers. To examine this possibility, we expressed RFX5 chimeras with GalDBD and VP16AD, first individually and then in combination in our mammalian two-hybrid system. Indeed, when RFX5 was tethered to DNA (GalRFX5 fusion protein), the expression from pG5bCAT was not increased (Fig. 5A, lane 3). However, when COS cells coexpressed the hybrid GalRFX5 and RFX5VP16 proteins, they activated transcription of the plasmid target (Fig. 5A, lane 4). The hybrid RFX5VP16 protein resulted in greater than fivefold increased CAT enzymatic activity (Fig. 5A, compare lanes 1 and 4). This activation was one-half that observed with the GalNFYC and RFX5VP16 chimeras (Fig. 5A, lane 5). Since this recruitment was observed in vivo, it could have occurred via additional proteins that are expressed in COS cells or via the formation of RFX5 multimers.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 5. RFX5 associates with itself in cells. (A) As indicated by + signs on the top, COS cells were transfected with 0.5 µg of pSG5bCAT and 1 µg of each plasmid effector that expressed GalNFYC (lanes 2 and 5), GalRFX5 (lanes 3 and 4), and RFX5VP16 (lanes 4 and 5) chimeras. (B) Schematic representation of the heterologous tethering system used to assay the self-association of RFX5 in vivo. pSG5bCAT was coexpressed with RFX5 fused to the Gal4 DBD (GalRFX5) as the bait and the hybrid RFX5VP16 protein as the prey.

 
RFX5 forms dimers in vitro. To examine whether the interaction between GalRFX5 and RFX5VP16 chimeras was due to the formation of RFX5 dimers, 35S-labeled proteins, which were synthesized from RRL in vitro, were combined with GST alone or the GSTRFX5 fusion protein in the GST pull-down assay (Fig. 6). Under our binding conditions, RFXANK/B, RFXAP, and RFX5 did not bind GST alone (Fig. 6, lanes 1 and 3). In sharp contrast, RFX5 bound the hybrid GSTRFX5 protein (Fig. 6, lane 5) and so did RFXANK/B and RFXAP, which were used as the positive controls (Fig. 6, lane 2) (12). Moreover, RFX5 could associate simultaneously with RFXANK/B and RFXAP. Furthermore, RFX5 dimers occurred even when RFX5 was bound to RFXANK/B and RFXAP (Fig. 6, lane 5). We conclude that the formation of RFX5 dimers occurs independently of DNA and that this self-association does not interfere with its interaction with other subunits of RFX.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 6. Dimerization of RFX5 does not interfere with its association with other RFX subunits. 35S-labeled RFXAP (lanes 1, 2, and 5), RFXANK/B (lanes 1, 2, and 5), and RFX5 (lanes 3, 4, and 5) proteins were combined with GST alone (lanes 1 and 3) or with the hybrid GSTRFX5 protein (lanes 2, 4, and 5) in a GST pull-down assay. The + signs mark the expression of appropriate proteins. Ten percent of the input labeled proteins was included. Arrows point to the position of expressed proteins as determined by SDS-PAGE and autoradiography.

