Role of the p68 Subunit of Human DNA Polymerase {alpha}-Primase in Simian Virus 40 DNA Replication

DNA polymerase ${alpha}$ -primase (pol-prim) is a heterotetramer withDNA polymerase and primase activities. The polymerase (p180)and primase (p48 and p58) subunits synthesize primers and extendthem, but the function of the remaining subunit (p68) is poorlyunderstood. Genetic studies in yeast suggested an essentialrole for the p68 ortholog in early S phase prior to the hydroxyurea-sensitivestep, possibly a regulatory role in initiation of DNA replication,but found no evidence for an essential function of p68 laterin S phase. To investigate whether the human p68 subunit hasan essential role in DNA replication, we examined the abilityof a purified trimeric human pol-prim lacking p68 to initiatesimian virus 40 DNA replication in vitro and to synthesize andelongate primers on single-stranded DNA in the presence of Tantigen and replication protein A (RPA). Both activities oftrimeric pol-prim were defective, but activity was recoveredupon addition of separately purified p68. Phosphorylation ofp68 by cyclin A-dependent protein kinase also inhibited bothactivities of pol-prim. The data strongly suggest that the p68subunit is required for priming activity of pol-prim in thepresence of RPA and T antigen, both during initiation at theorigin and during lagging strand replication.

INTRODUCTION

Top

Introduction

The recruitment of DNA polymerase ${alpha}$ -primase (pol-prim) is a keyevent in the assembly of functional replication complexes ineukaryotic cells. pol-prim initiates DNA replication by synthesizingshort RNA primers on the leading and lagging strand templatesand then elongating them into hybrid primers of about 35 nucleotides(3, 21, 25, 56, 62, 65). pol-prim is composed of four subunitsthat appear to be conserved in all eukaryotes. The human pol-primsubunits are named according to their apparent molecular weights:p180, p68, p58, and p48. The largest subunit contains the polymeraseactivity, and the smallest subunit contains the primase activity.Interactions of p68 with p180 and of p58 with p48 facilitateexpression and nuclear import of the catalytic subunits (41,42). In addition, the p58 subunit physically links p48 to p180and regulates the length of primers synthesized by the primase(3, 4, 7, 10).

The role of pol-prim in initiation of mammalian DNA replicationhas been investigated in the cell-free simian virus 40 (SV40)DNA replication system. In this model system, synthesis of RNAprimers at the viral origin of replication requires only SV40T antigen, the single-stranded DNA binding protein replicationprotein A (RPA), pol-prim, and topoisomerase I (23, 62). T antigenassembles on the viral origin, unwinds the parental DNA, andrecruits the required cellular proteins to the replication fork.The single-stranded DNA (ssDNA) generated by T antigen is sequesteredby RPA, and pol-prim synthesizes the first primers on the leadingand lagging strand templates. Subsequently, pol-prim is displacedfrom the primer-template by the clamp-loader replication factorC (RFC), the PCNA sliding clamp, and DNA polymerase ${delta}$ , whichextends the primers of both the leading and lagging strands(62, 69). Several lines of evidence suggest that T antigen interactsspecifically with pol-prim, constituting a simple primosome,and that these interactions are critical in the recruitmentand activity of pol-prim on ssDNA in the presence of RPA. Tantigen stimulates the primase and polymerase activities ofpol-prim through its physical association with all four subunitsof pol-prim (8, 9, 12-14, 24, 66). The primase activity of pol-primis markedly inhibited on RPA-saturated ssDNA, and T antigenrelieves this inhibition (9, 37). Antibodies against T antigenthat block its interactions with either RPA or pol-prim disruptits ability to facilitate priming in the presence of RPA (66,67). However, the precise requirements for activity of thissimple primosome, in particular whether p68 is required, remainpoorly understood.

In Saccharomyces cerevisiae, the p68 ortholog, known as p86or the B subunit, is required for cell viability and executesan essential function in early S phase prior to the hydroxyurea-sensitivestep, suggesting a possible role in initiation of DNA replication(19). However, no essential function of the B subunit was detectedlater in S phase (19). The B subunit was also dispensable forin vitro reconstitution of an enzymatically active complex ofthe other three subunits (7), suggesting that it may performa regulatory function in initiation of replication. Consistentwith this idea, the B/p68 subunit is phosphorylated in a cellcycle-dependent manner in both yeast and human cells (18, 20,49, 60). Hypophosphorylated pol-prim isolated from human cellsat G₁/S supports efficient initiation of SV40 DNA replicationin vitro, but hyperphosphorylated pol-prim from G₂/M cells hasminimal activity (60). Phosphorylation of p68 by cyclin A/cdk2or cdk1 in vitro targets the same sites that are phosphorylatedin vivo in G₂/M and inhibits pol-prim activity in initiationof SV40 replication (60). However, the mechanism through whichp68 phosphorylation regulates SV40 DNA replication remains unclear.

In this study, a trimeric form of human DNA pol-prim lackingp68 was used to investigate the possible functions of p68 inDNA replication using the SV40 model system. The trimer exhibitedenzymatic activity in several simple assays in the absence ofother replication proteins. However, the trimer was defectivein initiation of SV40 DNA replication, as well as in primingand elongation on RPA-coated ssDNA. Addition of separately purifiedp68 restored activity in both of these assays, indicating thatp68 is required for primosome activity in the presence of RPA.Several speculative models for the function of p68 during viraland chromosomal DNA replication are discussed.

MATERIALS AND METHODS

Top

Materials and Methods

Purification of recombinant human DNA pol-prim. The pol-prim tetramer was purified by immunoaffinity chromatographyfrom extracts of Hi-5 insect cells multiply infected with recombinantbaculoviruses essentially as described elsewhere (61). The trimericform of pol-prim was purified by the same protocol, except thatthe p68 baculovirus was omitted from the infection and the trimericpol-prim bound to the monoclonal antibody affinity column waswashed with 50 volumes of buffer B rather than 20 volumes asdescribed for purification of the tetramer (61). The typicalpolymerase specific activity of the pol-prim tetramer was 3.2U/µg and that of the trimer was 1.5 U/µg, with aunit (U) defined as incorporation of 1 nmol of nucleotide perh on a poly(dA)-oligo(dT) template (see below). The typicalprimase specific activity of the pol-prim tetramer was 20 U/µgand that of the trimer was 10 U/µg, with a unit definedas incorporation of 1 fmol of nucleotide per h on unprimed M13DNA. The usual yields were 3 mg of tetramer and 1.5 mg of trimerfrom 5 x 10⁸ Hi-5 cells.

