This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rangatia, J.
Right arrow Articles by Behre, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rangatia, J.
Right arrow Articles by Behre, G.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, December 2002, p. 8681-8694, Vol. 22, No. 24
0270-7306/02/$04.00+0     DOI: 10.1128/MCB.22.24.8681-8694.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Downregulation of c-Jun Expression by Transcription Factor C/EBP{alpha} Is Critical for Granulocytic Lineage Commitment

Janki Rangatia,1 Rajani Kanth Vangala,1 Nicolai Treiber,1 Pu Zhang,2 Hanna Radomska,2 Daniel G. Tenen,2 Wolfgang Hiddemann,1 and Gerhard Behre1*

Department of Medicine III, Ludwig Maximilians University Munich, and GSF-National Research Center, Munich, Germany,1 Harvard Institutes of Medicine and Harvard Medical School, Boston, Massachusetts2

Received 29 May 2002/ Returned for modification 1 July 2002/ Accepted 15 September 2002


arrow
ABSTRACT
 
The transcription factor C/EBP{alpha} is crucial for the differentiation of granulocytes. Conditional expression of C/EBP{alpha} triggers neutrophilic differentiation, and C/EBP{alpha} can block 12-O-tetradecanoylphorbol-13-acetate-induced monocytic differentiation of bipotential myeloid cells. In C/EBP{alpha} knockout mice, no mature granulocytes are present. A dramatic increase of c-Jun mRNA in C/EBP{alpha} knockout mouse fetal liver was observed. c-Jun, a component of the AP-1 transcription factor complex and a coactivator of the transcription factor PU.1, is important for monocytic differentiation. Here we report that C/EBP{alpha} downregulates c-Jun expression to drive granulocytic differentiation. An ectopic increase of C/EBP{alpha} expression decreases the c-Jun mRNA level, and the human c-Jun promoter activity is downregulated eightfold in the presence of C/EBP{alpha}. C/EBP{alpha} and c-Jun interact through their leucine zipper domains, and this interaction prevents c-Jun from binding to DNA. This results in downregulation of c-Jun's capacity to autoregulate its own promoter through the proximal AP-1 site. Overexpression of c-Jun prevents C/EBP{alpha}-induced granulocytic differentiation. Thus, we propose a model in which C/EBP{alpha} needs to downregulate c-Jun expression and transactivation capacity for promoting granulocytic differentiation.


arrow
INTRODUCTION
 
CCAAT enhancer binding protein {alpha} (C/EBP{alpha}) is a tissue-specific transcription factor expressed in liver, differentiating adipocytes, and myelo-monocytic cells. Gene targeting experiments revealed a specific defect in the hematopoietic system of C/EBP{alpha} knockout mice (56). The C/EBP{alpha} null mice lack mature granulocytes, while all of the other blood cell types are present, including monocytes and peritoneal macrophages (56). Increased levels of C/EBP{alpha} expressed from an inducible promoter construct directed differentiation along the granulocytic pathway (35, 51). These results demonstrate the indispensability of C/EBP{alpha} for the granulocytic differentiation pathway. In addition, ectopic expression of C/EBP{alpha} could prevent 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced monocytic differentiation of bipotential myeloid progenitor cells (35). C/EBP{alpha} induces proliferation arrest and differentiation in many cell types, suggesting that the two activities are linked (28, 48, 51).

C/EBP factors comprise a family of related basic-region leucine zipper (bZIP) DNA binding proteins that form homodimers or hetrodimers with other C/EBP proteins to regulate transcription of target genes (24, 25, 38). The bZIP domain contains a region rich in basic amino acids linked to a dimer-forming region called the leucine zipper. Several studies show that C/EBP leucine zippers can mediate heteromeric interactions with negative regulators, with other bZIP proteins, and with non-bZIP transcription factors and can directly regulate transcriptional activation (25).

It has been proposed that certain DNA binding proteins (including C/EBP, Jun, and Myc oncogene proteins) share a common structural motif based on helix-promoting regions containing heptad repeat sequences of leucine (8, 26). This structure is critical to the biological activity of these proteins, since it facilitates the formation of functional dimers in a configuration termed the leucine zipper. Dimerization of bZIP factors of one leucine zipper subfamily with those of another subfamily is much more selective and is somewhat unusual (25, 41).

The AP-1 transcription factors are considered immediate-early response genes and are thought to be involved in a wide range of transcriptional regulatory processes linked to cellular proliferation and differentiation (5, 14, 16, 18-20, 27, 39). A combination of in vitro and in vivo molecular genetic approaches has provided evidence to suggest that AP-1 transcription factors play multiple roles in functional development of hematopoietic precursor cells into mature blood cells along most, if not all, of the hematopoietic cell lineages. This includes the monocyte/macrophage, granulocyte, megakaryocyte, mastocyte, and erythroid lineages (7, 14, 39).

The c-jun proto-oncogene encodes the transcriptional activator protein AP-1. c-jun is a member of the early-response gene family genes that are rapidly and transiently activated in response to proliferative stimuli (22). Among the AP-1 members, c-Jun is unique in its ability to positively regulate cell proliferation and to induce partial macrophage-like morphology in U937 cells (44). TPA treatment of HL60 and other human myeloid leukemia cell lines such as U937 is associated with the appearance of c-Jun transcript (14, 19, 23, 24). The level of c-Jun expression is regulated by both transcriptional and posttranscriptional mechanisms. Among important regulatory elements previously identified in the c-Jun promoter, there are two AP-1 sites, a proximal AP-1 site (pAP-1) located between bp -71 and -64 and a distal AP-1 site (dAP-1) located between bp -190 and -183 in the c-Jun promoter (1, 46, 49). Importantly, c-Jun is autoregulated by its product Jun/AP-1 (1).

The bZIP region of NF-IL6 (C/EBPß) isoforms mediates a direct association with the bZIP regions of Jun and Fos (to a lesser extent) in vitro (20). It was shown that NF-IL6-2 transactivation capacity is reduced in presence of c-Jun. The N-terminal transactivation domain of NF-IL6-1 seems to be important in regulating the repressional effect by c-Jun. However, the effect of this NF-IL6-c-Jun interaction on c-Jun/AP-1 DNA binding capacity was not addressed (20). CHOP, a member of the C/EBP family (lacking the N-terminal transactivation domain) acts as a dominant inhibitor of C/EBP{alpha}. CHOP interacts with c-Jun via the leucine zipper domain of CHOP. CHOP-c-Jun synergizes to activate transcription from an AP-1 site (47). ATF-2, another member of the AP-1 family, also has cross-family dimerization capacity with C/EBP family proteins (43). ATF-2-C/EBP{alpha} interaction diminishes the transactivation capacity of C/EBP{alpha} through the C/EBP consensus DNA binding sites, whereas this heterodimer complex could transactivate through chimeric DNA binding sites. However, the effect of this interaction on ATF-2 transactivation or DNA binding capacity still needs to be addressed.

Here we propose that the proliferation arrest and granulocytic lineage commitment function of C/EBP{alpha} (28, 35) involves inactivation of c-Jun function via attenuation of its DNA binding activity. Inactivation of c-Jun might be important for the multifunction of C/EBP{alpha}, i.e., to drive granulocytic differentiation, to block monocytic lineage commitment, and for proliferation arrest.


arrow
MATERIALS AND METHODS
 
Cell culture conditions. Human myeloid U937 cells stably transfected with a zinc-inducible C/EBP{alpha} construct (U937 {alpha}#2) or vector alone (U937EV) have been described previously (35). Cells were cultured in RPMI 1640 medium supplemented with 10% fetal calf serum, 1% L-glutamine (Gibco), 1% PenStrep (Gibco), and 850 µg of G418 (Gibco) per ml. C/EBP{alpha} expression from the metallothionine promoter was induced upon adding 100 µM ZnSO4 (Sigma). Human promyelocytic HL60 cells (DSMZ ACC 3) and human chronic myeloid leukemia in blast crisis K562 cells (DSMZ ACC 10) were grown in RPMI 1640 medium containing 10% fetal bovine serum (FBS), 1% PenStrep (Gibco), and 1% L-glutamine (Gibco). CV-1 (CCL-70) cells, NIH 3T3 (ACC 59) cells, a 293 clone constitutively expressing the proteins encoded by E1A (293E1A cells), CHO (CCL-61) cells, 293T cells, and Phoenix-A cells were maintained in Dulbecco modified Eagle medium (Gibco) supplemented with 10% FBS, 1% Penstrep, and 1% L-glutamine. HeLa cells were grown in RPMI 1640 medium supplemented with 10% FBS, 1% Penstrep, and 1% L-glutamine.

Plasmids and transient transfections. A human c-Jun promoter bp -1780/+731 construct was generated by amplifying the c-Jun promoter fragment along with XhoI half sites at each end from human genomic DNA and ligated into the pGL3 basic vector (Promega) XhoI site. A series of 5' deletions were generated as described previously (47). The bp -79/+170 human c-Jun promoter construct, bp -79/+170 AP-1/CRE mutant, bp -1780/+731 proximal AP-1 mutant, and pGL2 basic vector were gifts from W. V. Vedekis (52). The pcDNA3 C/EBP{alpha} construct was generated by releasing a BamHI/EcoRI fragment of rat C/EBP{alpha} cDNA from the pUC18 vector and ligating this fragment into pcDNA3 (Invitrogen). The reporter construct p(C/EBP)2TK contains two consensus C/EBP{alpha} binding sites linked in tandem and cloned into pTK81 luciferase. The AP-1 x7 luciferase reporter construct, containing seven repeats of AP-1 DNA binding sites, was purchased from Stratagene. Gal-4(1-147), Gal-4-Tel, and Gal-4 DNA binding domain in eukaryotic expression vector SGS424 were kindly provided by S. Bohlander, Göttingen, Germany. C/EBP{alpha}mBR (mutation in the basic region) and C/EBP{alpha}{Delta}LZ (C/EBP{alpha} leucine zipper domain replaced with GCN4 leucine zipper domain) were kind gifts from A. D. Friedman (23, 24, 44). c-Jun{Delta}RK (DNA binding domain deletion) and c-Jun{Delta}LZ (leucine zipper domain deletion) have been described previously (34).

CV.1, NIH 3T3, 293E1A, CHO, and HeLa cells (104 cells) were transfected with Lipofectamine Plus (Life Technologies) according to manufacturer's instruction. A 0.05-µg amount of promoterless Renilla luciferase reporter plasmid as an internal control was transfected along with the respective amounts of other DNAs mentioned for each set of transfections. Transfected cells were lysed in 1x passive lysis buffer at 30 h posttransfection. Firefly luciferase activities were normalized to the Renilla luciferase values of pRL-null (3-6, 50). The fold promoter activity was calculated as the ratio between the promoter and promoter plus C/EBP{alpha}, assigning a value of 1 for the promoter alone. Firefly luciferase and Renilla luciferase were measured by using the dual luciferase reporter assay system (Promega). Results are given as means and standard errors of the means.

Transfection in U937 and K562 cells was performed with Effectene reagent (Qiagen) per the manufacturer's protocol with a few modifications. Briefly, 1 µg of the total DNA was mixed with 34 µl of EC buffer. Ten microliters of Enhancer reagent was added to the plasmid solution and incubated for 5 min at room temperature. Fifteen microliters of Effectene reagent was then added, and the mixture was further incubated at room temperature for 10 min. The DNA-Effectene complex solution was diluted in 500 µl of RPMI medium and gently added to 106 cells previously aliquoted in six-well plates.

Northern blot analysis. Twenty micrograms of total RNA from adult mouse brain, peritoneal macrophages, and day 19 fetal liver from C/EBP{alpha}+/+, C/EBP{alpha}+/-, and C/EBP{alpha}-/- mice was denatured in formamide and fractionated on 1% agarose-2.2 M formaldehyde gel. RNA was transferred to a Biotrans (ICN) membrane in 10 SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), and the blots were hybridized at 58°C in Church-Gilbert buffer (1 M NaH2PO4, 1 M Na2HPO4, 20% sodium dodecyl sulfate [SDS], 100 mM EDTA). Hybridization probes were prepared with a random priming kit (Roche) with the incorporation of 5'-[{alpha}-32P]dATP (3,000 Ci/mmol; Amersham). The blots were washed twice in 1x SSC-0.1% SDS for 15 min at 60°C. A 1.1-kb BamHI fragment from SP6 c-Jun plasmid served as a probe for c-Jun.

Real-time quantitative PCR. Real-time quantitative PCR was performed using the light cycler technology (Roche Diagnostic) as described previously (12). The primers for c-Jun were 5' GCA TGA GGA AAC GCA TCG CTG CCT CCA AGT 3' (forward) and 5' GCG ACC AAG TCC TTC CCA CTC GTG CAC ACT 3' (reverse). Glucose-6-phosphate dehydrogenase (G6PD) primers were 5' CCG GAT CGA CCA CTA CCT GGG CAA C 3' (forward) and 5' GTT CCC CAC GTA CTG GCC CAG GAC CA 3' (reverse). Thirty-five cycles of c-Jun and G6PD amplification were performed as follows: 95°C for 10 min, 95°C for 0.5 s, 64°C for 10 s, and 72°C for 25 s. The samples were run on a 1.2% agarose gel, and the PCR fragment sizes of 400 bp for c-Jun and 340 bp for G6PD were observed.

Electrophoretic mobility shift assays. In vitro-translated C/EBP{alpha} and c-Jun proteins were made using an in vitro translation kit (Promega) according to the company protocol. A bp -82/-53 proximal AP-1 oligonucleotide (5' AGGCCTTGGGGTGACATCATGGGCTATTTT) and a bp -57/-38 human granulocyte colony-stimulating factor receptor C/EBP{alpha} binding site control oligonucleotide (5' AAGGTGTTGCAATCCCCAGC) were [{gamma}-32P]dATP (Amersham) end labeled by using polynucleotide kinase (New England Biolabs). The binding conditions were as described earlier (5, 6, 50). C/EBP{alpha} (SC-61X) and c-Jun (SC-45X) antibodies and normal rabbit immunoglobulin G (IgG) (SC-2027) from Santa Cruz were used for supershift experiments.

Coimmunoprecipitation. Nuclear extracts from U937, HL60, and 293T cells transfected with various constructs were prepared as follows. Cells were washed in phosphate-buffered saline and lysed in buffer A (20 mM Tris [pH 8.0], 10 mM NaCl, 3 mM MgCl2, 0.1% [vol/vol] NP-40, 10% [vol/vol] glycerol, 0.2 mM EDTA, 1 mM dithiothreitol, 0.4 mM phenylmethylsulfonyl fluoride, 2.5 µg of leupeptin per ml, 5 µg of aprotinin per ml, and 5 µg of antipain per ml) for 15 min on ice with occasional mixing. Nuclei were pelleted by centrifugation in an Eppendorf 541SR centrifuge at 2,000 rpm for 5 min at 4°C. Proteins were extracted from nuclei by incubation at 4°C with snap freeze-thawing three times in buffer C (20 mM Tris [pH 8.0], 400 nM NaCl, 0.2 mM EDTA, 20% [vol/vol] glycerol, 1 mM dithiothreitol, 0.4 mM phenylmethylsulfonyl fluoride, 2.5 µg of leupeptin per ml, 5 µg of aprotinin per ml, and 5 µg of antipain per ml). Nuclear debris was pelleted by centrifugation at 14,000 x g for 15 min at 4°C, and the supernatant extract was aliquoted, snap frozen, and stored at -70°C. Sixty micrograms of the nuclear extracts was incubated with 40 µl of protein A-agarose beads and 2 µg of C/EBP{alpha}-specific antibody (SC-61) for 3 h, followed by extensive washes in coimmunoprecipitation buffer (50 mM Tris HCl [pH 7.5], 150 mM NaCl, 1 mM EDTA, 5% glycerol, 0.25% NP-40, and proteinase inhibitors). Samples were subjected to SDS-10% polyacrylamide gel electrophoresis and transferred to Immobilon-P membranes (Millipore). c-Jun was immunodetected with c-Jun-specific antibody (SC-45). For coimmunoprecipitation assays from transfected cells, 5 x 106 cells were plated in 100-mm-diameter dishes and 5 µg of the respective DNA was transfected by using Lipofectamine Plus reagent (Life Technologies). At 48 h posttransfection, cells were trypsinized and nuclear extract was made as described above.

Protein interaction assay. C/EBP{alpha} and c-Jun were in vitro transcribed and translated in the presence of [35S]methionine (Amersham Pharmacia) by using the T7-Sp6 coupled reticulocyte lysate system (Promega) per the manufacturer's instructions. Glutathione agarose pull-down assay was performed as described previously (3) with 60 µg of U937 nuclear extract.

Retroviral transduction. Phoenix-A cells were transfected with pMV7-neo, pMV7-c-Jun-neo (kindly provided by L. Bakiri), pMSCV-ires-EGFP and pMSCV,-C/EBP{alpha}-ires-EGFP vectors by using Lipofectamine Plus reagents (Life Technologies). Viral supernatant was collected as described by Grignani et al. (17). Transduction experiment were performed with the respective provirus infected at the same time. Three rounds of transduction were performed. Pool of stably transfected cells were subjected to fluorescence-activated cell sorter (FACS) and morphological analyses at various time points.

FACS analysis. Pools of green fluorescent protein (GFP)-positive HL60 and U937 cells were kept in G418 selection medium for 6 to 8 days, followed by FACS analysis and cytospins. For each flow cytometry analysis, 106 cells were washed twice in washing buffer (phosphate-buffered saline, 0.1% [wt/vol] NaN3, 1% FBS) and resuspended in 100 µl of washing buffer with 2 µl of the respective antibody. Incubation was performed at room temperature for 30 min. A minimum of 104 cells were analyzed by flow cytometery. CD15 PE (clone H198), its isotype control IgM {kappa}PE (clone G155-228), and CD 11b PE (clone ICRF44) and its isotype control IgG1 {kappa}PE (clone MOPC-21) were purchased from BD Biosciences.


arrow
RESULTS
 
Reciprocal C/EBP{alpha} and c-Jun expression. A reciprocal expression pattern of C/EBP{alpha} and c-Jun has been observed before in various cell types (13) but has not been not understood clearly. We investigated the level of c-Jun expression in fetal liver of C/EBP{alpha} wild-type, heterozygous, and nullizygous mice compared to expression in wild-type adult macrophages (Fig. 1A). About a fivefold decrease in c-Jun mRNA is observed in the wild-type compared to the nullizygous mice (Fig. 1B). Also, a high c-Jun mRNA level was detected in adult macrophages, which is consistent with previous studies. c-Jun expression is regulated by macrophage colony-stimulating factor, which is required for growth and differentiation of mononuclear phagocytes/macrophages (29). Various groups (21, 45) had observed that induction of macrophage differentiation by lipopolysaccharide, tumor necrosis factor alpha (TNF-{alpha}), gamma interferon, or interleukin-1 (IL-1) was associated with a decrease in C/EBP{alpha} expression. In comparison to wild-type C/EBP{alpha} mice, high c-Jun expression was observed in heterozygous mice, whereas the maximum expression was observed in homozygous mice, suggesting that the expression is controlled by both alleles of C/EBP{alpha}. The fetal liver samples used for the Northern blot analysis have been shown to have disturbed liver architecture (13). The C/EBP{alpha}-/- fetal liver is completely devoid of granulocytes and has a slightly higher percentage of monocytes (56). In the U937 cell line model with inducible C/EBP{alpha} expression, the decrease in c-Jun mRNA level is reciprocal to the increase in C/EBP{alpha} expression (Fig. 1C). Real-time PCR for c-Jun yielded a specific PCR product of the expected size, indicating that the analysis is specific for c-Jun and G6PD (Fig. 1D). One hundred micrograms of the protein extract was loaded to visualize the c-Jun protein band. At the protein level, a drastic decrease in c-Jun protein is observed from 0 to 4 h of C/EBP{alpha} protein induction. The c-Jun protein level is unable to return to basal level even after 24 h of C/EBP{alpha} expression induction (Fig. 1E). A faster-migrating band was also detected with the c-Jun-specific antibody. No significant change in the expression of this band was observed upon C/EBP{alpha} induction. It is unclear if this band is specific for c-Jun or is an artifact due to the polyclonal nature of the antibody used. The increase in C/EBP{alpha} protein expression upon zinc induction is also shown (Fig. 1F) and reference 35. Within 4 h of induction, C/EBP{alpha} expression increases; it reaches maximum level by 8 h and then gradually decreases by 24 h. The C/EBP{alpha} protein expression level at 24 h was still sufficient to block c-Jun protein expression.





View larger version (130K):
[in this window]
[in a new window]
 
FIG. 1. Reciprocal expression of C/EBP{alpha} and c-Jun. (A) Northern blot analysis showing the expression of c-Jun in day 19 fetal livers from C/EBP{alpha}+/+, C/EBP{alpha}+/-, and C/EBP{alpha}-/- mice, adult (a.) mouse brain, and peritoneal macrophages. Total RNA (10 µg) for each sample was electrophoresed, transferred, and hybridized with an {alpha}-32P-labeled c-Jun 1.1-kb BamHI-EcoRI cDNA fragment and a G6PD control fragment. (B) Ratio of c-Jun to G6PD from the Northern analysis data in panel A. (C) The U937 {alpha}#2 and U937 EV cell lines were induced with 100 µM zinc sulfate, and total RNA was collected at 0, 4, 8, 12, and 16 h. cDNA from 1 µg of total RNA was used for real-time PCR using c-Jun- and G6PD-specific primers. The error bars represent standard errors of the means from three independent experiments. (D) Specific real-time PCR products of c-Jun and G6PD as observed after 1.2% agarose gel electrophoresis. Numbers on the left of each panel are molecular sizes in kilodaltons. (E) Western blot analysis showing the expression of c-Jun protein from whole-cell extracts of the U937 {alpha}#2 and U937 EV cell lines after 0, 4, 8, 12, and 24 h of zinc induction. Immunodetection was performed using c-Jun specific antibody. Lane C, in vitro-translated c-Jun positive control. ß-Tubulin expression from the same blot is shown as a loading control. (F) Western blot analysis of the whole-cell extracts from panel E for C/EBP{alpha} expression with specific antibody. Lane C, in vitro-translated C/EBP{alpha} and loading control for the same Western blot.

C/EBP{alpha} downregulates c-Jun promoter activity. To investigate the ability of C/EBP{alpha} as a negative regulator of c-Jun expression, we first asked whether it was through binding to the c-Jun promoter. Human c-Jun promoter (52) bp -1780 to +731 in the pGL3 basic luciferase vector was cotransfected with C/EBP{alpha} expression vector in various nonmyeloid cell lines (Fig. 2A). The pGL3 basic luciferase reporter vector into which the c-Jun promoter was cloned served as a vector-alone control. Since we addressed the repression activity of C/EBP{alpha}, we also used the p(C/EBP)2TK promoter containing two repeats of the C/EBP consensus DNA binding site as a positive control for C/EBP{alpha} transcriptional activity under the same experimental conditions in order to rule out a toxic effect of C/EBP{alpha} in transient-transfection experiments (Fig. 2B). These transient-transfection experiments were carried out in various fibroblast cell lines, as shown in Fig. 2, to demonstrate that it was a general phenomenon and not cell line dependent. At least 8-fold downregulation of c-Jun promoter activity in the presence of C/EBP{alpha} was observed, whereas the p(C/EBP)2TK promoter was transactivated about 10-fold upon transient expression of C/EBP{alpha}.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 2. C/EBP{alpha} downregulates the c-Jun promoter activity. (A) Transient cotransfection of a c-Jun promoter reporter construct (bp -1780 to +731) and pGL3 with or without C/EBP{alpha} in CV.1, NIH 3T3, 293E1A, CHO, and HeLa cells. Solid bars, values for promoter alone; open bars, cotransfection with C/EBP{alpha}. The pRL-0 Renilla luciferase construct was cotransfected to normalize for transfection efficiency. Error bars indicate standard errors of the means. (B) Effect of transient cotransfection of C/EBP{alpha} on the positive control p(C/EBP)2TK-luciferase reporter construct, indicating the transactivation capacity of C/EBP{alpha} in these cell lines. The pTK-luciferase reporter construct served as a negative control. Solid bars, values for promoter alone; open bars, fold promoter activities in the presence of C/EBP{alpha}.

C/EBP{alpha} does not recruit a TSA-sensitive corepressor complex and blocks TPA-induced c-Jun promoter activity. To address the possibility of C/EBP{alpha}-mediated c-Jun promoter downregulation by recruiting corepressors, transient-transfection experiments with the c-Jun promoter were carried out with C/EBP{alpha} in the presence of trichostatin A (TSA), a potent inhibitor of histone deacetylase-corepressor complex formation on an open transcription promoter machinery. Downregulation of c-Jun promoter activity by C/EBP{alpha} is retained even in the presence of 100 nM TSA (Fig. 3A). TSA increases the c-Jun promoter activity by itself. We think that this could be because TSA increases histone H3 acetylation on c-Jun-associated nucleosomes (11). A positive control for TSA showing the loss of recruitment of corepressor complex by transcription factor TEL in the presence of TSA was also included (37).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 3. C/EBP{alpha} does not recruit a TSA-sensitive corepressor complex and blocks TPA-induced c-Jun promoter activity. (A) Transient-cotransfection experiments in the 293E1A cell line with the c-Jun promoter construct and C/EBP{alpha} in the presence or absence of TSA (100 nM). pGal-4-luc with Gal-4-TEL and TSA was used as a positive control for functionally active TSA. (B) U937 cells (106 in six-well plates) were transfected with 0.55 µg of c-Jun promoter construct (bp -1780 to +731) or pGL3, with or without 0.4 µg of C/EBP{alpha} expression plasmid or empty vector, and 0.05 µg of pRL-0. The cells were transfected by using the Effectene protocol (Qiagen). At 12 h posttransfection, TPA (100 nM) was added to the respective wells and further incubated at 37°C for 24 to 30 h. The pRL-0 Renilla luciferase construct was cotransfected to normalize for transfection efficiency. The results are the means from three independent experiments, and error bars represent the standard errors of mean values for each set.

TPA, a potent inducer of monocytic differentiation in myeloid bipotential cell lines, has been known to increase c-Jun expression (24). Radomska et al. (35) had earlier demonstrated that C/EBP{alpha} can block TPA-induced monocytic differentiation in U937 myeloid cells. We therefore asked whether C/EBP{alpha} could inhibit TPA-induced monocytic differentiation capacity by blocking c-Jun expression and activity. As shown in Fig. 3B, human c-Jun promoter activity was downregulated by C/EBP{alpha} and, interestingly, the TPA-induced increase in the c-Jun promoter activity was blocked by C/EBP{alpha}.

Mapping of the region in the c-Jun promoter that is important for C/EBP{alpha}-mediated promoter downregulation. Since C/EBP{alpha} does not recruit a TSA-sensitive corepressor complex to the c-Jun promoter, we further asked whether C/EBP{alpha} could exert this repressional activity via some specific transcription factor binding sites in the c-Jun promoter. Schematic presentations of various 5' c-Jun promoter deletion constructs described by Wei et al. (52) are shown in Fig. 4A. These constructs were used for promoter mapping experiments in 293E1A cells (Fig. 4B) and in U937 myeloid cells (Fig. 4C). As observed by Wei et al., each 5' deletion construct had transcriptional activity different from that of the longest (bp -1780/+731) promoter construct. As seen in Fig. 4B and C, the promoter activity of each c-Jun promoter deletion construct except the bp -63/+731 promoter construct was downregulated by C/EBP{alpha}. The bp -63/+731 construct lacks most of the regulatory regions identified so far. Since the bp -180/+731 c-Jun promoter construct was still downregulated by C/EBP{alpha}, we concluded that the site important for C/EBP{alpha}-mediated transcriptional downregulation would be between bp -180 and -63. Downregulation of the c-Jun promoter activity by C/EBP{alpha} was lost when the proximal AP-1 site was mutated (Fig. 4C). This suggested that the proximal AP-1 was important for C/EBP{alpha}-mediated downregulation of the c-Jun promoter. A schematic presentation of the c-Jun promoter spanning the bp -180 to -63 region (Fig. 4D) shows the binding sites for various transcription factors. This region includes pAP-1 (proximal AP-1), CTF, and Sp-1 sites.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 4. c-Jun promoter mapping to identify the region important for C/EBP{alpha}-mediated downregulation. (A) Schematic presentation of various c-Jun promoter 5' deletion constructs used for the transient-transfection experiment. (B) 293E1A cells (104 per well in 24-well plates) were transfected with 0.25 µg of 5' c-Jun promoter deletion constructs bp -1780/+731, bp -953/+731, bp -716/+731, bp -345/+731, bp -180/+731, and bp -63/+731 with or without 0.2 µg of C/EBP{alpha} or empty vector and 0.05 µg of pRL-0. (C) U937 cells (106 per well in six-well plates) were transfected with 0.55 µg of 5' c-Jun promoter deletion constructs bp -1780/+731, bp -180/+731, bp -63/+731, and bp -1780/+731 proximal AP-1 mutant c-Jun promoter with or without C/EBP{alpha} expression plasmid or empty vector and 0.05 µg of pRL-0. The cells were transfected by using the Effectene protocol. The pRL-0 Renilla luciferase construct was cotransfected to normalize for transfection efficiency. The results are the means from three independent experiments, and error bars represent the standard errors of mean values for each set. (D) Schematic presentation of the c-Jun promoter region between bp -180 and -63. This region contains a proximal AP-1 site, CTF site, and SP-1 site.

C/EBP{alpha} blocks the autoregulatory capacity of c-Jun by preventing c-Jun from binding to the proximal AP-1 site in the c-Jun promoter. The deletion constructs in Fig. 4B had very low basal transcriptional activity compared to the full-length c-Jun promoter. Hence, we decided to address the importance of the proximal c-Jun promoter in context with the full-length promoter. The bp -1780/+731 c-Jun promoter with a mutated proximal AP-1 site showed higher basal transcriptional activity than the bp -180 and -63 c-Jun promoter deletion constructs (52). Transient-transfection experiments using the bp -1780/+731 c-Jun promoter with mutated proximal AP-1, as shown in Fig. 4C, suggest that in the absence of the proximal AP-1 site, C/EBP{alpha} is unable to downregulate the c-Jun promoter. In transient transfections in U937 myeloid cells, c-Jun transactivates its own promoter, an autoregulatory mechanism that was identified by Angel et al. (2). Our data (Fig. 5A) suggest that transactivation of the c-Jun promoter by c-Jun is blocked in the presence of C/EBP{alpha}. Based on results from the previous promoter mapping experiments and TPA experiments, we decided to address the importance of the proximal AP-1 site in C/EBP{alpha}-mediated c-Jun promoter downregulation. We asked whether C/EBP{alpha} could block the transactivation capacity of c-Jun through the proximal AP-1 site in the c-Jun promoter. Using the bp -79/+170 promoter (54) containing only the proximal AP-1 site of the c-Jun promoter (Fig. 5B) and an artificial AP-1 construct containing seven repeats of the consensus AP-1 site (Fig. 5C), we observed that the autoregulatory capacity of c-Jun through the proximal AP-1 binding site was lost in the presence of C/EBP{alpha}. Increasing the concentration of c-Jun could not overcome the block by C/EBP{alpha}. C/EBP{alpha} was transcriptionally active in this set of experiments. To understand how C/EBP{alpha} blocks the autoregulatory capacity of c-Jun, we determined the DNA binding capacity of c-Jun to the proximal AP-1 site in the presence of C/EBP{alpha}. In a band shift mobility assay using the bp -79 c-Jun promoter oligonucleotide probe, c-Jun binding to the proximal AP-1 site (Fig. 5D, lane 2) was blocked by in vitro-translated C/EBP{alpha} (Fig. 5D, lane 14) but not by reticulocyte lysate alone (Fig. 5D, lane 12). Under similar experimental conditions, C/EBP{alpha} could bind to the CEBP consensus DNA binding site in the G-CSFR promoter, and the C/EBP{alpha} band shift was supershifted in the presence of C/EBP{alpha}-specific antibody (data not shown).





View larger version (92K):
[in this window]
[in a new window]
 
FIG. 5. C/EBP{alpha} blocks the autoregulatory capacity of c-Jun by preventing c-Jun from binding to the proximal AP-1 site in the c-Jun promoter. (A) Transient transfections in U937 myeloid cells were performed using a bp -1780/+731 c-Jun promoter construct, 0.2 µg of C/EBP{alpha} expression plasmid, and increasing amounts of c-Jun expression plasmid (0.1 and 0.2 µg). Error bars indicate standard errors of the means. (B) bp -79/+190 and bp -79/+190 mutated AP-1 site c-Jun promoter constructs were transiently transfected with 0.2 µg of C/EBP{alpha} expression plasmid and increasing concentrations of c-Jun expression plasmid. (C) The AP-1 luciferase construct containing seven repeats of an AP-1 binding site was used for transient transfection with c-Jun and C/EBP{alpha} in U937 myeloid cells. (D) Electrophoretic mobility shift assay using [{gamma}-32P]ATP-labeled bp -82/-53 c-Jun promoter oligonucleotide spanning the proximal AP-1 site was performed using in vitro-translated (i.v.t.) c-Jun (lanes 2 to 6 and 12 to 15) and C/EBP{alpha} (lanes 12, 13, 16, and 17) proteins, rabbit reticulocyte (Reti.) lysate (lanes 7 to 11, 14, and 15), c-Jun-specific antibody (lanes 3, 6, 8, 11, 13, and 15), normal rabbit IgG (lanes 4 and 9), C/EBP{alpha}-specific antibody (lane 17), and self unlabeled competitor probe (lanes 5, 6, 10, and 11). Arrows show the c-Jun shifted band (Shift) and the supershifted higher band with c-Jun-specific antibody (SS).

C/EBP{alpha} and c-Jun interact through their leucine zipper domains. We then asked whether c-Jun could interact with C/EBP{alpha}. An in vitro glutathione S-transferase (GST) pull-down assay (Fig. 6A and C) and an in vivo coimmunoprecipitation (Fig. 6D) indicate that C/EBP{alpha} and c-Jun interact in vitro and in vivo. An in vivo coimmunoprecipitation experiment with U937 and HL60 cells (Fig. 6C and D) suggested that C/EBP{alpha} and c-Jun could interact in myeloid cells. However, a very low basal level of c-Jun is present in U937 cells. Not surprisingly, due to such low levels of c-Jun protein, extremely little C/EBP{alpha} complex with c-Jun was observed (Fig. 6C). Figure 6B shows a control for GST-C/EBP{alpha}, which can form homodimers with in vitro-translated C/EBP{alpha}. We further wanted to investigate which domains of C/EBP{alpha} and c-Jun were important for this interaction. c-Jun{Delta}RK lacks the DNA binding domain (amino acids 251 to 276), and the c-Jun{Delta}LZ mutant construct has the leucine zipper dimerization domain (amino acids 281 to 313) deleted (34). A GST pull-down assay using GST-C/EBP{alpha} and in vitro-translated c-Jun{Delta}RK and c-Jun{Delta}LZ suggested that the leucine zipper dimerization domain of c-Jun was required to interact with C/EBP{alpha} (Fig. 7A and B). The C/EBP{alpha}mBR construct, carrying a mutation in the basic DNA binding domain, could still bind to c-Jun, but the C/EBP{alpha}{Delta}LZ construct (C/EBP{alpha} leucine zipper dimerization domain replaced with GCN4 leucine zipper) is unable to bind c-Jun (Fig. 7C). C/EBP{alpha} expression in the same experiment was determined to show the presence of the C/EBP{alpha} wild-type and mutant protein (Fig. 7B and data not shown). No nonspecific binding was observed with the control IgG coimmunoprecipitation. The C/EBP{alpha}mBR construct could downregulate the c-Jun promoter activity, whereas the C/EBP{alpha}{Delta}LZ mutant could not (Fig. 7D). These data suggest that the leucine zipper dimerization domains of c-Jun and C/EBP{alpha} are important for their interaction.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 6. C/EBP{alpha} and c-Jun interact in U937 and HL60 myeloid cells. (A) GST-C/EBP{alpha} and GST plus beads were incubated with in vitro-translated (i.v.t.) c-Jun as described in Materials and Methods. (B) As a positive control for GST-C/EBP{alpha}, GST-C/EBP{alpha} was incubated with in vitro-translated C/EBP{alpha}. (C) GST-C/EBP{alpha} was incubated with 85 µg of U937 nuclear extract (NE). Immunodetection was carried out using c-Jun antibody. GST and glutathione-agarose beads alone were incubated with U937 nuclear extract to determine the specificity of this interaction. (D) Coimmunoprecipitation assays from 60 µg of HL60 nuclear extract (N.Ex) were performed using C/EBP{alpha}, c-Jun-specific antibody, or normal rabbit IgG. Immunodetection was carried out using c-Jun-specific antibody. In vitro-translated c-Jun shows the migration of c-Jun protein.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 7. C/EBP{alpha} and c-Jun interact with their leucine zipper domains. (A) GST-C/EBP{alpha} was incubated with 35S in vitro-translated (i.v.t.) c-Jun{Delta}RK (lacking the DNA binding domain) and c-Jun{Delta}LZ (lacking the dimerization domain). GST plus beads alone incubated with these in vitro-translated proteins served as a negative control. (B) 293T cells were transfected with c-Jun{Delta}RK, c-Jun{Delta}LZ, or C/EBP{alpha}, or mock transfected, and at 24 h posttransfection nuclear extracts from these sets were used for coimmunoprecipitation (IP) assays using either C/EBP{alpha}-specific antibody or normal rabbit IgG. The samples were probed with c-Jun- and C/EBP{alpha}-specific antibodies. (C) 293T cells were transfected with c-Jun{Delta}RK, c-Jun{Delta}LZ, C/EBP{alpha}mBR (basic region mutated), or C/EBP{alpha}{Delta}LZ (dimerization domain replaced with GCN4 leucine zipper) or mock transfected. At 24 h posttransfection, nuclear extracts from these sets were used for coimmunoprecipitation assay with either C/EBP{alpha}-specific antibody or normal rabbit IgG. The samples were probed with c-Jun specific antibodies. (C/EBP{alpha} blot, data not shown). (D) The bp -1780/+731 c-Jun promoter construct was transiently transfected with and without C/EBP{alpha} wild-type, C/EBP{alpha}mBR, and C/EBP{alpha}{Delta}LZ plasmids in K562 cells. Mean values were normalized to empty vector values. Error bars indicate standard errors of the means from three independent experiments.

Overexpression of c-Jun blocks C/EBP{alpha}-induced granulocytic differentiation. We next wanted to understand the functional implications of C/EBP{alpha}-c-Jun interaction. Earlier studies have shown that C/EBP{alpha} could block monocytic lineage commitment (35). Here, we address the effect of c-Jun on C/EBP{alpha}-induced granulocytic differentiation. Three rounds of retroviral transduction of C/EBP{alpha} and c-Jun expression vectors along with their empty vectors were performed in HL60 and U937 cells at the same time. At 24 h after the third transduction, cells were subjected to G418 selection and analyzed consecutively for expression of differentiation markers such as CD11b and CD15. No ongoing differentiation could be detected until day 9 from the start of the experiment. Total RNA from the set of HL60-transduced cells was isolated for real-time PCR for c-Jun and G6PD. As shown in Fig. 1D, specific PCR products for c-Jun and G6PD were observed. The results in Fig. 8A are averages from three independent real-time PCR experiments. HL60 cells transduced with pMV7-c-Jun-neo showed twofold-higher c-Jun mRNA levels than the pMV7-neo vector alone. These two vectors were transduced along with pMSCV-ires-GFP vector (Fig. 8A, sets 1 and 2). When the pMV7-c-Jun-neo and pMV7-neo vectors were transduced along with pMSCV-C/EBP{alpha}-ires-EGFP, there was a marked decrease in c-Jun mRNA (Fig. 8A, sets 3 and 4). c-Jun expression from the same set of HL60 samples is shown in Fig. 8B. A decrease in the endogenous c-Jun level is observed upon ectopic expression of C/EBP{alpha}. This confirms our previous findings, shown in Fig. 1E. GFP expression of the pMSCV-ires-EGFP vector and pMSCV-C/EBP{alpha}-ires-EGFP vector transfected from the same set of HL60 cells was measured by gating the cells in an FL1 window, using FACS program (Fig. 8C).







View larger version (193K):
[in this window]
[in a new window]
 
FIG. 8. Overexpression of c-Jun blocks C/EBP{alpha}-induced granulocytic differentiation. (A) Real-time PCR for c-Jun and G6PD was performed for HL60 cells that were transduced with pMV7-c-Jun-neo (bars 1 and 3), pMV7-neo (bars 2 and 4), pMSCV-C/EBP{alpha}-ires-EGFP (bars 3 and 4), and pMSCV-ires-EGFP (bars 1 and 2) to estimate c-Jun expression in each set. Error bars indicate standard errors of the means. (B) Western blotting for c-Jun from the same experimental samples was performed by loading 100 µg of total protein lysates. (C) GFP expression in HL60 cells transduced with MSCV-ires-EGFP and MSCV-C/EBP{alpha}-ires-EGFP as analyzed by fluorescence in the FL1 channel. The samples from same HL60 experiment as in panels A, B, and E to G were used for FACS analysis. (D) Western blot analysis of 100 µg of whole-cell extract from the transduced U937 cells. The Western blots were immunoblotted using c-Jun-, C/EBP{alpha}-, and ß-tubulin specific antibodies. (E) FACS analysis for CD15-PE from the transduced HL60 and U937 cells, along with its isotype control. +ve, positive. (F) FACS analysis for CD11b-PE from transduced U937 cells, along with its isotype control. (G) Wright-Giemsa staining of the transduced cells. HL60 and U937 cells with ectopic expression of C/EBP{alpha} showed neutrophils by day 6, which were reduced in the presence of c-Jun expression.

One hundred micrograms of whole-cell extracts from a pool of U937 transduced cells was analyzed for expression of C/EBP{alpha} and c-Jun protein (Fig. 8D). High c-Jun protein expression was observed in cells transduced with the c-Jun vector (lanes 4 and 5), whereas the cells transduced with the vector alone showed basal c-Jun expression. Similarly, high C/EBP{alpha} expression was observed in cells transduced with the C/EBP{alpha} expression vector (lanes 5 and 6). In cells transduced with C/EBP{alpha} alone (lane 6), the corresponding c-Jun expression was equivalent to basal levels. We could not observe further downregulation as observed in the U937 inducible cell line model (Fig. 1E). We think that this was due to the low number of GFP-positive cells in this part of the experiment (data not shown).

Expression of CD15, a marker for granulocytic differentiation from HL60 and U937 transduced cells, was analyzed. As seen in Fig. 8E, CD15 expression increased in the presence of C/EBP{alpha} transduction (left panels), and pMV7-neo vector alone had no effect on C/EBP{alpha}-induced granulocytic differentiation (middle panels). The right panels show the CD15 expression in HL60 and U937 cells transduced with MSCV-C/EBP{alpha}-ires-EGFP and pMV7-c-Jun-neo. A negative shift of the CD15 peak was observed. This indicated that the increase in CD15 expression by C/EBP{alpha} was blocked in the presence of c-Jun (Fig. 8E). Similar results with the CD11b marker were also observed in HL60 cells (Fig. 8F). c-Jun-transduced cells were also investigated for CD11b expression; however, no increase in its expression was observed (data not shown). Morphological changes observed in the presence of C/EBP{alpha} and/or c-Jun are shown in Fig. 8G. C/EBP{alpha}-induced granulocytic differentiation (about 75 to 80% in both HL60 and U937 cells) was reduced to about 10 and 40% in U937 and HL60, respectively. The mock panels show cells which resembles the blast morphology of untransduced cells. The growth rate of the transduced cells was also investigated. The vector-alone constructs showed growth rates similar to those of the cells alone, whereas the cells expressing c-Jun and/or C/EBP{alpha} showed retarded growth (data not shown).


arrow
DISCUSSION
 
C/EBP{alpha} downregulates c-Jun expression. In this study, we have investigated the role of C/EBP{alpha} as a negative regulator of c-Jun expression and transcriptional activity and its significance in the myeloid lineage commitment. Inducers of monocytic differentiation such as TPA, bryostatin 1, 1,25-dihydroxyvitamin D3, and okadaic acid were shown to increases c-Jun activity by posttranslational events and increased synthesis (1, 7,14, 23, 42). These findings underline the importance of c-Jun as a member of the AP-1 family in the myeloid differentiation program. It has been reported that overexpression of c-Jun in bipotential myeloid cells leads to macrophage-like morphology (44). That report, however, did not address the expression of monocytic/macrophage differentiation markers. In addition, it is not clear why only partial macrophage-like morphology was observed upon c-Jun overexpression. Using a C/EBP{alpha}-inducible U937 cell line, we show that an increase in C/EBP{alpha} expression results in a significant decrease in the levels of endogenous c-Jun mRNA (Fig. 1C). The c-Jun protein level decreases drastically in the first 4 h of C/EBP{alpha} expression (Fig. 1E). At the same time, no change in c-Fos expression was observed upon induction of C/EBP{alpha} expression (data not shown). The reciprocal pattern of expression for C/EBP{alpha} and c-Jun was also observed in a C/EBP{alpha} knockout mouse model and in hepatocytes (Fig. 1A) (13, 36). Although the liver architecture in the C/EBP{alpha} newborn is disturbed, the hematopoetic system is not severely affected, except for the granulocytes. The immature hematopoetic cell population is also not affected. This led us to hypothesize that c-Jun downregulation by C/EBP{alpha} is important for the granulocytic lineage decision. In addition, C/EBP{alpha} is important for hepatocytic and the lung cell differentiation, which is severely disturbed in C/EBP{alpha} knockout mice. Figure 1A and B suggest that C/EBP{alpha} suppression of c-Jun might also play an important role in hepatocytic differentiation and development. Some reports state that expression of c-Fos, another AP-1 member, also increases on induction of monocytic differentiation. However, the increase in c-Fos mRNA was found to be transient and not myeloid lineage specific (14, 40). c-Fos expression was not sufficient for the process of macrophage differentiation (10, 27, 31). No detectable c-Fos level was observed in the fetal liver samples, whereas adult macrophage and adult brain RNA samples showed minimal c-Fos expression (data not shown). Low levels of C/EBP{alpha} mRNA are observed upon treatment of monocytes with inducing agents such as lipopolysaccharide, TNF-{alpha}, gamma interferon, and IL-1 (45). Figure 1A also shows a large amount of c-Jun mRNA in adult macrophages. The mechanism of how C/EBP{alpha} controls c-Jun expression is observed in the promoter assays. The C/EBP{alpha} protein negatively regulates the human c-Jun promoter in transient-transfection assays in fibroblast as well as in myeloid cell lines (Fig. 2), thus indicating that it was a general phenomenon and not cell line specific. As also observed in Fig. 1A, in the fetal livers of the C/EBP{alpha} knockout mice, the negative regulation of c-Jun by C/EBP{alpha} holds true in various cell types and tissue systems.

Mechanism of c-Jun expression downregulation by C/EBP{alpha} through the proximal AP-1 site of the c-Jun promoter. C/EBP{alpha} downregulation of the c-Jun promoter activity was not due to recruitment of a TSA-sensitive corepressor complex (Fig. 3A). The TPA experiment (Fig. 3B) suggested that a transcription factor binding to the c-Jun promoter was important for C/EBP{alpha}-mediated c-Jun promoter activity downregulation. Promoter mapping experiments (Fig. 4) suggested that the region between bp -180 and -63 in the c-Jun promoter was important for the c-Jun promoter downregulation by C/EBP{alpha}. The proximal AP-1 site (pAP-1) in the promoter lies within the region from bp -180 to -63. Earlier studies with the human c-Jun promoter addressed the importance of the proximal AP-1 site in c-Jun promoter being sufficient for a maximal response to various signals (TPA, serum, UV, E1A, and IL-1) (18, 49). Using the human c-Jun promoter, we show that C/EBP{alpha} blocks the autoactivation capacity of c-Jun through the proximal AP-1 site. On mutation of this proximal AP-1 site, C/EBP{alpha} was no longer able to downregulate the c-Jun promoter activity (Fig. 4C and 5B). These results led us to hypothesize that C/EBP{alpha} and c-Jun might interact. This is the first report showing C/EBP{alpha} and c-Jun interaction in myeloid cells (Fig. 6). Furthermore, the leucine zipper domains of both proteins are required for this interaction (Fig. 7), and the leucine zipper domain of C/EBP{alpha} was important for downregulating the c-Jun promoter activity (Fig. 7D). DNA binding experiments (Fig. 5D) indicate that C/EBP{alpha} binding to c-Jun inhibits latter from binding to its consensus AP-1 site in the c-Jun promoter. This was also confirmed by transient-transfection experiments using the bp -79 c-Jun promoter having only the proximal AP-1 site (Fig. 5B) and the full-length c-Jun promoter with the proximal AP-1 site mutated (Fig. 4C). It still needs to be addressed whether the C/EBP{alpha}-c-Jun interaction can block the latter from binding to the AP-1 site in other c-Jun-regulated promoters as well. We think that the presence of other interacting partners of both these proteins (e.g., PU.1, AML-1, p300, and C/EBPß) might play an important role in such interactions in a promoter-specific context.

Biological implication of C/EBP{alpha}-c-Jun interaction in normal myelopoiesis and leukemia. Previous reports have addressed the indispensability of C/EBP{alpha} in driving granulocytic differentiation, as well as its role in acute myeloid leukemia (AML) (9, 15, 32, 33, 35, 53, 56). The results shown in Fig. 8 indicate the importance of c-Jun expression downregulation by C/EBP{alpha} in myeloid lineage commitment. If c-Jun expression was high at the time of lineage commitment, it might block C/EBP{alpha} from committing these cells to the granulocytic lineage. c-Jun is an important regulator of TPA-mediated or independent macrophage lineage commitment (19, 44). TPA-induced monocytic differentiation was blocked by C/EBP{alpha} (35). These reports indicated that a block in c-Jun expression by C/EBP{alpha} might be also necessary for preventing macrophage differentiation so as to bias the progenitor cells towards the granulocytic lineage decision. Here we report the functional significance of the c-Jun block by C/EBP{alpha} (Fig. 8). The normal granulocytic differentiation capacity of C/EBP{alpha}, as observed by an increase in the CD15 and CD11b markers, was abolished upon overexpression of c-Jun (Fig. 8E and F). Morphologically, C/EBP{alpha}-induced granulocytic differentiation (75 to 80% in both cell types) was reduced about by 10% (U937) to 40% (HL60), as observed in Fig. 8G. These data indicate that inhibition of c-Jun expression and function is essential for C/EBP{alpha} to commit precursor myeloid cells towards the granulocytic lineage.

C/EBP{alpha}-c-Jun interaction (Fig. 6 and 7) suggests that C/EBP{alpha} might pull c-Jun away from its other interacting partners, thereby inhibiting c-Jun's function, e.g., c-Jun interaction with C/EBPß in monocytic differentiation by TNF-{alpha} (55). Ubeda et al. (47) have reported that CHOP, a dominant negative regulator of C/EBP family members, can interact with c-Jun through its leucine zipper domain. By such interaction, CHOP synergizes with c-Jun to activate transcription through the AP-1/TRE site. In contrast to these findings, we observe that the C/EBP{alpha}-c-Jun interaction prevents c-Jun from binding to the AP-1 site in the c-Jun promoter. The C/EBP{alpha}-c-Jun complex formation probably pulls c-Jun away from c-Jun-regulated genes.

Transient transfection of the C/EBP{alpha} mutant construct with the c-Jun promoter (Fig. 7D) emphasizes the functional importance of the interaction between the leucine zipper domains of C/EBP{alpha} and c-Jun (Fig. 6D and 7A to C). From our data and previous studies by other groups, it is clear that the leucine zipper dimerization domain that is conserved in the C/EBP family members is important for interaction with c-Jun. However, the functional outcome of such interactions is diverse. We think that apart from the C-terminal leucine zipper domains, the N-terminal domain of each C/EBP member is critical for the function of such interactions. This hypothesis is well understood, since C/EBP members such as C/EBP{alpha}, C/EBPß, and CHOP interact with c-Jun by their leucine zipper domains. However, C/EBP{alpha} antagonizes c-Jun function, whereas the latter two synergize with c-Jun.

Moreover, c-Jun can also function as a coactivator of the PU.1 transcription factor, which is important for the monocytic lineage (5). In the presence of higher C/EBP{alpha} expression and TPA, U937 myeloid cells were unable to undergo macrophage differentiation (35). The explanation for this observation could be that C/EBP{alpha} inhibits c-Jun from performing its coactivator role for PU.1 or from independent regulation of monocyte-specific genes. This could be either by preventing c-Jun from binding to the AP-1 site in the promoter or by disrupting c-Jun interaction with other transcription factors important for monocytic lineage commitment.

C/EBP{alpha} blocking of TPA-induced moncytic differentiation has been addressed before. We wanted to further investigate how c-Jun could affect the granulocytic differentiation capacity of C/EBP{alpha}. CD15, an indicator of granulocyte differentiation, is increased upon ectopic expression of C/EBP{alpha}. c-Jun alone does not change the expression level of this marker compared to vector alone (data not shown). However, in the presence of c-Jun and C/EBP{alpha} expression, a negative shift in the CD15 peak is observed (Fig. 8E). These data suggest that the granulocytic differentiation commitment induced by C/EBP{alpha} is blocked by c-Jun. CD11b, a marker for early differentiation, is upregulated irrespective of the lineage specificity. Upon overexpression of C/EBP{alpha}, an increase in CD11b expression is observed (Fig. 8F), which is blocked by c-Jun, as also observed with CD15. c-Jun, which has been shown to also induce partial macrophage-like morphology, should also show an increase in CD11b, which was not observed. This negative data was not surprising, because studies (30) have shown that c-Jun is unable to regulate the CD11b promoter on its own. Our data along with that report could explain why c-Jun causes only partial macrophage differentiation. c-Jun probably needs other factors (or needs to act along with other factors, perhaps PU.1) to attain complete monocyte/macrophage differentiation. Morphologically also, c-Jun was observed to inhibit granulocytic differentiation induced by C/EBP{alpha} (Fig. 8G).

Recent reports address the important role of C/EBP{alpha} in AML (15, 32, 33). Dominant negative mutations in C/EBP{alpha} were observed in AML FAB-M2 patient samples in the absence of the AML1-ETO fusion protein. Higher c-Jun mRNA levels in patient samples with C/EBP{alpha} mutations than in samples without C/EBP{alpha} mutations were observed (data not shown). Recent reports by Gombart et al. (15) have identified C-terminal mutations of C/EBP{alpha} in similar AML patient samples. The mutations they characterize show the importance of a functional C-terminal end of the C/EBP{alpha} protein. Although these mutants are expressed like the wild-type protein, they have lost their dimerization and/or DNA binding capacity. Although a significant amount of C/EBP{alpha} protein is present in AML, due to various modifications, it may be functionally dead and thus unable to rescue leukemic blasts into the normal differentiation program. These findings underline the importance of C/EBP{alpha} in controlling c-Jun expression and transcriptional activity in AML. When c-Jun is expressed in a deregulated manner, it might have the potential to act as a proto-oncogene and thus lead to hyperproliferation of the leukemic blasts. The function of each transcription factor is differentiation stage dependent. The concentration of the protein also plays an important role in deciding the cell fate, i.e., lineage commitment versus proliferation state. A few transcription factors, e.g., PU.1, program the cell for a specific lineage depending on their expression level. Similarly, c-Jun could function either as a coactivator for PU.1 leading to differentiation or as a proto-oncogene causing proliferation. As observed in AML blasts, c-Jun might act as a hyperproliferating agent, or, in the case of TPA induced macrophage differentiation, c-Jun might act as a transcription factor driving partial macrophage differentiation. The C/EBP{alpha}-c-Jun interaction might disrupt the function of c-Jun, depending on the expression levels of both of these proteins.

In conclusion, we propose a model for the importance of C/EBP{alpha} in blocking c-Jun expression and c-Jun transactivation capacity (Fig. 9). Bipotential myeloid cells differentiate towards the granulocytic lineage upon overexpression of C/EBP{alpha}, whereas the same cells have the potential for monocytic lineage commitment in the presence of inducers such as TPA. TPA is known to transactivate c-Jun and increase its expression. One of the important roles of c-Jun is to act as a coactivator of transcription factor PU.1. c-Jun on its own could also drive partial macrophage-like differentiation. However, when C/EBP{alpha} and c-Jun interact through their leucine zipper domains, the former prevents c-Jun from functioning as a macrophage differentiation regulator. At the same time, such interaction could also arrest C/EBP{alpha}-driven granulocytic lineage commitment (Fig. 9A). The data so far suggest that this interaction blocks c-Jun from binding to the AP-1 site of its own promoter, thereby inhibiting its expression and transcriptional activity (Fig. 9B). The significance of C/EBP{alpha} blocking of c-Jun DNA binding capacity for other c-Jun regulated genes still needs to be addressed. Because of such sequestering of c-Jun, C/EBP{alpha} might not only commit bipotential myeloid cells to granulocytic lineage but also prevent these cells from becoming monocytes/macrophages.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 9. Model for C/EBP{alpha} inactivating c-Jun in granulocytic differentiation. (A) Diagrammatic representation of myeloid bipotential stem cells that can differentiate to monocytes/macrophages on induction with TPA or become polymorphonuclear neutrophils on overexpression of C/EBP{alpha}. TPA induction for macrophage differentiation requires increases in c-Jun expression and c-Jun transcriptional activity. c-Jun acts as a coactivator of PU.1, leading to monocytic differentiation commitment. C/EBP{alpha} blocks the expression and transcriptional activity of c-Jun, thus preventing TPA-induced monocytic lineage commitment. At the same time, c-Jun also blocks C/EBP{alpha}-driven granulocytic lineage commitment. (B) Schematic representation showing interaction between C/EBP{alpha} and c-Jun via their leucine zipper domains. This interaction prevents c-Jun from binding to the proximal AP-1 site in its own promoter. c-Jun interaction with C/EBP{alpha} and the block in binding to its own promoter lead to downregulation of c-Jun expression. This C/EBP{alpha}-c-Jun interaction may lead to a block in monocytic lineage differentiation and proliferation.


arrow
ACKNOWLEDGMENTS
 
We thank Hanna Radomska for valuable discussions and Diana Dudziak, Falk Nimmerjahn, Joachim Ellwart, Karin Nispel, and Susan King for technical support. Thanks also go to Torsten Haferlach for providing the differentials and imaging of the cytospins.

This work was supported by DFG (German Research Foundation) grant 2042/2-1 to G.B.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Dept. of Medicine III, Ludwig Maximilians University Munich, Marchioninistr. 15, D-81377 Munich, Germany. Phone: 49-89-7095-118. Fax: 49-89-7095-5550. E-mail: gerdbehre{at}aol.com. Back


arrow
REFERENCES
 
    1
  1. Angel, P., K. Hattori, T. Smeal, and M. Karin. 1988. The jun proto-oncogene is positively autoregulated by its product, Jun/AP-1. Cell 55:875-885.[CrossRef][Medline]
  2. 2
  3. Angel, P., E. A. Allgretto, St. T. Okino, K. Hattori, W. J. Boyle, T. Hunter, and M. Karin. 1988. Oncogene jun encodes a sequence-specific trans-activator similar to AP-1. Nature 332:166-171.[CrossRef][Medline]
  4. 3
  5. Behre, G., L. T. Smith, and D. G. Tenen. 1999. Use of a promoterless Renilla luciferase vector as an internal control plasmid for transient co-transfection assays of Ras-mediated transcription activation. BioTechniques 26:24-26.[Medline]
  6. 4
  7. Behre, G., P. Zhang, D. E. Zhang, and D. G. Tenen. 1999. Analysis of the modulation of transcriptional activity in myelopoiesis and leukemogenesis. Methods 17:231-237.[CrossRef][Medline]
  8. 5
  9. Behre, G., A. J. Whitmarsh, M. P. Coghlan, T. Hoang, C. L. Carpenter, D. E. Zhang, R. J. Davis, and D. G. Tenen. 1999. c-jun is a JNK-independent coactivator of the PU.1 transcription factor. J. Biol. Chem. 274:4939-4946.[Abstract/Free Full Text]
  10. 6
  11. Behre, G., S. M. Singh, H. Liu, L. T. Bortolin, M. Christopeit, H. S. Radomska, J. Rangatia, W. Hiddemann, A. D. Friedman, and D. G. Tenen. 2002. Ras signaling enhances the activity of C/EBP{alpha} to induce granulocytic differentiation by phosphorylation of serine 248. J. Biol. Chem. 277:26293-26299.[Abstract/Free Full Text]
  12. 7
  13. Bertani, A., N. Polentarutti, A. Sica, A. Rambaldi, A. Mantovani, and F. Colotta. 1989. Expression of c-jun protooncogene in human myelomonocytic cells. Blood 74:1811-1816.[Abstract/Free Full Text]
  14. 8
  15. Brandt-Rauf, P. W., M. R. Pincus, J. M. Chen, and G. Lee. 1989. Conformational energy analysis of the leucine repeat regions of C/EBP, GCN4, and the proteins of the myc, jun, and fos oncogenes. J. Protein Chem. 8:679-688. (Abstract.)[CrossRef][Medline]
  16. 9
  17. Burel, S. A., N. Harakawa, L. Zhou, T. Pabst, D. G. Tenen, and D. E. Zhang. 2001. Dichotomy of AML1-ETO functions: growth arrest versus block of differentiation. Mol. Cell. Biol. 21:5577-5590.[Abstract/Free Full Text]
  18. 10
  19. Calabretta, B. 1987. Dissociation of c-Fos induction from macrophage differentiation in human myeloid leukemic cell lines. Mol. Cell. Biol. 7:769-774.[Abstract/Free Full Text]
  20. 11
  21. Clayton, A. L., S. Rose, M. J. Barratt, and L. C. Mahadevan. 2000. Phosphoacetylation of histone H3 on c-fos and c-jun-associate nucleosomes upon gene activation. EMBO 19:3714-3726.[CrossRef][Medline]
  22. 12
  23. Emig, M., S. Saussele, H. Wittor, A. Weisser, A. Reiter, A. Willer, U. Berger, R. Hehlmann, N. C. Cross, and A. Hochhaus. 1999. Accurate and rapid analysis of residual disease in patients with CML using specific fluorescent hybridization probes for real time quantitative RT-PCR. Leukemia 13:1825-1832.[CrossRef][Medline]
  24. 13
  25. Flodby, P., C. Barlow, H. Kylefjord, L. Ährlund-Richter, and K. G. Xanthopoulos. 1996. Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/enhancer binding protein alpha. J. Biol. Chem. 271:24753-24760.[Abstract/Free Full Text]
  26. 14
  27. Gaynor, R., K. Simon, and P. Koeffler. 1991. Expression of c-jun during macrophage differentiation of HL-60 cells. Blood 77:2618-2623.[Abstract/Free Full Text]
  28. 15
  29. Gombart, A. F., W. K. Hofmann, S. Kawano, S. Takeuchi, U. Krug, S. H. Kwok, R. J. Larsen, H. Asou, C. W. Miller, D. Hoelzer, and H. P. Koeffl. 2002. Mutations in the gene encoding the transcription factor CCAAT/enhancer binding protein alpha in myelodysplastic syndromes and acute myeloid leukemias. Blood 99:1332-1340.[Abstract/Free Full Text]
  30. 16
  31. Gramigni, C., S. Penco, G. Bianchi-Scarra, R. Ravazzolo, and G. Garre. 1998. An upstream negative regulatory element in human granulocyte-macrophage colony-stimulating factor promoter is recognised by AP-1 family members. FEBS Lett. 440:119-124.[CrossRef][Medline]
  32. 17
  33. Grignani, F., T. Kinsella, A. Mencarelli, M. Valtieri, D. Riganelli, L. Lanfrancone, C. Peschle, G. P. Nolan, and P. G. Pelicci. 1998. High efficiency gene transfer and selection of human hematopoietic progenitor cells with a hybrid EBV/retroviral vector expressing the green fluorescence protein. Cancer Res. 58:14-19.[Abstract/Free Full Text]
  34. 18
  35. Hallahan, D. E., E. Dunphy, J. Kuchibhotla, A. Kraft, T. Unlap, and R. Weichselbaum. 1996. Prolonged c-Jun expression in irradiated ataxia telangiectasia fibroblasts. Int. J. Radiat. Oncol. Biol. Phys. 36:355-360.[Medline]
  36. 19
  37. Hass, R., M. Brach, S. Kharbanda, G. Giese, P. Traub, and D. Kufe. 1991. Inhibition of phorbolester-induced monocytic differentiation by dexamethasone is associated with downregulation of c-fos and c-jun (AP-1). J. Cell. Physiol. 149:125-131.[CrossRef][Medline]
  38. 20
  39. Hsu, W., T. K. Kerppola, P. L. Chen, T. Curran, and S. Chen-Kiang. 1994. Fos and Jun repress transcription activation by NF-IL6 through association at the basic zipper region. Mol. Cell. Biol. 14:268-276.[Abstract/Free Full Text]
  40. 21
  41. Hu, H.-M., M. Baer, S. C. Williams, P. F. Johnson, and R. C. Schwartz. 1998. Redundancy of C/EBPalpha, -beta, and delta in supporting the lipopolysaccharide-induced transcription of IL-6 and monocyte chemoattractant protein-1. J. Immunol. 160:2334-2342.[Abstract/Free Full Text]
  42. 22
  43. Johnson, R. S., B. van Lingen, V. E. Papaioannou, and B. M. Spiegelman. 1993. A null mutation at the c-jun locus causes embryonic lethality and retarded cell growth in culture. Genes Dev. 7:1309-1317.[Abstract/Free Full Text]
  44. 23
  45. Kharbanda, S., R. Datta, E. Rubin, T. Nakamura, R. Hass, and D. Kufe. 1992. Regulation of c-jun expression during induction of monocytic differentiation by okadaic acid. Cell Growth Diff. 3:391-399.[Abstract]
  46. 24
  47. Lamph, W. W., P. Wamsley, P. Sassone-Corsi, and I. M. Verma. 1988. Induction of protooncogene JUN/AP-1 by serum and TPA. Nature 334:631.[CrossRef][Medline]
  48. 25
  49. Landschulz, W. H., P. F. Johnson, and S. L. McKnight. 1988. The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science 240:1759-1764.[Abstract/Free Full Text]
  50. 26
  51. Landschulz, W. H., P. F. Johnson, and S. L. McKnight. 1989. The DNA binding domain of the rat liver nuclear protein C/EBP is bipartite. Science 243:1681-1688.[Abstract/Free Full Text]
  52. 27
  53. Lord, K. A., A. Abdollahi, B. Hoffman-Liebermann, and D. A. Liebermann. 1993. Protooncogenes of the Fos/Jun family of transcription factors are positive regulators of myeloid differentiation. Mol. Cell. Biol. 13:841-851.[Abstract/Free Full Text]
  54. 28
  55. Müller, C., M. Alunni-Fabbroni, E. Kowenz-Leutz, X. Mo, M. Tommasino, and A. Leutz. 1999. Separation of C/EBP{alpha}-mediated proliferation arrest and differentiation pathways. Proc. Natl. Acad. Sci. USA 96:7276-7281.[Abstract/Free Full Text]
  56. 29
  57. Nakamura, T., R. Datta, S. Kharbanda, and D. Kufe. 1991. Regulation of jun and fos gene expression in human monocytes by the macrophage colony-stimulating factor. Cell Growth Diff. 2:267-272.[Abstract]
  58. 30
  59. Noti, J. D. 1997. Sp3 mediates transcriptional activation of the leukocyte integrin genes CD11c and CD11b and cooperates with c-jun to activate CD11c. J. Biol. Chem. 272:24038-24045.[Abstract/Free Full Text]
  60. 31
  61. Okada, S., Z. Q. Wang, A. E. Grugoriadis, E. F. Wagner, and T. Ruden. 1994. Mice lacking c-Fos have normal hematopoietic stem cells but exhibit altered B-cell differentiation due to an impaired bone marrow environment. Mol. Cell. Biol. 14:382-390.[Abstract/Free Full Text]
  62. 32
  63. Pabst, T., B. U. Mueller, N. Harakawa, C. Schoch, T. Haferlach, G. Behre, W. Hiddemann, D. E. Zhang, and D. G. Tenen. 2001. AML1-ETO downregulates the granulocytic differentiation factor C/EBP{alpha} in t(8;21) myeloid leukemia. Nat. Med. 7:444-451.[CrossRef][Medline]
  64. 33
  65. Pabst, T., B. U. Mueller, P. Zhang, H. Radomska, S. Narravula, S. Schnittger, G. Behre, W. Hiddemann, and D. G. Tenen. 2001. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBP{alpha}), in acute myeloid leukemia. Nat. Genet. 27:263-270.[CrossRef][Medline]
  66. 34
  67. Paradis, P., W. R. MacLellan, N. S. Belaguli, R. J. Schwartz, and M. D. Schneider. 1996. Serum response factor mediates AP-1-dependent induction of the skeletal {alpha}-actin promoter in ventricular myocytes. J. Biol. Chem. 271:10827-10833.[Abstract/Free Full Text]
  68. 35
  69. Radomska, H., C. Huettner, P. Zhang, T. Cheng, D. Scadden, and D. G. Tenen. 1998. CCAAT/enhancer binding protein {alpha} is a regulatory switch sufficient for induction of granulocytic development from bipotential myeloid progenitors. Mol. Cell. Biol. 18:4301-4314.[Abstract/Free Full Text]
  70. 36
  71. Rana, B., D. Mischoulon, Y. Xie, N. Bucher, and S. Farmer. 1994. Cell-extracellular matrix interactions can regulate the switch between growth and differentiation in rat hepatocytes: reciprocal expression of C/EBP{alpha} and immediate-early growth response transcription factors. Mol. Cell. Biol. 14:5858-5869.[Abstract/Free Full Text]
  72. 37
  73. Reddy, V. A., A. Iwama, G. Iotzova, S. Schulz, A. Elsasser, R. K. Vangala, D. G. Tenen, W. Hiddemann, and G. Behre. 2002. Granulocyte inducer C/EBP{alpha} inactivates the myeloid master regulator PU.1: possible role in lineage commitment decisions. Blood 100:483-490.[Abstract/Free Full Text]
  74. 38
  75. Rorth, P. 1994. Specification of C/EBP function during Drosophila development by the bZIP basic region. Science 266:1878-1881.[Abstract/Free Full Text]
  76. 39
  77. Rosson, D., and T. G. O'Brien. 1998. AP-1 activity affects the levels of induced erythroid and megakaryocytic differentiation of K562 cells. Arch. Biochem. Biophys. 354:298-305.
  78. 40
  79. Sariban, E., T. Mitchell, A. Rambaldi, and D. Kufe. 1998. c-sis but not c-fos gene expression is lineage specific in human myeloid cells. Blood 71:488-493.[Abstract/Free Full Text]
  80. 41
  81. Sassone-Corsi, P., L. J. Ransone, W. W. Lamph, and I. M. Verma. 1988. Direct interaction between fos and jun nuclear oncoproteins: role of the 'leucine zipper' domain. Nature 336:692-695.[CrossRef][Medline]
  82. 42
  83. Sherman, M. L., R. M. Stone, D. Rakesh, S. H. Bernstein, and D. W. Kufe. 1990. Transcriptional and posttranscriptional regulation of c-jun expression during monocytic differentiation of human myeloid leukemic cells. J. Biol. Chem. 265:3320-3323.[Abstract/Free Full Text]
  84. 43
  85. Shuman, J. D., J. Cheong, and J. E. Coligan. 1997. ATF-2 and C/EBP{alpha} can form a heterodimeric DNA binding complex in vitro. Functional implications for transcriptional regulation. J. Biol. Chem. 272:12793-12800.[Abstract/Free Full Text]
  86. 44
  87. Szabo, E., L. H. Preis, and M. J. Birrer. 1994. Constitutive c-jun expression induces partial macrophage differentiation in U937 cells. Cell Growth Diff. 5:439-446.[Abstract]
  88. 45
  89. Tengku S. T.-M., T. Hughes, H. Ranki, A. Cryer, and D. Ramji. 2000. Differential regulation of macrophage CCAAT-enhancer binding protein isoforms by lipopolysaccharide and cytokines. Cytokine 12:1430-1436.[CrossRef][Medline]
  90. 46
  91. Tornaletti, S., and G. P. Pfeifer. 1995. UV light as a footprinting agent: modulation of UV-induced DNA damage by transcription factors bound at the promoters of three human genes. J. Mol. Biol. 249:714-728.[CrossRef][Medline]
  92. 47
  93. Ubeda, M., M. Vallejo, and J. F. Habener. 1999. CHOP enhancement of gene transcription by interactions with Jun/Fos AP-1 complex proteins. Mol. Cell. Biol. 19:7589-7599.[Abstract/Free Full Text]
  94. 48
  95. Umek, R., A. D. Friedman, and S. L. McKnight. 1991. CCAAT-enhancer binding protein: a component of a differentiation switch. Science 251:288-292.[Abstract/Free Full Text]
  96. 49
  97. Unlap, T., C. C. Franklin, F. Wagner, and A. S. Kraft. 1992. Upstream regions of the c-jun promoter regulate phorbol ester-induced transcription in U937 leukemic cells. Nucleic Acids Res. 20:897-902.[Abstract/Free Full Text]
  98. 50
  99. Vangala, R. K., M. Heiss-Neumann, J. Rangatia, S. M. Singh, C. Schoch, D. G. Tenen, W. Hiddemann, and G. Behre. Master regulator PU.1 is downregulated by fusion protein AML1-ETO in t(8;21) leukemia. Blood, in press.
  100. 51
  101. Wang, X., E. Scott, C. Sawyers, and A. D. Friedman. 1999. C/EBP{alpha} bypasses granulocyte colony-stimulating factor signals to rapidly induce PU.1 gene expression, stimulate granulocytic differentiation, and limit proliferation in 32D cl3 myeloblasts. Blood 94:560-571.[Abstract/Free Full Text]
  102. 52
  103. Wei, P., N. Inamdar, and W. V. Vedeckis. 1998. Transrepression of c-jun gene expression by the glucocorticoid receptor requires both AP-1 sites in the c-jun promoter. Mol. Endocrinol. 12:1322-1333.[Abstract/Free Full Text]
  104. 53
  105. Westendorf, J. J., C. M. Yamamoto, N. Lenny, J. R. Downing, M. E. Selsted, and S. Hiebert. 1998. The t(8;21) fusion product AML-ETO associates with C/EBP{alpha}, inhibits C/EBP{alpha} dependent transcription, and blocks granulocytic differentiation. Mol. Cell. Biol. 18:322-333.[Abstract/Free Full Text]
  106. 54
  107. Wong, C., E. M. Rougier-Chappman, J. P. Frederick, M. B. Datto, N. T. Liberati, J.-M. Li, and X. Wang. 1999. Smad3-Smad4 and AP-1 complexes synergize in transcriptional activation of the c-Jun promoter by TGFß. Mol. Cell. Biol. 19:1821-1830.[Abstract/Free Full Text]
  108. 55
  109. Zagariya, A., S. Mungre, R. Lovis, M. Birrer, S. Ness, B. Thimmapaya, and R. Pope. 1998. Tumor necrosis factor {alpha} gene regulation: enhancement of C/EBPß-induced activation by c-Jun. Mol. Cell. Biol. 18:2815-2824.[Abstract/Free Full Text]
  110. 56
  111. Zhang, D. E., P. Zhang, N.-D. Wang, C. J. Hetherington, G. J. Darlington, and D. G. Tenen. 1997. Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein {alpha}-deficient mice. Proc. Natl. Acad. Sci. USA 94:569-574.[Abstract/Free Full Text]


Molecular and Cellular Biology, December 2002, p. 8681-8694, Vol. 22, No. 24
0270-7306/02/$04.00+0     DOI: 10.1128/MCB.22.24.8681-8694.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Schuler, A., Schwieger, M., Engelmann, A., Weber, K., Horn, S., Muller, U., Arnold, M. A., Olson, E. N., Stocking, C. (2008). The MADS transcription factor Mef2c is a pivotal modulator of myeloid cell fate. Blood 111: 4532-4541 [Abstract] [Full Text]  
  • Dahl, R., Iyer, S. R., Owens, K. S., Cuylear, D. D., Simon, M. C. (2007). The Transcriptional Repressor GFI-1 Antagonizes PU.1 Activity through Protein-Protein Interaction. J. Biol. Chem. 282: 6473-6483 [Abstract] [Full Text]  
  • Wang, D., D'Costa, J., Civin, C. I., Friedman, A. D. (2006). C/EBP{alpha} directs monocytic commitment of primary myeloid progenitors. Blood 108: 1223-1229 [Abstract] [Full Text]  
  • Shimokawa, T., Ra, C. (2005). C/EBP{alpha} functionally and physically interacts with GABP to activate the human myeloid IgA Fc receptor (Fc{alpha}R, CD89) gene promoter. Blood 106: 2534-2542 [Abstract] [Full Text]  
  • Witcher, M., Shiu, H. Y., Guo, Q., Miller, W. H. Jr (2004). Combination of retinoic acid and tumor necrosis factor overcomes the maturation block in a variety of retinoic acid-resistant acute promyelocytic leukemia cells. Blood 104: 3335-3342 [Abstract] [Full Text]  
  • Bastie, J.-N., Balitrand, N., Guidez, F., Guillemot, I., Larghero, J., Calabresse, C., Chomienne, C., Delva, L. (2004). 1{alpha},25-Dihydroxyvitamin D3 Transrepresses Retinoic Acid Transcriptional Activity via Vitamin D Receptor in Myeloid Cells. Mol. Endocrinol. 18: 2685-2699 [Abstract] [Full Text]  
  • Schwieger, M., Lohler, J., Fischer, M., Herwig, U., Tenen, D. G., Stocking, C. (2004). A dominant-negative mutant of C/EBP{alpha}, associated with acute myeloid leukemias, inhibits differentiation of myeloid and erythroid progenitors of man but not mouse. Blood 103: 2744-2752 [Abstract] [Full Text]  
  • Liu, H., Keefer, J. R., Wang, Q.-f., Friedman, A. D. (2003). Reciprocal effects of C/EBPalpha and PKCdelta on JunB expression and monocytic differentiation depend upon the C/EBPalpha basic region. Blood 101: 3885-3892 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rangatia, J.
Right arrow Articles by Behre, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rangatia, J.
Right arrow Articles by Behre, G.