 
A point mutation in the N-terminal leucine-rich stretch prevents the formation of RFX5 dimers. Previous studies demonstrated that the C terminus of RFX5 is dispensable for the assembly of RFX (44). Furthermore, the truncation of the N-terminal 194 residues of RFX5 abolished the formation of RFX5 dimers in vitro (data not shown). Unlike other RFX family members such as RFX1, RFX5 does not contain a classical dimerization motif. Therefore, we examined the N-terminal residues for sequences that could play a role in protein-protein interactions and the formation of a dimer. Previous work had identified a leucine-rich stretch (62LYLYLQL68) which was important for the function of RFX5 and for the constitutive as well as IFN-{gamma}-inducible expression of MHC-II determinants (6). Since leucine-rich regions can play important roles in a variety of protein-protein interactions and point mutation of one leucine can lead to their loss of function (1, 30), we performed an alanine scanning mutagenesis of these leucines of RFX5. When all four leucines were mutated to alanines (L62-68A), the formation of RFX5 dimers was blocked in vitro (data not shown). Furthermore, changing just the leucine at position 66 to alanine (L66A) also blocked the formation of the RFX5 dimer (Fig. 7A, compare lanes 2 and 4). However, that same mutation did not affect the binding of RFX5 to RFXANK/B (Fig. 7B, compare lanes 2 and 4) or RFXAP (data not shown). We conclude that the change of a single residue (L66A) might have resulted in structural modification of the leucine-rich stretch, which inhibited the formation of RFX5 dimers.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 7. Point mutation in the leucine-rich stretch inhibits the formation of RFX5 dimers. (A) GST (lanes 1, 3, and 5) or the hybrid GSTRFX5 protein (lanes 2, 4, and 6) were combined with 35S-labeled RFX5 (lanes 1 and 2), mutant RFX5L66A (lanes 3 and 4), or mutant RFX5L66V (lanes 5 and 6) proteins in a GST pull-down assay. Bound proteins were then separated by SDS-PAGE and revealed by autoradiography. (B) Alanine mutations do not prevent the interaction between RFX5 and other subunits of RFX. As indicated by + signs above the gel, GST (lanes 1, 3, and 5) or the hybrid GSTRFXANK/B protein (lanes 2, 4, and 6) was combined with the 35S-labeled wild-type or mutant RFX5 proteins. Bound proteins were revealed as described in the legend for panel A. (C) Ten percent of the input of RFX5 (lane 1), mutant RFX5L66A (lane 2), and mutant RFX5L66V (lane 3) proteins were analyzed by SDS-PAGE.

 
Previous studies demonstrated that the mutation of the leucine at position 66 to histidine was responsible for the defect in IFN-{gamma} inducibility of MHC-II determinants (6). Moreover, we speculated that if the structure of the leucine-rich stretch could be preserved, the mutant RFX5 protein might behave as its wild-type counterpart. To this end the leucine at position 66 was mutated to valine (L66V) and assayed for DNA binding and the formation of RFX5 dimers. Indeed, not only did the mutant RFX5L66V protein maintain the binding to RFXANK/B (Fig. 7B, lane 6) but it also restored the formation of the RFX5 dimer in vitro (Fig. 7A, lane 6). We conclude that RFX5 forms dimers in vivo and in vitro.

RFX5 dimers are required for the assembly of RFX on MHC-II promoters. To examine the relevance of RFX5 dimers directly, we first performed EMSAs and then functional studies in cells. RFX5 and mutant RFX5 proteins were combined with RFXANK/B and RFXAP, which were synthesized from RRL in vitro. EMSAs were performed by mixing the double-stranded 32P-labeled SX oligonucleotide with different combinations of RFX proteins. The specific RFX complex was formed when all three wild-type proteins were combined with DNA (Fig. 8A, lane 1). Excess of unlabeled probe competed for the assembly of these complexes on DNA (Fig. 8A, lane 2). When the dimerization mutant RFX5L66A protein was used, no retarded complexes were observed (Fig. 8A, lanes 3 and 4). However, the mutant RFX5L66V protein restored to RFX the ability to bind DNA (Fig. 8A, lane 5). Thus, the formation of RFX5 dimers is key for the ability of RFX to bind DNA. Most likely, RFX binds DNA as a dimer or possibly a higher-order complex.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 8. RFX5 dimers are critical for the assembly of the RFX complex on the DRA promoter and activation of MHC-II transcription. (A) Wild-type subunits of RFX and mutant RFX5 proteins were produced in vitro. As indicated by the + sign on the top, EMSA was carried out by combining a DNA probe that contained S and X boxes with the wild-type RFXAP and RFXANK/B proteins and wild-type (lanes 1 and 2) or mutant RFX5 (lanes 3, 4, 5, and 6) proteins. The positions of the complex between DNA and RFX and the free probe are indicated. Equivalent amounts of the subunits of RFX were used for each assay. The sequence of the leucine-rich stretch is presented below the FACS profiles. (B) The mutant RFX5L66V protein rescues the expression of MHC-II determinants in SJO cells. The expression of DR (black histogram) and MHC-I proteins (included as a positivecontrol; white histogram) was analyzed by FACS in Raji cells (a), untransfected SJO cells (b), and SJO cells which were transfected with plasmids that directed the expression of RFX5 (c), mutant RFX5 (L62-68A) (d), mutant RFX5 (L66A) (e), and mutant RFX5 (L66V) (f) proteins. Several profiles were also gated on RFP that was coexpressed with RFX5 (g), mutant RFX5 (L66A) (h), and mutant RFX5 (L66V) (i) proteins. The gray histogram represents background staining obtained with the FITC-coupled secondary antibody.