Recombinant human pol-prim prephosphorylated with purified cyclinA/cdk2 was prepared as described previously (60). Mock-phosphorylatedpol-prim was prepared using exactly the same protocol, exceptthat cyclin A/cdk2 was omitted from the prephosphorylation reaction(60).

Purification of other proteins. The baculovirus-expressed histidine (his)-tagged p68 subunitof human pol-prim was purified by nickel affinity chromatographyfrom extracts of Hi-5 insect cells infected with a recombinantbaculovirus as described previously (51). For bacterial expression,cDNAs encoding p68, p68 residues 1 to 240, and p68 residues241to 598 (8) were cloned into pET28a (Novagen, Madison, Wis.).The his-tagged p68 polypeptides were expressed in Escherichiacoli BL21(DE3) and purified by Ni-nitrilotriacetic acid affinitychromatography (51). SV40 T antigen was purified by immunoaffinitychromatography from extracts of Hi-5 insect cells infected witha recombinant baculovirus exactly as described previously (51).Bacterially expressed recombinant human RPA (22), E. coli ssDNAbinding protein (SSB) (28), and calf thymus topoisomerase I(43) were purified as described elsewhere.

Nuclease detection assay. Increasing amounts of purified pol-prim (50 to 500 ng) wereincubated with 5 pmol of 5'-³²P-end-labeled oligodeoxyribonucleotide(5'CAGGGCCCGGGCCAAGCACAGAATGCTTGTGTTCTCGCCGGTTC) in 30 mM HEPES(pH 7.9), 7 mM magnesium acetate, 1 mM dithiothreitol (DTT),4 mM ATP, 40 mM creatine phosphate, and 0.04 mg of creatinekinase/ml for 1 h at 37°C. Reaction products were adjustedto 0.05% (wt/vol) bromophenol blue, 0.05% (wt/vol) xylene cyanol,and 2.5% (wt/vol) Ficoll 400, and loaded on 8.0% polyacrylamidegels. Radiolabeled DNA fragments were resolved by electrophoresisin 45 mM Tris, 45 mM boric acid, 1 mM EDTA for 1.5 h at 100V. The gel was dried and the radiolabeled DNA was detected byautoradiography. The results of this analysis revealed no evidenceof nuclease contamination (data not shown).

DNA polymerase activity assay. The polymerase activities of the trimer and tetramer were testedon a randomly primed poly(dA)-oligo(dT) (20:1) template (AmershamBiosciences, Piscataway, N.J.). Reaction mixtures (20 µl)were assembled on ice and contained 0.5 µg of DNA in reactionbuffer (50 mM bis-Tris-HCl [pH 6.5], 1 mM DTT, 10 mM KCl, 7mM MgCl₂, 0.2 mg of bovine serum albumin/ml, 0.02 mM dTTP),0.1 µCi of [ ${alpha}$ -³²P]dTTP (3,000 Ci/mmol) (Amersham Biosciences),and pol-prim as indicated in the figure legends. After incubationfor 10 min at 37°C, reaction products were precipitatedwith cold 10% (vol/vol) trichloroacetic acid (TCA) and spottedon glass fiber filters (GF/C; Whatman, Clifton, N.J.). The filterswere washed five times with wash buffer (120 mM Na₂H₂P₂O₇, 1.2M HCl) and once with 100% ethanol and dried at room temperature.Radioactivity was analyzed by scintillation counting.

DNA primase activity assay. The primase activities of the pol-prim trimer and tetramer weretested on single-stranded M13 DNA. Primase reaction mixtures(20 µl) contained 50 to 500 ng of pol-prim, 100 ng ofM13 DNA in reaction buffer (30 mM HEPES-KOH [pH 7.9], 1 mM DTT,7 mM magnesium acetate, 4 mM ATP, 0.2 mM UTP, 0.2 mM GTP, 0.01mM CTP), and 20 µCi of [ ${alpha}$ -³²P]CTP (3,000 Ci/mmol; DupontNEN, Boston, Mass.). Reactions were assembled on ice and incubatedat 37°C for 90 min. Reaction products were precipitatedwith 2% NaClO₄ in acetone, washed with acetone, and dried. Theproducts were dissolved in formamide loading buffer (45% [vol/vol]formamide, 5 mM EDTA, 0.08% [wt/vol] xylene cyanol, 0.08% [wt/vol]bromophenol blue) at 65°C for 10 min and resolved by denaturing20% polyacrylamide gel electrophoresis (PAGE) for 4 to 5 h at500 V. The reaction products were visualized by autoradiography.

Stimulation of priming and elongation by T antigen. Reaction mixtures (20 µl) contained 25 ng of single-strandedM13 DNA, 30 ng of pol-prim tetramer or 60 ng of trimer, and250 ng of T antigen in elongation buffer (30 mM HEPES-KOH [pH7.9], 7 mM magnesium acetate, 0.01 mM ZnCl₂, 1 mM DTT, 4 mMATP, 0.2 mM GTP, 0.2 mM UTP, 0.2 mM CTP, 0.02 mM dATP, 0.1 MdGTP, 0.1 mM dTTP, 0.1 mM dCTP, 40 mM creatine phosphate, 0.04mg of creatine kinase/ml) supplemented with 3 µCi of [ ${alpha}$ -³²P]dATP(3,000 Ci/mmol) (Amersham Biosciences). Reaction mixtures wereincubated at 37°C for 45 min and then digested with 0.1mg of proteinase K/ml in the presence of 1% sodium dodecyl sulfate(SDS) and 1 mM EDTA for 30 min at 37°C. Reaction productswere purified over Sephadex G-50 columns (Boehringer Mannheim,Indianapolis, Ind.) and then precipitated with 2% NaClO₄ inacetone. The products were washed, dried, resuspended in alkalineloading buffer (60 mM NaOH, 2 mM EDTA [pH 8.0], 20% [wt/vol]Ficoll, 0.10% [wt/vol] bromophenol blue, 0.10% [wt/vol] xylenecyanol), and electrophoresed on 1.5% agarose gels in runningbuffer (30 mM NaOH, 1 mM EDTA) for 2 h at 50 V. The gels werefixed in 10% TCA and dried. The reaction products were visualizedby autoradiography. A sample of the radiolabeled products fromeach reaction was acid precipitated and analyzed by scintillationcounting.

Singly primed M13 DNA elongation reactions. Reaction mixtures (20 µl) contained 25 ng of singly primedM13 DNA and 25 to 250 ng of pol-prim in reaction buffer (30mM HEPES-KOH [pH 7.9], 7 mM magnesium acetate, 1 mM DTT, 0.02mM dATP, 0.10 mM dGTP, 0.10 mM dTTP, 0.10 mM dCTP, 40 mM creatinephosphate, and 0.04 mg of creatine kinase/ml) supplemented with3 µCi of [ ${alpha}$ -³²P]dATP (3,000 Ci/mmol) (Amersham Biosciences).Reaction mixtures were incubated at 37°C for 90 min andthen digested with 0.1 mg of proteinase K/ml in the presenceof 1% SDS and 1 mM EDTA for 30 min at 37°C. RadiolabeledDNA was purified over Sephadex G-50 columns (Boehringer Mannheim)and then precipitated with 2% NaClO₄ in acetone. The productswere washed, dried, resuspended in alkaline loading buffer (seeabove), and electrophoresed on 1.5% agarose gels in runningbuffer (30 mM NaOH, 1 mM EDTA) for 2 h at 50 V. The reactionproducts were visualized by autoradiography. In addition, asample of the radiolabeled products from each reaction was acidprecipitated and analyzed by scintillation counting.

Initiation of SV40 DNA replication assay. Initiation reactions were carried out with purified T antigen,RPA, topoisomerase I, and 50 to 400 ng of pol-prim in the presenceof radiolabeled ribonucleotides exactly as described elsewhere(51).

Assay for SV40 initiation coupled with elongation. Monopolymerase (17, 36, 48) reaction mixtures (20 µl)were identical to SV40 initiation reaction mixtures except thatthe amounts of RPA and T antigen were increased to 1,000 ngand 1,200 ng, respectively, and 0.02 mM dATP, 0.10 mM dGTP,0.10 mM dTTP, 0.10 mM dCTP, and 3 µCi of [ ${alpha}$ -³²P]dATP (3,000Ci/mmol; Amersham Biosciences) were present. Reaction mixtureswere assembled on ice, incubated at 37°C for 90 min, andthen digested with 0.1 mg of proteinase K/ml in the presenceof 1% SDS and 1 mM EDTA for 30 min at 37°C. Radiolabeledreaction products were purified over Sephadex G-50 columns (BoehringerMannheim) and then precipitated with 2% NaClO₄ in acetone. Theproducts were washed, dried, resuspended in alkaline loadingbuffer, and electrophoresed on 1.5% agarose gels in runningbuffer (30 mM NaOH, 1 mM EDTA) for 2 h at 50 V. The gels werefixed in 10% TCA and dried. The reaction products were visualizedby autoradiography. A sample of the radiolabeled products fromeach reaction was acid precipitated and analyzed by scintillationcounting.

Primer synthesis and elongation in the presence of RPA. Reaction mixtures (20 µl) containing 25 ng of single-strandedM13 DNA were assembled at 4°C and preincubated with 250to 1,250 ng of RPA in elongation buffer (see above) at 4°Cfor 20 min. The reactions were then supplemented with 3 µCiof [ ${alpha}$ -³²P]dATP (3,000 Ci/mmol) (Amersham Biosciences), 450 ngof pol-prim tetramer or 900 ng of trimer, and 300 to 600 ngof T antigen as indicated in the figure legends, incubated at37°C for 45 min, and then digested with 0.1 mg of proteinaseK/ml in the presence of 1% SDS and 1 mM EDTA for 30 min at 37°C.Radiolabeled reaction products were processed and analyzed asdescribed above for the SV40 monopolymerase assay.

Immunoblotting. Immunoblotting with monoclonal antibodies 1CT102 and 2CT25,specific for the p180 subunit of pol-prim, and 9D5, specificfor the p68 subunit, was performed as described previously (12,60).

RESULTS

Top

Results

Trimeric human DNA pol-prim lacking the p68 subunit has polymerase and primase activity and is stimulated by T antigen. Tetrameric and trimeric complexes of human pol-prim were expressedin insect cells by using recombinant baculoviruses and purifiedby immunoaffinity chromatography. The purification protocolreproducibly yielded about half as much trimer as tetramer.The purity and integrity of representative preparations of tetramerand trimer are shown in Fig. 1A (lanes 1 and 2). The tetramerdisplayed the expected four subunits: p180 and small amountsof its proteolytic products, p68, p58, and p48 (lane 1). Thetrimer lacked the p68 subunit, as expected (lane 2). A histidine-taggedhuman p68 subunit was separately expressed in insect cells andpurified by nickel affinity chromatography (Fig. 1A, lane 3).The compositions of the tetramer and trimer were confirmed byimmunoblotting with two monoclonal antibodies specific for thep180 subunit (Fig. 1B, lanes 1, 2, 5, and 6) and a monoclonalantibody specific for the p68 subunit (Fig. 1B, lanes 3 to 6).Trace bands observed at about 60 kDa in p68 preparations (Fig.1A, lane 3) and the trimer preparation (Fig. 1A, lane 2) werenot stained by the monoclonal antibodies (Fig. 1B, lane 4; datanot shown). Thus, the recombinant human pol-prim trimer appearedto be devoid of p68.

