Previous Article | Next Article ![]()
Molecular and Cellular Biology, October 2002, p. 6979-6992, Vol. 22, No. 20
0270-7306/02/$04.00+0 DOI: 10.1128/MCB.22.20.6979-6992.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Banting and Best Department of Medical Research,1 Department of Molecular and Medical Genetics, University of Toronto,2 TYPO, Toronto Yeast Proteomics Organization, Toronto, Ontario, Canada,3 Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts 02115,4 Department of Biochemistry, St. Louis University School of Medicine, St. Louis, Missouri 631045
Received 20 May 2002/ Returned for modification 20 June 2002/ Accepted 16 July 2002
|
|
|---|
|
|
|---|
Whereas general transcription factors are required for promoter-directed transcription initiation, and the multisubunit Srb/Mediator complex is associated with the RNAPII holoenzyme that binds to promoters in the yeast Saccharomyces cerevisiae, RNAPII can elongate the transcript unaided. However, several factors have been discovered that stimulate elongation on nonchromatin, "naked" DNA templates (e.g., TFIIS and TFIIF) (32, 47). Recently, other factors have been identified that are thought to affect RNAPII transcript elongation via effects on chromatin. These include the yeast factors Spt4 and Spt5 (corresponding to human 5,6-dichloro-1-ß-D-ribofuranosylbenzimidazole [DRB] sensitivity-inducing factor [DSIF], which is required for activation of elongation by human immunodeficiency virus Tat) (46), Elongator (30), Spt6 (15), and Spt16/Pob3 (corresponding to human FACT [facilitates chromatin transcription]) (28). Elongator copurified with the elongating form of RNAPII, and it was shown to bind preferentially to the hyperphosphorylated form of RNAPII in vitro (30). The Elp3 subunit of Elongator has histone acetyltransferase (HAT) activity in vitro (48), suggesting that the HAT activity of Elp3 may assist RNAPII during transcription elongation on a chromatin template. Human FACT stimulates transcriptional elongation on a chromatin template in a partially defined in vitro system and has been shown to interact with nucleosomes and histone H2A/H2B dimers (28, 29). Recently, FACT has also been identified in a complex containing human casein kinase II (CKII) that phosphorylates the tumor suppressor protein p53 (18).
Purification of proteins interacting with and affecting the activity of RNAPII has generally involved either conventional chromatography or RNAPII affinity chromatography, a procedure that identifies human TFIIF (RAP30/RAP74) and TFIIS (38). However, conventional or affinity purifications usually require either ion exchangers and hydrophobic columns (in the former case) or high salt concentrations (in the latter case) to reduce nonspecific protein binding to the column matrix. These conditions could potentially disrupt interactions that stabilize some protein complexes. To circumvent these problems, affinity tags that are fused to selected target proteins have been widely used to purify protein complexes. In most cases, however, it has again been necessary to use high salt concentrations to reduce nonspecific binding of proteins to solid supports.
Recently, a tandem affinity purification (TAP) scheme, in which two adjacent tags (calmodulin-binding peptide and Staphylococcus aureus protein A) separated by a tobacco etch virus (TEV) protease site were fused to the protein of interest, was described (33). The use of two tags and, consequently, two independent purification steps allowed protein purification to be carried out under native conditions at near-physiological ionic strengths while still maintaining a low background (defined as the protein yield from an extract derived from an untagged strain). Under these circumstances, protein complexes containing proteins that are weakly associated in vivo have a greater chance of remaining associated during the purification procedure.
Most of the RNAPII elongation factors of S. cerevisiae are poorly characterized. Moreover, conventional purifications of human proteins previously implicated in transcriptional elongation may have resulted in the loss of one or more associated proteins. In order to systematically characterize the yeast transcriptional elongation factors, we devised a modification of the TAP procedure (33) in which dilution of the yeast extract during the purification procedure was minimized and high salt concentrations were avoided. In most cases, purification using this procedure unveiled new protein-protein interactions and sometimes new polypeptides involved in transcriptional elongation in S. cerevisiae. Furthermore, the data revealed that the salt concentrations used during purification were critical in certain cases.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Yeast strains used in this study
|
Protein identification. Protein bands were reduced, alkylated, and subjected to in-gel tryptic digestion, and the peptides were then purified and identified by matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF) mass spectrometry with a PerSeptive DE STR instrument (26). For tandem mass spectrometry, the TCA-precipitated protein was resuspended in 100 mM NH4HCO3/1 mM CaCl2 buffer, pH 8.5, and digested overnight at 37°C with 2 µl of immobilized Poros trypsin beads (PerSeptive). The entire digest was fractionated as described previously (10) on a 7.5-cm (inner diameter, 100 µm) reverse-phase C18 capillary column attached in-line to a Finnigan LCQ-Deca ion trap mass spectrometer by ramping a linear gradient from 2 to 60% solvent B in 90 min. Solvent A consisted of 5% acetonitrile, 0.5% acetic acid, and 0.02% heptafluorobutanoic acid (HFBA), and solvent B consisted of acetonitrile-water (80:20) containing 0.5% acetic acid and 0.02% HFBA. The flow rate at the tip of the needle was set to 300 nl/min by programming the high-performance liquid chromatography pump and using a split line. The mass spectrometer cycled through four scans as the gradient progressed. The first was a full mass scan followed by successive tandem mass scans of the three most intense ions. A dynamic exclusion list was used to limit collection of tandem mass spectra for peptides that eluted over a long period of time. All tandem mass spectra were searched by using the SEQUEST computer algorithm against the complete yeast protein database (6/2,000). Each high-scoring peptide sequence was manually compared with the corresponding tandem mass spectrum to ensure that the match was correct.
ChIP. Chromatin immunoprecipitation (ChIP) and PCRs were performed as described previously (22). All yeast strains were grown at 30°C to an OD595 of 0.4 to 0.6. Sequences for the ADH1 3' untranslated region primer pair are as follows: ADH11231, ACCGGCATGCCGAGCAAATGCCTG; ADH11400, CCCAACTGAAGGCTAGGCTGTGG.
|
|
|---|
Spt5 is a phosphoprotein that associates with Spt4 or Spt6. Human DSIF and NELF (negative elongation factor) have previously been identified and purified as inhibitory elongation factors that make transcription sensitive to DRB (46, 49). DSIF consists of 160- and 14-kDa subunits and can also stimulate transcriptional elongation under certain conditions. The yeast homologues of the DSIF subunits, Spt4 and Spt5, also form a complex, and mutations in the genes encoding these proteins result in sensitivity to 6-azauracil (15), often considered to be an important criterion for mutations in yeast genes that encode elongation factors (2, 9). More recently, the Drosophila homologue of Spt5 was shown to colocalize with stalled, hypophosphorylated RNAPII on Drosophila heat shock genes in the absence of induction and with hyperphosphorylated, actively elongating RNAPII during salivary gland development, also implying that Spt5 is an elongation factor (1, 17).
Purification of tagged Spt4 from yeast extracts in the presence of 100 mM NaCl resulted in copurification of three forms of Spt5 as well as a substoichiometric amount of RNAPII (Fig. 1A). The three electrophoretically distinct forms of Spt5 were consistently observed, but they are probably caused by C-terminal degradation, because the tagging and purification of Spt5 resulted in the isolation of only one form of tagged Spt5 (Fig. 1A). Copurifying with the tagged Spt5 were Spt4, a substoichiometric amount of RNAPII, and, surprisingly, a truncated form of Spt6. The small untagged Spt4 polypeptide ran off the gel shown in Fig. 1A, but the presence of Spt4 in the sample applied to the gel was confirmed by tandem mass spectrometry. These results implied that Spt5 can associate either with Spt4 or with a modified form of Spt6. Analysis of the complexes containing tagged Spt4 or Spt5 by use of tandem mass spectrometry served to identify a phosphorylation site in Spt5 on serine 188 in the sequence SDDE, which is the start of a consensus CKII phosphorylation site [(S/T)-(D/E)-X-(D/E)] (see Fig. 2B) (12).
![]() ![]() View larger version (112K): [in a new window] |
FIG. 1. Isolation of protein complexes containing Spt4, Spt5, and Spt6. (A) TAPs of the Spt4/Spt5 complex were carried out on strains containing either no tagged protein or TAP-tagged versions of Spt4 or Spt5. Protein complexes were purified in the presence of 100 mM NaCl and were then analyzed by SDS-PAGE and silver staining. Spt4, Spt5, subunits of RNAPII, and a truncated form of Spt6 were identified by trypsin digestion and MALDI-TOF mass spectrometry. In the purification of tagged Spt5, the presence of Spt4 was identified by subjecting an aliquot of the eluate from the final column directly to trypsin digestion and tandem mass spectrometry. (B) TAP of Spt6. Purification using an extract containing a TAP-tagged version of Spt6 in 100 mM NaCl resulted in isolation of three forms of the tagged protein and a previously uncharacterized protein encoded by ORF YPR133c, whose gene product we have called Iws1 (interacts with Spt6). (C) TAP of Iws1. Tagging and isolation of Iws1 in 100 mM salt resulted in copurification of a stoichiometric amount of one form of Spt6. Because both Spt6-TAP and Iws1-TAP were run on the same gel, it could be concluded that Iws1 copurified with only the slowest-migrating form of Spt6.
|
![]() View larger version (29K): [in a new window] |
FIG. 2. Detection of phosphorylation on putative CKII sites in Spt5, Spt6, and Iws1. (A) Identification of phosphorylation sites in Spt6. Tandem mass spectrometry was used to identify three tryptic fragments in the N-terminal region of Spt6 that were phosphorylated on serine residues (serines 95 [SEDD], 135 [SESD], and 207 [SDED]). Each phosphorylated serine residue in Spt6 was at the beginning of a consensus CKII site. (B) Phosphorylation of a conserved serine present in both Spt5 and Iws1. Mass spectrometry successfully detected a phosphorylation site on serine 89 (SDDD) of Iws1 as well as on serine 188 (SDDE) of Spt5; each of these occurs at the start of a putative CKII site. The acidic N-terminal regions of Spt5 and Iws1 have sequence similarity, and their phosphorylated serine residues align perfectly. The regions compared have 23% identity and 40% similarity.
|
Tagging and purification of yeast Spt6 resulted in copurification of substoichiometric amounts of a previously uncharacterized protein, encoded by the essential open reading frame (ORF) YPR133c, which we have called Iws1 (interacts with Spt6) (Fig. 1B). Conversely, tagging and purification of Iws1 resulted in the isolation of Spt6, further confirming that this interaction occurs in vivo (Fig. 1C). There were three electrophoretically distinct forms of tagged Spt6, but only the form with the lowest electrophoretic mobility copurified with tagged Iws1. It is not clear whether the higher-mobility forms of tagged Spt6 are a consequence of posttranslational modification or in vitro or in vivo degradation.
Tandem mass spectrometry was used to identify three tryptic fragments in the N-terminal region of Spt6 that were phosphorylated on serine residues (serines 95 [SEDD], 135 [SESD], and 207 [SDED]) (Fig. 2A). As was the case for Spt5, each phosphorylated serine residue in Spt6 was at the beginning of a consensus CKII site. Many more putative CKII sites exist in the N-terminal region of Spt6, but tandem mass spectrometry did not detect phosphorylation at these sites. We did detect a phosphorylation site on serine 89 (SDDD) of Iws1, which is also a putative CKII site. Interestingly, the acidic N-terminal regions of Spt5 and Iws1 have sequence similarity (Fig. 2B), and surprisingly, their phosphorylated serine residues align perfectly, perhaps explaining why Spt6 can interact with both of them.
Spt16/Pob3 associates with multiple protein complexes. Human FACT was purified as a factor that overcame a nucleosomal block to elongation by RNAPII in vitro and is composed of human homologues of yeast Spt16/Cdc68 and Pob3 (28, 29). FACT interacts with nucleosomes and histone H2A-H2B dimers and might, therefore, promote nucleosome disruption during transcriptional elongation. Moreover, the yeast SPT16 gene interacts genetically with the genes encoding the yeast elongation factors TFIIS and Spt4 (41).
When the yeast counterparts of FACT, Spt16 and Pob3, were tagged and subsequently purified from yeast extracts in buffers containing 150 mM NaCl, large and approximately stoichiometric amounts of Spt16 and Pob3 were isolated and no other proteins were detected by silver staining (Fig. 3A). However, when the NaCl concentration used throughout the purification was reduced to 125 mM, many other proteins copurified with Spt16 and Pob3 in substoichiometric amounts (Fig. 3B). When the NaCl concentration was further reduced to 100 mM (Fig. 3C and D), the yields of the proteins associated with Spt16 and Pob3 increased substantially. In each case, none of the Spt16/Pob3-associated proteins were detected in parallel purifications carried out with extracts derived from an untagged strain (Fig. 3A, B, and C).
![]() ![]() ![]() ![]() ![]() View larger version (207K): [in a new window] |
FIG. 3. Spt16/Pob3 associates with several protein complexes. (A) TAPs of Spt16 and Pob3 from TAP-tagged strains in buffers containing 150 mM NaCl. Purified preparations were analyzed by SDS-PAGE and silver staining. Spt16 and Pob3 were identified by mass spectrometry. (B) Purification of Spt16/Pob3 complexes in buffers containing 125 mM NaCl. Analysis by SDS-PAGE and silver staining revealed that a number of other polypeptides copurified with tagged Spt16 and Pob3. (C and D) Tagged Spt16 was purified in buffers containing 100 mM NaCl, resulting in an increased yield of proteins associated with Spt16/Pob3. The purified preparation was electrophoresed on gels containing 10% (C) or 15% (D) polyacrylamide. The additional proteins identified by mass spectrometry were Chd1, Ctr9, Paf1, Cdc73, Rtf1, Leo1, Yol054w, all four subunits of CKII, and histones. (E) TAP of tagged Chd1 in the presence of 100 mM salt. The purified protein was analyzed by SDS-PAGE, silver staining, and mass spectrometry. Tagged Chd1 copurified with seemingly stoichiometric amounts of the four subunits of CKII (CkaI, CkaII, CkbI, and CkbII) as well as substoichiometric amounts of Spt16 and Pob3. (F through H) TAPs of Leo1, Rtf1, and Ctr9 (F), Paf1 (G), and Cdc73 (H) (all in the presence of 100 mM NaCl) resulted in isolation of complexes containing Rtf1, Leo1, Ctr9, Paf1, and Cdc73, as well as Spt16 and Pob3, but no histones. (I) Sensitivities of deletion strains to 6-azauracil. Strains containing the rtf1 , paf1 , cdc73 , leo1 , chd1 , or dst1 deletion, as well as plasmid pRS316, were plated on SD-uracil medium with or without the drug 6-azauracil (50 µg/ml) and were grown at 30°C for 2 to 4 days. WT, wild type.
|
The plethora of proteins we identified in association with Spt16 and Pob3 raised the possibility that several distinct protein complexes were associated with Spt16 and Pob3. To resolve these complexes, we tagged and purified from yeast extracts the various proteins that were associated with Spt16 and Pob3. Tagging of Chd1 resulted in copurification of approximately stoichiometric amounts of the four subunits of CKII (CkaI, CkaII, CkbI, and CkbII), as well as substoichiometric amounts of Spt16 and Pob3 (Fig. 3E), but none of the other polypeptides that had copurified with Spt16 and Pob3. Tagging and purification of Ctr9 resulted in the coisolation of Rtf1, Leo1, Paf1, and Cdc73, as well as Spt16 and Pob3, but neither the histones nor CKII and Chd1 (Fig. 3F). However, tagging and purification of histone H3 did result in the copurification of Spt16 and Pob3 (data not shown). These results indicated that there are at least three separable complexes that associate with Spt16 and Pob3: histones and nucleosomes, Chd1/CKII, and the complex containing Ctr9, Paf1, Cdc73, Rtf1, and Leo1. Confirmation came from experiments in which we labeled and purified Leo1 and Rtf1 (Fig. 3F), Paf1 (Fig. 3G), and Cdc73 (Fig. 3H). In each case, we observed all of the untagged components of this subcomplex, as well as amounts of Spt16 and Pob3 that varied from near-stoichiometric to clearly substoichiometric. In certain cases, there were two distinct forms of Paf1, Cdc73, or Ctr9, although we have not yet determined whether these are consequences of degradation, processing, or posttranslational modification. Although Yol054w had copurified with tagged Spt16 and Pob3, we did not observe copurification of Yol054w with tagged Paf1, Ctr9, Cdc73, Rtf1, or Leo1, suggesting that Yol054w may be directly associated with Spt16 or Pob3.
To determine if the polypeptides copurifying with Spt16/Pob3 might be involved in transcriptional elongation in vivo, strains harboring knockouts of genes encoding some of the nonessential subunits of the Spt16/Pob3 complex were tested for sensitivity to 6-azauracil. The drug 6-azauracil results in reductions in UTP and GTP concentrations in yeast cells, leads to induction of the PUR5 gene (35), and has been shown to affect the elongation efficiency of RNAPII (9). Therefore, sensitivity to this compound has been used as an indicator for involvement in transcriptional elongation. Studies using 6-azauracil have helped to show that genes like DST1, which encodes TFIIS, encode factors that have a role in transcriptional elongation (2). When dst1
was used as a control, deletions in rtf1, paf1, cdc73, and leo1, but not chd1, resulted in significant or marked sensitivity to 50 µg of 6-azauracil/ml (Fig. 3I).
Purification of TFIIF and TFIIS. TFIIF is a general transcription factor that interacts with RNAPII and can recruit RNAPII to a preinitiation complex containing TFIID and TFIIB (14). TFIIF also participates in promoter clearance and can associate with RNAPII in vitro during chain elongation, enhancing its polymerization rate and processivity (7, 32). It is thought that TFIIF acts during the early stages of elongation and prevents abortive transcription, perhaps by increasing the rate of nucleotide addition.
In yeast, TFIIF is comprised of the three subunits Tfg1, Tfg2, and Tfg3. When each subunit was tagged and purified from yeast extracts in buffers containing 150 mM NaCl, a complex containing all three subunits of TFIIF was isolated along with a nearly stoichiometric amount of RNAPII (Fig. 4A).
![]() View larger version (45K): [in a new window] |
FIG. 4. TAPs of TFIIF and TFIIS and detection of RNAPII interactions by Western blot analysis. (A) Purification of TFIIF by using TAP-tagged versions of Tfg1, Tfg2, and Tfg3. Purified proteins were analyzed by SDS-PAGE, silver staining, and mass spectrometry. Purification of any of the three subunits of TFIIF in buffers containing 150 mM NaCl results in isolation of all three components of TFIIF as well as a substoichiometric amount of RNAPII. (B) Tagging and purification of TFIIS. Purification of TFIIS (encoded by the DST1 gene) in buffers containing 100 mM NaCl resulted in the isolation of predominantly TFIIS. Further development of the silver stain revealed only background proteins and none that had copurified with TFIIS. (C) Western blot analysis of transcription elongation factors purified in the presence of 100 mM NaCl by using monoclonal antibody 8WG16, which binds to the CTD of the largest subunit of RNAPII, Rpb1. As a positive control, RNAPII was purified from a strain with a TAP tag on its third-largest subunit, Rpb3. Equal volumes of the column eluates from the various purifications were loaded onto the gel, except that approximately 10 times less of the Rpb3 purification was loaded. RNAPII, in the presence of 100 mM NaCl, copurified with TFIIF (Tfg1, -2, and -3), Spt4/Spt5, Spt6/Iws1, TFIIS, Spt16, and Paf1/Rtf1, but not with Elongator (Elp1 and Elp5) or Chd1.
|
Isolation of a holo-Elongator complex. Because the three-subunit Elongator complex was originally found associated with the elongating form of RNAPII and was shown to preferentially bind to the hyperphosphorylated form of RNAPII in vitro (30), it was hypothesized that Elongator replaces the mediator during the switch from transcription initiation to elongation. By using extracts from individual strains containing tagged versions of the three known Elongator subunits, Elp1, Elp2, and Elp3, a six-subunit yeast holo-Elongator complex containing three additional polypeptides, Elp4, Elp5, and Elp6, was subsequently isolated (23). When purification was carried out at higher salt concentrations, Elongator could be separated into two subcomplexes, one consisting of Elp1, -2, and -3 and the other consisting of Elp4, -5, and -6 (23). Interestingly, no RNAPII detectable by silver staining was present in our Elongator preparations, even when microgram quantities of Elongator were loaded onto the gel (23) (data not shown).
Copurification of the yeast elongation factors with RNAPII. Human TFIIS, TFIIF, and Spt5 are known to bind directly to RNAPII (32, 38, 46). As well, Ctr9, Paf1, and Cdc73 were identified as components of a yeast protein complex that binds to RNAPII (21, 36), and Elongator copurified with chromatin-bound elongating RNAPII (30). Enough RNAPII copurified with tagged TFIIF, Spt4, and Spt5 for us to detect its two largest subunits, Rpb1 and Rpb2, by silver staining and identify them by mass spectrometry (Fig. 1A and 4A). We used the more sensitive Western blot technique with a monoclonal antibody directed against Rpb1 to determine which yeast elongation factors were associated more weakly with RNAPII (Fig. 4C). Purification of RNAPII itself from a strain containing a TAP tag on Rpb3, the third-largest subunit of RNAPII, showed that the soluble yeast extracts used for our purifications indeed contained RNAPII recognized by monoclonal antibody 8WG16 (Fig. 4C). All of the tagged elongation factor subunits copurified with at least some RNAPII except Chd1 and Elongator. Chd1 may not copurify with RNAPII simply because its association with RNAPII is too indirect: it is weakly associated with Spt16/Pob3, which in turn is weakly associated with Paf1/Ctr9/Cdc73/Rtf1/Leo1, which in turn is weakly associated with RNAPII (see Fig. 6). Remarkably, no detectable RNAPII copurified with Elongator when either Elp1 or Elp5 was tagged and purified, even when as much as 1 µg of purified Elongator was loaded onto the gel (Fig. 4C), and similar results were obtained with tagged Elp2 and Elp3 (data not shown). In other experiments (data not shown), we used antibodies specific for the phosphorylated C-terminal domain (CTD) on Rpb1. Although purification of tagged Rpb3 revealed that our extracts contained some phosphorylated Rpb1, phosphorylated Rpb1, like the mostly unphosphorylated Rpb1 recognized by the antibody (8WG16) used in Fig. 4C, did not copurify with Elongator tagged on Elp1 or Elp5.
![]() View larger version (14K): [in a new window] |
FIG. 6. Comprehensive interaction map for the RNAPII elongation factors. For details, see the text.
|
All three subunits of TFIIF, namely, Tfg1, Tfg2, and Tfg3, cross-linked to the promoter region of ADH1 but not to the coding region or 3' untranslated region (Fig. 5A). These results suggested that, whereas TFIIF is a stable component of the initiation complex and may play a role in early elongation, it does not remain stably associated with elongating RNAPII in vivo. In contrast, all components of the Paf1 complex were found to cross-link specifically to all three regions of the ADH1 gene that were tested, including the novel, uncharacterized protein Leo1 (Fig. 5B); that is, all three fragments of the ADH1 gene were enriched by immunoprecipitation relative to a DNA fragment from a nontranscribed region, no matter which subunit of the Paf1/Ctr9/Cdc73/Rtf1/Leo1 complex was tagged. Similarly, the ChIP patterns of Spt6 and Iws1 were almost identical, and both displayed the same degree of cross-linking to all three regions of the ADH1 gene (Fig. 5C). Interestingly, ChIP assays demonstrated that Elongator subunits did not cross-link to any part of the ADH1 gene or to a number of other genes that were tested (our unpublished data).
![]() View larger version (32K): [in a new window] |
FIG. 5. ChIP assays with TFIIF, Paf1/Leo1/Ctr9/Cdc73/Rtf1, and Spt6/Iws1. ChIP was performed with strains containing TAP-tagged versions of the TFIIF subunits Tfg1, Tfg2, and Tfg3 (A), Paf1, Cdc73, Rtf1, Leo1, and Ctr9 (B), or Spt6 and Iws1 (C). To monitor the presence of each protein along the ADH1 gene, chromatin was immunoprecipitated with rabbit IgG-agarose and PCR amplified with primer pairs recognizing promoter (P), coding (C), and 3' untranslated (U) regions (see schematic in panel A). Each PCR contained a second primer pair that amplified a region of chromosome V devoid of ORFs (marked by asterisks), thus providing an internal control for background. Input, signal from chromatin before immunoprecipitation. Primer pairs used are as follows: for P, ADH1-235 and ADH1-13; for C, ADH1844 and ADH11013; for U, ADH11231 and ADH11400; and for the nontranscribed region, Intergenic V-1 and Intergenic V-2.
|
|
|
|---|
Collectively, these previously published studies implicated 13 polypeptides as having possible roles in chain elongation by yeast RNAPII. However, only TFIIS, TFIIF, and Elongator had ever been purified; moreover, none of the yeast elongation factors had been purified under conditions designed to minimize subunit loss during the purification procedure, raising the possibility that there were intersubunit associations and new elongation factor subunits that had yet to be discovered. Based on the experiments we have described here and other experiments (N. J. Krogan and J. F. Greenblatt, unpublished data), we believe that complexes containing proteins that are weakly associated in vivo have a greater chance of remaining associated during purification when dilution is minimized and purification is carried out using near-physiological ionic strengths. The web of interactions among the RNAPII elongation factors that we uncovered by these procedures is illustrated in Fig. 6.
Most importantly, these procedures enabled us to discover that Spt16/Pob3 associates with 14 other polypeptides, namely, Rtf1 and the core histones, as well as Chd1, the four subunits of yeast CKII, a three-protein complex (Paf1/Ctr9/Cdc73) known to associate with RNAPII, and one or two proteins of unknown function, Leo1 and possibly Yol054w. A relatively small change in the NaCl concentration used for the purification, from 150 to 125 or 100 mM, enabled us to identify all these Spt16/Pob3-associated proteins rather than just Spt16 and Pob3. Tagging each of the other proteins associated with Spt16/Pob3 revealed that the Spt16/Pob3 complex associates with three distinct protein complexes: the core histones, Chd1/CKII, and Rtf1/Paf1/Ctr9/Cdc73/Leo1 (see Fig. 6). It is not clear whether these three protein complexes associate simultaneously with Spt16/Pob3. Simultaneous association would imply that Spt16/Pob3 is a scaffold for the coassembly of all these factors.
The interaction of Spt16/Pob3 with Chd1 and the core histones is in accord with similar findings for human FACT (19, 28, 29). Kelley et al. (19) showed that the human homologues of Pob3 and Chd1 interact physically in vitro and in vivo. As well, a chd1
mutation suppressed the growth defect conferred by a particular pob3 point mutation (8) and may also result in resistance to 6-azauracil in some strain backgrounds (although not particularly in the one we have used here), implicating Chd1 in transcriptional elongation (44). FACT was also observed to copurify with human CKII in a complex that phosphorylated p53 (18), but it is not clear whether human CHD1 was also part of this complex. The results we obtained by tagging and purifying Chd1 imply that yeast Chd1 is directly associated with CKII (see Fig. 6). One possibility is that Chd1 controls elongation by controlling the phosphorylation of an elongation factor by CKII. Definitive proof that Chd1 is an elongation factor awaits experiments showing that it can directly affect elongation by RNAPII in vivo or in vitro.
It was recently shown that Paf1 (RNAPII-associated factor), Cdc73, and Ctr9 form a complex that associates with RNAPII (21, 36). However, the roles of these proteins in transcription by RNAPII were unclear. The observation that combining a PAF1 deletion with deletion of the mediator subunit SRB5 is lethal was used to argue that the Paf1 complex is involved in initiation (36). However, we found that Paf1, Cdc73, and Ctr9 are associated with Spt16/Pob3 in a complex that also contains Rtf1 and Leo1, and so it is likely that this complex mediates the interaction between Spt16/Pob3 and RNAPII. Rtf1 (restores TBP function) was originally shown to affect the function of the TATA-binding protein (TBP) (40). However, recent work has suggested that it is likely to play a role in elongation by RNAPII, since a strain with a deletion of RTF1 is sensitive to 6-azauracil, a phenotype associated with defects in transcriptional elongation (8). Also, a deletion of RTF1 has been shown to genetically interact with point mutations in the essential genes SPT16 and POB3. In view of the genetically defined role of Rtf1 in elongation and the association of Paf1/Ctr9/Cdc73 with RNAPII, it is very likely that the Rtf1/Paf1/Ctr9/Cdc73/Leo1 complex has an important role in the behavior of Spt16/Pob3 as an elongation factor. Consistent with this, we found that paf1
, leo1
, and cdc73
strains are sensitive to 6-azauracil, implicating the products of these genes in transcriptional elongation in vivo. Further confirmation that Paf1/Cdc73/Ctr9/Rtf1/Leo1 is involved in elongation came from ChIP experiments showing that these proteins are associated with the transcribed regions of ADH1 and other genes (our data and reference 31) and from recently published genetic and coimmunoprecipitation experiments examining the roles of these proteins (27, 39). However, in contrast to this work, neither study was able to detect a stable physical association between the Paf1 complex and Spt16/Pob3. Nevertheless, definitive proof that Paf1, Cdc73, Ctr9, Rtf1, and Leo1 are elongation factors awaits experiments showing directly that they have elongation activity in vivo or in vitro.
Tagging and purification of Rtf1, Paf1, Ctr9, or Cdc73 resulted in copurification of the same set of polypeptides that included these proteins as well as Leo1, Spt16, and Pob3, confirming that all are truly associated with Spt16/Pob3. Since it is possible that the presence of the TAP tag on a protein may impair its function in vivo, strains harboring individual tagged components of the Paf1 complex were tested for sensitivity to 6-azauracil. The strains containing the tagged proteins did not confer any significant sensitivity to the drug, implying the tag is not very detrimental to the function of the complex (data not shown). It can similarly be inferred that C-terminal tags on Spt16, Pob3, Spt5, Spt6, Iws1, Tfg1, and Tfg2 are not very detrimental, because these proteins are all encoded by essential genes, and tagged haploid strains are viable and grow well in all cases. Although the uncharacterized polypeptide Yol054w was detected when tagged Spt16 was purified in buffers containing 100 mM NaCl, it was not observed to copurify with any of the other tagged proteins. Efforts to tag Yol054w were unsuccessful, and so we cannot conclude that Yol054w is a bona fide subunit of any of these complexes. It is possible, however, that Yol054w is directly associated with Spt16 or Pob3 (see Fig. 6).
When all three subunits of TFIIF (Tfg1, Tfg2, and Tfg3) were tagged and purified in buffers containing 150 mM NaCl, the three proteins copurified with a near-stoichiometric amount of RNAPII in each case. This showed that TFIIF interacts with RNAPII in vivo, as suggested by experiments in many systems (7, 38) which demonstrated that TFIIF interacts with RNAPII in vitro. However, Tfg3 has also been reported to be associated with a number of other complexes, including the transcription initiation factor TFIID and the chromatin-modifying complexes SWI/SNF and NuA3 (5, 13, 16). When an extract from a Tfg3-tagged strain was used to purify the smallest subunit of TFIIF in buffers containing 75 to 100 mM NaCl, other polypeptides were detected by silver staining of the SDS-polyacrylamide gel, and these may correspond to subunits of these other factors (Krogan and Greenblatt, unpublished).
The Elongator complex reported to copurify with RNAPII was originally shown to have three subunits, Elp1, Elp2, and Elp3, but is now known to have three additional subunits, Elp4 (YPL101w), Elp5 (YHR187w), and Elp6 (YMR312w), which can be separated from Elp1/Elp2/Elp3 in buffers containing 200 mM NaCl (23, 30). Genetic and DNA microarray analysis of strains containing deletions of the Elongator subunits revealed that all are likely to be components of the same functional complex. Interestingly, Western blot analysis showed that no detectable RNAPII copurified with tagged Elp1, Elp2, Elp3, or Elp5. Given our observation that purified Elongator, unlike purified TFIIF, also did not stimulate elongation by RNAPII in vitro (our unpublished data), this result implies either that Elongator, unlike TFIIS, TFIIF, Spt4/Spt5, Spt6/Iws1, and the Spt16/Pob3 complex, does not truly associate with RNAPII or else that Elongator associates with RNAPII only once RNAPII is engaged in transcription and then perhaps only on some genes. In our hands, deletion of the genes encoding subunits of Elongator does not confer resistance or sensitivity to 6-azauracil (23), suggesting that Elongator may not generally be an elongation factor. Yeast Elongator subunits are mainly localized in the cytosol (24, 31), and ChIP experiments did not reveal association of Elongator subunits with the transcribed region of the ADH1 gene (our unpublished data). However, human Elongator has been shown to weakly stimulate transcription by human RNAPII in vitro (20), and one of its subunits has been shown to move from the cytosol to the nucleus in response to interleukin-6 treatment (6). Therefore, Elongator may regulate the transcription of specific genes in response to signaling pathways. This would be consistent with microarray experiments indicating that Elongator affects the expression of only a small set of yeast genes (23).
Tagging and purification of Spt4 resulted in the copurification of Spt5. When purification was carried out in buffers containing 100 mM NaCl, Spt4/Spt5 copurified with RNAPII and was detectable by silver staining. Similarly, tagged Spt5 copurified with Spt4 and RNAPII. These findings are in accord with previous observations that a mutated form of RPB2 genetically interacts with SPT5 and that Spt5 coimmunoprecipitates with Rpb1 (15), the largest subunit of RNAPII. Similarly, DSIF, the human counterpart of Spt4/Spt5, physically interacts with human RNAPII (46).
Tagged Spt5 also copurified with a truncated form of Spt6. A physical interaction between Spt5 and Spt6 was detected in one previously published study (41) but not in a follow-up study (15). Our tagging and purification of Spt6 did not result in the copurification of Spt5, probably because the form of Spt6 that copurified with tagged Spt5 is missing its C-terminal region and we have used C-terminal tags exclusively. However, we did discover a previously uncharacterized 40-kDa polypeptide, Iws1, associated with Spt6. When Iws1 was tagged and purified, it copurified with Spt6, confirming that this is a bona fide interaction. Western blotting demonstrated that Spt6-Iws1, like Spt4/Spt5, copurifies with RNAPII. Conversely, purification of tagged RNAPII resulted in copurification of Spt4, Spt5, Iws1, and Spt6, confirming these associations (data not shown). Our ChIP experiments showing that Iws1 is associated with the transcribed region of the ADH1 gene, together with our observations that Iws1 is associated with Spt6 and RNAPII, suggest that Iws1, like Spt6, is an RNAPII elongation factor. Proof that Spt6 and Iws1 are elongation factors awaits experiments showing that these proteins influence elongation by RNAPII in vivo and in vitro.
Interestingly, the sequence of the acidic N-terminal region of Iws1 displays similarity to the N-terminal region of Spt5. Moreover, tandem mass spectrometry revealed that a conserved serine residue in a consensus CKII phosphorylation site in this region was phosphorylated in both Spt5 and Iws1. Three phosphorylated serines detected by mass spectrometry in the N-terminal region of Spt6 are also located in consensus CKII sites (12). Therefore, phosphorylation by CKII may be important for the association of Spt5 and Iws1 with Spt6 or may have a regulatory role in the activities of Spt5, Spt6, and Iws1. One interesting possibility is that the CKII associated with Chd1 in the Spt16/Pob3 elongation factor complex may be involved in the phosphorylation of Spt5, Spt6, and Iws1 (see Fig. 6).
Our targeted proteomics approach has led to the description of a web of interactions, comprising 25 polypeptides (31 if Elongator is included), among the putative transcriptional elongation factors of S. cerevisiae. Construction of this interaction web was made possible by our use of affinity tagging and purification for each of the polypeptides, followed by electrophoresis, silver staining, and mass spectrometry. Determining which interactions are direct and which are indirect would not have been possible if we had simply relied on the sensitive Western blot technique. In some cases, (for example, TFIIS, TFIIF, and Spt4/Spt5), our results confirmed known or suspected interactions. In other cases, tagging and purification of a known elongation factor resulted in the discovery of novel information regarding that factor. In particular, Iws1, Paf1, Cdc73, Ctr9, and Leo1 were not previously suspected to be RNAPII elongation factors, and Paf1, Cdc73, Ctr9, Leo1, and Rtf1 were not known to associate with Spt16/Pob3. It is intriguing that there are probably so many elongation factors for RNAPII. It is not known whether all the RNAPII elongation factors can associate simultaneously with the elongating transcription complex, nor is it known whether a given factor accompanies RNAPII all the way from its initiation site to its termination site. The nonessentiality in yeast of many of the elongation factor polypeptides may imply that some of them are functionally redundant. However, it is also possible that some of them specifically regulate genes whose expression is not essential under laboratory conditions. The yeast genetic system as well as ChIP assays may make it possible to resolve some of these issues.
N.J.K. was supported by a PGS-B Scholarship Award from the Natural Sciences and Engineering Research Council of Canada (NSERC) and a Doctoral Fellowship from the Canadian Institute of Health Research (CIHR). This research was supported by grants to J.F.G. from the Canadian Institutes of Health Research and the National Cancer Institute of Canada with funds from the Canadian Cancer Society. A.S. is a scholar of the Leukemia & Lymphoma Society.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»