The Neuronal Basic Helix-Loop-Helix Transcription Factor NSCL-1 Is Dispensable for Normal Neuronal Development

The neuronal stem cell leukemia (NSCL) basic helix-loop-helixfactors are neural cell-specific transcription factors. We havedisrupted the NSCL-1 gene by homologous recombination and replacedthe coding region with a beta-galactosidase reporter cassetteto study the role of NSCL-1 in neuronal development and to followthe fate of NSCL-1 mutant cells. NSCL-1 mutant mice are viableand fertile on various genetic backgrounds and do not show anyobvious signs of neurological malfunction. No differences inthe distribution of NSCL-1 mutant or heterozygous neuronal cellswere observed in the diencephalon, hippocampus, neocortex, andcerebellum at different stages of development. Likewise, nodefects were found in the laminar organization of the cortex,and the distinct neuronal subpopulation appeared normal duringdevelopment of the neocortex. