This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lau, P. J.
Right arrow Articles by Kolodner, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lau, P. J.
Right arrow Articles by Kolodner, R. D.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, October 2002, p. 6669-6680, Vol. 22, No. 19
0270-7306/02/$04.00+0     DOI: 10.1128/MCB.22.19.6669-6680.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Isolation and Characterization of New Proliferating Cell Nuclear Antigen (POL30) Mutator Mutants That Are Defective in DNA Mismatch Repair

Patrick J. Lau, Hernan Flores-Rozas, and Richard D. Kolodner*

Ludwig Institute for Cancer Research, Cancer Center, and Department of Medicine, University of California-San Diego School of Medicine, La Jolla, California 92093-0660

Received 28 February 2002/ Returned for modification 31 March 2002/ Accepted 28 June 2002


arrow
ABSTRACT
 
A number of studies have suggested a role for proliferating cell nuclear antigen (PCNA) in DNA mismatch repair (MMR). However, the majority of mutations in the POL30 gene encoding PCNA that cause MMR defects also cause replication and other repair defects that contribute to the increased mutation rate caused by these mutations. Here, 20 new pol30 mutants were identified and screened for MMR and other defects, resulting in the identification of two mutations, pol30-201 and pol30-204, that appear to cause MMR defects but little if any other defects. The pol30-204 mutation altered an amino acid (C81R) in the monomer-monomer interface region and resulted in a partial general MMR defect and a defect in MSH2-MSH6 binding in vitro. The pol30-201 mutation altered an amino acid (C22Y) located on the surface of the PCNA trimer that slides over the DNA but did not cause a defect in MSH2-MSH6 binding in vitro. The pol30-201 mutation caused an intermediate mutator phenotype. However, the pol30-201 mutation caused almost a complete defect in the repair of AC and GT mispairs and only a small defect in the repair of a "+T" insertion, an effect similar to that caused by an msh6{Delta} mutation, indicating that pol30-201 primarily effects MSH6-dependent MMR. The chromosomal double mutant msh3-FF>AA msh6-FF>AA eliminating the conserved FF residues of the PCNA interacting motif of these proteins caused a small (<10%) defect in MMR but showed synergistic interactions with mutations in POL30, indicating that the FF>AA substitution may not eliminate PCNA interactions in vivo. These results indicate that the interaction between PCNA and MMR proteins is more complex than was previously appreciated.


arrow
INTRODUCTION
 
DNA mismatch repair (MMR) corrects base-base mispairs and small insertion/deletion mispairs that result from DNA replication errors, reducing the accumulation of mutations during DNA replication. The best-characterized MMR system is the MutHLS system in Escherichia coli (reviewed in references 8, 26, 32, 41, and 42). In this system, the MutS protein first binds to a DNA mismatch, and then the MutL protein binds to the MutS protein and activates MutH. The activated MutH protein makes a single-strand break in the newly synthesized, unmethylated strand of DNA. The nicked strand of DNA is then unwound past the mismatch by the UvrD helicase and degraded by one or more of the single-strand-specific exonucleases: Exo I, Exo VII, RecJ, or the recently identified Exo X (54). DNA polymerase III, single-stranded DNA-binding protein (SSB), and DNA ligase then act to fill in the gap produced by the excision reaction.

In the budding yeast Saccharomyces cerevisiae, three MutS homologues (MSH) and four MutL homologues (MLH) have been suggested to function in MMR (reviewed in references 8, 26, 32, 33, and 42). The MSH2 protein forms two complexes that bind to mismatches, one with the MSH3 protein and the other with the MSH6 protein (38). These two complexes are functionally analogous to the bacterial MutS homodimer (38). The MSH2-MSH6 complex binds and functions in the repair of base-base and insertion/deletion mispairs, while the MSH2-MSH3 complex binds and functions in the repair of insertion/deletion mispairs (2, 25, 37, 38). The genetic results suggest that MSH3 and MSH6 contribute relatively equally to the repair of single base insertion/deletions, whereas MSH3 is increasingly more important than MSH6 for repair as the size of the insertion/deletion increases (20, 22, 38, 50). Like the MSH, the MLH also form multiple complexes. MLH1 forms complexes with PMS1, MLH2, and MLH3. Genetic studies indicate that the MLH1-PMS1 complex functions in most repair events, whereas the MLH1-MLH3 complex plays a minor role in MMR (6, 16, 27, 34, 45, 46, 55, 57). Recent studies suggest that a complex of MLH1 and MLH2 may also play a minor role in the repair of some mispairs (27, 55). A number of studies have suggested that the MLH1-PMS1 complex forms a ternary complex with either the MSH2-MSH6 or the MSH2-MSH3 complex and DNA containing a mismatch (24, 45).

The proliferating cell nuclear antigen (PCNA) is a DNA polymerase processivity factor that plays a critical role in DNA replication, nucleotide excision repair (1, 49), base excision repair (13, 39), and cell cycle regulation (18, 58). PCNA is also thought to play an important role in MMR, although its exact role has not been defined. In vitro studies with human cell extracts have suggested that PCNA is required for MMR at both the DNA synthesis step (23) and at a step prior to DNA synthesis (23, 52). A number of studies have indicated that PCNA interacts with various MMR proteins, and these interactions appear to be mediated by a specific PCNA interaction motif (56) present in the N terminus of both MSH3 and MSH6 (11, 17, 30). Genetic studies support the view that PCNA's interaction with either MSH2-MSH3 or MSH2-MSH6 is important for MMR. PCNA mutations that cause a mutator phenotype and an MMR defect in assays that detect the repair of transformed plasmids containing a defined mispair (9, 11, 29, 52) cause a defect in binding to the MSH2-MSH6 complex (17). One of these mutations was tested and found to eliminate the increase in mispair binding specificity of the MSH2-MSH6 complex seen in the presence of wild-type PCNA (17). Conversely, mutations that change amino acids in the PCNA binding motif in either MSH3 or MSH6 cause a weak mutator phenotype and a defect in binding to PCNA (11, 17). However, it is difficult to quantitatively evaluate the importance of the interaction between PCNA and MMR proteins for MMR. This is because all pol30 mutations suggested to cause an MMR defect have also been shown to cause replication defects and other repair defects, and in most cases these other defects also appear to contribute to the mutator phenotype caused by the pol30 mutation (3, 5, 9, 14, 29, 31, 40). In addition, the PCNA interaction domain mutations in MSH3 and MSH6 only cause partial MMR defects (11, 17), and it has not been ruled out that these mutations cause additional defects in MSH3 or MSH6 function besides that of binding to PCNA.

To gain further insight into the role of PCNA in MMR, we mutagenized the POL30 gene and identified pol30 mutations that cause increased mutation rates. From this collection of mutations, we identified two novel mutator alleles of POL30. These two mutations, pol30-201 and pol30-204, do not appear to cause replication defects or other repair defects to the extent seen with other pol30 mutator mutations. The pol30-201 allele appears to cause a strong defect in MSH6-dependent MMR and possibly a small defect in MSH3-dependent MMR, whereas the pol30-204 allele appears to cause a partial defect in both MSH6- and MSH3-dependent MMR. The PCNA-204 protein is defective in binding to MSH2-MSH6 in vitro, and the PCNA-201 protein may inappropriately interact with MSH2-MSH6 and reduce MMR.


arrow
MATERIALS AND METHODS
 
Strains and plasmids. All of the strains used in the present study were derived from a S288C background and are listed in Table 1. Yeast extract-peptone-dextrose medium (YEPD) and synthetic complete medium (SC) for propagating strains were as previously described (4, 10, 48). Plasmids pRDK904 (pol30-104 TRP1), pRDK905 (pol30-201 TRP1), pRDK909 (pol30-204 TRP1), pRDK914 (pol30-209 TRP1), and pRDK915 (pol30-210 TRP1) were digested with the restriction enzymes MluI and SacI, and the POL30-containing fragment was cloned into the vector backbone of pRDK902 (pCH1572) (POL30 LEU2) (3) that had been partially digested with SacI and fully digested with MluI to yield plasmids pRDK929 (pol30-104.LEU2), pRDK925 (pol30-201.LEU2), pRDK926 (pol30-204.LEU2), pRDK927 (pol30-209.LEU2), and pRDK928 (pol30-210.LEU2), respectively. The SacI fragment containing the POL30 gene from plasmids pRDK925 to pRDK927 was used to integrate the respective POL30 alleles at the chromosomal locus in different strains (Table 1). All integrated POL30 alleles were confirmed by sequencing the POL30 gene to verify the presence of the allele, whereas the presence of disruption mutations was verified by PCR.


View this table:
[in this window]
[in a new window]
 
TABLE 1. S. cerevisiae strains used in this study

Site-directed mutagenesis. MSH3 was amplified by using the primer pairsMSH3AatII (5'-GATCGAGACGTCTTTTACCAATAGTGTTTCCCCGA)with MSH3MUT3' (5'-CGTCAGCTCTGATTTTACCGCCTTCTTGGCAGCCCTGCTTATTGTGGGTTGTCCCGCC) and MSH3MUT5' (5'-GGCGGGACAACCCACAATAAGCAGGGCTGCCAAGAAGGCGGTAAAATCAGAGCTGACG) with MSH3BamHI (5'-CGGGATCCGTCTGATAATGCTGCATTTAGAACATAC). The two PCR products were then mixed and amplified again with the primers MSH3AatII and MSH3BamHI. The resulting PCR product was digested with the restriction enzymes AatII and BamHI and cloned into Yip5 that had been digested with AatII and BamHI to generate pRDK933 (msh3F39F40-AA URA3). The SpeI and MluI fragment of pRDK933, which contained the vector backbone, as well as part of MSH3, was used to integrate the mutation into different strains by using the pop-in and pop-out method (47). pRDK934 (msh6F33F34-AA URA3) was created by using the same procedure as for pRDK933 (msh3F39F40-AA URA3) except that MSH6 was amplified with the primer pairs MSH6AatII (5'-GATCGAGACGTCTCATGTATAGGTCATCGCCATATAGAG) with MSH6MUT3' (5'-CGGTGTGCCAGAAGGTACCTGTTTTGAGGCAGCAGATAACAAACTCGATTGCTTC) and MSH6MUT5'(5'-GAAGCAATCGAGTTTGTTATCTGCTGCCTCAAAACAGGTACCTTCTGGCACACCG) with MSH6BamHI (5'-CGGGATCCGAATCCTTTTTCAACGACCAAAAC), followed by reamplification with primers MSH6AatII and MSH6BamHI. The BsiWI and BlpI fragment of pRDK934, which contained the vector backbone, as well as parts of MSH6, was used to integrate the mutation into different strains by using the pop-in and pop-out method. The presence of the desired mutation and the absence of other mutations on the mutagenized plasmid and modified chromosomal allele were verified by sequence analysis.

PCR mutagenesis. PCR mutagenesis (12, 43, 53) combined with the plasmid shuffle technique (7) was used to create strains RDKY3854 to RDKY3875 (alleles pol30-52, pol30-104, and pol30-200 to pol30-219, respectively) as previously described (3). In brief, the POL30 gene on pRDK837 (pCH1565) (3) was amplified by PCR in 13 different reactions by using Taq polymerase (Perkin-Elmer) under low dATP conditions (50 µM dATP; 200 µM [each] dCTP, dGTP, and dTTP) with the primers 5'-GGGAAATCACTCCCAATTA and 5'-GCTGCGCGTAACCACCAC3'. Of the 13 reactions, 5 also contained 10 µM MnCl2. The PCR products were mixed and then transformed into strain RDKY3852 (this strain contains a chromosomal pol30{Delta} mutation and pRDK900 [POL30 URA3]), along with the vector backbone of SacI-digested pRDK837 (pCH1565) (3). The transformants were plated on SC minus tryptophan to select for the mutagenized plasmids and were then replica plated onto SC supplemented with 30 mg of uracil/liter plus 5.7 mM 5-fluoroorotic acid to select for the loss of pRDK900 (pCH1511) (POL30 URA3) (3). The resulting colonies were replica plated onto SC minus threonine to screen for POL30 alleles that caused an increased rate of reversion of a +1 insertion in the HOM3 gene and hence conferred a mutator phenotype. Colonies that grew on the SC minus threonine plates were further tested for mutator phenotypes by replica plating patch tests on SC minus lysine, a condition which detects the reversion of a +4 insertion in the LYS2 gene, and SC minus arginine plus canavanine (60 mg/liter), a condition which detects mutations that inactivate the CAN1 gene. All POL30 plasmids conferring a mutator phenotype were then rescued into an E. coli strain, and the POL30 gene was fully sequenced to identify the relevant mutation. The plasmids were then retested in S. cerevisiae essentially as described above.

Sensitivity to MMS, HU, UV light, and temperature. Qualitative tests were performed by spotting dilutions of each strain onto appropriate plates. The temperature sensitivity of each strain was determined by spotting dilutions of each strain onto YEPD, followed by incubation at either 37°C for 2 days, 30°C for 2 days, 25°C for 4 days, or 16°C for 7 days. Sensitivity to methyl methanesulfonate (MMS) or hydroxyurea (HU) was determined by spotting dilutions of each strain onto YEPD plates containing 0.01% MMS or 0.08 M HU, respectively, followed by incubation at 30°C for 2 days. Sensitivity to UV was determined by spotting dilutions of each strain onto YEPD and treating the cells with 48 J of UV light/m2, followed by incubation at 30°C for 2 days. Each of these plates was then scored for relative growth compared to wild-type control strains.

Quantitative tests for sensitivity to MMS were performed by suspending overnight cultures in water and treating them with either no MMS or 0.025, 0.05, or 0.1% MMS for 2 h at 30°C and then plating dilutions of the treated cells onto YEPD. The plates were then incubated at 30°C for 2 days. Quantitative tests for sensitivity to HU were performed by plating dilutions of an overnight culture for each strain onto YEPD plates containing either no HU or 0.005, 0.01, 0.04, or 0.08 M HU. The plates were then incubated at 30°C for 2 days. Quantitative tests for sensitivity to UV were performed by plating dilutions of an overnight culture for each strain onto YEPD and then irradiating the plates with 0.8 J/m2 per s of UV for 30, 60, or 90 s. The plates were then incubated at 30°C for 2 days, after which the number of colonies present was determined.

Flow cytometry. The strains of interest were grown to log phase at 30°C. The cultures were then split; one culture was grown at 30°C for an additional 3 h, and the other culture was grown at 16°C for an additional 10.5 h. The cultures were collected by centrifugation, sonicated, diluted, and stained with propidium iodide (28). The relative DNA content of the stained cells was then determined by using a Becton Dickinson fluorescence-activated cell sorter.

Mutation rate analysis. Mutator phenotypes were evaluated by using three different mutation rate assays: the hom3-10 assay, which measures the reversion of a +1 insertion in the HOM3 gene; the lys2-bgl assay, which measures the reversion of a +4 insertion in the LYS2 gene; and the CAN1 assay, which detects any mutation which inactivates the CAN1 gene (arginine permease) (22, 38). Qualitative mutator phenotypes for each strain were determined by using patch tests. Each strain was patched onto SC minus tryptophan plates and incubated overnight at 30°C. The plates were then replica plated onto SC minus threonine, SC minus lysine, and SC minus arginine plus canavanine (60 mg/liter) plates and then incubated at 30°C for 2 days (16, 38). Each strain was then scored as a "strong," "moderate," "weak," or "non" mutator for the hom3-10 and lys2-bgl assays and as a "mutator" or a "nonmutator" for the CAN1 assay, depending on the number of colonies present on the various indicator plates. For the hom3-10 and the lys2-bgl assays, "strong" refers to an approximately 100- to 1,000-fold increase in the number of colonies compared to what would have been observed with a wild-type strain, "moderate" refers to an approximately 10- to 100-fold increase in the number of colonies compared to what would have been observed with a wild-type strain, "weak" refers to up to an approximately 10-fold increase in the number of colonies compared to what would have been observed with a wild-type strain, and "non" refers to a number of colonies that was similar to that seen with a wild-type strain. For the CAN1 assay, strains were classified as mutators if there was any increase in colonies above that seen with the wild-type strain. However, they were not further subclassified because of the relatively small difference seen between a wild-type strain and a fully MMR-defective strain such as an msh2{Delta} mutant in the CAN1 assay. Mutation rates for the various strains were determined by fluctuation analysis (36, 38). Each strain was streaked onto a YEPD plate and incubated at 30°C for 2 days. Seven independent colonies from each strain were then cultured overnight to saturation in YEPD at 30°C. The cultures were then harvested by centrifugation and washed once with water. Appropriate dilutions were then plated on SC, SC minus threonine, SC minus lysine, and SC minus arginine plus canavanine (60 mg/liter) plates. After incubation at 30°C for 3 days, the plates were counted, and the mutation rates were calculated. The results presented represent the median rate for all cultures obtained from three to seven independent experiments.

In vivo MMR assay. The mispair-containing plasmids were constructed essentially as previously described (9, 34). In brief, 3 µg of single-stranded circular DNA was annealed to 19 µg of linear denatured double-stranded DNA. The sample was then treated with benzoylated naphthoylated DEAE cellulose to remove any single-stranded DNA and the double-stranded circular DNA was separated from the double-stranded linear DNA by high-pressure liquid chromatography by using a Gen-Pac Fax column (Waters). The heteroduplex circular DNA was introduced into each strain of interest by electroporation. The electroporated cells were plated on SC minus uracil containing low levels of adenine (6 mg/liter) and incubated for 5 days at 30°C. The colonies were then scored as either sectored, solid red, or solid white.

Protein purification. MSH2-MSH6 was purified as previously described (2, 37). Plasmids pRDK931 and pRDK932 were created by amplifying the POL30 allele from strains RDKY3876 and RDKY3878, respectively, with the primers PCNA-A (5'-GGAGATATACATATGTTAGAAGCAAAATTT) and PCNA-B (5'-TAAGCAGCCGGATCCAACTATATAGATAAT), digesting the resulting PCR fragment with NdeI and BamHI, and cloning the relevant fragment into the vector backbone of NdeI- and BamHI-digested pRDK930 (pT7ScPCNA; provided by B. Stillman, Cold Spring Harbor Laboratory). The resulting plasmids were then sequenced to verify that they did not contain unwanted mutations. PCNA, PCNA-201, and PCNA-204 were purified as previously described (15). In brief, the PCNA-overexpressing plasmids pRDK930 (POL30), pRDK931 (pol30-201), or pRDK932 (pol30-204) were transformed into BL21(DE3) cells and grown to an optical density at 600 nm of 0.6 in Luria-Bertani medium containing 100 µg of ampicillin/ml. The cells were harvested by centrifugation and lysed by lysozyme treatment, followed by sonication. The cell extract was then clarified by centrifugation, and the protein present in the supernatant was successively chromatographed on Q-Sepharose, Sp-Sepharose, and hydroxyapatite columns.

Protein analysis. Sedimentation analysis was performed as previously described (17). In brief, protein samples were loaded onto the top of 4 ml, 15 to 30% glycerol gradients and centrifuged at 45,000 rpm at 4°C for 20 h by using a Beckman SW60 rotor. Thirty fractions were collected from the bottom of each gradient, and these were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on 4 to 15% gradient gels. The following amounts of proteins (either individually or in mixtures) were sedimented through the gradients: 75 µg of MSH2-MSH6, 25 µg of PCNA, 32 µg of PCNA-201, 34 µg of PCNA-204, 40 µg of ferritin, 40 µg of catalase, and 40 µg of bovine serum albumin as indicated. In some cases, the Stokes radius was determined by gel filtration on a Superdex 200 column (Amersham Pharmacia Biotech). Then, 25 µg of each PCNA protein was chromatographed on the column at 0.4 ml/min in a buffer containing 50 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1 mM dithiothreitol, and 0.01% (octylphenoxy)polyethoxyethanol (Sigma). The protein standards used were ferritin, catalase, aldolase, albumin, ovalbumin, chymotrypsinogen A, and RNase A (Amersham Pharmacia Biotech).

Statistical analysis. The 95% confidence interval for the median of a population and the Mann-Whitney test were used to compare mutation rates. The chi-square test was used to compare the proportion of sectored and nonsectored colonies in the in vivo MMR assay. The Fisher exact test was used to compare the proportion of base substitutions and frameshifts for the CAN1 mutation spectrum data, and the 95% confidence interval for the median of a population was used to compare the rates of base substitutions and frameshifts in the CAN1 gene. These tests were performed by using programs available at http://faculty.vassar.edu/lowry/vshome.html.


arrow
RESULTS
 
Isolation and initial characterization of new POL30 alleles. We generated new POL30 alleles by random PCR mutagenesis, screened the resulting mutagenized plasmids for those conferring a mutator phenotype, and verified the properties of each allele by retesting it in a reconstructed strain. Twenty POL30 alleles were obtained containing a mutation that changed only a single amino acid and conferred a weak to strong mutator phenotype in at least one of the mutator assays. The plasmid designation, nucleotide change, and amino acid substitution for each allele are listed in Table 2. Reconstructed strains were then generated as described in Materials and Methods and tested for sensitivity to temperature, MMS, UV light, and HU by using qualitative spot tests, and the results of these tests are also listed in Table 2. The pol30-52 and pol30-104 alleles have been previously characterized (3) and are analyzed here as controls.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Properties of the pol30 mutants

The pol30 mutants were grouped into three classes based on their phenotypes. The mutants in one group—alleles pol30-206, pol30-208, pol30-211, pol30-212, pol30-215, and pol30-217—were all very weak mutators and otherwise showed no differences in phenotype compared to a wild-type POL30 strain. Another group of mutator mutants—alleles pol30-200, pol30-202, pol30-203, pol30-205, pol30-207, pol30-209, pol30-210, pol30-213, pol30-214, pol30-216, pol30-218, and pol30-219—were sensitive to MMS. Within this group, 4 of the 12 mutants (pol30-203, pol30-210, pol30-214, and pol30-219) showed temperature-sensitive growth defects and were sensitive to UV light, whereas the remaining eight mutants were not temperature sensitive or sensitive to UV light. The last group of mutants (alleles pol30-201 and pol30-204) exhibited a moderate mutator phenotype but were not temperature sensitive or sensitive to UV light or MMS. None of the alleles conferred significant sensitivity to HU.

The pol30 mutations were also tested for synthetic lethality when combined with a rad52 mutation, since previous studies have shown that many pol30 mutations are lethal in combinations with a rad52 mutation (9, 40). Strain RDKY4673 contains pol30 and rad52 deletion mutations and also contains pRDK900 (POL30 URA3). The pol30 mutations to be tested were introduced into this strain by transforming RDKY4673 with pRDK903 to pRDK924, which contain different pol30 mutations, to create strains RDKY4675 to RDKY4696, respectively. The pol30 alleles were tested for synthetic lethality with the rad52 mutation by plating dilutions of each strain on 5-fluoroorotic acid containing plates to determine whether the cells were able to lose the plasmid pRDK900 (POL30 URA3) (Table 2). The pol30-52, pol30-104, pol30-203, pol30-210, pol30-214, and pol30-219 mutations showed synthetic lethality when combined with a rad52 mutation, whereas the rest of the pol30 alleles did not show synthetic lethality (pol30-104 has previously been shown to be synthetic lethal [lethal in combination with] with a rad52 mutation and was included here as a control [3]).

Identification of pol30 mutator mutants that lack other growth and repair defects. Four of the POL30 alleles were integrated at the chromosomal POL30 locus in strains RDKY2672 and RDKY4079 for more quantitative testing. Because the pol30-201 and pol30-204 alleles caused a significant mutator phenotype but did not appear to cause any other defects, they were the best candidates for pol30 mutations that cause a defect in MMR but do not cause defects in replication or other repair pathways. The pol30-209 and pol30-210 alleles were also included as representative examples of mutations that caused MMS sensitivity but not cold sensitivity or rad52 synthetic lethality and mutations that caused MMS and cold sensitivity and rad52 synthetic lethality, respectively. The survival curves presented in Fig. 1A demonstrate that none of the four mutant alleles or an msh2{Delta} mutation conferred sensitivity to HU, a finding consistent with the results of the qualitative tests (Table 2). The survival curves presented in Fig. 1B show that the pol30-201 and the msh2{Delta} mutants were not more MMS sensitive than the wild-type strain and that the pol30-204 mutant may be slightly more MMS sensitive (i.e., showing a fourfold increase at 0.1% MMS) than the wild-type strain, whereas the pol30-209, pol30-210, and mec1 mutants showed significantly increased sensitivity to MMS (63-, 125-, and 490-fold increases, respectively, at 0.1% MMS) compared to the wild-type strain. Figure 1C shows that the pol30-201 and the msh2{Delta} mutants were not more UV sensitive than the wild-type strain, that the pol30-204, pol30-209 and pol30-210 mutants may be slightly more UV sensitive (3-, 7-, and 4-fold increases, respectively, at 90 s of UV light) than the wild-type strain, and that the mec1 mutant was significantly more UV sensitive (198-fold increase at 90 s of UV) than the wild-type strain.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 1. Sensitivity of POL30 mutants to HU, MMS, and UV irradiation. The indicated strains were treated with HU (A), MMS (B), or UV irradiation (C) as described in Materials and Methods, and the fractions of surviving cells at the indicated treatment level were determined by plating the cells as indicated and counting the number of resulting colonies. The strains used in this experiment are described in detail in Table 1 and included RDKY2672 (POL30), RDKY4082 (pol30-201), RDKY4084 (pol30-204), RDKY4086 (pol30-209), RDKY4088 (pol30-210), RDKY2706 (msh2{Delta}), RDKY3735 (mec1{Delta}), and RDKY3903 (rad9{Delta}).

To better understand any possible growth defects caused by the four pol30 mutations, the cellular morphology and cell cycle progression properties of the mutants were investigated (Fig. 2A). The pol30-201 and pol30-204 mutants behaved similarly to the wild-type strain at both 30 and 16°C when unsynchronized cultures were analyzed, indicating that these two pol30 alleles are unlikely to cause a cell cycle progression defect. Approximately 55% of POL30, pol30-201, and pol30-204 cells had a 2c DNA content at 30°C, and ca. 47% of POL30, pol30-201, and pol30-204 cells had a 2c DNA content at 16°C. The proportions of cells with a 1c DNA content or that were in S phase were also similar. Both the pol30-104 mutant, a known cold-sensitive mutant (3), and the pol30-210 mutant were growth defective at 30 and 16°C. Consistent with this finding, ca. 75% of the pol30-104 and pol30-210 cells had a 2c DNA content at 30°C, and 83 and 74% of the cells had a 2c content at 16°C, respectively. The pol30-209 mutant had a slightly elevated percentage of cells, with a 2c DNA content both at 30°C (60%) and at 16°C (56%). In a separate experiment, the wild-type and msh2{Delta} strains showed the same distribution of 1c and 2c DNA content cells, indicating that an MMR defect per se does not cause a defect in cell cycle progression (Fig. 2B). The cellular morphology of the cells was consistent with the fluorescence-activated cell sorting results. The pol30-201, pol30-204, pol30-209, and msh2{Delta} mutants had a distribution of unbudded, small-budded, and large-budded cells at 30 and 16°C that was similar to that seen with the wild-type control strain (Table 3). In contrast, the pol30-104 and pol30-210 mutants had a significantly elevated proportion of large-budded cells at 30 and 16°C compared to the wild-type control strain, a finding consistent with a cell cycle progression defect.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 2. Analysis of DNA content by flow cytometry. Asynchronous cultures of the indicated strains were grown at either 30°C or 16°C as indicated, and the relative DNA content per cell was determined by flow cytometry as described in Materials and Methods. The strains used in this experiment are described in detail in Table 1 and are RDKY4079 (POL30), RDKY4080 (pol30-104), RDKY4082 (pol30-201), RDKY4084 (pol30-204), RDKY4086 (pol30-209), RDKY4088 (pol30-210), and RDKY4922 (msh2{Delta}).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Cellular morphology of pol30 mutants

Characterization of the pol30-201 and pol30-204 mutator phenotypes. The mutation rates caused by the pol30-201 and pol30-204 mutations were measured by fluctuation analysis by using three different assays: the hom3-10 assay, which measures the reversion of a +1 insertion in the HOM3 gene; the lys2-bgl assay, which measures the reversion of a +4 insertion in the LYS2 gene; and the CAN1 assay, which detects any mutation which inactivates the CAN1 gene (arginine permease) (22, 38). The pol30-201 and pol30-204 mutants each had elevated mutation rates in all three assays compared to the wild-type rates (P < 0.05 in all cases, Mann-Whitney test; 95% confidence limits), although the mutation rates were not elevated to the extent seen for an msh2{Delta} mutant (P < 0.05 in all cases, Mann-Whitney test; 95% confidence limits), suggesting that the pol30 mutations could cause at most a partial defect in MMR (Table 4). When the pol30-204 mutation was combined with an msh2{Delta} mutation, the mutation rate of the double mutant in all three assays was significantly higher than that seen for the pol30-204 single mutant (P < 0.05 in all cases, Mann-Whitney Test; 95% confidence limits) but was not significantly higher than the mutation rate caused by an msh2{Delta} mutation alone (P > 0.05 in all cases, Mann-Whitney test; 95% confidence limits) (Table 4); however, we could not distinguish the double-mutant rate from the sum of the single mutant rates (95% confidence limits). The mutation rate of the pol30-201 msh2{Delta} double mutant also was significantly higher than that seen for the pol30-201 single mutants in all three assays (P < 0.05 in all cases, Mann-Whitney test; 95% confidence limits) and, for the CAN1 assay, was not significantly higher than the mutation rate caused by an msh2{Delta} deletion alone (P > 0.05, Mann-Whitney test; 95% confidence limits) (Table 4). However, the mutation rate of the pol30-201 msh2{Delta} double mutant was lower than that caused by an msh2{Delta} mutation alone in the hom3-10 assay (P < 0.05 in both cases, Mann-Whitney test; 95% confidence limits) but not in the lys2-bgl assay (95% confidence limits) (Table 4). The fact that the mutation rates of the pol30-201 msh2{Delta} and pol30-204 msh2{Delta} double mutants were not significantly higher than that caused by an msh2{Delta} mutation alone suggests that the mutator phenotype caused by the pol30-201 and pol30-204 mutations is MMR specific and indicates that the pol30 mutations do not cause increased accumulation of errors that are substrates for MMR (multiplicitivity predicted). However, we were not able to rule out the possibility that the pol30 mutations and the msh2{Delta} mutation cause defects in independent pathways (additivity predicted).


View this table:
[in this window]
[in a new window]
 
TABLE 4. Mutation rate analysis

Analysis of the CAN1 mutation spectrum showed that the pol30-201 and pol30-204 mutations increased the rate of both base substitution and frameshift mutations compared to the wild-type strain (proportion of mutations in a given class times the mutation rate compared at the 95% confidence limit) (Table 5). In each case, the modest increase in the rate of both base substitution and frameshift mutations was significantly different from the large increase in frameshift mutations due to the complete MMR defect caused by an msh2{Delta} mutation (Fisher exact test, P < 0.05) and is consistent with the mutation rate analysis (38, 50). For both the pol30-201 and pol30-204 mutations, the rate of base substitutions was higher than that caused by an msh3{Delta} mutation and lower than that caused by an msh6{Delta} mutation (proportion of mutations in a given class times the mutation rate compared at the 95% confidence limit). For both the pol30-201 and pol30-204 mutations, the rate of frameshift mutations was higher than that caused by an msh3{Delta} or msh6{Delta} mutation alone (proportion of mutations in a given class times the mutation rate compared at the 95% confidence limit). These results are consistent with the idea that each pol30 mutation may cause a defect in both MSH3-dependent and MSH6-dependent MMR but do not cause a complete defect in MMR.


View this table:
[in this window]
[in a new window]
 
TABLE 5. Comparison of CAN1 mutation spectra observed in different mutantsa

Consistent with pol30-201 and pol30-204 having defects in both MSH3- and MSH6-dependent MMR, both mutations had synergistic effects when combined with either an msh3{Delta} or an msh6{Delta} mutation. When the pol30-201 and pol30-204 mutations were combined with either an msh3 or an msh6 deletion, the double mutants showed higher mutation rates in all three assays compared to any of the single mutants (P < 0.05 in all cases, Mann-Whitney test). When the pol30-201 mutation was combined with either an msh3{Delta} mutation or an msh6{Delta} mutation, the mutation rates of the double mutants were significantly greater than the sum of rates of the individual single mutants and hence showed a synergistic interaction (95% confidence limits). The pol30-204 msh3{Delta} and pol30-204 msh6{Delta} double-mutant rates were also greater than additive (95% confidence limits). Interestingly, combining the pol30-201 and pol30-204 mutations with the msh3{Delta} mutation resulted in an approximately twofold-higher mutation rate in the hom3-10 assay and lys2-bgl frameshift reversion assays than was observed when the pol30-201 and pol30-204 mutations were combined with the msh6{Delta} mutation; this was a significant difference in each case (P < 0.05 in all cases, Mann-Whitney test). A similar effect was seen in the CAN1 assay when the mutation rates of the double mutants were compared to the mutation rates of the msh3{Delta} and msh6{Delta} single mutants. Combining the msh3F39F40-AA msh6F33F34-AA mutations, which eliminate the conserved FF of the PCNA interacting motif present in MSH3 and MSH6 (17, 18, 56), resulted in a small increase in mutation rate that was much less than that observed for the msh3{Delta} msh6{Delta} double mutant (P < 0.05 in all cases, Mann-Whitney test). However, combining the msh3F39F40-AA msh6F33F34-AA mutations with either the pol30-201 or the pol30-204 mutations caused synergistic increases in the mutation rate (95% confidence limits) (Table 4).

The observations discussed above do not fit simple models in which the pol30-201 and pol30-204 mutations cause an increase in errors that are substrates for MMR (synergism with all MMR-defective mutations predicted), cause a general defect in MMR (epistasis with MMR-defective mutations predicted), or cause a completely independent defect resulting in a mutator phenotype (additivity with MMR-defective mutations predicted). To more directly test the effect of the pol30-201 and pol30-204 mutations on MMR, the pol30-201 and the pol30-204 mutants were transformed with plasmids containing either an A/C mispair, a G/T mispair, or a -/T insertion/deletion mispair (9, 34), and the efficiency of plasmid MMR was measured (Table 6). The pol30-204 mutation did not appear to cause a defect in the repair of either the A/C or G/T mispair compared to the wild-type strain (P > 0.05, chi-square test) but did cause a small but significant defect in the repair of the -/T insertion/deletion mispair (P < 0.05, chi-square test). These results are consistent with the observation that the pol30-204 mutation only causes increased mutation rates that are 5 to 25% of the mutation rates caused by an msh2{Delta} mutation, depending on the assay. In contrast, the pol30-201 mutation caused a strong defect in the repair of the A/C and G/T mispairs (P < 0.05 for both cases, chi-square test), which was 66 to 81% of, but not the same as, that caused by msh2{Delta} or msh6{Delta} mutations (P < 0.05, chi-square test). The pol30-201 mutation also caused a small but significant defect in the repair of a -/T insertion/deletion mispair (P < 0.05, chi-square test) that was only 12% of the defect caused by an msh2{Delta} mutation and not statistically different from that caused by an msh6{Delta} mutation (P > 0.05, chi-square test). The pol30-201 mutation caused essentially the same pattern of defects in the repair of defined mispairs as were seen with an msh6{Delta} mutation, suggesting that the pol30-201 mutation strongly affects MSH6-dependent MMR. In contrast, the msh3{Delta} mutation caused a small defect in the repair of the A/C, G/T, and -/T insertion/deletion mispairs (P < 0.05 in all cases, chi-square test). The msh3F39F40-AA msh6F33F34-AA double mutation caused a small defect in the repair of the A/C, G/T, and -/T insertion/deletion mispairs (P < 0.05, chi-square test), a finding consistent with the mutation rate analysis (Table 4). These data on the repair of a mispaired base containing plasmids in conjunction with the mutation rate data support the hypotheses that pol30-201 causes a strong MMR defect that is primarily in MSH6-dependent MMR and that pol30-204 causes weak defects in both MSH3- and MSH6-dependent MMR.


View this table:
[in this window]
[in a new window]
 
TABLE 6. Effect of pol30 mutations on the repair of mispair-containing plasmids

Effect of pol30-201 and pol30-204 on the interaction between PCNA and MSH2-MSH6. To begin to understand the biochemical defects caused by the pol30-201 and pol30-204 mutations, the interaction between MSH2-MSH6 and either PCNA-201 or PCNA-204 was analyzed (17). Purified PCNA, PCNA-201, or PCNA-204, alone or in combination with purified MSH2-MSH6, was sedimented through glycerol gradients (Fig. 3 and Table 7). When PCNA was combined with the MSH2-MSH6 complex, PCNA and the MSH2-MSH6 complex cosedimented at 13.5 S, which was higher than either PCNA (6.1 S) or the MSH2-MSH6 complex alone (10.2 S) and was consistent with the formation of a 1:1 MSH2-MSH6 heterodimer-PCNA trimer complex (17). When PCNA-201 was combined with the MSH2-MSH6 complex, the two protein complexes sedimented together at 12.7 S, whereas PCNA-201 alone sedimented at 6.1 S and the MSH2-MSH6 complex alone sedimented at 10.2 S. These results indicate that PCNA-201 also forms a one MSH2-MSH6 heterodimer-one PCNA trimer complex when combined with MSH2-MSH6. In contrast, PCNA-204 alone sedimented at 4.4 S, and the MSH2-MSH6 complex sedimented at 10.2 S and, when they were combined, there was no change in the sedimentation position of the two protein complexes. These results indicate that PCNA-204 does not interact with MSH2-MSH6 and behaves similarly to the behavior previously observed for PCNA-52, PCNA-104, and PCNA-108. Within experimental error, PCNA-204 had the same S value and Stokes radius as observed for the known monomeric mutant PCNA, PCNA-52 (Table 7) (5). This indicates that PCNA-204 exists as a monomer in vitro, a result consistent with the idea the PCNA-204 protein functions as a trimer in vivo that has an altered conformation or altered stability.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 3. Sedimentation analysis of in vitro binding of PCNA to MSH2-MSH6 complex. MSH2-MSH6 complex and either wild-type or mutant PCNA, as indicated in each panel, were mixed and sedimented through glycerol gradients, and fractions were collected and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis as described in Materials and Methods. The first lane of each gel contains protein size standards, and the subsequent lanes contain the protein present in an aliquot of the indicated fraction number. Fraction 1 is the bottom of the gradient, and the top of the gradient was usually fraction 30. The peak fraction of wild-type PCNA sedimented alone was usually fraction 24, 25, or 26, and the peak fraction of wild-type MSH2-MSH6 sedimented alone was usually fraction 18, 19, or 20 (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 7. Physical characteristics of PCNA proteins and PCNA-MSH2-MSH6 complexes


arrow
DISCUSSION
 
To better understand the role of PCNA in MMR, we mutagenized a cloned POL30 gene by random mutagenesis and then screened the resulting POL30 plasmids for the presence of mutations that caused a mutator phenotype by using the plasmid shuffle technique (7). Twenty distinct mutations causing a mutator phenotype were obtained and then tested for their effect on sensitivity to temperature, MMS, UV light, and HU, as well as for whether they were lethal in combination with a rad52{Delta} mutation. The mutations fell into three classes: the first class caused a weak mutator phenotype; the second class caused a weak to strong mutator phenotype and MMS sensitivity, along with some combination of sensitivity to temperature or UV light and lethality in combination with a rad52{Delta} mutation; and the third class (pol30-201 and pol30-204) caused a moderate mutator phenotype and little or no other repair-related or growth defect that we could detect. Although it is possible that this class of mutations may cause repair and replication defects that we could not detect, they appear to be more MMR specific than previously described pol30 mutations. Additional analysis showed that the pol30-201 mutation acted like it caused a strong defect in the MSH6-dependent MMR pathway, with a small defect in the MSH3-dependent MMR pathway, and did not alter the interaction between PCNA and the MSH2-MSH6 complex. In contrast, the pol30-204 mutation acted like it caused a partial defect in the MSH6- and MSH3-dependent MMR pathways, and it completely eliminated the interaction between PCNA and the MSH2-MSH6 complex, as determined by sedimentation through glycerol gradients.

Previous studies have identified candidate MMR-defective pol30 mutations (pol30-52, pol30-104, and pol30-108) (9, 29, 31, 52) that cause a mutator phenotype and, in all cases tested, show at least a partial defect in an assay that directly analyzes the repair of mispair-containing plasmids (9). However, all of these mutations also cause other phenotypes, such as sensitivity to MMS, growth defects at low temperature, and synthetic lethality, when combined with a rad52{Delta} mutation (3, 5, 40). It has been suggested that cold-sensitive pol30 mutants have defects in replication because the mutants progress slowly through S phase (3), and subsequent studies have shown that pol30 mutants that show synthetic lethality with a rad52{Delta} mutation also have defects in replication, specifically in Okazaki fragment maturation, and accumulate single-stranded DNA fragments during growth (40). The fact that the pol30-52, pol30-104, and pol30-108 mutations cause a cold-sensitive phenotype (3) and show synthetic lethality when combined with a rad52{Delta} mutation (40) suggests that these mutations also cause replication defects. Two other pol30 mutations, pol30-70 and pol30-90, were shown to cause a mutator phenotype but were also shown to cause to varying extents defects in stimulation of DNA synthesis by DNA polymerases {delta} and {varepsilon}, as well as sensitivity to MMS, UV light, and HU and growth defects (14). These replication defects may result in increased errors, such as misincorporation or slippage errors, during DNA replication, which represent mutator phenotypes that are distinct from MMR defects, and this may explain why the pol30-52, pol30-104, and pol30-108 mutations show synergistic interactions when combined with an msh2{Delta} mutation and mutator phenotypes that differ from those caused by MMR defects (9, 31). These results indicate that most previously described pol30 mutator mutations cause significant defects other than MMR defects that contribute to their mutator phenotype; this makes it difficult to determine how much of the mutator phenotype they cause is the result of defective MMR. In the present study, 12 pol30 mutations were identified that caused a strong mutator phenotype, along with sensitivity to MMS. Of these, four pol30 mutations (pol30-203, pol30-210, pol30-214, and pol30-219) caused a strong cold-sensitive phenotype. These latter four mutations were the only mutations that were lethal in combination with a rad52{Delta} mutation, and the one that was further investigated (pol30-210) showed a significant cell cycle defect. These results further strengthen the correlation between cold sensitivity, cell cycle progression defects, and lethality with rad52{Delta}, as well as between mutator phenotypes, and a broad spectrum of other defects.