 
RFX5 must form dimers to function in vivo. To define the functional role for the formation of RFX5 dimers, we examined the ability of our mutant RFX5 proteins to rescue the expression of MHC-II determinants on SJO cells, which bear mutations in the RFX5 gene. SJO cells were cotransfected with plasmids that directed the expression of wild-type or dimerization mutant RFX5 proteins and RFP. Transfection of RFX5 restored the expression of HLA-DR on 11% of these cells (Fig. 8B, panels c and g). The expression of mutant RFX5L62-68A and RFX5L66A proteins did not rescue the expression of MHC-II determinants in these cells (Fig. 8B, panels d, e, and h). However, the expression of mutant RFX5L66V protein rescued the expression of DR to levels comparable to those observed with the wild-type RFX5 protein (Fig. 8B, panels f and i). By gating on the RFP-positive cells, high levels of DR expression were achieved with the wild-type RFX5 and mutant RFX5L66V proteins but not with the dimerization mutant RFX5L66A protein (Fig. 8B, compare panels g, i, and h). We conclude that the formation of RFX5 dimers is not only required for the binding of RFX to DNA but the function of the MHC-II enhanceosome in cells. Most likely, higher-order complexes of RFX and NFY bind cooperatively to multiple sites on the same face of the double helix in CUS.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Using a combination of in vivo and in vitro approaches, this study demonstrated the presence of complex and nonexclusive interactions between subunits of NFY and RFX and between RFX for the binding of the platform to CUS. Importantly, NFY and RFX associated in the presence of endogenous levels of cellular proteins and in the absence of CUS. Complementation of BLS cells and structural assays in vitro demonstrated that this interaction was mediated by NFYA, NFYC, and RFXANK/B. Furthermore, RFX5 formed dimers off and on DNA. Mutagenesis of the leucine-rich stretch just N-terminal to the RFX5 DBD mapped this binding to the key leucine at position 66. The RFX5 dimer was found to be essential for the binding of RFX to CUS and for the activity of RFX in SJO cells that bear mutations in their RFX5 genes. Thus, this study suggests that higher-order complexes begin to assemble in solution and are attracted to DNA via multiple sites on the same face of the double helix. A model for these protein-protein interactions and the assembly of the transcriptional platform on MHC-II promoters is presented in Fig. 9.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 9. A model for the assembly of the transcriptional platform on MHC-II promoters. Subunits of both NFY and RFX form trimers. Next, RFX dimers form (1), and NFY and RFX begin to assemble in solution (2). Finally, the complex binds many points on the same face of the double helix (3). DNA provides another surface that strengthens these protein-protein interactions. Although the binding of the RFX dimer on S and X boxes is presented, this dimer could also bind to each S and X box, thus forming a tetramer or an even higher-order complex on CUS.

 
In a reversal of the usual progression from in vitro studies to their confirmation in vivo, we first determined key interactions in vivo. Only then could all conditions for their assembly be met, which included their cotranslation, coprocessing, posttranslational modifications, and proper subcellular localization. After associations were established in cells, we pursued them in vitro, which revealed that these proteins interact directly. Since many of the findings with NFY and RFX were confirmatory of previous work in vivo and on DNA (7, 44), we did not map these surfaces more precisely. Nevertheless, we could establish that RFXANK/B binds NFYA and NFYC at the same time as it helps to nucleate RFX. We also know that CIITA binds to yet a different surface on the outer helices of the four ankyrin repeats in RFXANK/B (33). Thus, RFXANK/B represents a master transcriptional adaptor. Because the formation of RFX5 dimers had not been reported, we mapped this surface more precisely and found a single point mutation (L66A) that abolished this self-association. Moreover, using several different assays, we confirmed the structural and functional consequences of this observation. This finding also explains mutation of leucine at position 66 to histidine, which was reported previously (6). The use of mutant cell lines from patients with BLS proved invaluable. Thus, functional roles of RFXANK/B and RFX5 could be confirmed in Bequit and SJO cells, respectively, that bear mutations in their genes. Finally, the leucine at position 66 behaved similarly to those in more conventional leucine zippers. Whereas its change to alanine destroyed any further protein-protein interaction, its more conservative substitution to valine restored the function of the wild-type protein (30).

The picture that emerges is that the MHC-II enhanceosome starts to assemble in solution. Because of our previous work with the hybrid RFX5VP16 protein, which revealed functionally important protein-protein interactions on CUS (13), we knew that CIITA did not contribute to the binding of proteins to MHC-II promoters in vivo. Additionally, in this study it did not contribute to the protein-protein associations in cells. However, the interaction between the platform and CUS plays an essential role in recruiting CIITA, i.e., DNA-bound proteins present a more favorable surface to CIITA (12, 28). Minimally, RFX dimers could cover S and X boxes (Fig. 9). Alternatively, like RFX1 (15), RFX dimers could bind each palindromic S and X box, which would suggest the formation of RFX tetramers. Alternatively, RFX5 dimers could nucleate one RFX complex, or RFX5 multimers could assemble multiple RFX complexes on S and X boxes. Although our studies do not permit the delineation of the exact stoichiometry of RFX5 in the MHC-II enhanceosome, this multiplicity of RFX complexes suggests that more than one CIITA molecule could be recruited to each MHC-II promoter. Indeed, recent studies suggest that CIITA exists minimally as a dimer in cells (20, 23, 37)

This model also addresses two conundra of MHC-II transcription. The first deals with the constraints on the spacing between CUS, with SX being most invariant and XY tolerating changes of full helical turns (13, 42, 43). Since RFX dimers or higher-order complexes are required for binding DNA and this dimerization interface is found immediately adjacent to the DBD in RFX5 (15, 44), these DNA-protein and protein-protein interactions should be invariant. Since RFXANK/B does not have its own DBD and must protrude into solution to bind CIITA (12, 33), the interaction between NFY and RFX could be more flexible, thus allowing for changes of helical turns between X and Y boxes (13, 42). The second conundrum revolves around the observations that MHC-II promoters are not occupied in cells which contain intact NFY but are missing subunits of RFX (19). In other systems, NFY binds DNA tightly and recruits histone acetyltransferases that remodel chromatin (10, 22). Thus, MHC-II promoters should be occupied. However, if the complex between NFY and RFX has to undergo some prior assembly to bind CUS, then bare promoters could be explained.

In sum, our findings suggest that dedicated transcriptional regulatory complexes could begin to assemble in cells, similarly to the RNA polymerase II holoenzyme, different general transcription complexes, such as TFIID, TFIIH, multiple chromatin remodeling complexes, etc. (21). In that case, how does NFY perform its functions on several hundred other promoters that do not contain S and X boxes if it is already committed to RFX? The answer would have to be that there are many loosely assembled complexes that contain NFY, each one subserving a different function. In this scenario, the complex between NFY and RFX targets MHC-II promoters and DNA binding strengthens these interactions (44). Others might target liver-specific genes (29), cartilage (11), etc. This assembly model would also facilitate the conversion between different transcriptional programs. Since the disassociation from DNA would not be required, these complexes could rearrange more rapidly and efficiently in response to extra- or intracellular cues. Then, these new transcriptional programs would depend on amounts of individual subunits and their posttranslational processing. In this scenario, other elements, such as locus control regions, matrix attachment sites, transcriptional enhancers, etc., could direct more easily the structure and function of their targeted promoters.


    ACKNOWLEDGMENTS
 
We thank members of the laboratory for expert secretarial assistance, help with experiments, and critical comments on the manuscript.

This work was supported by the Nora Eccles Treadwell Foundation and the Breast Cancer California Program (BCRP 6KB-0116).


