Complex Transcriptional Effects of p63 Isoforms: Identification of Novel Activation and Repression Domains{dagger}

p63 is a transcription factor structurally related to the p53tumor suppressor. The C-terminal region differs from p53's inthat it contains a sterile alpha motif (SAM) domain and is subjectto multiple alternative splicings. The N-terminal region ispresent in the transactivation (TA) and ${Delta}$ N configurations, withthe latter lacking the transcriptional activation domain 1.Single amino acid substitutions and frameshift mutations ofp63 cause the human ankyloblepharon ectodermal dysplasia clefting(AEC) or ectrodactyly ectodermal dysplasia and facial clefting(EEC) syndromes. We have systematically compared the activitiesof the wild-type p63 isoforms and of the natural mutants inactivation and repression assays on three promoters modulatedby p53. We found that p63 proteins with an altered SAM domainor no SAM domain—the ß isoforms, the EEC frameshiftmutant, and the missense AEC mutations—all showed a distinctlyhigher level of activation of the MDM2 promoter and decreasedrepression on the HSP70 promoter. Fusion of SAM to the GAL4DNA-binding domain repressed a heterologous promoter. A secondactivation domain, TA2, corresponding to exons 11 to 12, wasuncovered by comparing the activation of ${Delta}$ N isoforms on naturalpromoters and in GAL4 fusion systems. In colony formation assays,the AEC mutants, but not the EEC frameshift, were consistentlyless efficient in suppressing growth, in both the TA versionand the ${Delta}$ N version, with respect to their p63 ${alpha}$ counterparts. Thesedata highlight the modularity of p63, identifying the SAM domainas a dominant transcriptional repression module and indicatingthat the AEC and EEC frameshift mutants are characterized bya subversion of the p63 transcriptional potential.

INTRODUCTION

Top

Introduction

p53 is a sequence-specific transcription factor that plays acritical role in activating the expression of genes involvedin cell cycle arrest and apoptosis. Under conditions of genotoxicstress, p53 stabilization leads to transcriptional activationand repression of different sets of genes (7). The MDM2, p21,and GADD45 genes are among those that are activated by p53 bydirect binding to specific sites in their regulatory regions(32). Mutations in the p53 tumor suppressor gene are the mostfrequent somatic alterations found in human cancers, and hotspots of mutations are found within the DNA-binding subdomain(34, 47). Many genes are down-regulated at the transcriptionallevel by p53 with mechanisms that are less clearly defined,possibly involving direct interactions with components of thebasal transcriptional apparatus (15, 22). More recently, twogenes were uncovered, referred to as the p63 and p73 genes,encoding proteins that share significant amino acid identitywith p53 in the transactivation, DNA-binding, and oligomerizationdomains (19, 20, 28, 37, 49). p63 and p73 are more similar toeach other than to p53, and both can activate p53-responsivepromoters (18, 26, 31, 48). An extended C-terminal coding region,not found in p53, is present in p63 and p73 and undergoes complexalternative splicing (21). Within this C-terminal extension,there is a sterile alpha motif (SAM) that is found in proteinsthat regulate mammalian development and is thought to be involvedin protein-protein interactions (4, 44). In contrast to p53,p73 and p63 are rarely mutated in human cancers (34). Anothernotable difference is that p63 and p73 are present as two isoformswith respect to their N termini, with widely divergent biologicalproperties: the transactivating (TA) isoforms, which resemblep53, are generated by the use of an upstream promoter; the ${Delta}$ Nisoforms, produced from an intronic promoter, contain the sameDNA-binding and oligomerization domains as the TA but lack thetransactivation domain (see Fig. 1). Both the TA and ${Delta}$ N isoformshave three possible carboxyl termini, termed ${alpha}$ , ß,and ${gamma}$ . The ß and ${gamma}$ isoforms lack the SAM domain.

View larger version (22K):
[in this window]
[in a new window]
FIG. 1. Schematic representation of p63 structure. Intron-exon structure of the p53 and p63 genes, showing the p63 transcriptional start sites and the alternative splicing at the 3' end that gives rise to the ${alpha}$ , ß, and ${gamma}$ isoforms, is shown. The change in the reading frame within exons 14 and 15 occurring in the ß and ${gamma}$ isoforms is indicated. The positions of the EEC and AEC SAM domain mutations are indicated. All mutations fall within exon 13 and are predicted to affect only the ${alpha}$ isoforms.

Inactivations of genes for p53-like proteins in mice have verydifferent outcomes, implying that they play distinct roles invivo. In fact, even though p53 modulates critical cellular processesand is ubiquitously expressed, p53 knockout mice are developmentallynormal and show increased susceptibility to spontaneous tumorigenesis(13). Mice deficient for p73 exhibit profound defects, includinghippocampal dysgenesis, hydrocephalus, chronic infections, andinflammations, as well as abnormalities in pheromone sensorypathways (50). Mice lacking p63 are born alive but die soonafter birth, with several developmental defects, particularlyin limb formation and in the skin compartment (35, 51). Importantclues as to the physiological role of p63 came from the analysisof the molecular defects of patients with distinct autosomaldominant syndromes, caused by alteration of the p63 gene. (i)In ectrodactyly, ectodermal dysplasia and cleft lip/palate (EEC)syndrome, the phenotypes are similar to some of the featuresdetected in p63-deficient mice (8). All but one of the almost50 p63 mutations so far identified in EEC patients create aminoacid substitutions that are predicted to abolish the DNA-bindingcapacity of p63. The remaining mutation introduces a frameshiftwithin exon 13 of the p63 gene that affects p63 ${alpha}$ but not thep63ß or ${gamma}$ isotype (46). (ii) Approximately 10% of thepatients with isolated split hand-split foot malformation (SHFM)have p63 mutations, these being either amino acid substitutionsin the DNA-binding domain or stop mutations at the C-terminalend of p63 ${alpha}$ (17, 46). (iii) For the Hay-Wells syndrome, alsoknown as ankyloblepharon-ectodermal dysplasia-clefting (AEC),whose phenotype is similar to but clearly distinct from thatof the EEC patients, all mutations identified so far are singleamino acid substitutions encoded within exon 13 of the p63 gene(33).

A number of studies have so far addressed the activation andgrowth suppression features of some of p63 isoforms (48). However,a comprehensive comparison of all known p63 isoforms on a naturalrather than artificial construct is lacking. Thus, to bettercomprehend the biological complexity of p63, we undertook asystematic analysis of the transcriptional and growth-regulatingactivities of six splicing variants of p63 (TAp63 ${alpha}$ , -ß,and - ${gamma}$ and ${Delta}$ Np63 ${alpha}$ , -ß, and - ${gamma}$ ), of the exon 13 frameshiftmutation isolated from an EEC patient, and of four missensemutations causing the AEC syndrome.

MATERIALS AND METHODS

Top

Materials and Methods

Cell culture and transfections. The Saos-2 cell line was maintained in RPMI 1640 medium supplementedwith 10% fetal calf serum. For transfection, 80,000 cells wereseeded into 24-well multiplates and on the following day weretransfected with Lipofectamine 2000 (Gibco) under the conditionssuggested by the manufacturer. The total amount of transfectedDNA (1 µg) was kept constant using empty vector DNA whennecessary. Thirty-six hours later, cells were collected forchloramphenicol acetyltransferase (CAT) assays (16). For RNAextraction, 800,000 Saos-2 cells were seeded into 60-mm-diameterdishes and, the day after, transfected with Lipofectamine 2000with 10 µg of DNA (Gibco).

RNA preparation and analysis. Total RNAs were extracted from Saos-2 cells by the Trizol reagent(Gibco) according to the instructions of the manufacturer. Fifteenmicrograms of each sample was loaded on a 1% formaldehyde-containingagarose gel and transferred to a nitrocellulose membrane. Thefollowing fragments were used as probes: a 1.9-kb EcoRI fragmentfrom the human MDM2 gene (5) and the rat glyceraldehyde-3-phosphatedehydrogenase fragment, used for normalization of RNA loading(40). Fragments were labeled with [ ${alpha}$ -³²P]dCTP by the Random PrimedDNA labeling kit (Boehringer).

Colony-forming efficiency assay. Saos-2 cells were transfected with p63-containing plasmids,all carrying a neo-resistance gene. After 2 weeks of selection,the G418-resistant colonies were fixed with methanol-aceticacid (2:10 [vol/vol]) and visualized by staining with 2% (wt/vol)crystal violet for easy visualization.

Plasmids. The p21/WAFCAT contains the 2.4-kb fragment from the p21/WAFpromoter (6). The Bp100 CAT reporter contains two copies ofthe p53RE motif derived from the MDM2 intronic promoter (5).The Hsp70 CAT (23) and all p63 isoforms (wild type [wt] andmutants) were described previously (8, 33). The reporter GAL4vectors, G5X ${Delta}$ N-CAT and G5-PB11CAT, were provided by B. Majello(29, 30).

GAL4 fusion proteins. For construction of GAL4 fusion proteins, different oligonucleotidepairs were synthesized in order to specifically amplify exons11, 12, and 14 from the wt TA ${alpha}$ p63 cDNA and exon 13 from wt andAEC-mutated TA ${alpha}$ p63 cDNAs. The sequences of the oligonucleotideswere as follows: exon 11, 11 Forward (GGGGATCGATTCAGACCTCAATACAG11) and 11 Reverse (CCCCCTCGAGTCAAATGTTGGCTCCCAT); exon 12,12 Forward (CCCCATCGATTCCCATGATGGGCACC) and 12 Reverse (CCCCCTCGAGCTAGACAATGCTGCAATC);exon 13, 13 Forward (GGGGATCGATTAGTTTCTTAGCGAGG) and 13 Reverse(CCCCCTCGAGTCAATCCATGGAGTAATG); exon 14, 14 Forward (GGGGATCGATTGATCTGGCAAGTCTG)and 14 Reverse (CCCCCTCGAGTCACTCCCCCTCCTCTTT).

All oligonucleotides contained adequate restriction sites (underlined)to allow further cloning steps. The amplification products werepurified after digestion with restriction enzymes and ligatedinto the pGAL4poly plasmid in frame with the GAL4 DNA-bindingdomain (27). All clones were authenticated by DNA sequencing.

Western immunoblot analysis. Thirty-six hours after transfection, cells were lysed in loadingbuffer (2% sodium dodecyl sulfate, 30% glycerol, 300 mM ß-mercaptoethanol,100 mM Tris-HCl [pH 6.8]), and different volumes of total extractswere separated on SDS-8% polyacrylamide gels and transferredto a nitrocellulose membrane (Schleicher & Schuell). Theblots were incubated with the following antibodies: p53 (FL393, no. sc6243) c-myc (A14, no. sc789), and GAL4 (RK5C1, no.sc510) (Santa Cruz Biotechnology) and developed according tothe manufacturer's instructions (Super Signal; Pierce).

RESULTS

Top

Results

Activation and inhibition of promoters by p63 isoforms. p63 is present in multiple isoforms, resulting in part fromdifferential splicing and in part from the use of two promotersthat generate variations at the N-terminal end of the protein.Figure 1 shows a schematic representation of p63 complexity,as well as the positions of the mutations identified in EECand AEC patients that were used in this study. Bona fide naturalp63 gene targets have not been identified so far. To test thetranscriptional activities of the different p63 isoforms, weused two target promoters that are activated (MDM2 and p21)and one promoter that is repressed (Hsp70) by p53. The Bp100-CATand p21/WAFCAT plasmids contain the intronic MDM2 promoter andthe upstream control sequences and promoter of p21, respectively,both harboring two DNA binding sites for p53 (5). The Hsp70-CATplasmid contains a promoter with no known p53 binding sitesthat is efficiently down-regulated by p53 (1). In these experiments,we used the human osteosarcoma cell line Saos-2, which expressesvery low levels of p73 and no p53 or p63 (6).

Initially, we verified the expression levels of the transfectedp63 isoforms. Figure 2A shows that all proteins were expressedfrom the pcDNA vectors and their abundance varies to some extent,with the ${alpha}$ isoforms being the more abundant and the ${gamma}$ being theless abundant, in agreement with published results (5); forthis reason, different amounts of total cell lysates were used:25 µl for TAp63ß and TAp63 ${gamma}$ (Fig. 2A, lanes 2and 6) and 10 µl for other p63 isoforms and p53. To takeon these differences, which could possibly alter transactivationpotentials, we systematically transfected different doses ofplasmids in the subsequent experiments. Results in Fig. 2B showthe transcriptional activities of dose responses of all p63isoforms on the p21 promoter: as expected, p53, as well as TAp63 ${alpha}$ and TAp63 ${gamma}$ , activate transcription, albeit modestly, whereas ${Delta}$ Np63 ${alpha}$ does not. TAp63ß and, surprisingly, ${Delta}$ Np63 ${gamma}$ and ${Delta}$ Np63ß also activate p21 over a wide range of transfectedDNA. A different activation profile emerges from the analysisof the MDM2 reporter (Fig. 2C). Both the TAp63 ${alpha}$ and ${Delta}$ Np63 ${alpha}$ isoformswere inefficient as transcriptional activators. The TAp63 ${gamma}$ and ${Delta}$ Np63 ${gamma}$ isoforms activated transcription modestly, fourfold onaverage (Fig. 2C). On the other hand, the TAp63ß and ${Delta}$ Np63ß isoforms activated transcription very efficiently,10- to 15-fold, even at low levels of transfected plasmids,with TAp63ß being a stronger activator than p53. Thisis remarkable, since the protein levels of the ß isoformsare consistently lower by a factor of three than those of the ${alpha}$ isoforms (Fig. 2A); thus, we are possibly underestimating theTA and ${Delta}$ Np63ß activation potential. Taken together,these results are surprising, since (i) the robust activationobtained on the MDM2 promoter with ${Delta}$ Np63ß is effectivedespite the lack of the canonical TA activation domain, suggestingthat an additional transcriptional activation function(s) iscontained within p63, and (ii) the lack of activation of theTAp63 ${alpha}$ isoform is most likely due to sequences at the C-terminalend, possibly suggesting that a repressive domain is presentin exons 13 to 14, which are absent in the ß isoform.

View larger version (29K):
[in this window]
[in a new window]
FIG. 2. Transactivation potential of p63 isoforms. (A) The transfected proteins are correctly expressed. Saos-2 cells were transiently transfected with 0.5 µg of the indicated plasmids and lysed in 100 µl of lysis buffer 36 h after transfection. Different volumes of total cell extracts were immunoblotted with anti-myc antibodies: p53 (10 µl) (lane 1), TAp63 ${alpha}$ (10 µl) (lane 2), ${Delta}$ Np63 ${alpha}$ (10 µl) (lane 3), TAp63ß (25 µl) (lane 4), ${Delta}$ Np63ß (10 µl) (lane 5), TAp63 ${gamma}$ (25 µl) (lane 6), and ${Delta}$ Np63 ${gamma}$ (10 µl) (lane 7). (B) Saos-2 cells were transfected with the p21/WAFCAT reporter plasmid (0.5 µg) (open bar). Different amounts of expression plasmids for p53 and p63 isoforms were cotransfected (5, 25, 100, and 300 ng; dotted, black, dashed, and gray bars, respectively). After 36 h, cells were harvested and CAT activity was determined. (C) Saos-2 cells were transfected with the pBP100 reporter plasmid (0.5 µg) (open bar) and with expression plasmids as in panel B. (D) Saos-2 cells were transfected with the Hsp70 reporter plasmid (0.25 µg) (open bar) and with expression plasmids (100, 300, and 500 ng; dashed, gray and squared bars, respectively). The basal activity of the reporters was set to 1. Data are presented as fold activation or repression relative to the sample without effector. Each histogram bar represents the mean of three independent transfection duplicates. Standard deviations are indicated.

Several promoters were shown to be inhibited by p53 (15). Repressionassays were performed with p63 ${alpha}$ and ${gamma}$ isoforms but not with p63ß(36). We wished to verify whether p63 isoforms have repressioncapacity by cotransfecting increasing amounts of p63 plasmidswith the Hsp70 promoter, a p53 target which possesses a highlevel of intrinsic activity even without activation by heatshock. Indeed, promoter activity is very efficiently repressedby p53 (10- to 15-fold; see Fig. 2D), a result entirely consistentwith previous reports (1). TAp63 ${alpha}$ and TAp63 ${gamma}$ potently inhibitedtranscription, whereas the corresponding ${Delta}$ N isoforms showed aclear reduction of the inhibition capacity. On the other hand,both the TA and ${Delta}$ Np63ß isoforms modestly inhibitedHsp70 promoter function. These data suggest that two domainsinfluence the repressing activity: the TA domain, whose presencein the ${alpha}$ and ${gamma}$ isoforms guarantees stronger repression, and theC terminus of the protein, the absence of which decreases repression.

No correlation has been shown so far between transient coexpressionwith transfected p63 isoforms and the actual modulation of endogenousgenes. For this reason, we felt it was important to validatethe results obtained with the MDM2-CAT reporter constructs bychecking the expression of the endogenous MDM2 gene upon cotransfectionof the different p63 isoforms described above. Thirty-six hoursafter the addition of p63 cDNAs, total RNA was extracted andused for Northern blot analysis. As shown in Fig. 3, we observeda fivefold increase with p53 and an even higher induction withthe TAp63ß and TAp63 ${gamma}$ isoforms (Fig. 3A, compare lane1 with lanes 2, 5, and 7). The TA and ${Delta}$ N p63 ${alpha}$ isoforms were completelyineffective (Fig. 3A, lanes 3 and 4), while the ${Delta}$ Nßand ${Delta}$ N ${gamma}$ isoforms were very modestly active (Fig. 3A, lanes 6 and8). These results are in line with those previously reportedfor p53 (52) and largely confirmatory of the data obtained withthe reporter assays, with the exception of ${Delta}$ Np63ß,which is much more efficient in the latter experimental setup.

View larger version (62K):
[in this window]
[in a new window]
FIG. 3. The endogenous MDM2 mRNA is induced upon p63 transfection. Northern analysis of total RNA extracted from Saos-2 cells transiently transfected with the indicated plasmids is shown. MDM2 RNA was barely detectable in mock-transfected cells (lane 1). As expected, p53 transfection induced MDM2 RNA expression (lane 2); an even stronger induction was observed in the TAß transfectants (lane 5); transfection of the TA ${gamma}$ isoform resulted in a good induction of MDM2 RNA (lane 7). Transfection of the TAp63 ${alpha}$ , ${Delta}$ Np63 ${alpha}$ , and ${Delta}$ Np63ß isoforms did not induce MDM2 RNA expression (lanes 3, 4, and 6). The same filter was hybridized to a rat glyceraldehyde 3-phosphate dehydrogenase (GAPDH) cDNA probe for normalization of RNA loading.

Dissection of C-terminal repression and activation subdomains. To dissect the function(s) of the p63 C-terminal region, weused the GAL4 recruitment assay with Saos-2 cells. We generatedconstructs containing exon 11, 12, 13, or 14 fused to the yeastGAL4 DNA-binding domain. The activities of the resulting constructs,termed hereafter G4-63-11, G4-63-12, G4-63-13, and G4-63-14,were checked with two reporter plasmids: the first, the G5X ${Delta}$ Nconstruct, which contains five GAL4 binding sites fused to thehuman myc promoter sequences spanning from -93 to +54 of theP2 transcription start site, has low intrinsic activity andwas used to study activation (30). The second one, the G5-PB11plasmid, a construct that harbors a minimal simian virus 40promoter with 6 Sp1 binding site and a TATA box, driving highbasal activity, was used to score for repression (29). Initially,we verified that the proteins were correctly expressed upontransfection into Saos-2 cells (Fig. 4A). As shown in Fig. 4B,the G5X ${Delta}$ N was activated three- to fivefold by both the G4-63-11and the G4-63-12 fusion proteins. A construct in which bothexons 11 and 12 were fused to GAL4 DNA-binding domain did notincrease transcription further (data not shown). The G4-63-13and G4-63-14 proteins had a slight inhibitory effect on thevery low level of transcription from this reporter. On the otherhand, when the latter were used with the G5-PB11 reporter plasmid,which has high intrinsic activity, they repressed transcriptionfour- to fivefold (Fig. 4C). These data uncover two new functionslocated at the C terminus of p63: (i) an activation domain,termed hereafter TA2, encoded within exons 11 and 12 that ismost likely responsible for the transcriptional activation observedwith the ${Delta}$ N isoforms in transient reporter assays; and (ii) arepressive domain, encoded by sequences within exons 13 and14.

View larger version (19K):
[in this window]
[in a new window]
FIG. 4. Transcriptional activation and repression by Gal4-p63 exons. (A) Saos-2 cells were transiently transfected with 0.5 µg of the indicated plasmids and lysed in 100 µl of lysis buffer 36 h after transfection. Ten microliters of total cell extracts were immunoblotted with anti-GAL4 antibodies. (B) G5X ${Delta}$ N reporter (0.5 µg) (open bar) was cotransfected into Saos-2 cells together with indicated GAL4 vectors (black and dashed bars; 0.3 and 0.5 µg, respectively). (C) PB11 reporter (0.5 µg) (open bar) was cotransfected into Saos-2 cells together with indicated GAL4 vectors (black and dashed bars; 0.3 and 0.5 µg, respectively). Data are presented as fold activation or repression relative to the sample without effector. Each histogram bar represents the mean of three independent transfection duplicates. Standard deviations are indicated.

Analysis of transcriptional activity of the EEC and AEC p63 mutants. The delineation of exon 13 sequences as a transcriptional repressingpart of p63 prompted us to examine the activities of mutantscausative of the human EEC and AEC syndromes (8, 33). p63 ${alpha}$ FScontains a mutation found in an EEC syndrome patient containingan A insertion that generates a frameshift at amino acid 525encoded within exon 13, leading to a predicted premature stop;p63 AEC missense mutants L518F, G534V, T537P, and Q540L arealso encoded within exon 13 in the ${alpha}$ 1 and ${alpha}$ 3 helices and L2 ofthe SAM domain (33). Because of the alternative splicing atthe C terminus (Fig. 1), these mutations are present only inthe ${alpha}$ isoforms. We performed the reporter assays outlined abovewith expression vectors coding for these mutants in the TA and ${Delta}$ N configurations. The TA and ${Delta}$ N p63 ${alpha}$ FS mutants showed similarbehavior, activating the p21 and MDM2 promoters (Fig. 5A and B):both were among the strongest activators, unlike their wtcounterparts, which were ineffective in MDM2 activation. Withthe AEC mutants, all the ${Delta}$ N isoforms were unable to activatep21 or the MDM2 promoter, while the TA isoforms were activeon MDM2 but not on p21. The gain of transcription function ofTA540 is particularly striking, for it is the strongest amongthe activators tested on MDM2. In repression assays, the frameshiftmutants showed no differences with respect to the wt isoforms(Fig. 5C), whereas the TA AEC mutants completely lost the capacityto repress Hsp70 transcription. Indeed, all ${Delta}$ N AEC constructs,whose ${Delta}$ N wt counterpart has no repression capacity, showed arobust activation of this promoter. The mutants were checkedfor protein expression in immunoblot analysis with specificanti-myc tag antibodies, and all were expressed at equivalentlevels (Fig. 5D). From this analysis, we conclude that singleamino acid substitutions within the SAM domain turn an ineffectiveactivator, such as TAp63 ${alpha}$ , into a powerful one (Fig. 5B) andat the same time render the proteins incapable of repression(Fig. 5C). Furthermore, the transcriptional properties/behaviorof p63 ${alpha}$ FS is clearly distinct from that of the AEC mutants. Tofurther clarify whether the AEC mutations alter the exon 13repression domain identified above (Fig. 4C), we generated constructscontaining the AEC G534V and Q540L exon 13 mutants fused tothe yeast GAL4 DNA-binding domain (G4-13-534 and G4-13-540).The activities of the resulting constructs were assayed withthe reporter used above (Fig. 4C). The proteins were correctlyexpressed upon transfection into Saos-2 cells (Fig. 5E). Asshown in Fig. 5F, when assayed with the G5-PB11 reporter, therepression capacities of G4-13-534 and G4-13-540 were modestlyreduced compared to that of G4-63-13. These data suggest thatthe AEC mutations do not disrupt the exon 13 repression domain,but rather, in the entire p63 protein, AEC mutations could prevent(i) the association of a corepressor and/or (ii) interactionsof the SAM domain with the TA1 of p63.

View larger version (51K):
[in this window]
[in a new window]
FIG. 5. Transcriptional regulation by EEC and AEC mutation. (A) Saos-2 cells were transfected with the p21/WAFCAT reporter plasmid (0.5 µg) (open bar). Different amounts of expression plasmids for p63 isoforms were cotransfected (5, 25, 100, and 300 ng; dotted, black, dashed, and gray bars, respectively). After 36 h, cells were harvested and CAT activity was determined. (B) Saos-2 cells were transfected with the pBp100 reporter plasmid (0.5 µg) (open bar) and cotransfected as in panel A. (C) Saos-2 cells were transfected with the Hsp70 reporter plasmid (0.25 µg) (open bar) and cotransfected with expression plasmids (5, 25, 100, 300 and ng; dotted, black, dashed, and gray bars, respectively). (D and E) Saos-2 cells were transiently transfected with 0.5 µg of the indicated plasmids and lysed in 100 µl of lysis buffer 36 h after transfection. Twenty microliters of total cell extracts were immunoblotted with anti-myc (D) and anti-GAL4 (E) antibodies. (F) G5-PB11 reporter (0.5 µg, open bar) was cotransfected into Saos-2 cells together with indicated GAL4 vectors (black and dashed bars, 0.3 and 0.5 µg, respectively). Data are presented as fold activation or repression relative to the sample without effector. Each histogram bar represents the mean of three independent transfection duplicates. Standard deviations are indicated.

Growth suppression by wt and mutant p63 isoforms. p53 is known to inhibit growth and some of p63 isoforms havebeen already checked for growth suppression in colony formationassays, known to reveal cell cycle blocking and proapoptosisfunctions (37). We performed such experiments with Saos-2 cellsstably transfected with the constructs used above, which harbora neomycin selection marker. The numbers of colonies scoredafter 2 weeks of addition of G418 in the medium are shown inFig. 6A. As expected, p53 induced a dramatic decrease (50-fold)in colony numbers. In line with previous reports, essentiallythe same picture was evident with all the TAp63 isoforms. Amongthe mutants, TAp63 ${alpha}$ FS and TA540 behaved like the wt p63 ${alpha}$ isoform,whereas TA518, TA534, and to a lesser degree TA537 yielded five-to sevenfold more colonies than TAp63 ${alpha}$ yet clearly fewer thanthe pcDNA control. As for the ${Delta}$ N isoforms, p63 ${alpha}$ and, more profoundly,p63ß inhibited growth, whereas p63 ${gamma}$ and AEC mutantswere essentially negative in this assay: in fact, ${Delta}$ N518, ${Delta}$ N534,and ${Delta}$ N540 generated a consistently higher number of colonies.On the other hand, p63 ${alpha}$ FS behaved essentially like the p63ßisoform, being the strongest repressor of cell growth. Takentogether, these data highlight remarkable differences in termsof growth suppression between (i) the TA and ${Delta}$ N isoforms, (ii)the ${alpha}$ / ${gamma}$ and ß isoforms, and (iii) the EEC and AEC mutants.

View larger version (41K):
[in this window]
[in a new window]
FIG. 6. Growth suppression by expression of wt and mutated p63 isoforms. (A) p53, p63 isoforms, and pcDNA expression vectors (0.3 µg each) were transfected into Saos-2 cells. After 2 weeks of selection, colonies were fixed and stained to demonstrate suppression of colony formation. (B) The graph represents the number of colonies obtained with the indicated plasmids relative to that detected on the pcDNA transfected plates, which was set to 1. The experiment was repeated three times in duplicate. Standard deviations are indicated.

DISCUSSION

Top

Discussion

We have performed the first comprehensive and systematic investigationof the transcriptional and growth inhibition activities of thep63 isoforms identified so far: the results are summarized inTable 1. We uncovered a novel activation domain, TA2, encodedwithin exons 11 and 12 and a repression function encoded byexons 13 and 14. Most importantly, single amino acid substitutionsin the SAM domain completely abolish inhibition function and,within the TA isoforms, acquire activation potential. The biologicalimportance of the SAM domain was further detailed in colonyassays using AEC mutants. We conclude that the SAM domain isa dominant transcriptional repression module crucial for thefunction of the ${alpha}$ isoform.

View this table:
[in this window]
[in a new window]
TABLE 1. Summary of the transcriptional and growth suppression activities of wild-type and mutated p63^a

p63 TA2 activation domain. For all p53 family members, the very N terminus of the proteinharbors a transcriptional activation domain. Although far lessconserved than the DNA-binding subdomain, this highly acidicstretch shows some degree of similarity among the three familymembers. The ß isoform in the ${Delta}$ N configuration haspowerful activation potential, suggesting that a second activationfunction was present in p63. The analysis of ${Delta}$ N ${gamma}$ , lacking theSAM domain and less active in transcription, suggested thatsequences encoded by exons 11 and 12 are important for activation.That a second activation domain, TA2, is positioned betweenamino acids 410 and 512 is indeed documented by the GAL4 fusionexperiments (Fig. 4B). Several additional indications are inkeeping with the importance of TA2: (i) it is confined to discreteexon-intron boundaries, as is often the case for functionallydefined domains, and its genomic organization, differentialsplicing, and primary amino acid sequence are conserved betweenp63 and p73. (ii) The analysis of the transcriptional effectsof p63 ${alpha}$ on natural promoters with TA and ${Delta}$ Np63 inducible celllines showed that one of the p53 potential targets, GADD45,was activated exclusively by ${Delta}$ Np63 ${alpha}$ , a result well in line withthe requirement of a second activation domain (12). (iii) p73was shown to contain an activation function active in yeastand in mammalian cells between amino acids 380 and 499, a regionthat corresponds to p63 gene exons 11 and 12 (38, 45); moreover,one of the two p73 missense mutations identified in human neuroblastomasinvolves a proline, P425L, that is conserved in p63: the mutationindeed affects activation function in GAL4 assays (43). (iv)This region has a high proline content that is found in theactivation domains of many other transcription factors (25).Interestingly, the Blandino and colleagues have recently shownthat Yes-associated protein, a WW domain adaptor, binds to astretch of p73 that is conserved within exon 12 of p63 and coactivatesp73- and p63-mediated transcription (42).

Finally, the residual activity of ${gamma}$ isoforms observed in ourassays could well be due to 26 amino acids at the very N-terminalend of the protein outside TA1 which are encoded by additionalsplicing variants (3). A further activation function was recentlymapped to this region (12). In general, we provide evidencethat an endogenous gene is activated by the panel of transfectedp63 isoforms. It should be mentioned, however, that we wereunable to activate the endogenous MDM2 gene by overexpressing ${Delta}$ Np63ß in the absence of TA1, unlike the robust activationobserved with the TA versions. This result is remindful of thep73 case, for which activation in reporter assays by overexpressionwas not completely paralleled by stimulation of endogenous geneexpression (24). Several explanations can be invoked to explainthis behavior, since (i) the reporter genes are not recapitulatingthe whole regulation and (ii) the endogenous gene is constrainedby chromatin structures.

The p63 SAM repression domain. The repressive activity elicited by the SAM domain encoded byexon 13 was characterized in more detail, revealing the following.(i) Removal of this region by alternative splicing (ßversus ${alpha}$ ) dramatically increases the activation potential ofp63 on MDM2. (ii) Fusion of this domain to a GAL4 DNA-bindingdomain repressed an SV40 promoter reporter construct. (iii)In repression assays with the HSP70 promoter, the AEC mutantsled to a complete subversion of the repression behavior withinthe TA ${alpha}$ configuration, turning these mutants into activators,albeit weak ones. Results obtained with p73 support this idea:a C-terminal deletion to amino acid 427, including the SAM domain,has been shown to yield a more active protein (43, 45). A cleardifference between the ${alpha}$ and ß isoforms within theTA configuration was reported on the MDM2 and GADD45 promotersbut not on the p21 promoter (24). We also found that a C-terminaldeletion augmented activity.

The three-dimensional structure of the p73 SAM domain betweenamino acids 491 to 550 has been recently solved by nuclear magneticresonance: it is composed of five ${alpha}$ -helices that are structurallyvery similar to the prototype SAM domain of the ephrin B2 receptor(9). Interestingly, the AEC mutations studied here are clusteredand are predicted to be either modifying the overall structureand stability of the helices or causing subtle differences inthe solvent-accessible surface of ${alpha}$ 3 (33). The ß isoforms,in addition to splicing of the SAM, also are subject to a changein the frame and loss of the amino acids encoded by exon 14.Interestingly, mutations causing premature stop codons in exon14 have been associated with limb mammary syndrome and SHFMsyndrome, pointing to a relevant role of this exon (46).

What are the mechanisms by which the ${alpha}$ isoforms inhibit transcription?The interpretation must consider the fact that the DNA-bindingdomain is intact and presumably capable of targeting the proteinto the various promoters. The SAM domain is thought to be aprotein-protein interacting module that mediates homo- and heterodimerization(44). Self-association of p63 and binding to p73 are not elicitedby the SAM domain (10). Rather, it is tempting to speculatethat a corepressor protein is normally bound to this part ofp63 ${alpha}$ isoforms, possibly interfering with DNA binding and renderingp63 transcriptionally inactive: alternatively spliced ßand ${gamma}$ isoforms or mutations would prevent the association ofsuch a corepressor and hence unmask the activation domains.

AEC/EEC and p63 transcriptional control. Both AEC and EEC syndromes are dominant traits caused by thedominant-negative activities of the mutated p63 isoforms. TheEEC single amino acid mutations described so far concern theDNA-binding subdomain of p63 and affect all isoforms (2, 8):many correspond to residues in p53, such as R204, R279, R280,and R304 in p63, which are the equivalents of p53 mutationalhot spots in innumerable human tumors (34, 41). Their effectson artificial p53 reporters have been observed: they were unableto activate when transfected alone and were unable to represscotransfected p53 or TAp63 ${gamma}$ (8, 33, 48). The equivalent p53 mutantsare known to behave in very much the same way: indeed, someof the p63 missense mutations in EEC syndrome, such as R204and R304, which are shared between EEC and SHFM (46), behavedvery much like the p53 equivalents in transfections assays (8).Biochemical work indicated that heterotetramers between p63and p73 with p53 are not easily observed in vitro and in vivo(10). However, it was recently found that p53 DNA-binding mutantsare specifically capable of heteromerizing with p63 and p73,hence lending support to a model whereby the function of thesetwo proteins would also be influenced in a negative way (14).

A fundamentally different scenario is evident for the AEC missensemutants. First, none of the mutations identified so far involvesthe DNA-binding domain; second, unlike the missense EEC, theyare present only in the ${alpha}$ isoforms. These mutants showed no differencesin the activation of an artificial reporter containing 13 p53binding sites in front of a minimal promoter, compared to thewt TAp63 ${alpha}$ counterpart (33): this behavior is indeed confirmedin our study of the p21 promoter, but it is clearly differentfrom the pattern of activation observed on MDM2, suggestingthat AEC mutants affect only a subset of p63 targets. The resultsobtained with AEC mutations in the GAL4 context (Fig. 5F) suggestthat rather than disrupting the exon 13 repression domain, AECmutations prevent association with a corepressor necessary toinduce the down-modulation normally seen in the TAp63 ${alpha}$ protein.This suggests that the role of the repression domain is dominant,a notion that is consistent with the results obtained with exon13-lacking ß and ${gamma}$ isoforms. It is even possible thatthe negative role of the SAM domain affects the TA1 activationfunction.

AEC patients have a peculiar phenotype of skin lesions, in particularsevere scalp dermatitis (46). Skin biopsies of AEC and EEC syndromepatients documented p63 staining in the differentiating cellsof the suprabasal layer, where p63 is normally absent (33).The TA and ${Delta}$ N isoforms are known to be differentially expressedin keratinocyte differentiation systems: the former increasesand the latter conversely decreases upon loss of growth capacityand differentiation (11, 39). Growth suppression assays usedin our study are the results of both activation of proapoptosisgenes and repression of cell cycle promoting genes. In general,the colony assays of the AEC TA and ${Delta}$ N isoforms suggest a morecomplex picture that might involve an altered capacity in activatinggrowth-stimulating genes and in repressing proapoptosis genes.The dramatic increase in growth inhibition in the ${Delta}$ Nßand ${Delta}$ NFS isoforms possibly indicates that proapoptosis genesare not repressed. Conversely, the importance of TA2 is highlightedby the comparison between the ${Delta}$ Nß and ${gamma}$ isoforms, inwhich it is evident that loss of exons 11 and 12 leads to lackof activation of proapoptosis genes. Thus, the severe skin phenotypeof these patients might be a complex combination of alteredcell renewal and lack of expression of highly specific differentiationgenes. This interpretation requires the exact knowledge of p63isoforms present in the basal layer in vivo, at present unknown,and the identification of p63 endogenous targets, some of whichare emerging (11). Identification of bona fide p63 targets invivo is clearly mandatory in order to fully understand the activationand repression functions of this transcription factor.

ACKNOWLEDGMENTS

We thank Francesco Blasi for critical reading of the manuscriptand for continuous support to L.G. We also thank Romina Colombofor help with some of the experiments and Simone Sabbionedafor computer assistance.

This work was supported by a grant from MURST to L.G.

FOOTNOTES

* Corresponding author. Mailing address: Dipartimento di Genetica e Biologia dei Microrganismi, Via Celoria 26, 20133 Milano, Italy. Phone: 02-5031-5000. Fax: 02-5031-5044. E-mail: luisa.guerrini{at}unimi.it. ${dagger}$ Luisa dedicates this work to the memory of Giusi.

REFERENCES

Top