The pol30-201 and pol30-204 mutations caused a mutator phenotype. However, these two mutations did not appear to cause cold sensitivity, cell cycle progression defects, lethality in combination with a rad52{Delta} mutation, and sensitivity to MMS, UV light (note that pol30-204 may cause weak MMS and/or UV light sensitivity), or HU. These results are consistent with the idea that the pol30-201 and pol30-204 mutations cause defects that are more specific for MMR than the previously described pol30 mutations and that the resulting mutator phenotype is not the result of a replication defect or some other repair defect. The pol30-204 mutation caused little if any defect in the repair of plasmids containing a mispaired base and a small defect in the repair of an inserted base, a result that is consistent with the modest mutator phenotype caused by this mutation. The pol30-204 mutation caused a synergistic increase in mutation rate when combined with msh6{Delta} and msh3{Delta} mutations and no synergistic interaction with an msh2{Delta} mutation, suggesting that pol30-204 causes a partial defect in both the MSH6- and MSH3-dependent MMR pathways. The PCNA-204 protein is defective for interactions with the MSH2-MSH6 complex, and such weakened interaction with MSH2-MSH6, and presumably MSH2-MSH3 as well, may underlie the pol30-204 MMR defect. The pol30-204 mutation alters an amino acid located in the monomer-monomer interface region of PCNA (35), which is consistent with PCNA-204 existing as a monomer in vitro and an altered or destabilized configuration in vivo. The pol30-201 mutation caused a more striking synergistic increase in mutation rate when combined with an msh3{Delta} mutation compared to an msh6{Delta} mutation and no synergistic interaction with an msh2{Delta} mutation, suggesting that pol30-201 causes a greater defect in the MSH6-dependent MMR pathway than the MSH3-dependent MMR pathway. Consistent with this, the pol30-201 mutation caused almost a complete defect in the repair of base-base mispairs and only a small defect in the repair of an insertion/deletion mispair in the plasmid transformation assay. This result is very similar to that caused by an msh6{Delta} mutation and is distinct from the broader MMR defect caused by an msh2{Delta} mutation or the very small MMR defect caused by an msh3{Delta} mutation. PCNA-201 formed a stable complex with MSH2-MSH6, which suggests that the pol30-201 mutation may result in an inactive PCNA-MSH2-MSH6 complex and further suggests differences in how PCNA interacts with MSH6 versus MSH3. The pol30-201 mutation alters an amino acid located on the inner surface of the PCNA ring that slides on the DNA (35). This suggests that the PCNA-201-MSH2-MSH6 complex may not interact correctly with mispaired bases in DNA or may not interact correctly with other MMR proteins that function after the mispair recognition step.

A number of studies have shown that PCNA interacts with MSH3 and MSH6 and suggested this interaction is important for MMR (11, 17, 30). The pol30-52, pol30-104, and pol30-108 mutations, which cause a mutator phenotype (9, 29, 52), all disrupt the interaction between PCNA and MSH2-MSH6 (17). However, because these mutations cause replication and repair defects in addition to MMR defects (3, 40), the magnitude of the mutator phenotype they cause may not necessarily reflect the importance of the interaction between MSH2-MSH6 or MSH2-MSH3 and PCNA for MMR. The FF>AA amino acid substitution that eliminates the conserved FF residues of the PCNA interaction motif (56) of MSH6 and MSH3 also eliminates the in vitro interaction between MSH2-MSH6 or MSH2-MSH3 and PCNA, suggesting a role for PCNA in MMR (11, 17). Interestingly, the msh3FF-AA msh6FF-AA double mutation only caused a small increase in mutation rate and a small MMR defect in the plasmid transformation assay, indicating that this double mutation only causes an MMR defect that is ~1% the defect caused by an msh2{Delta} mutation (as seen in the hom3-10 assay). Similarly, the pol30-204 mutation, which appears to only cause a small MMR-specific defect, eliminates the in vitro binding of PCNA by MSH2-MSH6. These data suggest that either the interaction between MSH2-MSH6 or MSH2-MSH3 and PCNA is not particularly important for MMR or that the observed in vitro binding defects caused by different pol30 mutations may overestimate the extent of the in vivo interaction defects. It has been suggested that the interaction between PCNA and other proteins is complex, with the FF-containing motif functioning in the interaction, but that the interaction ultimately extends into other regions of the proteins (11, 17, 19, 21, 44). As a consequence, the FF>AA substitution might only cause a partial interaction defect in vivo. Consistent with this, combining the pol30-204 mutation with the msh3FF-AA msh6FF-AA double mutation resulted in a synergistic increase in mutation rate, despite the fact that the pol30-204 allele alters an amino acid that is not near the FF binding site. These data suggest that more extensive alterations in protein structure are required to disrupt the in vivo association of MSH2-MSH6 or MSH2-MSH3 with PCNA.

By isolating novel pol30 mutations, it has been possible to better define the in vivo requirement for PCNA in MMR, as well as to better determine the extent of the MMR defects resulting from defects in the interaction between PCNA and MMR proteins. Our results support the view that the association of MSH2-MSH6 or MSH2-MSH3 with PCNA is complex and extends beyond the FF-containing interaction motif. In addition, it appears that the interactions between PCNA and either MSH6 or MSH3 are quite different. The mutations we have described will provide useful tools for dissecting these protein-protein interactions at the biochemical level.


arrow
ACKNOWLEDGMENTS
 
We thank Dan Mazur, Chris Putnam, and Kristina Schmidt for comments on the manuscript and John Weger and Jill Green for DNA sequencing.

This work was supported by NIH grant GM50006 and by NIH/NCI cancer cell biology training grant 5T32CA67754.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Ludwig Institute for Cancer Research, UCSD School of Medicine-CMME3080, 9500 Gilman Dr., La Jolla, CA 92093-0660. Phone: (858) 534-7804. Fax: (858) 534-7750. E-mail: rkolodner{at}ucsd.edu. Back


arrow
REFERENCES
 
    1
  1. Aboussekhra, A., M. Biggerstaff, M. K. Shivji, J. A. Vilpo, V. Moncollin, V. N. Podust, M. Protic, U. Hubscher, J. M. Egly, and R. D. Wood. 1995. Mammalian DNA nucleotide excision repair reconstituted with purified protein components. Cell 80:859-868.[CrossRef][Medline]
  2. 2
  3. Alani, E. 1996. The Saccharomyces cerevisiae Msh2 and Msh6 proteins form a complex that specifically binds to duplex oligonucleotides containing mismatched DNA base pairs. Mol. Cell. Biol. 16:5604-5615.[Abstract]
  4. 3
  5. Amin, N., and C. Holm. 1996. In vivo analysis reveals that the interdomain region of the yeast proliferating cell nuclear antigen is important for DNA replication and repair. Genetics 144:479-493.[Abstract]
  6. 4
  7. Amin, N. S., M. Nguyen, S. Oh, and R. D. Kolodner. 2001. exo1-dependent mutator mutations: model system for studying functional interactions in mismatch repair. Mol. Cell. Biol. 21:5142-5155.[Abstract/Free Full Text]
  8. 5
  9. Ayyagari, R., K. J. Impellizzeri, B. L. Yoder, S. L. Gary, and P. M. Burgers. 1995. A mutational analysis of the yeast proliferating cell nuclear antigen indicates distinct roles in DNA replication and DNA repair. Mol. Cell. Biol. 15:4420-4429.[Abstract]
  10. 6
  11. Bishop, D. K., M. S. Williamson, S. Fogel, and R. D. Kolodner. 1987. The role of heteroduplex correction in gene conversion in Saccharomyces cerevisiae. Nature 328:362-364.[CrossRef][Medline]
  12. 7
  13. Budd, M., and J. L. Campbell. 1987. Temperature-sensitive mutation in the yeast DNA polymerase I gene. Proc. Natl. Acad. Sci. USA 84:2838-2842.[Abstract/Free Full Text]
  14. 8
  15. Buermeyer, A. B., S. M. Deschenes, S. M. Baker, and R. M. Liskay. 1999. Mammalian DNA mismatch repair. Annu. Rev. Genet. 33:533-564.[CrossRef][Medline]
  16. 9
  17. Chen, C., B. J. Merrill, P. J. Lau, C. Holm, and R. D. Kolodner. 1999. Saccharomyces cerevisiae pol30 (proliferating cell nuclear antigen) mutations impair replication fidelity and mismatch repair. Mol. Cell. Biol. 19:7801-7815.[Abstract/Free Full Text]
  18. 10
  19. Chen, C., K. Umezu, and R. D. Kolodner. 1998. Chromosomal rearrangements occur in S. cerevisiae rfa1 mutator mutants due to mutagenic lesions processed by double-strand-break repair. Mol. Cell 2:9-22.[CrossRef][Medline]
  20. 11
  21. Clark, A. B., F. Valle, K. Drotschmann, R. K. Gary, and T. A. Kunkel. 2000. Functional interaction of proliferating cell nuclear antigen with MSH2-MSH6 and MSH2-MSH3 complexes. J. Biol. Chem. 275:36498-36501.[Abstract/Free Full Text]
  22. 12
  23. Das Gupta, R., and R. D. Kolodner. 2000. Novel dominant mutations in Saccharomyces cerevisiae MSH6. Nat. Genet. 24:53-56.[CrossRef][Medline]
  24. 13
  25. Dianov, G. L., B. R. Jensen, M. K. Kenny, and V. A. Bohr. 1999. Replication protein A stimulates proliferating cell nuclear antigen-dependent repair of abasic sites in DNA by human cell extracts. Biochemistry 38:11021-11025.[CrossRef][Medline]
  26. 14
  27. Eissenberg, J. C., R. Ayyagari, X. V. Gomes, and P. M. Burgers. J. 1997. Mutations in yeast proliferating cell nuclear antigen define distinct sites for interaction with DNA polymerase {delta} and DNA polymerase {varepsilon}. Mol. Cell. Biol. 17:6367-6378.[Abstract]
  28. 15
  29. Fien, K., and B. Stillman. 1992. Identification of replication factor C from Saccharomyces cerevisiae: a component of leading-strand DNA replication complex. Mol. Cell. Biol. 12:155-163.[Abstract/Free Full Text]
  30. 16
  31. Flores-Rozas, H., and R. D. Kolodner. 1998. The Saccharomyces cerevisiae MLH3 gene functions in MSH3-dependent suppression of frameshift mutations. Proc. Natl. Acad. Sci. USA 95:12404-12409.[Abstract/Free Full Text]
  32. 17
  33. Flores-Rozas, H., D. Clark, and R. D. Kolodner. 2000. Proliferating cell nuclear antigen and Msh2p-Msh6p interact to form an active mispair recognition complex. Nat. Genet. 26:375-378.[CrossRef][Medline]
  34. 18
  35. Flores-Rozas, H., Z. Kelman, F. B. Dean, Z. Q. Pan, J. W. Harper, J. W. Elledge, M. O'Donnell, and J. Hurwitz. 1994. Cdk-interacting protein 1 directly binds with proliferating cell nuclear antigen and inhibits DNA replication catalyzed by the DNA polymerase delta holoenzyme. Proc. Natl. Acad. Sci. USA 91:8655-8659.[Abstract/Free Full Text]
  36. 19
  37. Frank, G., J. Qiu, L. Zheng, and B. Shen. 2001. Stimulation of eukaryotic flap endonuclease-1 activities by proliferating cell nuclear antigen (PCNA) is independent of its in vitro interaction via a consensus PCNA binding region. J. Biol. Chem. 276:36295-36302.[Abstract/Free Full Text]
  38. 20
  39. Genschel, J., S. J. Littman, J. T. Drummond, and P. Modrich. 1998. Isolation of MutSß from human cells and comparison of the mismatch repair specificities of MutSß and MutS{alpha}. J. Biol. Chem. 273:19895-19901.[Abstract/Free Full Text]
  40. 21
  41. Gomes, X. V., and P. M. J. Burgers. 2000. Two modes of FEN1 binding to PCNA regulated by DNA. EMBO J. 19:3811-3821.[CrossRef][Medline]
  42. 22
  43. Greene, C. N., and S. Jinks-Robertson. 1997. Frameshift intermediates in homopolymer runs are removed efficiently by yeast mismatch repair proteins. Mol. Cell. Biol. 17:2844-2850.[Abstract]
  44. 23
  45. Gu, L., Y. Hong, S. McCulloch, H. Watanabe, and G. Li. 1998. ATP-dependent interaction of human mismatch repair proteins and dual role of PCNA in mismatch repair. Nucleic Acids Res. 26:1173-1178.[Abstract/Free Full Text]
  46. 24
  47. Habraken, Y., P. Sung, L. Prakash, and S. Prakash. 1997. Enhancement of MSH2-MSH3-mediated mismatch recognition by the yeast MLH1-PMS1 complex. Curr. Biol. 7:790-793.[CrossRef][Medline]
  48. 25
  49. Habraken, Y., P. Sung, L. Prakash, and S. Prakash. 1996. Binding of insertion/deletion DNA mismatches by the heterodimer of yeast mismatch repair proteins MSH2 and MSH6. Curr. Biol. 6:1185-1187.[CrossRef][Medline]
  50. 26
  51. Harfe, B. D., and S. Jinks-Robertson. 2000. DNA mismatch repair and genetic instability. Annu. Rev. Genet. 34:359-399.[CrossRef][Medline]
  52. 27
  53. Harfe, B. D., B. K. Minesinger, and S. Jinks-Robertson. 2000. Discrete in vivo roles for the MutL homologs Mlh2p and Mlh3p in the removal of frameshift intermediates in budding yeast. Curr. Biol. 10:145-148.[CrossRef][Medline]
  54. 28
  55. Hutter, K. J., and H. E. Eipel. 1979. Microbial determinations by flow cytometry. J. Gen. Microbiol. 113:367-375.
  56. 29
  57. Johnson, R. E., G. K. Kovvali, S. N. Guzder, N. Amin, C. Holm, Y. Habraken, P. Sung, L. Prakash, and S. Prakash. 1996. Evidence for involvement of yeast proliferating cell nuclear antigen in DNA mismatch repair. J. Biol. Chem. 271:27987-27990.[Abstract/Free Full Text]
  58. 30
  59. Kleczkowska, H. E., G. Marra, T. Lettieri, and J. Jiricny. 2001. hMSH3 and hMSH6 interact with PCNA and colocalize with it to replication foci. Genes Dev. 15:724-736.[Abstract/Free Full Text]
  60. 31
  61. Kokoska, R. J., L. Stefanovic, A. B. Buermeyer, R. M. Liskay, and T. D. Petes. 1999. A mutation of the yeast gene encoding PCNA destabilizes both microsatellite and minisatellite DNA sequences. Genetics 151:511-519.[Abstract/Free Full Text]
  62. 32
  63. Kolodner, R. D. 1996. Biochemistry and genetics of eukaryotic mismatch repair. Genes Dev. 10:1433-1442.[Free Full Text]
  64. 33
  65. Kolodner, R. D., and G. T. Marsischky. 1999. Eukaryotic DNA mismatch repair. Curr. Opin. Genet. Dev. 9:89-96.[CrossRef][Medline]
  66. 34
  67. Kramer, B., W. Kramer, M. S. Williamson, and S. Fogel. 1989. Heteroduplex DNA correction in Saccharomyces cerevisiae is mismatch specific and requires functional PMS genes. Mol. Cell. Biol. 9:4432-4440.[Abstract/Free Full Text]
  68. 35
  69. Krishna, T. S. R., X. Kong, S. Gary, P. M. Burgers, and J. Kuriyan. 1994. Crystal structure of the eukaryotic DNA polymerase processivity factor PCNA. Cell 79:1233-1243.[CrossRef][Medline]
  70. 36
  71. Lea, D. E., and C. A. Coulson. 1948. The distribution of the numbers of mutants in bacterial populations. J. Genet. 49:264-285.
  72. 37
  73. Marsischky, G. T., and R. D. Kolodner. 1999. Biochemical characterization of the interaction between the Saccharomyces cerevisiae MSH2-MSH6 complex and mispaired bases in DNA. J. Biol. Chem. 274:26668-26682.[Abstract/Free Full Text]
  74. 38
  75. Marsischky, G. T., N. Filosi, M. F. Kane, and R. D. Kolodner. 1996. Redundancy of Saccharomyces cerevisiae MSH3 and MSH6 in MSH2-dependent mismatch repair. Genes Dev. 10:407-420.[Abstract/Free Full Text]
  76. 39
  77. Matsumoto, Y., K. Kim, J. Hurwitz, R. Gary, D. S. Levin, A. E. Tomkinson, and M. S. Park. 1999. Reconstitution of proliferating cell nuclear antigen-dependent repair of apurinic/apyrimidinic sites with purified human proteins. J. Biol. Chem. 274:33703-33708.[Abstract/Free Full Text]
  78. 40
  79. Merrill, B. J., and C. Holm. 1998. The RAD52 recombinational repair pathway is essential in pol30 (PCNA) mutants that accumulate small single-stranded DNA fragments during DNA synthesis. Genetics 148:611-624.[Abstract/Free Full Text]
  80. 41
  81. Modrich, P. 1991. Mechanisms and biological effects of mismatch repair. Annu. Rev. Genet. 25:229-253.[CrossRef][Medline]
  82. 42
  83. Modrich, P., and R. Lahue. 1996. Mismatch repair in replication fidelity, genetic recombination, and cancer biology. Annu. Rev. Biochem. 65:101-133.[CrossRef][Medline]
  84. 43
  85. Muhlrad, D., R. Hunter, and R. Parker. 1992. A rapid method for localized mutagenesis of yeast genes. Yeast 8:79-82.[CrossRef][Medline]
  86. 44
  87. Otterlei, M., E. Warbrick, T. A. Nagelhus, T. Haug, G. Slupphaug, M. Akbari, P. A. Aas, K. Steinsbekk, O. Bakke, and H. E. Krokan. 1999. Post-replicative base excision repair in replication foci. EMBO J. 18:3834-3844.[CrossRef][Medline]
  88. 45
  89. Prolla, T. A., D. M. Christie, and R. M. Liskay. 1994. A requirement in yeast DNA mismatch repair for MLH1 and PMS1, two homologs of the bacterial MutL gene. Mol. Cell. Biol. 14:407-415.[Abstract/Free Full Text]
  90. 46
  91. Prolla, T. A., Q. Pang, E. Alani, R. D. Kolodner, and R. M. Liskay. 1994. MLH1, PMS1, and MSH2 interactions during the initiation of DNA mismatch repair in yeast. Science 265:1091-1093.[Abstract/Free Full Text]
  92. 47
  93. Scherer, S., and R. W. Davis. 1979. Replacement of chromosome segments with altered DNA sequences constructed in vitro. Proc. Natl. Acad. Sci. USA 76:4951-4955.[Abstract/Free Full Text]
  94. 48
  95. Sherman, F., G. R. Fink, and J. B. Hicks. 1986. Methods in yeast genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  96. 49
  97. Shivji, M. K. K., M. K. Kenny, and R. D. Wood. 1992. Proliferating cell nuclear antigen is required for DNA excision repair. Cell 69:367-374.[CrossRef][Medline]
  98. 50
  99. Sia, E. A., R. J. Kokoska, M. Dominska, P. Greenwell, and T. D. Petes. 1997. Microsatelite instability in yeast: dependence on repeat unit size and DNA mismatch repair genes. Mol. Cell. Biol. 17:2851-2858.[Abstract]
  100. 51
  101. Tishkoff, D. X., N. Filosi, G. M. Gaida, and R. D. Kolodner. 1997. A novel mutation avoidance mechanism dependent on S. cerevisiae RAD27 is distinct from DNA mismatch repair. Cell 88:253-263.[CrossRef][Medline]
  102. 52
  103. Umar, A., A. B. Buermeyer, J. A. Simon, D. C. Thomas, A. B. Clark, R. M. Liskay, and T. A. Kunkel. 1996. Requirement for PCNA in DNA mismatch repair at a step preceding DNA resynthesis. Cell 87:65-73.[CrossRef][Medline]
  104. 53
  105. Umezu, K., N. Sugawara, C. Chen, J. E. Haber, and R. D. Kolodner. 1998. Genetic analysis of yeast RPA1 reveals its multiple functions in DNA metabolism. Genetics 148:989-1005.[Abstract/Free Full Text]
  106. 54
  107. Viswanathan, M., V. Burdett, C. Baitinger, P. Modrich, and S. T. Lovett. 2001. Redundant exonuclease involvement in Escherichia coli methyl-directed mismatch repair. J. Biol. Chem. 276:31053-31058.[Abstract/Free Full Text]
  108. 55
  109. Wang, T. F., N. Kleckner, and N. Hunter. 1999. Functional specificity of MutL homologs in yeast: evidence for three Mlh1-based heterocomplexes with distinct roles during meiosis in recombination and mismatch correction. Proc. Natl. Acad. Sci. USA 96:13914-13919.[Abstract/Free Full Text]
  110. 56
  111. Warbrick, E. 1998. PCNA binding through a conserved motif. Bioessays 20:195-199.[CrossRef][Medline]
  112. 57
  113. Williamson, M. S., J. C. Game, and S. Fogel. 1985. Meiotic gene conversion mutants in Saccharomyces cerevisiae. I. Isolation and characterization of pms1-1 and pms1-2. Genetics 110:609-646.[Abstract/Free Full Text]
  114. 58
  115. Xiong, Y., H. Zhang, and D. Beach. 1992. D type cyclins associate with multiple protein kinases and the DNA replication and repair factor PCNA. Cell 71:505-514.[CrossRef][Medline]


Molecular and Cellular Biology, October 2002, p. 6669-6680, Vol. 22, No. 19
0270-7306/02/$04.00+0     DOI: 10.1128/MCB.22.19.6669-6680.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Jiang, C., Komazin-Meredith, G., Tian, W., Coen, D. M., Hwang, C. B. C. (2009). Mutations That Increase DNA Binding by the Processivity Factor of Herpes Simplex Virus Affect Virus Production and DNA Replication Fidelity. J. Virol. 83: 7573-7580 [Abstract] [Full Text]  
  • Hong, Z., Jiang, J., Hashiguchi, K., Hoshi, M., Lan, L., Yasui, A. (2008). Recruitment of mismatch repair proteins to the site of DNA damage in human cells. J. Cell Sci. 121: 3146-3154 [Abstract] [Full Text]  
  • Xu, X., Page, J. L., Surtees, J. A., Liu, H., Lagedrost, S., Lu, Y., Bronson, R., Alani, E., Nikitin, A. Yu., Weiss, R. S. (2008). Broad Overexpression of Ribonucleotide Reductase Genes in Mice Specifically Induces Lung Neoplasms. Cancer Res. 68: 2652-2660 [Abstract] [Full Text]  
  • Stone, J. E., Ozbirn, R. G., Petes, T. D., Jinks-Robertson, S. (2008). Role of Proliferating Cell Nuclear Antigen Interactions in the Mismatch Repair-Dependent Processing of Mitotic and Meiotic Recombination Intermediates in Yeast. Genetics 178: 1221-1236 [Abstract] [Full Text]  
  • Masih, P. J., Kunnev, D., Melendy, T. (2008). Mismatch Repair proteins are recruited to replicating DNA through interaction with Proliferating Cell Nuclear Antigen (PCNA). Nucleic Acids Res 36: 67-75 [Abstract] [Full Text]  
  • Kow, Y. W., Bao, G., Reeves, J. W., Jinks-Robertson, S., Crouse, G. F. (2007). Oligonucleotide transformation of yeast reveals mismatch repair complexes to be differentially active on DNA replication strands. Proc. Natl. Acad. Sci. USA 104: 11352-11357 [Abstract] [Full Text]  
  • Jiang, C., Hwang, Y. T., Randell, J. C. W., Coen, D. M., Hwang, C. B. C. (2007). Mutations That Decrease DNA Binding of the Processivity Factor of the Herpes Simplex Virus DNA Polymerase Reduce Viral Yield, Alter the Kinetics of Viral DNA Replication, and Decrease the Fidelity of DNA Replication. J. Virol. 81: 3495-3502 [Abstract] [Full Text]  
  • Ivanov, I., Chapados, B. R., McCammon, J. A., Tainer, J. A. (2006). Proliferating cell nuclear antigen loaded onto double-stranded DNA: dynamics, minor groove interactions and functional implications. Nucleic Acids Res 34: 6023-6033 [Abstract] [Full Text]  
  • de Saro, F. J. L., Marinus, M. G., Modrich, P., O'Donnell, M. (2006). The beta Sliding Clamp Binds to Multiple Sites within MutL and MutS. J. Biol. Chem. 281: 14340-14349 [Abstract] [Full Text]  
  • Erdeniz, N., Dudley, S., Gealy, R., Jinks-Robertson, S., Liskay, R. M. (2005). Novel PMS1 Alleles Preferentially Affect the Repair of Primer Strand Loops during DNA Replication. Mol. Cell. Biol. 25: 9221-9231 [Abstract] [Full Text]  
  • Lau, P. J., Kolodner, R. D. (2003). Transfer of the MSH2{middle dot}MSH6 Complex from Proliferating Cell Nuclear Antigen to Mispaired Bases in DNA. J. Biol. Chem. 278: 14-17 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lau, P. J.
Right arrow Articles by Kolodner, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lau, P. J.
Right arrow Articles by Kolodner, R. D.