    FOOTNOTES
 
* Corresponding author. Mailing address: N215, UCSF Mt. Zion Cancer Center, 2340 Sutter St., San Francisco, CA 94115-0703. Phone: (415) 502-1902. Fax: (415) 502-1901. E-mail: matija{at}itsa.ucsf.edu. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Alberti, S., S. Oehler, B. von Wilcken-Bergmann, H. Kramer, and B. Muller-Hill. 1991. Dimer-to-tetramer assembly of Lac repressor involves a leucine heptad repeat. New Biol. 3:57-62.[Medline]

2. Bellorini, M., J. C. Dantonel, J. B. Yoon, R. G. Roeder, L. Tora, and R. Mantovani. 1996. The major histocompatibility complex class II Ea promoter requires TFIID binding to an initiator sequence. Mol. Cell. Biol. 16:503-512.[Abstract]

3. Boss, J. M. 1999. A common set of factors control the expression of the MHC class II, invariant chain, and HLA-DM genes. Microbes Infect. 1:847-853.[CrossRef][Medline]

4. Boss, J. M., and J. L. Strominger. 1986. Regulation of a transfected human class II major histocompatibility complex gene in human fibroblasts. Proc. Natl. Acad. Sci. USA 83:9139-9143.[Abstract/Free Full Text]

5. Bottazzo, G. F., R. Pujol-Borrell, T. Hanafusa, and M. Feldmann. 1983. Role of aberrant HLA-DR expression and antigen presentation in induction of endocrine autoimmunity. Lancet ii:1115-1119.

6. Brickey, W. J., K. L. Wright, X. S. Zhu, and J. P. Ting. 1999. Analysis of the defect in IFN-gamma induction of MHC class II genes in G1B cells: identification of a novel and functionally critical leucine-rich motif (62-LYLYLQL-68) in the regulatory factor X 5 transcription factor. J. Immunol. 163:6622-6630.[Abstract/Free Full Text]

7. Caretti, G., F. Cocchiarella, C. Sidoli, J. Villard, M. Peretti, W. Reith, and R. Mantovani. 2000. Dissection of functional NF-Y-RFX cooperative interactions on the MHC class II Ea promoter. J. Mol. Biol. 302:539-552.[CrossRef][Medline]

8. Chan, S., H. Gabra, F. Hill, G. Evan, and K. Sikora. 1987. A novel tumour marker related to the c-myc oncogene product. Mol. Cell Probes 1:73-82.[CrossRef][Medline]

9. Cresswell, P. 1994. Assembly, transport, and function of MHC class II molecules. Annu. Rev. Immunol. 12:259-293.[CrossRef][Medline]

10. Currie, R. A. 1998. NF-Y is associated with the histone acetyltransferases GCN5 and P/CAF. J. Biol. Chem. 273:1430-1434.[Abstract/Free Full Text]

11. de Crombrugghe, B., V. Lefebvre, R. R. Behringer, W. Bi, S. Murakami, and W. Huang. 2000. Transcriptional mechanisms of chondrocyte differentiation. Matrix Biol. 19:389-394.[CrossRef][Medline]

12. DeSandro, A. M., U. M. Nagarajan, and J. M. Boss. 2000. Associations and interactions between bare lymphocyte syndrome factors. Mol. Cell. Biol. 20:6587-6599.[Abstract/Free Full Text]

13. Fontes, J. D., N. Jabrane-Ferrat, and B. M. Peterlin. 1997. Assembly of functional regulatory complexes on MHC class II promoters in vivo. J. Mol. Biol. 270:336-345.[CrossRef][Medline]

14. Fontes, J. D., S. Kanazawa, N. Nekrep, and B. M. Peterlin. 1999. The class II transactivator CIITA is a transcriptional integrator. Microbes Infect. 1:863-869.[CrossRef][Medline]

15. Gajiwala, K. S., H. Chen, F. Cornille, B. P. Roques, W. Reith, B. Mach, and S. K. Burley. 2000. Structure of the winged-helix protein hRFX1 reveals a new mode of DNA binding. Nature 403:916-921.[CrossRef][Medline]

16. Ghosh, S., M. J. Selby, and B. M. Peterlin. 1993. Synergism between Tat and VP16 in trans-activation of HIV-1 LTR. J. Mol. Biol. 234:610-619.[CrossRef][Medline]

17. Jabrane-Ferrat, N., J. D. Fontes, J. M. Boss, and B. M. Peterlin. 1996. Complex architecture of major histocompatibility complex class II promoters: reiterated motifs and conserved protein-protein interactions. Mol. Cell. Biol. 16:4683-4690.[Abstract]

18. Kanazawa, S., T. Okamoto, and B. M. Peterlin. 2000. Tat competes with CIITA for the binding to P-TEFb and blocks the expression of MHC class II genes in HIV infection. Immunity 12:61-70.[CrossRef][Medline]

19. Kara, C. J., and L. H. Glimcher. 1991. In vivo footprinting of MHC class II genes: bare promoters in the bare lymphocyte syndrome. Science 252:709-712.[Abstract/Free Full Text]

20. Kretsovali, A., C. Spilianakis, A. Dimakopoulos, T. Makatounakis, and J. Papamatheakis. 2001. Self-association of class II transactivator correlates with its intracellular localization and transactivation. J. Biol. Chem. 276:32191-32197.[Abstract/Free Full Text]

21. Lemon, B., and R. Tjian. 2000. Orchestrated response: a symphony of transcription factors for gene control. Genes Dev. 14:2551-2569.[Free Full Text]

22. Li, Q., M. Herrler, N. Landsberger, N. Kaludov, V. V. Ogryzko, Y. Nakatani, and A. P. Wolffe. 1998. Xenopus NF-Y pre-sets chromatin to potentiate p300 and acetylation-responsive transcription from the Xenopus hsp70 promoter in vivo. EMBO J. 17:6300-6315.[CrossRef][Medline]

23. Linhoff, M. W., J. A. Harton, D. E. Cressman, B. K. Martin, and J. P. Ting. 2001. Two distinct domains within CIITA mediate self-association: involvement of the GTP-binding and leucine-rich repeat domains. Mol. Cell. Biol. 21:3001-3011.[Abstract/Free Full Text]

24. Linhoff, M. W., K. L. Wright, and J. P. Ting. 1997. CCAAT-binding factor NF-Y and RFX are required for in vivo assembly of a nucleoprotein complex that spans 250 base pairs: the invariant chain promoter as a model. Mol. Cell. Biol. 17:4589-4596.[Abstract]

25. Mantovani, R. 1999. The molecular biology of the CCAAT-binding factor NF-Y. Gene 239:15-27.[CrossRef][Medline]

26. Mantovani, R., L. Tora, V. Moncollin, J. M. Egly, C. Benoist, and D. Mathis. 1993. The major histocompatibility complex (MHC) Ea promoter: sequences and factors at the initiation site. Nucleic Acids Res. 21:4873-4878.[Abstract/Free Full Text]

27. Masternak, K., E. Barras, M. Zufferey, B. Conrad, G. Corthals, R. Aebersold, J. C. Sanchez, D. F. Hochstrasser, B. Mach, and W. Reith. 1998. A gene encoding a novel RFX-associated transactivator is mutated in the majority of MHC class II deficiency patients. Nat. Genet. 20:273-277.[CrossRef][Medline]

28. Masternak, K., A. Muhlethaler-Mottet, J. Villard, M. Zufferey, V. Steimle, and W. Reith. 2000. CIITA is a transcriptional coactivator that is recruited to MHC class II promoters by multiple synergistic interactions with an enhanceosome complex. Genes Dev. 14:1156-1166.[Abstract/Free Full Text]

29. Milos, P. M., and K. S. Zaret. 1992. A ubiquitous factor is required for C/EBP-related proteins to form stable transcription complexes on an albumin promoter segment in vitro. Genes Dev. 6:991-1004.[Abstract/Free Full Text]

30. Moitra, J., L. Szilak, D. Krylov, and C. Vinson. 1997. Leucine is the most stabilizing aliphatic amino acid in the D position of a dimeric leucine zipper coiled coil. Biochemistry 36:12567-12573.[CrossRef][Medline]

31. Moreno, C. S., G. W. Beresford, P. Louis-Plence, A. C. Morris, and J. M. Boss. 1999. CREB regulates MHC class II expression in a CIITA-dependent manner. Immunity 10:143-151.[CrossRef][Medline]

32. Nagarajan, U. M., P. Louis-Plence, A. DeSandro, R. Nilsen, A. Bushey, and J. M. Boss. 1999. RFX-B is the gene responsible for the most common cause of the bare lymphocyte syndrome, an MHC class II immunodeficiency. Immunity 10:153-162.[CrossRef][Medline]

33. Nekrep, N., M. Geyer, N. Jabrane-Ferrat, and B. M. Peterlin. 2001. Analysis of ankyrin repeats reveals how a single point mutation in RFXANK results in bare lymphocyte syndrome. Mol. Cell. Biol. 21:5566-5576.[Abstract/Free Full Text]

34. Nekrep, N., N. Jabrane-Ferrat, and B. M. Peterlin. 2000. Mutations in the bare lymphocyte syndrome define critical steps in the assembly of the regulatory factor X complex. Mol. Cell. Biol. 20:4455-4461.[Abstract/Free Full Text]

35. Reith, W., and B. Mach. 2001. The bare lymphocyte syndrome and the regulation of MHC expression. Annu. Rev. Immunol. 19:331-373.[CrossRef][Medline]

36. Setterblad, N., B. M. Peterlin, and G. Andersson. 1997. Role of the X2 box in activated transcription from the DRA promoter in B cells. Immunogenetics 46:318-325.[CrossRef][Medline]

37. Sisk, T. J., S. Roys, and C. H. Chang. 2001. Self-association of CIITA and its transactivation potential. Mol. Cell. Biol. 21:4919-4928.[Abstract/Free Full Text]

38. Steimle, V., L. A. Otten, M. Zufferey, and B. Mach. 1993. Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome). Cell 75:135-146.[CrossRef][Medline]

39. Ting, J. P., and X. S. Zhu. 1999. Class II MHC genes: a model gene regulatory system with great biologic consequences. Microbes Infect. 1:855-861.[Medline]

40. Tsang, S. Y., M. Nakanishi, and B. M. Peterlin. 1988. B-cell-specific and interferon-gamma-inducible regulation of the HLA-DR alpha gene. Proc. Natl. Acad. Sci. USA 85:8598-8602.[Abstract/Free Full Text]

41. Tsang, S. Y., M. Nakanishi, and B. M. Peterlin. 1990. Mutational analysis of the DRA promoter: cis-acting sequences and trans-acting factors. Mol. Cell. Biol. 10:711-719.[Abstract/Free Full Text]

42. Vilen, B. J., J. P. Cogswell, and J. P. Ting. 1991. Stereospecific alignment of the X and Y elements is required for major histocompatibility complex class II DRA promoter function. Mol. Cell. Biol. 11:2406-2415.[Abstract/Free Full Text]

43. Vilen, B. J., J. F. Penta, and J. P. Ting. 1992. Structural constraints within a trimeric transcriptional regulatory region. Constitutive and interferon-gamma-inducible expression of the HLA-DRA gene. J. Biol. Chem. 267:23728-23734.[Abstract/Free Full Text]

44. Villard, J., M. Peretti, K. Masternak, E. Barras, G. Caretti, R. Mantovani, and W. Reith. 2000. A functionally essential domain of RFX5 mediates activation of major histocompatibility complex class II promoters by promoting cooperative binding between, RFX, and NF-Y. Mol. Cell. Biol. 20:3364-3376.[Abstract/Free Full Text]

45. Viret, C., and C. A. Janeway, Jr. 1999. MHC and T cell development. Rev. Immunogenet. 1:91-104.[Medline]

46. Zhu, X. S., M. W. Linhoff, G. Li, K. C. Chin, S. N. Maity, and J. P. Ting. 2000. Transcriptional scaffold: CIITA interacts with NF-Y, RFX, and CREB to cause stereospecific regulation of the class II major histocompatibility complex promoter. Mol. Cell. Biol. 20:6051-6061.[Abstract/Free Full Text]


Molecular and Cellular Biology, August 2002, p. 5616-5625, Vol. 22, No. 15
0270-7306/02/$04.00+0     DOI: 10.1128/MCB.22.15.5616-5625.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jabrane-Ferrat, N.
Right arrow Articles by Peterlin, B. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jabrane-Ferrat, N.
Right arrow Articles by Peterlin, B. M.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals