![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Laboratoire de Biologie Moléculaire Eucaryote du CNRS, Université Paul Sabatier, 31062 Toulouse Cedex 04, France
Received 8 May 2002/ Returned for modification 7 June 2002/ Accepted 19 July 2002
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C/D snoRNPs all contain a small RNA component featuring the conserved C and D boxes (hence the name) and are associated with at least four proteins, Nop1p (in yeast) or fibrillarin (in higher eukaryotes) (3, 21, 63, 77, 88), Nop58p, Nop56p (23, 44, 52, 61, 103, 104), and Snu13p (yeast)/15.5-kDa or NHPX protein (human) (102). H/ACA snoRNPs derive their name from the nature of their RNA component (H/ACA snoRNA), characterized by the presence of two conserved sequence motifs, the H box and the ACA box, and a conserved secondary structure. This structure consists of two hairpins containing an irregular bulge (the "pseudouridylation pocket") separated by a single-stranded hinge region containing the H box and followed by a single-stranded tail containing the 5'ACA3' triplet situated 3 nucleotides from the 3' end of the mature snoRNA (3, 21). The core of H/ACA snoRNPs contains four proteins; Cbf5p in yeast (5, 34, 43, 101, 105) (the orthologues of which are termed Nop60B in Drosophila [24, 71], Nap57 in rodents [54, 104], and dyskerin in humans [55]), Gar1p (3, 16, 21, 26), Nhp2p, and Nop10p (29, 40, 72, 101).
Except for the C/D snoRNA U3 in plants, which is transcribed by RNA polymerase III (38), C/D or H/ACA snoRNAs are transcribed by RNA polymerase II either as independent transcription units, polycistronic (i.e., comprising several small RNAs) transcripts, or as part of introns of pre-mRNAs (83). Intronic snoRNAs are released from pre-mRNAs by two alternative mechanisms. In most cases, intronic snoRNAs are produced from the debranched intron lariat, following splicing of the flanking exons (65, 70). Alternatively, some intronic C/D snoRNAs are released directly from the pre-mRNA in which they are embedded by endonucleolytic digestions performed by RNase III (6, 25, 99, 100). Release of mature snoRNAs from independent or polycistronic transcription units is initiated by an endonucleolytic, possibly cotranscriptional, digestion event in the 3' portion of the primary transcript that requires the Nrd1p protein, the Sen1p helicase, and the cleavage factor IA activity of the RNA polyadenylation machinery (17, 56, 81). Sequences of different snoRNAs present on the same polycistronic transcript are separated from one another by RNase III-catalyzed endonucleolytic digestions (11, 12, 73). Precursor transcripts containing a single snoRNA may also be cleaved 5' to the mature snoRNA sequence by RNase III (11). In all cases, final pre-snoRNA maturation steps always involve 3'-to-5' exonucleolytic digestion performed by the exosome (1, 94) and, at least in the case of intronic or polycistronic snoRNAs, by 5'-to-3' exonuclease digestion by Rat1p (70, 73) to the ends of the mature snoRNAs.
At what stage of the pre-snoRNA maturation process and where and how snoRNP proteins assemble with the sequences retained in the mature snoRNAs remain questions of debate and ongoing research. Snu13p may be the protein that initiates the assembly of C/D snoRNPs, since it interacts directly and specifically in vitro with the so-called "kink-turn" motif formed by the interaction between the C and D boxes (102). This hypothesis is strongly supported by the recent work of Omer et al., who have succeeded in reconstituting active archaeal C/D particles from purified components (64). They demonstrate that the obligatory order of in vitro RNP assembly is archaeal L7a (the archaeal orthologue of Snu13p; see also reference 41), archaeal NOP56, and archaeal fibrillarin (64). Information concerning H/ACA snoRNP assembly is far scarcer. Nhp2p is known to bind directly to RNA in vitro but is unlikely, on its own, to initiate the assembly of H/ACA snoRNPs (28). The nucleation steps of C/D and H/ACA snoRNP assembly are likely to occur during pre-snoRNA processing, possibly very early (75). Proteins bound to conserved boxes of the snoRNAs are believed to prevent exonucleases, generating the mature snoRNA termini, from degrading the body of snoRNAs. In addition, Nop1p is proposed in some cases to actively participate in pre-snoRNA processing by recruiting yeast RNase III (25). Gar1p has also been shown to interact directly with yeast RNase III, but the importance of this interaction for pre-snoRNA processing is unclear (90). Our understanding of how the particles reach the dense fibrillar component of the nucleolus, where they function, remains very limited. Most studies point to proteins bound to the conserved boxes of the snoRNAs as crucial to the nucleolar targeting of the particles (45-47, 59, 60, 75, 98). C/D snoRNPs transit through the Cajal bodies (in mammalian cells) (60, 83, 97) or the "nucleolar body" (97, 98) (in yeast) before reaching the dense fibrillar component of the nucleolus. Whether H/ACA snoRNPs follow the same route remains uncertain (83, 98).
In the present paper, we describe the characterization of Naf1p (encoded by the YNL124W open reading frame) as a predominantly nucleoplasmic protein specifically required for normal steady-state accumulation of H/ACA snoRNPs. Our results are compatible with a role for Naf1p in the assembly and/or the intranuclear trafficking of H/ACA snoRNPs.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1; leu2-3 112; trp1-289; YNL124w [44,1436]::kanMX4; pCD31) used for the immunoprecipitation experiments, the analysis of the sedimentation profile of Naf1p on a glycerol gradient, and the immunolocalization of Naf1p was produced as follows: the diploid strain CVLE083 (HE) (EUROSCARF accession number 30507D) (CEN.PK; MATa/
; ura3-52/ura3-52; his31/his31; leu2-3 112/leu2-3 112; trp1-289/trp1-289; YNL124w [44,1436]::kanMX4/YNL124W) was transformed with the centromeric plasmid pCD31, containing the NAF1-ZZ gene cassette expressed from the GAR1 promoter and terminator sequences. To produce pCD31, the NAF1 open reading frame flanked by BglII restriction sites was PCR amplified using yeast genomic DNA and oligonucleotides YNL124/1 (5' CCCCCCAGATCTAATCATGAGCGATGACTTGTTTTCTAAGGCT 3') and YNL124/2 (5' CCCCCCAGATCTAGGGTTCTTGGATCTTGCTGATGCTGAT 3'). The resulting PCR fragment was digested with BglII and inserted into plasmid pHA113 (28) cut with BamHI, creating pCD31. Sporulation of the diploid strain (CEN.PK; MATa/; ura3-52/ura 3/52; his31/his31; leu2-3 112/leu2-3 112; trp1-289/trp1-289; YNL124w [44,1436]::kanMX4/YNL124W; pCD31) was induced, tetrads were dissected, and a haploid strain (CEN.PK; ura3-52; his31; leu2-3 112; trp1-289; YNL124w [44,1436]::kanMX4; pCD31) was selected.
Saccharomyces cerevisiae strains were grown either in yeast-peptone medium (1% yeast extract, 1% peptone) supplemented with either 2% galactose, 2% raffinose, 2% sucrose, or 2% glucose as the carbon source or in YNB medium (0.17% yeast nitrogen base and 0.5% [NH4]2SO4) supplemented with 2% galactose, 2% raffinose, 2% sucrose, and the required amino acids. Escherichia coli DH5 strain (F', endA1, hsdr17 [rk- mk+], supE44, thi-1, recA1, gyrA [Nalr], relA1, [lacIZYA-argF]U169, deoR, [
80dlac{lacZ}M15]) grown on Luria-Bertani (1% Bacto Tryptone, 0.5% Bacto-yeast extract, and 1% NaCl) liquid or solid media was used for all cloning procedures.
Production of anti-Nop10p antibodies. An internal peptide from Nop10p (H2N CSAHPARFSPDDKY CONH2) was used to immunize a rabbit (performed by Eurogentec S.A.). The anti-Nop10p polyclonal serum obtained after 3 months reacted at 500-fold dilution with Nop10p from total yeast cellular extracts.
Production of total protein extracts. Total protein extracts used for the Western blot analyses presented in Fig. 2A and 6B were produced as follows: a pellet corresponding to approximately 2 x 107 yeast cells was resuspended in 100 µl of ice-cold H2O. Twenty microliters of 100% trichloroacetic acid (TCA) and 100 µl of glass beads were then added. Yeast cells were broken by vigorous agitation at 4°C during 6 min. One milliliter of ice-cold 5% TCA was added, and the sample was centrifuged 15 min at 4°C and 16,000 x g in a microcentrifuge (Eppendorf 5415D). The supernatant was removed, and the pellet was resuspended in 80 µl of 100 mM Tris-HCl, pH 8.0, 4% sodium dodecyl sulfate (SDS), 20% glycerol, 0.04% bromophenol blue, and 200 mM dithiothreitol (DTT). Twenty microliters of 1 M Tris-HCl, pH 9.5, was added, and the sample was heated at 80°C for 5 min. The sample was then mixed by vigorous agitation for 5 min at 4°C and was heated again at 80°C for 5 min. Forty microliters of 100 mM Tris-HCl, pH 8.0, 4% SDS, 20% glycerol, 0.04% bromophenol blue, 200 mM DTT, and 10 µl of 1 M Tris-HCl, pH 9.5, was then added, and the sample was agitated vigorously for 5 min at 4°C. The sample was finally centrifuged 5 min at 4°C and 16,000 x g in a microcentrifuge (Eppendorf 5415D), and the supernatant was collected.
|
|
Fractionation of yeast extract on glycerol gradient.
A total cellular extract was prepared as described in the previous paragraph from the strain expressing Naf1p-ZZ (CEN.PK; ura3-52; his31; leu2-3 112; trp1-289; YNL124w [44,1436]::kanMX4; pCD31). Five hundred microliters of extract corresponding to 5 mg of proteins was loaded on a 10 to 30% glycerol gradient. Preparation of the gradient, loading of the extract, centrifugation, and collection of fractions were performed as described in references 4 and 95.
Western analysis. Proteins from total extracts, obtained from gradient fractions after TCA precipitation or from immunoprecipitated pellets, were separated on SDS-12% polyacrylamide gels and transferred to Hybond-C extra membranes (Amersham Pharmacia Biotech). Gar1p, Nsr1p, and ribosomal protein L3 were detected as described in reference 4. Ribosomal protein S8 was detected by use of a rabbit polyclonal serum diluted 2,000-fold. Nhp2p was detected as described in reference 28. Nop10p was detected by use of the anti-Nop10 serum (see above) diluted 500-fold. Naf1p-ZZ and Cbf5p-TAP were detected using rabbit PAP (Dako) diluted 10,000-fold.
RNA extractions, Northern hybridizations, and 3' end labeling of RNAs. RNA extractions were performed as described in reference 89. RNA fractionations by polyacrylamide gel electrophoresis were performed as described in reference 29. Pre-rRNA precursors, mature rRNAs, RPS22B mRNA, and various small RNAs were detected using 32P-labeled oligodeoxynucleotide probes. Sequences of antisense oligonucleotides used to detect pre-rRNA precursors, mature rRNAs, snR10, snR11, snR31, snR33, snR36, snR42, snR46, U14, U24, U1, and MRP were reported in reference 29. The sequence of the oligonucleotide used to detect snR37 was reported in reference 28, the anti-TLC1 oligonucleotide was described in reference 15, and the anti-snR72 and anti-snR78 oligonucleotides were described in reference 73. The remaining oligonucleotides used were as follows: anti-RPS22B mRNA oligonucleotide 1, 5' TGTACCACTACTAAAAACTTACTTAATAG 3'; anti-RPS22B mRNA oligonucleotide 2, 5' AGCGAGTCATTTTTTACCTAATTACTA 3'; anti-U2, 5' CCAACCCCACCCTACACCCCC 3'; anti-U3, 5' ATGGGGCTCATCAACCAAGTTGG 3'; anti-U4, 5' GACCATGAGGAGACGGTCTGG 3'; anti-U5, 5' CAACACCCGGATGGTTCTGG 3'; anti-U6, 5' CATCCTTATGCAGGGGAACTG 3'; anti-RNase P RNA, 5' CGCCGTAGCGGGCGACAAGTC 3'; and anti-SRP RNA, 5' CCCACCAGAAAGCCATTACAGCC 3'. Blots were hybridized with 5' end-labeled oligonucleotide probes and were washed as described in reference 29. End labeling (3') of RNAs with [5'-32P]pCp was performed as described in reference 21.
Pulse-chase analysis. It was performed as indicated in reference 4, except that cells were grown in rich yeast-peptone medium and were shifted to minimal yeast nitrogen base medium only 4 h before the labeling.
Immunoelectron microscopy. Detection of Naf1p-ZZ by immunoelectron microscopy was performed as described in reference 29.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
From these experiments, we conclude that Naf1p is not a core component of H/ACA snoRNPs. Nevertheless, these data suggest that Naf1p interacts specifically with several components of H/ACA snoRNPs, though in a weak and/or transient manner.
Depletion of Naf1p inhibits 18S rRNA accumulation. The weak interactions detected between Naf1p-ZZ and H/ACA snoRNP components suggest that Naf1p could be involved in one or several of the following processes: synthesis of H/ACA snoRNP components, assembly of H/ACA snoRNPs, intranuclear transport of these particles, regulation of their mode of action, and/or recycling of the particles. A defect in any one of these steps is likely to lead to an inhibition of the synthesis of pseudouridines within the pre-rRNA and of mature 18S rRNA. As a first step in assessing whether Naf1p is involved in one of the processes listed above, we analyzed the accumulation of rRNAs in cells in which production of Naf1p is inhibited. For that purpose, since Naf1p is essential for yeast viability (7), we constructed a yeast strain that conditionally expresses the Naf1p protein comprising a ZZ tag at the N terminus (ZZ-Naf1p protein), allowing its easy detection. The NAF1 open reading frame was tagged by the ZZ-encoding sequence and placed under the control of the regulated GAL1-10 promoter by homologous recombination, creating strain GAL::zz-naf1. This strain was propagated in a medium containing galactose, raffinose, and sucrose as carbon sources and was then shifted to a glucose-containing medium. As expected, the carbon source shift led to an increase in doubling time. After 24 h in glucose-containing medium, the doubling time of GAL::zz-naf1 cells had doubled, and after 48 h, it had tripled. After that time point, contrary to our expectations, the cells carried on dividing at roughly the same, reduced growth rate (doubling time of 9 h). Aliquots of GAL::zz-naf1 cells grown in galactose-containing medium or grown for 6, 12, 24, 48, or 72 h in glucose-containing medium were harvested. From these aliquots, total proteins and RNAs were extracted for Western (Fig. 2A) or Northern (Fig. 2B) blot analyses. The level of ZZ-Naf1p strongly diminishes between 6 and 24 h after transfer to glucose-containing medium (Fig. 2A, lanes 2 to 4). However, consistent with the fact that GAL::zz-naf1 cells continue growing even after 72 h in glucose-containing medium, complete depletion of ZZ-Naf1p was never achieved (Fig. 2A, panel showing overexposed ZZ-Naf1p). Nevertheless, the strong reduction in ZZ-Naf1p level obtained is correlated with a strong decrease in the steady-state level of mature 18S rRNA relative to the level of 25S rRNA (Fig. 2B, panels for 18S rRNA and 25S rRNA). According to phosphorimager quantification, the level of 18S rRNA, relative to that of 25S rRNA, is diminished by 95% after 48 h of growth in glucose-containing medium. The steady-state levels of various precursors to the mature rRNAs, relative to the 25S rRNA level, are less dramatically affected (for a cartoon of the pre-rRNA processing pathway, see Fig. 2C). We detect an accumulation of the 23S pre-rRNA that is produced when the 35S pre-rRNA is cleaved directly at site A3, without prior cleavage at sites A0, A1, and A2. Thus, this suggests that early cleavages of 35S pre-rRNA at sites A1 and A2, necessary for the production of 20S pre-rRNA (the immediate precursor to 18S rRNA), are somewhat impaired. The effects of a reduced ZZ-Naf1p level on pre-rRNA processing were also assessed by pulse-chase analysis using [methyl-3H]methionine. Such analysis (Fig. 3) clearly shows that synthesis of the 25S rRNA is not affected. In contrast, 18S rRNA synthesis is strongly inhibited, most probably as a direct result of reduced 20S pre-rRNA production detected by this approach.
|
|
|
The effects of Naf1p depletion on the levels of Gar1p, Nhp2p, and Nop10p were tested by Western blot analysis of total protein extracts obtained from GAL::zz-naf1 cells, grown on galactose, raffinose, and sucrose or shifted to glucose-containing medium, using polyclonal sera. To monitor the effects of Naf1p depletion on Cbf5p levels, the same procedures were repeated using a strain (GAL::naf1/CBF5-TAP) that expresses native Naf1p conditionally and produces an epitope-tagged version of Cbf5p (Cbf5p-TAP). Steady-state levels of Gar1p, Nop10p (Fig. 6B, lanes 1 to 6), and Cbf5p-TAP (Fig. 6B, lanes 7 to 12) are lowered by Naf1p depletion. The level of Nhp2p is only very marginally reduced, and Nop1p accumulation is unaffected (Fig. 6B, lanes 1 to 6). We conclude that Naf1p depletion leads to a specific reduction in the levels of H/ACA snoRNP components.
The most straightforward interpretation of the above data is that Naf1p is involved either in the synthesis of H/ACA snoRNP components or in the assembly of the particles. Abortive assembly of H/ACA snoRNPs is likely to result in increased turnover of most of their constituents. Likewise, a defect in the synthesis of one H/ACA snoRNP component would lead to abortive assembly of the particles and hence would have the same consequences.
Naf1p is unlikely to be involved in the production of H/ACA snoRNP proteins. We have checked that the steady-state levels of GAR1 and NOP10 mRNAs in GAL::zz-naf1 cells grown 48 h in glucose-containing medium are not reduced compared to those of cells grown on galactose/raffinose/sucrose (data not shown). Yet at that time point, Gar1p and Nop10p levels have already substantially declined (Fig. 6B, lanes 5 and 11). A role for Naf1p in protein synthesis is not very plausible, given that it accumulates within the nucleus. To investigate whether Naf1p could be involved in the transcription as such of H/ACA snoRNA sequences, we assessed the accumulation, in the course of Naf1p depletion, of the mature mRNA of the snR44 host gene, RPS22B, which encodes ribosomal protein rpS22B. There is in fact another gene, RPS22A, which encodes the ribosomal protein rpS22A, which is identical to rpS22B but for 1 amino acid. The oligonucleotides used to detect RPS22B mRNA cannot hybridize to RPS22A mRNA. As shown in Fig. 6A, there is no significant reduction of the RPS22B mRNA level after 48 h of growth in glucose-containing medium. Since production of mature snR44 has been shown to be mostly dependent upon splicing of its host pre-mRNA (65), we conclude that defective transcription of the SNR44 sequence is most probably not the explanation for the drastic reduction in snR44 steady-state levels observed during Naf1p depletion.
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Naf1p is found mainly in the nucleoplasm, cannot be detected in the dense fibrillar component of the nucleolus, and sediments in a glycerol gradient above all as a free protein or as part of a complex of the size of free snRNPs. This suggests strongly that (i) Naf1p is not a core component of active mature H/ACA snoRNPs, consistent with a previous proposal that most mature H/ACA snoRNPs contain only the Cbf5p, Gar1p, Nhp2p, and Nop10p proteins (29) and that (ii) Naf1p is not directly involved in pre-rRNA processing and modification. We are fully aware that the Naf1p presence in the dense fibrillar component of the nucleolus may have gone undetected, and we observe that traces of Naf1p sediment with preribosomes. Nevertheless, the likeliest interpretation of the 18S rRNA accumulation defect detected in Naf1p-depleted cells remains that it is the consequence of the reduction in snR10 and snR30 H/ACA snoRNP levels. Indeed, the most striking phenotype resulting from Naf1p depletion is a dramatic and specific decrease in the accumulation of all H/ACA snoRNP components except Nhp2p. Remarkably, none of the other small RNAs tested, in particular none of the C/D snoRNAs, show a similar decrease in steady-state levels. The very specific reduction in H/ACA snoRNA levels following Naf1p depletion was also demonstrated by the groups of G. Chanfreau and D. Tollervey (P. K. Yang, G. Rotondo, T. Porras, P. Legrain, and G. Chanfreau, submitted for publication; and A. Fatica, M. Dlaki, and D. Tollervey, submitted for publication). This accumulation defect is probably not due to defective transcription, since independently transcribed H/ACA snoRNAs and the snR44 intronic RNA are equally affected. In the case of snR44, our results strongly suggest that no defective transcription (either initiation, elongation, or termination) is occurring: snR44 production has been shown to be dependent upon splicing of its host pre-mRNA (65), and we failed to detect a significant decrease in the steady-state accumulation of the corresponding mRNA. Defective pre-snoRNA processing in Naf1p-depleted cells is not very probable either. The activity of the enzymatic machinery (i.e., splicing machinery, Rnt1p endonuclease, Rat1p exonuclease, and exosome) as such is not impaired, since it is involved in processing precursors to both H/ACA and C/D snoRNAs. Yet no defective processing of C/D snoRNAs is detected. For example, we notice that the pattern of bands detected with the U24 or snR78 probes reflecting heterogeneous end formation by exonucleases is not altered by Naf1p depletion. We cannot of course exclude the possibility that the processes that target the processing machinery to H/ACA snoRNA precursors are impaired. We note, however, that when probes complementary to mature H/ACA snoRNA sequences are used, no obvious accumulation of H/ACA snoRNA precursors was observed. Finally, although the possibility is formally open, impaired production of H/ACA snoRNP proteins is unlikely, for the following reasons: we have established that the steady-state levels of GAR1 and NOP10 mRNAs are not decreased by the time the steady-state accumulation of the proteins that they encode is already significantly diminished. Because Naf1p accumulates within the nucleus, the possibility that Naf1p intervenes in cytoplasmic translation is very slight. A role for Naf1p in the nuclear import of Cbf5p, Gar1p, and Nop10p can still be envisaged.
We favor the idea that Naf1p is involved in H/ACA snoRNP assembly and/or in H/ACA snoRNP transport from the nucleoplasm to the nucleolus. A role for Naf1p in intranuclear trafficking is consistent with its localization in the nucleoplasm and within the nucleolus and with its weak association with mature H/ACA snoRNAs. Intriguingly, the localization of Naf1p in the nucleolus in close vicinity to the dense fibrillar component is reminiscent of that of the nucleolar body, the yeast equivalent of the Cajal body, through which C/D snoRNPs are proposed to transit before reaching the dense fibrillar component (97, 98). No evidence has been provided so far that H/ACA snoRNPs transit through the nucleolar body. If they do, their routing process to and from the nucleolar body is likely to require trans-acting factors different from those for C/D snoRNPs (98). Naf1p is thus a possible candidate.
The presence of some Naf1p within the nucleolus may reflect, rather than a transport function, an involvement of this protein in late H/ACA snoRNP assembly steps. Indeed, in the case of the U3 snoRNP, for example, recent work strongly suggests that final U3 snoRNP assembly occurs in the nucleolar body (in yeast) or the Cajal body (in mammals) (97). Because Naf1p is predominantly found in the nucleoplasm, a role for this protein in putative early snoRNP assembly steps taking place at or in the vicinity of pre-snoRNA transcription sites is also a very attractive hypothesis. A role for Naf1p in particle assembly is consistent with the observation that depletion of Cbf5p, Nhp2p, or Nop10p, which obviously prevents assembly of complete particles, has the same consequences as does Naf1p depletion on accumulation of H/ACA snoRNAs and Gar1p (29, 43). In the absence of particle assembly, the body of H/ACA snoRNAs normally protected by bound proteins may be degraded by the exonucleases that remove the flanking sequences and/or may be turned over by a discard pathway distinct from the normal processing pathway. Cbf5p, Gar1p, and Nop10p form a very stable complex (A. Henras and M. Caizergues-Ferrer, unpublished observation) that may be targeted for degradation when stable association with H/ACA snoRNAs is prevented. How could Naf1p promote particle assembly? The most striking motifs present in Naf1p are, in the N-terminal part, a serine-rich domain and, at the C terminus, a large proline- and glutamine-rich domain somewhat reminiscent of a domain found in the RNA-binding protein Nrd1p (80). Thus, it is conceivable that the C-terminal part of Naf1p could be involved in binding to H/ACA snoRNAs at an early stage. The serine-rich domain of Naf1p, which also contains a high proportion of negatively charged residues, is predicted to be highly phosphorylated by casein kinase II. It could recruit one or several H/ACA snoRNP proteins by providing a binding platform for exposed basic domains of these proteins, such as the C-terminal KKE repeat domain of Cbf5p, the putative amphipathic alpha-helix at the N terminus of Nhp2p, and/or the overall basic small Nop10p protein.
The SMN complex, containing the SMN protein, has also been proposed to be involved in H/ACA snoRNP assembly in some eukaryotes, since the SMN protein can interact with the GAR domains of Gar1p (69, 82). In addition, the SMN protein has also been shown to interact with the GAR domain of fibrillarin, suggesting that the SMN complex could also be involved in C/D snoRNP assembly (35, 69, 82). Moreover, a role for the SMN complex, so far not detected in S. cerevisiae, in the assembly of spliceosomal snRNPs has been well documented in higher eukaryotes (18, 50, 82). Thus, this complex probably exerts a role that is broader than and different from that of Naf1p. Indeed, the hypothesis that the SMN complex could play in higher eukaryotes the role of Naf1p in lower eukaryotes is contradicted by the fact that Schizosaccharomyces pombe contains both an SMN complex (27, 66, 67) and a protein, encoded by the SPBC30D10.15 open reading frame, significantly related to S. cerevisiae Naf1p (29% identity, 48% similarity over 438 amino acids), which very likely constitutes its S. pombe orthologue. In addition to SMN, two non-snoRNP proteins, Rvb2p (the yeast orthologue of the mammalian helicase p50) and Srp40p (the yeast orthologue of Nopp140p), have also been proposed to be required, directly or indirectly, for H/ACA snoRNP assembly and localization (36, 53, 104). Like Naf1p depletion, depletion of Srp40p (in a yeast strain lacking the LES2 gene) inhibits H/ACA snoRNA accumulation, while that of C/D snoRNAs remains unaffected (104). Unlike Naf1p, however, Srp40p and Rvb2p seem also to be linked to C/D snoRNPs (36, 61). The mammalian orthologue of Srp40p, Nopp140p, interacts with C/D snoRNP components, and Rvb2p is required for normal accumulation of both C/D and H/ACA snoRNAs. In addition, Rvb2p has been implicated in various processes, including chromatin remodeling (36, 61). Finally, no interaction has been described between Rvb2p or Srp40p and Naf1p. For all these reasons, Srp40p and Rvb2p are unlikely to directly cooperate with Naf1p. In contrast, a good candidate for a Naf1p partner is the essential Shq1p protein. By a double-hybrid test, Shq1q and Naf1p have been shown to interact (32). Moreover, Shq1p associates with Flag-Cbf5p (30) and we have established that Shq1p remains associated (directly or indirectly) with TAP-tagged Gar1p after tandem affinity purification (C. Dez, C. Froment, and V. Dossat, unpublished observation). The functional importance of the interactions detected between Shq1p, Naf1p and H/ACA snoRNP components has in fact been demonstrated by the group of G. Chanfreau, who have shown that Shq1p, like Naf1p, is required for H/ACA snoRNA accumulation (Yang et al., submitted).
|
ACKNOWLEDGMENTS |
|---|
C.D. is supported by a grant from the Ministère de l'Education Nationale, de l'Enseignement Supérieur et de la Recherche. This work was financed by la Ligue Nationale contre le Cancer, the CNRS, and Université Paul Sabatier, Toulouse, France.
|
FOOTNOTES |
|---|
We dedicate this work to the memory of Albert Henry (1910-2002), Université Libre de Bruxelles et Académie Royale de Belgique.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Bachellerie, J.-P., and J. Cavaillé. 1997. Guiding ribose methylation of rRNA. Trends Biochem. Sci. 22:257-261.[CrossRef][Medline]
3. Balakin, A. G., L. Smith, and M. J. Fournier. 1996. The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86:823-834.[CrossRef][Medline]
4. Bousquet-Antonelli, C., E. Vanrobays, J.-P. Gélugne, M. Caizergues-Ferrer, and Y. Henry. 2000. Rrp8p is a yeast nucleolar protein functionally linked to Gar1p and involved in pre-rRNA cleavage at site A2. RNA 6:826-843.[Abstract]
5. Cadwell, C., H. J. Yoon, Y. Zebarjadian, and J. Carbon. 1997. The yeast nucleolar protein Cbf5p is involved in rRNA biosynthesis and interacts genetically with the RNA polymerase I transcription factor RRN3. Mol. Cell. Biol. 17:6175-6183.[Abstract]
6. Caffarelli, E., M. Arese, B. Santoro, P. Fragapane, and I. Bozzoni. 1994. In vitro study of processing of the intron-encoded U16 small nucleolar RNA in Xenopus laevis. Mol. Cell. Biol. 14:2966-2974.
7. Capozzo, C., F. Sartorello, F. Dal Pero, M. D'Angelo, A. Vezzi, S. Campanaro, and G. Valle. 2000. Gene disruption and basic phenotypic analysis of nine novel yeast genes from chromosome XIV. Yeast 16:1089-1097.[CrossRef][Medline]
8. Cavaillé, J., and J.-P. Bachellerie. 1998. SnoRNA-guided ribose methylation of rRNA: structural features of the guide RNA duplex influencing the extent of the reaction. Nucleic Acids Res. 26:1576-1587.
9. Cavaillé, J., K. Buiting, M. Kiefmann, M. Lalande, C. I. Brannan, B. Horsthemke, J.-P. Bachellerie, J. Brosius, and A. Huttenhofer. 2000. Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization. Proc. Natl. Acad. Sci. USA 97:14311-14316.
10. Cavaillé, J., M. Nicoloso, and J.-P. Bachellerie. 1996. Targeted ribose methylation of RNA in vivo directed by tailored antisense RNA guides. Nature 383:732-735.[CrossRef][Medline]
11. Chanfreau, G., P. Legrain, and A. Jacquier. 1998. Yeast RNase III as a key processing enzyme in small nucleolar RNAs metabolism. J. Mol. Biol. 284:975-988.[CrossRef][Medline]
12. Chanfreau, G., G. Rotondo, P. Legrain, and A. Jacquier. 1998. Processing of a dicistronic small nucleolar RNA precursor by the RNA endonuclease Rnt1. EMBO J. 17:3726-3737.[CrossRef][Medline]
13. Chu, S., R. H. Archer, J. M. Zengel, and L. Lindahl. 1994. The RNA of RNase MRP is required for normal processing of ribosomal RNA. Proc. Natl. Acad. Sci. USA 91:659-663.
14. Darzacq, X., B. E. Jady, C. Verheggen, A. M. Kiss, E. Bertrand, and T. Kiss. 2002. Cajal body-specific small nuclear RNAs: a novel class of 2'-O-methylation and pseudouridylation guide RNAs. EMBO J. 21:2746-2756.[CrossRef][Medline]
15. Dez, C., A. Henras, B. Faucon, D. Lafontaine, M. Caizergues-Ferrer, and Y. Henry. 2001. Stable expression in yeast of the mature form of human telomerase RNA depends on its association with the box H/ACA small nucleolar RNP proteins Cbf5p, Nhp2p and Nop10p. Nucleic Acids Res. 29:598-603.
16. Dragon, F., V. Pogacic, and W. Filipowicz. 2000. In vitro assembly of human H/ACA small nucleolar RNPs reveals unique features of U17 and telomerase RNAs. Mol. Cell. Biol. 20:3037-3048.
17. Fatica, A., M. Morlando, and I. Bozzoni. 2000. Yeast snoRNA accumulation relies on a cleavage-dependent/polyadenylation-independent 3'-processing apparatus. EMBO J. 19:6218-6229.[CrossRef][Medline]
18. Fischer, U., Q. Liu, and G. Dreyfuss. 1997. The SMN-SIP1 complex has an essential role in spliceosomal snRNP biogenesis. Cell 90:1023-1029.[CrossRef][Medline]
19. Frank, D. N., and N. R. Pace. 1998. Ribonuclease P: unity and diversity in a tRNA processing ribozyme. Annu. Rev. Biochem. 67:153-180.[CrossRef][Medline]
20. Ganot, P., M.-L. Bortolin, and T. Kiss. 1997. Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs. Cell 89:799-809.[CrossRef][Medline]
21. Ganot, P., M. Caizergues-Ferrer, and T. Kiss. 1997. The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation. Genes Dev. 11:941-956.
22. Ganot, P., B. E. Jády, M.-L. Bortolin, X. Darzacq, and T. Kiss. 1999. Nucleolar factors direct the 2'-O-ribose methylation and pseudouridylation of U6 spliceosomal RNA. Mol. Cell. Biol. 19:6906-6917.
23. Gautier, T., T. Bergès, D. Tollervey, and E. Hurt. 1997. Nucleolar KKE/D repeat proteins Nop56p and Nop58p interact with Nop1p and are required for ribosome biogenesis. Mol. Cell. Biol. 17:7088-7098.[Abstract]
24. Giordano, E., I. Peluso, S. Senger, and M. Furia. 1999. minifly, a Drosophila gene required for ribosome biogenesis. J. Cell Biol. 144:1123-1133.
25. Giorgi, C., A. Fatica, R. Nagel, and I. Bozzoni. 2001. Release of U18 snoRNA from its host intron requires interaction of Nop1p with the Rnt1p endonuclease. EMBO J. 20:6856-6865.[CrossRef][Medline]
26. Girard, J.-P., H. Lehtonen, M. Caizergues-Ferrer, F. Amalric, D. Tollervey, and B. Lapeyre. 1992. GAR1 is an essential small nucleolar RNP protein required for pre-rRNA processing in yeast. EMBO J. 11:673-682.[Medline]
27. Hannus, S., D. Buhler, M. Romano, B. Séraphin, and U. Fischer. 2000. The Schizosaccharomyces pombe protein Yab8p and a novel factor, Yip1p, share structural and functional similarity with the spinal muscular atrophy-associated proteins SMN and SIP1. Hum. Mol. Genet. 9:663-674.
28. Henras, A., C. Dez, J. Noaillac-Depeyre, Y. Henry, and M. Caizergues-Ferrer. 2001. Accumulation of H/ACA snoRNPs depends on the integrity of the conserved central domain of the RNA-binding protein Nhp2p. Nucleic Acids Res. 29:2733-2746.
29. Henras, A., Y. Henry, C. Bousquet-Antonelli, J. Noaillac-Depeyre, J.-P. Gélugne, and M. Caizergues-Ferrer. 1998. Nhp2p and Nop10p are essential for the function of H/ACA snoRNPs. EMBO J. 17:7078-7090.[CrossRef][Medline]
30. Ho, Y., A. Gruhler, A. Heilbut, G. D. Bader, L. Moore, S. L. Adams, A. Millar, P. Taylor, K. Bennett, K. Boutilier, L. Yang, C. Wolting, I. Donaldson, S. Schandorff, J. Shewnarane, M. Vo, J. Taggart, M. Goudreault, B. Muskat, C. Alfarano, D. Dewar, Z. Lin, K. Michalickova, A. R. Willems, H. Sassi, P. A. Nielsen, K. J. Rasmussen, J. R. Andersen, L. E. Johansen, L. H. Hansen, H. Jespersen, A. Podtelejnikov, E. Nielsen, J. Crawford, V. Poulsen, B. D. Sorensen, J. Matthiesen, R. C. Hendrickson, F. Gleeson, T. Pawson, M. F. Moran, D. Durocher, M. Mann, C. W. Hogue, D. Figeys, and M. Tyers. 2002. Systematic identification of protein complexes in Saccharomyces cerevisiae by mass spectrometry. Nature 415:180-183.[CrossRef][Medline]
31. Hughes, J. M., and M. Ares, Jr. 1991. Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18S ribosomal RNA. EMBO J. 10:4231-4239.[Medline]
32. Ito, T., T. Chiba, R. Ozawa, M. Yoshida, M. Hattori, and Y. Sakaki. 2001. A comprehensive two-hybrid analysis to explore the yeast protein interactome. Proc. Natl. Acad. Sci. USA 98:4569-4574.
33. Jady, B. E., and T. Kiss. 2001. A small nucleolar guide RNA functions both in 2'-O-ribose methylation and pseudouridylation of the U5 spliceosomal RNA. EMBO J. 20:541-551.[CrossRef][Medline]
34. Jiang, W., K. Middleton, H. J. Yoon, C. Fouquet, and J. Carbon. 1993. An essential yeast protein, CBF5p, binds in vitro to centromeres and microtubules. Mol. Cell. Biol. 13:4884-4893.
35. Jones, K. W., K. Gorzynski, C. M. Hales, U. Fischer, F. Badbanchi, R. M. Terns, and M. P. Terns. 2001. Direct interaction of the spinal muscular atrophy disease protein SMN with the small nucleolar RNA-associated protein fibrillarin. J. Biol. Chem. 276:38645-38651.
36. King, T. H., W. A. Decatur, E. Bertrand, E. S. Maxwell, and M. J. Fournier. 2001. A well-connected and conserved nucleoplasmic helicase is required for production of box C/D and H/ACA snoRNAs and localization of snoRNP proteins. Mol. Cell. Biol. 21:7731-7746.
37. Kiss, T. 2001. Small nucleolar RNA-guided post-transcriptional modification of cellular RNAs. EMBO J. 20:3617-3622.[CrossRef][Medline]
38. Kiss, T., C. Marshallsay, and W. Filipowicz. 1991. Alteration of the RNA polymerase specificity of U3 snRNA genes during evolution and in vitro. Cell 65:517-526.[CrossRef][Medline]
39. Kiss-Laszlo, Z., Y. Henry, J.-P. Bachellerie, M. Caizergues-Ferrer, and T. Kiss. 1996. Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs. Cell 85:1077-1088.[CrossRef][Medline]
40. Kolodrubetz, D., and A. Burgum. 1991. Sequence and genetic analysis of NHP2: a moderately abundant high mobility group-like nuclear protein with an essential function in Saccharomyces cerevisiae. Yeast 7:79-90.[CrossRef][Medline]
41. Kuhn, J. F., E. J. Tran, and E. S. Maxwell. 2002. Archaeal ribosomal protein L7 is a functional homolog of the eukaryotic 15.5kD/Snu13p snoRNP core protein. Nucleic Acids Res. 30:931-941.
42. Lafontaine, D., and D. Tollervey. 1996. One-step PCR mediated strategy for the construction of conditionally expressed and epitope tagged yeast proteins. Nucleic Acids Res. 24:3469-3471.
43. Lafontaine, D. L., C. Bousquet-Antonelli, Y. Henry, M. Caizergues-Ferrer, and D. Tollervey. 1998. The box H + ACA snoRNAs carry Cbf5p, the putative rRNA pseudouridine synthase. Genes Dev. 12:527-537.
44. Lafontaine, D. L., and D. Tollervey. 1999. Nop58p is a common component of the box C+D snoRNPs that is required for snoRNA stability. RNA 5:455-467.[Abstract]
45. Lange, T. S., A. Borovjagin, E. S. Maxwell, and S. A. Gerbi. 1998. Conserved boxes C and D are essential nucleolar localization elements of U14 and U8 snoRNAs. EMBO J. 17:3176-3187.[CrossRef][Medline]
46. Lange, T. S., M. Ezrokhi, F. Amaldi, and S. A. Gerbi. 1999. Box H and box ACA are nucleolar localization elements of U17 small nucleolar RNA. Mol. Biol. Cell 10:3877-3890.
47. Lange, T. S., M. Ezrokhi, A. V. Borovjagin, R. Rivera-Leon, M. T. North, and S. A. Gerbi. 1998. Nucleolar localization elements of Xenopus laevis U3 small nucleolar RNA. Mol. Biol. Cell 9:2973-2985.
48. Li, H. V., J. Zagorski, and M. J. Fournier. 1990. Depletion of U14 small nuclear RNA (snR128) disrupts production of 18S rRNA in Saccharomyces cerevisiae. Mol. Cell. Biol. 10:1145-1152.
49. Lindahl, L., and J. M. Zengel. 1995. RNase MRP and rRNA processing. Mol. Biol. Rep. 22:69-73.[CrossRef][Medline]
50. Liu, Q., U. Fischer, F. Wang, and G. Dreyfuss. 1997. The spinal muscular atrophy disease gene product, SMN, and its associated protein SIP1 are in a complex with spliceosomal snRNP proteins. Cell 90:1013-1021.[CrossRef][Medline]
51. Lygerou, Z., C. Allmang, D. Tollervey, and B. Séraphin. 1996. Accurate processing of a eukaryotic precursor ribosomal RNA by ribonuclease MRP in vitro. Science 272:268-270.[Abstract]
52. Lyman, S. K., L. Gerace, and S. J. Baserga. 1999. Human Nop5/Nop58 is a component common to the box C/D small nucleolar ribonucleoproteins. RNA 5:1597-1604.[Abstract]
53. Meier, U. T. 1996. Comparison of the rat nucleolar protein nopp140 with its yeast homolog SRP40. Differential phosphorylation in vertebrates and yeast. J. Biol. Chem. 271:19376-19384.
54. Meier, U. T., and G. Blobel. 1994. NAP57, a mammalian nucleolar protein with a putative homolog in yeast and bacteria. J. Cell Biol. 127:1505-1514.
55. Mitchell, J. R., E. Wood, and K. Collins. 1999. A telomerase component is defective in the human disease dyskeratosis congenita. Nature 402:551-555.[CrossRef][Medline]
56. Morlando, M., P. Greco, B. Dichtl, A. Fatica, W. Keller, and I. Bozzoni. 2002. Functional analysis of yeast snoRNA and snRNA 3'-end formation mediated by uncoupling of cleavage and polyadenylation. Mol. Cell. Biol. 22:1379-1389.
57. Morrissey, J. P., and D. Tollervey. 1995. Birth of the snoRNPs: the evolution of RNase MRP and the eukaryotic pre-rRNA-processing system. Trends Biochem. Sci. 20:78-82.[CrossRef][Medline]
58. Morrissey, J. P., and D. Tollervey. 1993. Yeast snR30 is a small nucleolar RNA required for 18S rRNA synthesis. Mol. Cell. Biol. 13:2469-2477.
59. Narayanan, A., A. Lukowiak, B. E. Jady, F. Dragon, T. Kiss, R. M. Terns, and M. P. Terns. 1999. Nucleolar localization signals of box H/ACA small nucleolar RNAs. EMBO J. 18:5120-5130.[CrossRef][Medline]
60. Narayanan, A., W. Speckmann, R. Terns, and M. P. Terns. 1999. Role of the box C/D motif in localization of small nucleolar RNAs to coiled bodies and nucleoli. Mol. Biol. Cell 10:2131-2147.
61. Newman, D. R., J. F. Kuhn, G. M. Shanab, and E. S. Maxwell. 2000. Box C/D snoRNA-associated proteins: two pairs of evolutionarily ancient proteins and possible links to replication and transcription. RNA 6:861-879.[Abstract]
62. Ni, J., A. L. Tien, and M. J. Fournier. 1997. Small nucleolar RNAs direct site-specific synthesis of pseudouridine in ribosomal RNA. Cell 89:565-573.[CrossRef][Medline]
63. Ochs, R. L., M. A. Lischwe, W. H. Spohn, and H. Busch. 1985. Fibrillarin: a new protein of the nucleolus identified by autoimmune sera. Biol. Cell 54:123-133.[Medline]
64. Omer, A. D., S. Ziesche, H. Ebhardt, and P. P. Dennis. 2002. In vitro reconstitution and activity of a C/D box methylation guide ribonucleoprotein complex. Proc. Natl. Acad. Sci. USA 99:5289-5294.
65. Ooi, S. L., D. A. Samarsky, M. J. Fournier, and J. D. Boeke. 1998. Intronic snoRNA biosynthesis in Saccharomyces cerevisiae depends on the lariat-debranching enzyme: intron length effects and activity of a precursor snoRNA. RNA 4:1096-1110.[Abstract]
66. Owen, N., C. L. Doe, J. Mellor, and K. E. Davies. 2000. Characterization of the Schizosaccharomyces pombe orthologue of the human survival motor neuron (SMN) protein. Hum. Mol. Genet. 9:675-684.
67. Paushkin, S., B. Charroux, L. Abel, R. A. Perkinson, L. Pellizzoni, and G. Dreyfuss. 2000. The survival motor neuron protein of Schizosacharomyces pombe. Conservation of survival motor neuron interaction domains in divergent organisms. J. Biol. Chem. 275:23841-23846.
68. Peculis, B. A., and J. A. Steitz. 1993. Disruption of U8 nucleolar snRNA inhibits 5.8S and 28S rRNA processing in the Xenopus oocyte. Cell 73:1233-1245.[CrossRef][Medline]
69. Pellizzoni, L., J. Baccon, B. Charroux, and G. Dreyfuss. 2001. The survival of motor neurons (SMN) protein interacts with the snoRNP proteins fibrillarin and GAR1. Curr. Biol. 11:1079-1088.[CrossRef][Medline]
70. Petfalski, E., T. Dandekar, Y. Henry, and D. Tollervey. 1998. Processing of the precursors to small nucleolar RNAs and rRNAs requires common components. Mol. Cell. Biol. 18:1181-1189.
71. Phillips, B., A. N. Billin, C. Cadwell, R. Buchholz, C. Erickson, J. R. Merriam, J. Carbon, and S. J. Poole. 1998. The Nop60B gene of Drosophila encodes