View larger version (34K):
[in this window]
[in a new window]
FIG. 1. Purification of tetrameric and trimeric complexes of pol-prim and the p68 subunit. Purified preparations of the pol-prim tetramer, trimer, and p68-his were analyzed by SDS-PAGE and Coomassie blue staining (A), or by immunoblotting (B) with two p180-specific antibodies (left panel), a p68-specific antibody (center panel), or a mixture of all three antibodies (right panel). The positions of marker proteins of known size are indicated at the right in kilodaltons.

The polymerase and primase activities of the two pol-prim preparationswere initially characterized in a series of simple enzyme assays.To test the polymerase activity, equimolar amounts of the tetramerand trimer were incubated with a poly(dA)-oligo(dT) template-primerand radiolabeled dTTP. The resulting radiolabeled DNA was precipitated,washed, and quantitated by scintillation counting. The trimerexhibited polymerase activity, but its specific activity wasabout half that of the tetramer in this assay (Fig. 2A). Toassay the primase activity, equimolar amounts of the tetramerand trimer were incubated with single-stranded M13 DNA and ribonucleosidetriphosphates, of which one was radiolabeled. The radiolabeledprimers were separated by denaturing PAGE and visualized byautoradiography. The tetramer synthesized primers of predominantly7 to 10 nucleotides in length, and smaller amounts of primersof twice that length (Fig. 2B, lanes 1 to 6). The trimer producedprimers of 7 to 10 nucleotides, as well as shorter primers (Fig.2B, lanes 7 to 12). However, the specific primase activity ofthe trimer was about half that of the tetramer. A control reactionlacking pol-prim generated no product (Fig. 2B, lane 13). Theseresults show that the trimer possesses both polymerase and primaseactivity, albeit with about half the specific activity of thetetramer.

View larger version (58K):
[in this window]
[in a new window]
FIG. 2. Biochemical characterization of tetrameric and trimeric complexes of pol-prim. (A) The DNA polymerase activities of equimolar amounts of the tetramer and trimer were tested on poly(dA)-oligo(dT) template-primer. (B) Primase activities of equimolar amounts (0.15, 0.3, 0.6, 0.9, 1.2, and 1.5 pmol) of the pol-prim tetramer (lanes 1 to 6) and trimer (lanes 7 to 12) were assayed on single-stranded M13 DNA template. Primers synthesized by pol-prim were visualized by denaturing electrophoresis and autoradiography. A control reaction containing no enzyme (-E) is shown in lane 13. End-labeled oligonucleotide markers (M) of the indicated lengths are shown in lanes 14 and 15. (C) Elongation of singly primed M13 DNA by 0.8, 1.6, 2.4, and 3.2 polymerase units of the pol-prim tetramer (lanes 1 to 4) or trimer (lanes 5 to 8 and 9 to 12) was assayed. A fivefold molar excess of purified p68 was added to the trimer in lanes 9 to 12. Radiolabeled elongation products were detected by alkaline agarose electrophoresis and autoradiography. Products made in the presence of p68 alone (lane 13) or in the absence of pol-prim (lane 14) are shown as controls. The radioactivity (counts per minute [cpm]) incorporated in each reaction is shown below each lane. (D) pol-prim tetramer (striped) and trimer (hatched) of equal primase activity (0.3 or 0.6 U, as indicated) were assayed for activity in priming-coupled elongation on unprimed M13 DNA in the presence and absence of 250 ng of T antigen. A control reaction (black) lacked pol-prim. Reaction products with and without T antigen were detected by alkaline agarose electrophoresis and quantitated by phosphorimaging to determine the stimulation of incorporation by T antigen.

In the presence of deoxyribonucleotides, the RNA primers synthesizedby pol-prim are transferred to the DNA polymerase active siteof the same molecule and extended into hybrid RNA-DNA primersof about 35 nucleotides (3, 10, 65). In the absence of the RFC/PCNAprimer recognition complex, these RNA-DNA primers can be furtherelongated in repeated cycles of extension by the DNA polymeraseactivity (58, 59). The primer extension activities of pol-primtetramer and trimer were determined by incubating an equal polymeraseactivity of each [i.e., about twice as many moles of trimeras tetramer, based on their specific activities on poly(dA)-oligo(dT)template-primer] with a uniquely primed single-stranded M13DNA template in the presence of radiolabeled deoxyribonucleosidetriphosphates. Both enzymes extended the primer to productsof about 6 kb in length (Fig. 2C, compare lanes 1 to 4 with5 to 8). The trimer appeared to synthesize about twice as muchproduct as the tetramer (compare lanes 2 and 3 with 6 and 7).However, when products of equal molar amounts of tetramer andtrimer were compared, the amount and length of the productswere remarkably similar (Fig. 2C, compare lanes 4 and 6). Theaddition of a fivefold molar excess of purified p68 to the trimerstimulated its elongation activity only at the lower amountof trimer (compare lanes 9 to 12 with lanes 5 to 8). Controlreactions containing only p68 (lane 13) or without pol-prim(lane 14) generated no products. These results demonstrate that,on a singly preprimed natural DNA template, the primer extensionactivity of the trimer was comparable to that of the tetramer.

Physical interactions of SV40 T antigen with human pol-prim,in particular with the p68 subunit, stimulate both priming andprimer elongation activities of pol-prim (8, 9, 46), raisingthe question of whether T antigen could stimulate the activitiesof the trimer. To address this question, tetramer and trimercomplexes of equal primase activity (i.e., about twice as manymoles of trimer as tetramer) were incubated with unprimed single-strandedM13 DNA in the presence of unlabeled ribo- and deoxyribonucleotidesand a radiolabeled deoxynucleoside triphosphate, with or withoutT antigen. Reaction products were resolved by alkaline agaroseelectrophoresis and quantitated by phosphorimaging. At the higheramount of primase activity, T antigen stimulated both the trimerand the tetramer about sixfold (Fig. 2D), but with half theamount of primase activity, stimulation of the tetramer wasgreater than that of the trimer. Addition of p68 to the trimerreaction did not further enhance the level of stimulation (datanot shown). These results indicate that, at least qualitatively,T-antigen-mediated stimulation of pol-prim does not requirep68.

The p68 subunit of DNA pol-prim is essential for initiation of SV40 DNA replication. The initial characterization of the pol-prim trimer demonstratedpolymerase and primase activities and showed that these activitiescould be stimulated by T antigen, suggesting that p68 was dispensable.On the other hand, the p68 subunit could be required for coordinatedinteractions of pol-prim with other replication proteins, suchas RPA and T antigen, in viral DNA replication. If so, one wouldexpect the trimer to be unable to support initiation of SV40DNA replication, but the p68 subunit may be able to restoreits activity. This prediction was tested using in vitro replicationassays containing supercoiled SV40 origin DNA, topoisomeraseI, RPA, T antigen, and pol-prim tetramer or trimer in the presenceof radiolabeled ribonucleotides. Reactions containing the pol-primtetramer generated easily detectable labeled RNA products of7 to 14 nucleotides in length (Fig. 3A, lanes 1 to 3). However,the trimer (lanes 4 to 6) did not synthesize products abovethe background level. This result suggests that p68 is requiredfor the initiation of replication at the viral origin. To confirmthis interpretation, a fivefold molar excess of recombinantp68 purified from either baculovirus-infected insect cells (lane7) or bacterial extracts (lane 8) was added to the trimer reactionmixtures. The initiation activity of the trimer was substantiallyrestored by p68 (lanes 7 and 8). The initiation activity ofthe trimer was not restored by addition of the amino-terminaldomain (N) of p68, which binds to T antigen (8), the carboxy-terminaldomain (C), which binds to p180 (8, 40, 41), or a mixture ofthe N and C domains (Fig. 3A, lanes 9 and 10; data not shown).No product was synthesized in control reactions containing p68but lacking pol-prim, demonstrating that the restoration ofactivity was not caused by possible contaminants in the p68preparations (lanes 11 to 14).

View larger version (55K):
[in this window]
[in a new window]
FIG. 3. The pol-prim trimer is defective in the initiation of SV40 DNA replication. (A) Initiation of SV40 DNA replication was assayed in reaction mixtures containing SV40 origin DNA, topoisomerase I, RPA, SV40 T antigen, and 5, 10, or 20 primase units of tetramer (lanes 1 to 3) or trimer (lanes 4 to 6) as indicated. A fivefold molar excess of full-length (F, F_*) p68 or p68 domains N or C (F_*, baculovirus-expressed, lane 7; F, bacterially expressed, lane 8; N, amino-terminal domain, lane 9; C, carboxy-terminal domain, lane 10) was added to reaction mixtures containing 10 units of the trimer. Products of reactions lacking pol-prim are shown as controls (lanes 11 to 14). Primers synthesized by pol-prim were detected by denaturing electrophoresis and autoradiography. End-labeled oligonucleotide markers (M) of the indicated lengths are shown at the right. (B) Initiation coupled with elongation was assayed in reaction mixtures containing SV40 origin DNA, topoisomerase I, RPA, SV40 T antigen, and increasing amounts (10, 15, and 20 primase units) of tetramer (lanes 1 to 3) or trimer (lanes 4 to 6). A 5- or 10-fold molar excess of separately purified, baculovirus-expressed p68 was added to reaction mixtures containing 10 units of the trimer in lanes 7 and 8. Elongation products synthesized by pol-prim were detected by alkaline agarose electrophoresis and autoradiography. Products of reactions lacking pol-prim (lane 9) or T antigen (lane 10) are shown as controls. The positions of end-labeled marker DNA fragments of the indicated sizes (in base pairs) are indicated at the right. A sample of the radiolabeled products from each reaction was also analyzed by scintillation counting (counts per minute [cpm] listed below each lane).

These results argue that the p68 subunit serves an essentialfunction in the initial stage of replication when short oligoribonucleotideprimers are synthesized. An alternative interpretation of theseresults is that the trimer is active, but that the primers itsynthesizes are too few or too short to be easily detected inthis assay. To address this concern, we tested the trimer andtetramer in a monopolymerase SV40 initiation assay where primingwas coupled with elongation, thereby amplifying the signal (17,36, 48). Reaction mixtures contained supercoiled SV40 originDNA, topoisomerase I, RPA, T antigen, pol-prim tetramer or trimer,unlabeled ribonucleoside triphosphates, and deoxyribonucleosidetriphosphates, of which one was radiolabeled. Reactions containingthe tetramer generated radiolabeled products of 0.3 to 3 kbin length, and the amount of product was dependent on the amountof pol-prim tetramer in the reaction mixture (Fig. 3B, lanes1 to 3). The trimer synthesized much less product (lanes 4 to6). When purified p68 was present in the trimer reaction ina 5- or 10-fold molar excess, it restored activity to the trimer,resulting in a nearly 15-fold increase in replication activity(compare lanes 7 and 8 with lane 4). The products synthesizedby the trimer in the presence of p68 were similar in size andabundance to those synthesized by the equivalent activity ofthe tetramer (Fig. 3B, compare lane 1 with lane 7). No productswere synthesized in a control reaction containing p68 but lackingpol-prim, demonstrating that the recovery of activity couldnot be attributed to a contaminant in the p68 preparation (lane9). No products were synthesized in a control reaction lackingT antigen (lane 10). We conclude that p68 is required for initiationof SV40 DNA replication in vitro.

The p68 subunit of pol-prim is required for priming and elongation on RPA-saturated single-stranded template. In vitro SV40 replication assays have demonstrated that thep68 subunit of pol-prim is essential to initiate replication,but its role in initiation is unclear. The p68 requirement forprimer synthesis and elongation at the SV40 origin could beorigin specific, reflecting pol-prim enhancement of T-antigenassembly on the origin, effects on T-antigen-mediated unwindingof duplex DNA, or origin-specific loading of pol-prim by T antigen.Alternatively, p68 could be more generally required for T-antigen-mediatedpriming by pol-prim on RPA-coated ssDNA (8, 9, 37, 46, 47).For instance, the species-specific requirement for primate pol-primin SV40 DNA replication is apparent during initiation of DNAreplication at the viral origin, but not during T-antigen-mediatedpriming on RPA-coated ssDNA (54).

To assess whether p68 plays a role in T-antigen-mediated primingby pol-prim in the presence of RPA, we tested the activitiesof the pol-prim trimer and tetramer in priming-coupled DNA synthesison RPA-saturated ssDNA (Fig. 4). Single-stranded M13 DNA wasfirst incubated with or without RPA, and then pol-prim tetrameror trimer was added to the reaction mixture, either with orwithout T antigen. In the absence of RPA, the pol-prim tetramersynthesized primers and extended them into radiolabeled DNAproducts of 0.4 to 4 kb (Fig. 4A, lane 1). Preincubation ofthe template with increasing amounts of RPA reduced the amountof reaction product by more than 10-fold (lanes 2 and 3). Thisinhibition was partially relieved in the presence of T antigen(Fig. 4A, lanes 4 and 5), consistent with previous reports (9,37, 51).

View larger version (38K):
[in this window]
[in a new window]
FIG. 4. T-antigen-mediated priming and elongation activity of the pol-prim trimer in the presence of RPA. Reaction mixtures contained 25 ng of M13 DNA, 300 ng of T antigen as indicated (+), 200 ng of tetramer (A), 250 ng of trimer (B and C), and 500 to 1,000 ng of RPA (A), 1,000 ng of RPA (B), or 50 to 300 ng of E. coli SSB (C). Where indicated, 250 ng of p68 was added to the reaction (B and C). Radiolabeled elongation products were detected by alkaline agarose electrophoresis and autoradiography. The radioactivity (counts per minute [cpm]) incorporated in each reaction is shown below each lane. Products made in control reactions without pol-prim, T antigen, RPA, or SSB are indicated (-). The mobilities of end-labeled marker DNA fragments of the indicated lengths in nucleotides are shown at the right.

The pol-prim trimer also synthesized primers and elongated themto products of up to 6 kb in length (Fig. 4B, lane 1), and synthesiswas inhibited when the template DNA was saturated with RPA (lane2). However, addition of T antigen failed to relieve the inhibitioncaused by RPA (Fig. 4B, compare lanes 3 and 4 with lane 2).Importantly, the ability of the trimer to synthesize and elongateprimers on RPA-saturated ssDNA was recovered when p68 was addedtogether with T antigen (Fig. 4B, compare lanes 7 and 8 withlane 6).

Although several different SSBs inhibit priming by pol-primtetramer, T antigen relieves only the inhibition by mammalianRPA, correlating with its ability to bind mammalian RPA butnot other SSBs (37, 50, 54). To test whether the T-antigen-mediatedpriming and elongation reaction was dependent on specific protein-proteininteractions of T antigen with RPA and the pol-prim trimer,the experiment in Fig. 4B was repeated using single-strandedM13 DNA saturated with bacterial SSB instead of RPA (Fig. 4C).SSB inhibited priming and elongation by the pol-prim trimer(Fig. 4C, compare lanes 2 to 5 with lane 1), but activity wasnot recovered in the presence of T antigen (lane 6). Moreover,neither p68 nor a mixture of p68 and T antigen restored activityof the pol-prim trimer in the presence of SSB (compare lanes8 and 9 with lane 7). Taken together, the results of these experimentsargue strongly that p68 is required for T-antigen-mediated primingand elongation by pol-prim on RPA-saturated ssDNA.

Phosphorylation of the p68 subunit by cyclin A/cdk2 inhibits priming-coupled elongation activity of pol-prim in the presence of RPA. The initiation of SV40 DNA replication in vitro is regulatedby phosphorylation of pol-prim by cyclin/cdk (11, 49, 55, 60,61). Phosphorylation of pol-prim by cyclin A/cdk2 on specificN-terminal residues of the p68 subunit, followed by purificationof the pol-prim away from the kinase, resulted in a 10-foldinhibition of primer synthesis at the SV40 origin compared withmock-phosphorylated pol-prim (60, 61). These results raisedthe question of whether phosphorylation of p68 regulated theinitiation activity of pol-prim only at the origin, or whetherit might also inhibit its ability to synthesize and elongateprimers during lagging strand DNA replication. To investigatethis question, we prepared prephosphorylated and mock-phosphorylatedpurified human pol-prim and compared their properties with thosedescribed previously (60, 61). Both preparations were composedof the expected four subunits (Fig. 5A, lanes 1 and 2) and displayedDNA polymerase and primase activities in simple enzyme assays(60, 61). The mobility of the p68 subunit in the phosphorylatedpol-prim was slightly retarded compared to that of the mock-phosphorylatedp68, as reported previously for hyperphosphorylated p68 (60).Immunoblotting of both pol-prim preparations with a monoclonalantibody specific for p68 confirmed the identity of the p68bands (Fig. 5B). Lastly, to confirm that the activity of theprephosphorylated pol-prim in initiation of SV40 DNA replicationwas effectively inhibited, both preparations were tested forSV40 origin-dependent initiation coupled with primer elongation(Fig. 5C). Mock-phosphorylated pol-prim synthesized primersand elongated them into easily detectable products (Fig. 5C,lanes 1 to 4), while the activity of the prephosphorylated pol-primwas inhibited about 10-fold (lanes 5 to 8). These results confirmand extend earlier observations that phosphorylation of pol-primby cyclin A/cdk2 inhibits initiation of SV40 DNA replication(60, 61).

View larger version (53K):
[in this window]
[in a new window]
FIG. 5. Phosphorylation of pol-prim by cyclin A/cdk2 inhibits initiation and elongation of SV40 DNA replication. (A and B) pol-prim purified after prephosphorylation (Phos) with cyclin A/cdk2 (A/2) or mock phosphorylation (Mock) was analyzed by SDS-PAGE with 10% (A) or 7.5% (B) polyacrylamide and staining with Coomassie blue (A) or Western blotting with a p68-specific antibody (B). The mobilities of marker proteins (M) of known sizes are indicated (in kilodaltons) at the right. (C) Initiation and elongation of SV40 DNA replication was assayed in reaction mixtures containing SV40 origin DNA, topoisomerase I, RPA, T antigen, and increasing amounts (5, 10, 15, and 20 primase units) of mock-phosphorylated pol-prim (lanes 1 to 4) and cyclin A/cdk2-phosphorylated pol-prim (lanes 5 to 8). Reaction products made in the absence of T antigen (lane 9) or pol-prim (lane 10) are shown. Radiolabeled elongation products synthesized by pol-prim were detected by alkaline electrophoresis and autoradiography. The radioactivity (counts per minute [cpm]) incorporated in each reaction is shown below the lane. The mobilities of end-labeled marker DNA fragments of the indicated lengths in nucleotides are shown at the right.

To address the question of whether phosphorylation of pol-primby cyclin A/cdk2 specifically inhibits only initiation of SV40DNA replication, or perhaps also priming and elongation on anRPA-bound template in general, we tested the activity of phosphorylatedpol-prim in priming-coupled elongation on RPA-saturated M13ssDNA. Preincubation of the ssDNA template with RPA inhibitedprimer synthesis and elongation by both mock-phosphorylatedand cyclin A/cdk2-phosphorylated pol-prim in a dose-dependentmanner (Fig. 6A). Although the activity of mock-phosphorylatedpol-prim was restored by T antigen as expected, the activityof phosphorylated pol-prim was refractory to T-antigen stimulation.The data indicate that phosphorylation of pol-prim inhibitsits activity in T-antigen-mediated priming and elongation onRPA-coated templates.

View larger version (45K):
[in this window]
[in a new window]
FIG. 6. Phosphorylation of pol-prim on p68 by cyclin A/cdk2 inhibits T-antigen-mediated priming and elongation on RPA-coated ssDNA. Reaction mixtures contained 25 ng of unprimed M13 DNA that had been precoated with 250 to 750 ng of RPA as indicated, T antigen (300 ng) as indicated (+), and 200 ng of wild-type pol-prim tetramer (A) or mutant tetramer containing 4xA p68 (B), either mock phosphorylated or phosphorylated with cyclinA/cdk2, as indicated in the figure, and nucleoside triphosphates. The bar graphs show the radioactivity (counts per minute [cpm]) incorporated in each reaction of a typical experiment with each pol-prim preparation. Products made in control reactions without pol-prim, T antigen, or RPA are indicated.

Since both the p68 and p180 subunits of pol-prim can be phosphorylatedby cyclin A/cdk2, these results cannot distinguish whether phosphorylationof p68, p180, or both, is responsible for the observed inhibitionof priming in the presence of RPA. To address this question,we utilized a mutant p68 with alanine substitutions at fourspecific serine residues (4xA) that renders pol-prim resistantto the inhibitory effects of phosphorylation (60). The experimentin Fig. 6A was repeated using pol-prim with a 4xA mutant p68subunit (Fig. 6B). The priming-coupled elongation activity ofphosphorylated and unmodified 4xA pol-prim was diminished byincreasing amounts of RPA (Fig. 6B). T antigen significantlyreversed the inhibition of 4xA pol-prim both with and withoutprephosphorylation. The data demonstrate that phosphorylationof p68 is primarily responsible for the inhibition of pol-primactivity in T-antigen-mediated priming on RPA-saturated ssDNA.

DISCUSSION

Top

Discussion

Trimeric pol-prim lacking the p68 subunit has enzymatic activity. To elucidate the role of the p68 subunit of pol-prim in DNAreplication, we have generated and characterized a recombinanthuman pol-prim lacking the p68 subunit (Fig. 1). The reducedyield of pol-prim trimer may indicate that p68 facilitates pol-primassembly or stability, as suggested by the ability of yeastB subunit to stimulate yeast pol-prim reconstitution (7). Thepurified human trimer synthesized primers and elongated them(Fig. 2), consistent with the previously reported activitiesof human p180 reconstituted with mouse p48-p58 primase heterodimer(10) and of yeast p180 reconstituted with yeast primase (7).The primase specific activity of trimeric human pol-prim wasabout half that of the tetramer (Fig. 2B). The polymerase specificactivity of pol-prim trimer was also about half that of thetetramer when assayed on a poly(dA)-oligo(dT) template-primer(Fig. 2A). However, on a preprimed natural DNA template, theprimer extension activity of the trimer was at least as greatas that of the tetramer (Fig. 2C). The reason for the differencein primer extension activity of trimeric pol-prim on the twotypes of preprimed templates is not known. In any case, thedata demonstrate that trimeric human pol-prim is not grosslydeficient in enzymatic activity.

The p68 subunit is required for primer synthesis by human pol-prim in the presence of RPA and T antigen. Trimeric pol-prim was essentially unable to initiate SV40 DNAreplication, but its activity was significantly restored uponaddition of purified intact p68 that had been expressed in eitherinsect cells or bacteria (Fig. 3). Moreover, the activity ofpol-prim trimer in T-antigen-mediated primer synthesis and elongationon RPA-saturated ssDNA template was also markedly reduced, butit could be largely rescued by addition of purified p68 (Fig.4). Phosphorylation of p68 by cyclin A/cdk2 caused tetramericpol-prim to behave much like trimeric pol-prim lacking p68 (Fig.6). The data argue that p68 is critical both for initiationand for primer synthesis and elongation by pol-prim in the presenceof RPA and T antigen, and that phosphorylation of p68 regulatesboth of these activities.

How does p68 promote pol-prim activity in the presence of Tantigen and RPA? The p68 subunit interacts physically with thep180 subunit through its C terminus (40, 41) and with T antigenthrough its N terminus (8). Thus, one model is that the p68subunit tethers the pol-prim complex to T antigen, which encirclesthe DNA as a processive DNA helicase, thereby promoting primersynthesis and elongation by pol-prim. Consistent with this idea,a monoclonal antibody against a C-terminal region of T antigenblocked pol-prim binding to T antigen, as well as stimulationof pol-prim activity by T antigen (9, 54, 66, 67). However,since T antigen binds to all four subunits of pol-prim (14,24, 67), and since the activity of the trimer was stimulatedby T antigen (Fig. 2D), p68 appears to be dispensable for thistethering. Thus, tethering is not fully satisfactory as an explanationfor the p68 requirement, but it could represent part of themechanism.

A second possible model is that p68 enhances the accessibilityof the primase active site in the presence of RPA. It is intriguingthat in the absence of RPA, the primase specific activity ofthe trimer on M13 ssDNA was about half that of the tetramer(Fig. 2B), while its primer elongation activity on M13 DNA wasmaintained (Fig. 2C). This observation suggests the possibility,that without p68, the polymerase active site of the trimer mightbe more accessible than the primase site. We speculate thatthis bias in favor of the polymerase active site may be exacerbatedin the presence of RPA, so that p68 would be needed to sequesterthe p180 subunit and facilitate priming on RPA-saturated ssDNA.

A third possible model to explain the p68 requirement mightbe that coordinated T antigen binding to pol-prim and to RPA-saturatedssDNA orients pol-prim properly on the template for primer synthesis(6, 8, 9, 12-14, 67). As a hexamer, T antigen could conceivablybind simultaneously to RPA and to all four subunits of pol-prim(24, 66). T antigen was recently shown to modulate the bindingmode of RPA on ssDNA, a functional interaction that may facilitateT-antigen-mediated priming by pol-prim on RPA-saturated ssDNA(51; R. D. Ott, T. Sidorova, L. Douthitt, Y. Wang, V. N. Podust,and E. Fanning, unpublished data). Since T antigen and primasebind to overlapping sites in RPA70 (6, 13, 50, 64), it is attractiveto speculate that primase competes with T antigen for bindingto the modified RPA-coated ssDNA. With the other subunits ofpol-prim tethered to the T-antigen hexamer, p68 may be requiredas a loading factor to position pol-prim correctly, or to sequesterthe p180 active site as in the second model described above,to promote primer synthesis. This temporally and spatially coordinatedbinding of T antigen to RPA and pol-prim may allow RPA and pol-primto switch places on the ssDNA, poising primase for action.

Does p68 regulate pol-prim activity in chromosomal DNA replication? In yeast, the B subunit appears to execute an essential functionbefore the hydroxyurea-sensitive step, but not later duringS phase (19). Assuming that the B subunit serves a similar functionin yeast and SV40 DNA replication, one might have expected defectsin both initiation and elongation of yeast DNA replication aftera shift to the nonpermissive temperature. Perhaps this mutantB subunit was defective only prior to its assembly in replicationforks, where pol-prim interacts with other fork proteins, e.g.,DNA polymerase ${varepsilon}$ (Pol ${varepsilon}$ ), Dpb11, Cdc45, Sld2, and Sld3 (1, 2,26, 27, 34, 35, 38, 39, 68). In that case, analysis of additionalB subunit alleles might reveal defects in both initiation andelongation. On the other hand, chromosomal replication forksdiffer from those in SV40 replication. Pol ${varepsilon}$ is required forchromosomal DNA replication (15, 16, 45, 56, 63), but not forSV40 DNA replication (53, 70). Moreover, in viral DNA replication,T antigen assumes the roles of multiple cellular initiationproteins, including origin recognition and DNA unwinding (5).Thus, our analysis of the functions of p68 in SV40 replicationmay not accurately reflect those in chromosomal replication.

In spite of the differences between SV40 and chromosomal replication,regulation of p68/B subunit activity by cdk phosphorylationshows some similarity in the two systems. Phosphorylation ofp68/B subunit by cyclin-dependent kinases is observed in yeastand human cells at the G₁/S transition and increases with progressionto G₂/M (11, 18, 20, 49, 52, 60). However, B-subunit phosphorylationis delayed in yeast during the intra-S-phase checkpoint responsein a Rad53-dependent manner (52). If cdk phosphorylation ofyeast pol-prim blocks its primosome activity in the presenceof RPA, as observed with human pol-prim, then preventing pol-primphosphorylation at stalled replication forks probably contributesto Rad53-dependent stabilization of the forks after DNA damage(31, 57). The notion that primosome activity of yeast pol-primis regulated in response to DNA damage is supported by the findingthat RPA70 and p48 primase mutants are defective in respondingto Rad53-dependent checkpoint signals (29, 30, 33).

Human pol-prim appears to be associated with a phosphatase,as well as with cyclin A/cdk2, in human cells (11), raisingthe question of whether phosphate turnover may regulate pol-primactivity during S phase. We speculate that as cyclin A/cdk2activity rises during S phase, modification of the clusteredphosphorylation sites in human p68 may increase progressively,shutting down pol-prim activity as DNA replication is completed.Activation of the intra-S-phase checkpoint in human cells (32,44), if it prevents phosphorylation of pol-prim p68 as in yeast,would prolong the window of pol-prim primosome activity, presumablyat origins of replication and during lagging strand replication.Indeed, if the genomic instability associated with SV40 infectionactivates the intra-S-phase checkpoint, it would be expectedto enhance viral DNA replication.

ACKNOWLEDGMENTS

We thank the past and present members of the Fanning lab fordiscussions, advice, and reagents, and Amy Altman and StevenGray for comments on the manuscript.

The financial support of NIH grant GM52948 and Vanderbilt Universityis gratefully acknowledged.

FOOTNOTES

* Corresponding author. Mailing address: Department of Biological Sciences, Vanderbilt University, VU Station B 351634, Nashville, TN 37235-1634. Phone: (615) 343-5677. Fax: (615) 343-6707. E-mail: fannine{at}ctrvax.vanderbilt.edu.

Present address: Wilramstr. 25, D-81669 Munich, Germany.

Present address: 1727 Todd Dr., Johnson City, TN 37604.

REFERENCES

Top