![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, December 2002, p. 8398-8408, Vol. 22, No. 24
0270-7306/02/$04.00+0 DOI: 10.1128/MCB.22.24.8398-8408.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Department of Biochemistry and Molecular Biology, University of Illinois at Chicago, Chicago, Illinois 60612
Received 2 April 2002/ Returned for modification 12 September 2002/ Accepted 19 September 2002
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Genetic studies in mice have suggested a potent tumor suppression function of the ARF protein. For example, mice lacking only the ARF function developed tumors at a frequency that is similar to loss of the ARF/p16INK4A locus, suggesting that, at least in mice, the tumor suppression pathway of ARF is significant (14-16). The function of ARF has been biochemically linked to p53. It has been shown that ARF can stabilize and stimulate the activities of p53 (22, 23, 27, 31, 42), and it does so by regulating MDM2, which is an inhibitor of p53. MDM2 has been shown to possess a p53-specific E3 ubiquitin ligase activity (8, 11, 19, 30, 36). It binds to p53 and causes ubiquitination followed by proteolysis of p53. The ARF protein associates with MDM2 and inhibits its ability to ubiquitinate p53 (11).
ARF also possesses a p53-independent tumor suppression function. The first indication came from studies on transgenic mice expressing the Myc gene (5). Premalignant B cells expressing transgenic Myc and lacking both ARF and p53 proliferated at a much faster rate than those expressing Myc and lacking p53 or ARF alone. These observations suggested additional p53-independent functions of ARF. Further evidence for a p53-independent tumor suppression function of ARF came from studies that compared tumor frequencies in mice lacking ARF, MDM2, and p53 with those in mice lacking p53 and MDM2 or p53 alone (43). Mice nullizygous for ARF, p53, and MDM2 developed tumors at a frequency greater than that observed in mice lacking both p53 and MDM2 or p53 alone. Moreover, reintroduction of ARF in fibroblasts lacking ARF, p53, and MDM2 caused a G1 arrest, suggesting that ARF can interact with targets other than p53 and MDM2 to inhibit cell proliferation. Studies on the simian virus 40 T antigen also provided evidence for the p53-independent tumor suppression function of ARF (4). Finally, a recent study, with mutants of ARF, indicated that the sequences involved in MDM2 regulation are not sufficient for the growth suppression function of ARF (17).
Recent studies also provided biochemical evidence for the p53-independent function of ARF. It has been demonstrated (25) that ARF could associate with certain members of the E2F family of transcription factors (E2Fs) and induce their degradation through the 26S proteasome pathway. The degradation is associated with a relocalization. For example, ARF expression caused relocalization of E2F1 from mainly nucleoplasmic to mainly nucleolar. The ARF effect is not true for all E2Fs; for example, E2F6 was not affected by ARF. Experiments with mouse embryo fibroblasts lacking both copies of p53 indicated that E2F1 could associate with ARF in a p53-independent manner. Moreover, expression of ARF in cells containing functionally defective p53 reduced the steady-state levels of E2F1. In addition, expression of a dominant negative p53 had no effect on the ARF-induced destabilization of E2F1 and E2F3 in U2OS cells. It was also shown that E2F1 could partially overcome ARF-induced growth arrest of p53-defective cells (25). Taken together, these observations suggest that ARF can regulate certain members of the E2Fs in a p53-independent manner.
These observations are significant with regard to the tumor suppressor functions of ARF because E2Fs stimulate expression of a number of genes that are critical for DNA replication and mitosis (13, 29). Another study (6) investigated the effect of human ARF on the transcriptional activity of E2F1. This group also demonstrated an interaction between ARF and E2F1. Moreover, they showed that ARF inhibited E2F1-activated transcription in a manner independent of p53. Furthermore, exon 1b of ARF was sufficient to bind E2F1 and inhibit E2F1-activated transcription. It is very possible that the inhibition of the E2F1-activated transcription is a result of E2F1 proteolysis induced by ARF. However, additional roles of ARF as a transcriptional repressor of the E2F1-regulated genes cannot be ruled out.
The E2F family of transcription factors bind DNA as heterodimers in conjunction with the DP family of factors (1, 7, 10). DP1 is the best-studied member of the DP family of proteins. E2Fs and DP1 contain hydrophobic heptad repeats, which are believed to be involved in heterodimer formation through coil-coil interactions. DP1 also possesses a DNA-binding domain that contributes to the sequence-specific DNA binding activity of the E2Fs. DP1 by itself has very little transcriptional activity; however, it cooperates with the E2Fs to activate transcription of the E2F target genes (1, 10). DP1 is also a critical component of the E2F-retinoblastoma protein repressor complex. It has been shown that heterodimerization with DP1 is important for a stable interaction between E2F1 and retinoblastoma protein (10).
The activity of DP1 is believed to be regulated through phosphorylation by cyclin A-cdk2. It has been shown that cyclin A-cdk2 binds to an N-terminal region in E2F1 and phosphorylates DP1, which leads to a loss of DNA binding by the E2F1/DP1 complex (18). Thus, DP1 is both a functional and a regulatory partner of E2F1. In this study, we show that DP1 is also a target of ARF. Moreover, the E2F1/DP1 complex is refractory to the regulatory effects of ARF.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Expression plasmids. An expression plasmid expressing hemagglutinin (HA)-tagged p19ARF driven by a cytomegalovirus promoter was constructed by subcloning a fragment containing the p19ARF cDNA along with HA sequences into the BamHI and XhoI sites of pCDNA3. The expression plasmids expressing T7 epitope-tagged proteins were constructed with PCR in which the upstream primers contained a sequence encoding the T7 epitope in frame with the first ATG of the respective cDNA. Appropriate restriction enzyme sites were also engineered into the primers to facilitate cloning,
For T7-E2F1, the upstream and downstream primers used were ACGGTACCCACCATGGCTAGCATGACCGGCGGACAGCAGATGGGCATGGCCTTGGCCGGG and ACTCTAGATCAGAAATCCAGGGG, respectively, and the amplified fragment was cloned as a KpnI (5')-XbaI (3') fragment into pCDNA3. For T7-DP1 the upstream and downstream primers used were CGGGATCCCGCCATGGCTAGCATGACCGGCGGACAGCAGATGGGCATGGCAAAAGATGCCGGTCT and GCTCTAGAGCTCAGTCGTCCTCGTCATTCT, respectively, and the amplified fragment was cloned as a BamHI (5')-XbaI (3') fragment into pCDNA3. For T7-p19ARF, the upstream and downstream primers were GCGGTACCCACCATGGCTAGCATGACCGGCGGACAGCAGATGGGCATGGGTCGCAGGTTC and AGTCTCGAGCTATGCCCGTCGGTC, respectively, and the amplified fragment was cloned as a KpnI (5')-XhoI (3') fragment into pCDNA3.
The DP1 d205-277 mutant was created by PCR in two steps. The region between amino acids 1 and 204 was amplified with the upstream primer DP1mut1 (ACGGATCCATGGCAAAAGAT) and downstream primer DP1mut2 (AAGGTACCGTTCTGACATTC). Similarly, the region between amino acids 278 and 410 was amplified with the upstream primer DP1mut3 (AAGGTACCAATGACAAATTT) and downstream primer DP1mut4 (GCTCTAGAGCTCAGTCGTCCTCGTCATTCT). An XhoI site was engineered into the primers designated DP1mut 2 and DP1mut3. Following PCR amplification and digestion with XhoI, the fragments were ligated, and a heat-inactivated aliquot of the ligation mix was used to do PCR with the DP1 upstream and downstream primers (DP1mut1 and DP1mut4) as described above. The amplified product was cloned as a BamHI (5')-XbaI (3') fragment into pCDNA3. The T7-tagged version of the DP1 mutant was made in a similar fashion except that the sequence for the T7 tag was engineered into the primer designated DP1mut1.
DNA transfections. All DNA transfections, unless and until mentioned, were done by the calcium phosphate precipitate method as described previously (9).
CAT assays. Chloramphenicol acetyltransferase (CAT) assays were performed by the xylene extraction method of Seed and Sheen as described earlier (35).
Immunoprecipitation and Western blotting. The transfected cells were harvested 48 h after transfection. The cells were washed twice with phosphate-buffered saline (PBS) and suspended in NETT250 buffer [20 mM Tris-HCl (pH 8.0), 0.1 mM EDTA, 250 mM NaCl, 0.5% Triton X-100] for 1 h at 4°C. After incubation, the lysates were centrifuged at 13,000 x g for 10 min, and the supernatants were used for immunoprecipitation. p19ARF antibody (R562; GeneTex, San Antonio, Tex.) was used for immunoprecipitation. Cell lysates (1.2 mg) were incubated with the antibody for 2 h at 4°C. Protein A-Sepharose was then added, and the tubes were rocked for 1 h at 4°C. The beads were then collected by centrifugation. Precipitates were washed three times with 400 µl of the NETT250 buffer. The bound proteins were subjected to Western blot analysis.
Western blot analysis was performed with anti-rabbit or anti-mouse Fab fragments conjugated to horseradish peroxidase (Amersham) and the ECL Western blot detection reagent (Amersham) according to the manufacturer's instructions. The T7 epitope tag-horseradish peroxidase conjugated antibody was obtained from Novagen. The E2F1 antibody (KH95) was from Santa Cruz Biotechnology. The polyclonal antibody against p19ARF (R562) was obtained from GeneTex. The DP1 antibody (WTH16) was from NeoMarkers.
Decay rate analysis. U2OS cells or SAOS2 cells were transfected with the indicated expression plasmids by the calcium phosphate method. The transfections were done in duplicate for each combination of plasmids indicated. Sixteen hours after transfection, the cells were trypsinized, pooled, and replated. Twenty-four hours after transfection, cycloheximide (ICN Pharmaceuticals) was added to the cells at a final concentration of 20 µg/ml, the cells were harvested at the indicated times, and extracts were prepared with lysis buffer [20 mM HEPES (pH 7.9), 400 mM NaCl, 1 mM EDTA, 0.1% NP-40, 1 mM phenylmethylsulfonyl fluoride, and 10% glycerol]. The extracts were run on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels, and Western blot analysis was performed as described above.
Immunostaining and confocal microscopy. U20S cells were grown in 24-well plates containing coverslips. For DP1 localization, cells were transfected with either T7-DP1 (0.2 µg) alone or a combination of plasmids expressing T7-DP1 or T7-DP1 d205-277 and p19ARF (0.6 µg). Cells were also transected with plasmids expressing T7-Cul4B (0.2 µg) alone or in combination with p19ARF to serve as a control.
For E2F1 localization, cells were either transfected with T7-E2F1 (0.2 µg) alone or cotransfected with T7-E2F1 and p19ARF (0.6 µg) or with T7-E2F1, p19ARF, and either DP1 or DP1 d205-277 (0.2 µg each) expression plasmids. Transfections were done with Lipofectamine 2000 reagent (Invitrogen). Twenty-four hours after transfection, the cells were fixed with methanol, blocked with 5% goat serum in PBS, and probed with T7 tag monoclonal antibody (1:250 dilution) and polyclonal p19ARF antibody (1:250 dilution). The proteins were detected with tetramethyl rhodamine isocyanate (TRITC)-conjugated anti-mouse and fluorescein isothiocyanate (FITC)-conjugated anti-rabbit immunoglobulin secondary antibodies (both at 1:200 dilution). Finally, the coverslips were washed and mounted on glass slides with Vectashield mounting medium (Vector Laboratories). The immunofluorescence was detected and images were taken with a CLSM 510 microscope (Zeiss) and a 63x Acrophlan water immersion objective.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We could easily detect coimmunoprecipitation of the wild-type DP1 protein with ARF (Fig. 1). In the same experiment, Cul-4B or the mutant DP1 was not coimmunoprecipitated with ARF. These results provide evidence for an association of DP1 with the ARF tumor suppressor protein. Moreover, the interaction is dependent upon the sequences in DP1 required for binding to E2F1. It is possible that the E2F1-binding motif in DP1 is also required for binding to ARF.
|
For this purpose, U2OS cells were transfected with a plasmid expressing T7 epitope-tagged DP1 or the mutant DP1 in the presence and absence of an ARF expression plasmid. T7 epitope-tagged Cul-4B was also used as a control. The transfections were carried out with cells grown on coverslips. Following transfection, the coverslips were subjected to immunostaining with T7 antibody for DP1 and ARF antibody to detect the localization of ARF. Fluorescently conjugated secondary antibodies (TRITC for DP1 and FITC for ARF) were used for visualization. The subcellular localizations of DP1 and ARF were visualized with a confocal microscope.
Consistent with previous observations (24), we found that DP1 is mainly localized to the cytoplasm when expressed alone (Fig. 2A). DP1 lacks a functional nuclear localization signal, and its nuclear localization is dependent upon the DNA-binding partners, the E2F family of proteins (24). It was shown that binding to E2F1 is critical for nuclear localization of DP1 (24). Interestingly, coexpression of ARF resulted in a relocalization of DP1 from mainly cytosolic to mainly nucleolar (Fig. 2A and Table 1). The colocalization of DP1 with ARF is also consistent with their interaction. The mutant DP1 and Cul-4B failed to colocalize with ARF in the nucleolus. The nucleolar localization of DP1 in the presence of ARF was confirmed by staining for nucleolin (Fig. 2B). Taken together, these results suggest that ARF associates with DP1 and relocalizes it to the nucleolus.
|
|
As expected, E2F1 was mainly found in the nucleoplasm when expressed in the absence of ARF (Fig. 3 and Table 1). In the presence of ARF expression, there was a dramatic change; the majority of E2F1 colocalized with the ARF protein to nuclear structures (Fig. 3) previously shown to be nucleoli (25). Interestingly, expression of DP1 reversed or blocked the effect of ARF. In the presence of DP1 expression, E2F1 was localized mainly in the nucleoplasm even in the presence of the ARF protein. The mutant DP1 failed to retain E2F1 in the nucleoplasm.
|
Coexpression of DP1 blocks ARF-induced proteolysis of E2F1. Consistent with the previous result (25), we observed that ARF expression induces proteolysis of E2F1. These experiments were performed by transfecting U2OS cells with plasmids expressing E2F1 or DP1 in the presence or absence of the ARF expression plasmid. For each set of experiments, two plates of cells were transfected with the expression plasmids. To equalize for the transfection efficiencies, 16 h after transfection (after addition of the DNA precipitates), cells from the same set were trypsinized and pooled, and approximately equal numbers of cells were divided among five plates. Twenty-four hours after replating, cells were treated with cycloheximide at a final concentration of 20 µg/ml. At the indicated times, cells were harvested, and the extracts were subjected to Western blot assays and probed with a monoclonal antibody against E2F1 or the T7 epitope for DP1.
As expected, E2F1 decayed at faster rates in the presence of ARF than in its absence (Fig. 4). The half-life of E2F1 was reduced from greater than 4 h to less than 2 h. We observed that the half-life of DP1 was also reduced in the presence of ARF. However, the effect of ARF on the stability of DP1 was moderate compared to that of E2F1 (Fig. 4).
|
To further investigate the effect of DP1, we looked at the decay rate of E2F1 in the presence of DP1 expression. U2OS (Fig. 5, upper panel) or SAOS2 (Fig. 5, lower panel) cells were transfected with plasmids expressing E2F1 and ARF in the presence of a DP1 expression plasmid. As in the previous experiment, 16 h following transfection, cells from the same set were pooled and equally divided among five plates. Twenty-four hours after replating, cells were treated with cycloheximide and harvested at the indicated time points following cycloheximide treatment. Analysis of the levels of E2F1 clearly indicated a stabilizing effect of DP1. Expression of DP1 blocked the ARF-induced decay of E2F1 (Fig. 5). The mutant DP1, which does not form heterodimers with E2F1 and is unable to retain E2F1 in the nucleoplasm, was also unable to stabilize E2F1. The results reinforce the notion that the E2F1/DP1 complex is refractory to the regulatory effects of ARF.
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Towards this end, we show that the DP1 subunit of the E2F family of transcription factors also associates with ARF. Moreover, binding of ARF leads to a relocalization of DP1 from the cytoplasm to the nucleolus. In addition, there was a modest increase in the decay rate of DP1 in the presence of ARF. These results suggest that DP1, which is an essential DNA-binding partner of the E2Fs, is also a target of the ARF regulatory pathways. Interestingly, we observed that ARF regulates E2F1 and DP1 effectively when these proteins are expressed individually. Coexpression of E2F1 and DP1 blocks the regulatory effects of ARF. When coexpressed, E2F1 and DP1 exist mainly in the form of E2F1/DP1 complex. Our results suggest that the E2F1/DP1 complex, unlike E2F1 and DP1, is refractory to the inhibitory effects of ARF.
We observed that a mutant DP1 which lacks the region important for heterodimerization with E2F1 also failed to associate with ARF. While it is possible that DP1 associates with ARF through E2F1, we favor the model in which DP1 associates with ARF independently of the E2Fs through its heterodimerization domain, because ARF could quantitatively relocalize DP1 from cytoplasm to the nucleolus in the absence of exogenous E2F (Fig. 2). Independent binding through the heterodimerization domain would raise the possibility that E2F1 and ARF compete for binding to DP1. We observed evidence for such a competition. When all three proteins were coexpressed, E2F1 outcompeted ARF for binding to DP1. ARF was found mainly in the nucleolus, while the E2F1 and DP1 proteins were in the nucleoplasm (Fig. 3). The lack of colocalization of the E2F1/DP1 complex with ARF would be consistent with the notion that ARF does not interact with the heterodimeric complex of E2F1 and DP1. This would also explain why we failed to detect a DNA-bound complex of E2F (which involves both E2F1 and DP1) that contains ARF (data not shown).
It is likely that DP1 has a much higher affinity for E2F1 than for ARF because we could almost quantitatively block the ARF-induced nucleolar localization of DP1 by E2F1 with a low level of the E2F1 expression plasmid (Fig. 3 and Table 1). E2F1, DP1, and ARF were expressed with a common expression vector (pcDNA3; Invitrogen). Therefore, it is also noteworthy that a relatively small amount of DP1 expression plasmid (50 ng) was able reverse the inhibition of the E2F1-activated transcription by 2 µg of ARF expression plasmid (Fig. 6A). Thus, under our experimental conditions, the E2F1/DP1 heterodimer is a stronger complex than the ARF/E2F1 or the ARF/DP1 complex. This is also consistent with the observation that a much higher level of ARF was needed to inhibit transcription when both E2F1 and DP1 were expressed (Fig. 6).
How does ARF inhibit E2F-activated transcription? Although E2F1 and DP1 are functional partners, expression of these two proteins is regulated differentially. For example, DP1 is expressed constitutively, whereas several members of the E2F family of proteins (E2F1, E2F2, and E2F3) are expressed mainly at the G1/S boundary of the cell cycle (see reference 29 and references therein). These E2F family members, after their expression, associate with the available pool of DP1 to participate in the transcription of a variety of DNA replication genes and genes involved in mitosis (13). Thus, in early G1 phase, there is a pool of unbound DP1, which might be a target for ARF regulation (Fig. 7). ARF would sequester away all the available unbound DP1, which in turn would favor a dissociation of the E2F1/DP1 complex present at low levels in G1 phase. The dissociated E2F1 and DP1 molecules will become further targets of ARF. This would be consistent with the G1 arrest function of ARF.
|
The E2F1/DP1 complex is abundant only at the boundary of G1/S phases (29), at a time when the cell has committed to progression through S phase. The E2F1/DP1 complex stimulates expression of genes necessary for progression through the S and G2/M phases (13). Since ARF is one of the E2F-induced genes, one would expect an increased expression of ARF at the G1/S boundary. Therefore, the resistance of the E2F1/DP1 complex to ARF regulation would ensure progression through S phase. It is possible that ARF curtails any excessive activity of E2F1, which would otherwise lead to apoptosis. E2F1 was shown to induce cellular senescence in human primary fibroblasts through increased expression of ARF (4a). This study ectopically expressed E2F1 alone and relied upon endogenous DP1, a condition under which ARF is dominant over E2F1. It would be interesting to determine whether coexpression of E2F1/DP1 induces senescence or apoptosis.
It is unclear whether the ARF-induced nucleolar localization is essential for the proteolysis of E2F1 and DP1. Nucleolar localization of the ARF-MDM2 complex has been studied in detail (41). It has been shown that the ARF-mediated relocalization is dependent upon a cryptic nucleolar localization signal, the R/KR/KXR/K motif, in MDM2. It was suggested that binding of ARF to MDM2 causes a conformational change in MDM2, unmasking the cryptic nucleolar signal in MDM2 (41). However, it is unclear how nucleolar localization signals direct localization of a protein or a complex of proteins.
Interestingly, both E2F1 and DP1 contain a potential nucleolar signal, between residues 181 and 185 for E2F1 and between residues 105 and 108 for DP1. These signals map within the DNA-binding domain and very close to the heterodimerization domain of both proteins. We speculate that, in the absence of heterodimerization, as in the case of MDM2, the cryptic nucleolar signal in DP1 and E2F1 becomes active after binding to ARF and plays a role in the nucleolar localization of the ARF-DP1 or ARF-E2F1 complex. Following heterodimerization of E2F1 and DP1, however, the cryptic nucleolar signals in E2F1 and DP1 may not be available for relocalization to the nucleolus. Clearly, further studies will be necessary to test this model.
|
ACKNOWLEDGMENTS |
|---|
The work was supported by a grant from the NCI (RO1 CA 77637) to P.R.
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Bates, S., A. C. Phillips, P. A. Clarke, F. Stott, G. Peters, R. L. Ludwig, and K. H. Vousden. 1998. p14ARF links the tumor suppressors pRB and p53. Nature 395:124-125.[CrossRef][Medline]
3. Carnero, A., J. D. Hudson, C. M. Price, and D. Beach. 2000. p16INK4a and p19ARF act in overlapping pathways in cellular immortalization. Nat. Cell. Biol. 2:148-155.[CrossRef][Medline]
4. Chao, H. H. A., A. M. Buchmann, and J. DeCaprio. 2000. Loss of p19ARF eliminates the requirement for the pRB-binding motif in simian virus 40 large T antigen-mediated transformation. Mol. Cell. Biol. 20:7624-7633.
4. Dimri, G. P., K. Itahana, M. Acosta, and J. Campisi. 2000. Regulation of a senescence checkpoint response by the E2F1 transcription factor and p14ARF tumor suppressor. Mol. Cell. Biol. 20:273-285.
5. Eischen, C. M., J. D. Weber, M. F. Roussel, C. Sherr, and J. L. Cleveland. 1999. Disruption of the ARF-Mdm2-p53 tumor suppressor pathway in Myc-induced lymphomagenesis. Genes Dev. 13:2658-2669.
6. Eymin, B., L. Karayan, P. Seite, C. Brambilla, E. Brambilla, C.-J. Larsen, and S. Gazzeri. 2001. Human ARF binds E2F1 and inhibits its transcriptional activity. Oncogene 20:1033-1041.[CrossRef][Medline]
7. Girling, R., J. F. Partridge, L. R. Bandara, N. Burden, N. F. Totty, J. J. Hsuan, and N. B. LaThangue. 1993. A new component of the transcription factor DRTF/E2F. Nature 352:83-87.
8. Haupt, Y., R. Maya, A. Kazaz, and M. Oren. 1997. Mdm2 promotes the rapid degradation of p53. Nature 387:296-299.[CrossRef][Medline]
9. Hayes, S., P. Shiyanov, X. Chen, and P. Raychaudhuri. 1998. DDB, a putative DNA repair protein, can function as a transcriptional partner of E2F1. Mol. Cell. Biol. 18:240-249.
10. Helin, K., C.-L. Wu, A. R. Fattaey, J. A. Lees, B. D. Dynlacht, C. Ngwu, and E. Harlow. 1993. Heterodimerization of the transcription factor E2F1 and DP1 leads to cooperative transactivation. Genes Dev. 7:1850-1861.
11. Honda, R., H. Tanaka, and H. Yasuda. 1997. Oncoprotein MDM2 is a ubiquitin ligase E3 for tumor suppressor p53. FEBS Lett. 420:25-27.[CrossRef][Medline]
12. Honda, R., and H. Yasuda. 1999. Association of p19ARF with Mdm2 inhibits ubiquitin ligase activity of MDM2 for tumor suppressor p53. EMBO J. 18:22-27.[CrossRef][Medline]
13. Ishida, S., E. Huang, H. Zuzan, R. Spang, G. Leone, M. West, and J. R. Nevins. 2001. Role for E2F in control of both DNA replication and mitotic functions as revealed from DNA microarray analysis. Mol. Cell. Biol. 21:4684-4699.
14. Kamijo, T., S. Bodner, E. van de Kamp, D. H. Randle, and C. J. Sherr. 1999. Tumor spectrum in ARF-deficient mice. Cancer Res. 59:2217-2222.
15. Kamijo, T., J. D. Weber, G. Zambetti, F. Zindy, M. F. Roussel, and C. J. Sherr. 1998. Functional and physical interactions of the ARF tumor suppressor with p53 and Mdm2. Proc. Natl. Acad. Sci. USA 95:8292-8296.
16. Kamijo, T., F. Zindy, M. F. Roussel, D. E. Quelle, J. R. Downing, R. A. Ashmun, G. Grosveld, and C. J. Sherr. 1997. Tumor suppression at the mouse INK4a locus mediated by the alternative reading frame product p19ARF. Cell 91:649-659.[CrossRef][Medline]
17. Korgaonkar, C., L. Zhao, M. Modestou, and D. Quelle. 2002. ARF function does not require p53 stabilization or MDM2 relocalization. Mol. Cell. Biol. 22:196-206.
18. Krek, W., G. Xu, and D. M. Livingston. 1995. Cyclin A-kinase regulation of E2F 1 DNA binding function underlies suppression of an S phase checkpoint. Cell 83:1149-1158.[CrossRef][Medline]
19. Kubbutat, M. H., S. N. Jones, and K. H. Vousden. 1997. Regulation of p53 stability by Mdm2. Nature 387:299-303.[CrossRef][Medline]
20. Lam, E. W., and N. B. La Thangue. 1994. DP and E2F proteins: coordinating transcription with cell cycle progression. Curr. Opin. Cell Biol. 6:859-866.[CrossRef][Medline]
21. Lin, W.-C., F.-T. Lin, and J. R. Nevins. 2001. Selective induction of E2F1 in response to DNA damage, mediated by ATM-dependent phosphorylation. Genes Dev. 15:1833-1844.
22. Llanos, S., P. A. Clark, J. Rowe, and G. Peters. 2001. Stabilization of p53 by p14ARF without relocalization of mdm2 to the nucleolus. Nat. Cell. Biol. 3:445-452.[CrossRef][Medline]
23. Lohrum, M. A. E., M. Ashcroft, M. H. G. Kubbutat, and K. H. Vousden. 2000. Contribution of two independent mdm2-binding domains in p14ARF to p53 stabilization. Curr. Biol. 10:539-542.[CrossRef][Medline]
24. Magae, J., S. Illenye, Y.-C. Chang, Y. Mitsui, and N. H. Heintz. 1999. Association with E2F1 governs intracellular trafficking and polyubiquitination of DP1. Oncogene 18:593-605.[CrossRef][Medline]
25. Martelli, F., T. Hamilton, D. P. Silver, et al. 2001. P19ARF targets certain E2F species for degradation. Proc. Natl. Acad. Sci. USA 98:4455-4460.
26. Martin, K., D. Trouche, C. Hagemeier, T. S. Sorensen, N. B LaThangue, and T. Kouzarides. 1995. Stimulation of E2F1/DP1 transcriptional activity by mdm2 oncoprotein. Nature 375:691-694.[CrossRef][Medline]
27. Midgley, C. A., J. M. Desterro, M. K. Saville, S. Howard, A. Sparks, R. T. Hay, and D. P. Lane. 2000. An N-terminal p14ARF peptide blocks Mdm2-dependent ubiquitination in vitro and can activate p53 in vivo. Oncogene 19:2312-2323.[CrossRef][Medline]
28. Nevins, J. R., J. DeGregory, L. Jakoi., and G. Leone. 1997. Functional analysis of E2F. Methods Enzymol. 283:205-219.[CrossRef][Medline]
29. Nevins, J. R. 1998. Towards an understanding of the functional complexity of the E2F and retinoblastoma families. Cell Growth Differ. 9:585-593.[Medline]
30. Oliner, J. D., J. A. Pietenpol, S. Thiagalingam, J. Gyuris, K. W. Kinzler, and B. Vogelstein. 1993. Oncoprotein MDM2 conceals the activation domain of tumour suppressor p53. Nature 362:857-860.[CrossRef][Medline]
31. Pomerantz, J., N. Schreiber-Agus, N. J. Liégeois, et al. 1998. The Ink4a tumor suppressor gene product, p19ARF, interacts with MDM2 and neutralizes MDM2's inhibition of p53. Cell 92:713-723.[CrossRef][Medline]
32. Quelle, D. E., F. Zindy, R. A. Ashmun, and C. Sherr. 1995. Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell 83:993-1000.[CrossRef][Medline]
33. Roth, J., M. Dobbelstein, D. A. Freedman, T. Shenk, and A. J. Levine. 1998. Nucleo-cytoplasmic shuttling of the hdm2 oncoprotein regulates the levels of the p53 protein via a pathway used by the human immunodeficiency virus rev protein. EMBO J. 17:554-564.[CrossRef][Medline]
34. Schmitt, C. A., M. E. McCurrach, E. De Stanchina, R. R. Wallace-Brodeur, and S. W. Lowe. 1999. INK4a/ARF mutations accelerate lymphomagenesis and promote chemoresistance by disabling p53. Genes Dev. 13:2670-2677.
35. Seed, B., and J. Y. Sheen. 1988. A simple phase-extraction assay for chloramphenicol acetyltransferase activity. Gene 67:271-277.[CrossRef][Medline]
36. Shengyun, F., J. P. Jensen, R. L. Ludwig, K. H. Vousden, and A. M. Weissman. 2000. Mdm2 is a RING finger-dependent ubiquitin protein ligase for itself and p53. J. Biol. Chem. 275:8945-8951.
37. Sherr, C. J. 1998. Tumor surveillance via the ARF-p53 pathway. Genes Dev. 12:2984-2991.
38. Stott, F. J., S. Bates, M. C. James, et al. 1998. The alternative product from the human CDKN2A locus, p14ARF, participates in a regulatory feedback loop with p53 and MDM2. EMBO J. 17:5001-5014.[CrossRef][Medline]
39. Tao, W., and A. J. Levine. 1999. p19ARF stabilizes p53 by blocking nucleo-cytoplasmic shuttling of Mdm2. Proc. Natl. Acad. Sci. USA 96:6937-6941.
40. Trimarchi, J. M., and J. A. Lees. 2002. Sibling rivalry in the E2F family. Nat. Rev. Mol. Cell. Biol. 1:11-20.
41. Weber, J. D., M.-L. Kuo, B. Bothner, E. L. DiGiammarino, R. W. Kriwacki, M. F. Roussel, and C. J. Sherr. 2000. Cooperative signals governing ARF-Mdm2 interaction and nucleolar localization of the complex. Mol. Cell. Biol. 20:2517-2528.
42. Weber, J. D., L. J. Taylor, M. F. Roussel, C. J. Sherr, and D. Bar-Sagi. 1999. Nucleolar Arf sequesters Mdm2 and activates p53. Nat. Cell Biol. 1:20-26.[CrossRef][Medline]
43. Weber, J. D., J. R. Jeffer, J. E. Rehg, D. H. Randle, G. Lozano, M. F. Roussel, C. J. Sherr, and G. P. Zambetti. 2000. p53-independent functions of the p19ARF tumor suppressor. Genes Dev. 14:2358-2365.
44. Zhang, Y., and Y. Xiong. 2001. Control of p53 ubiquitination and nuclear export by Mdm2 and ARF. Cell Growth Differ. 12:175-186.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
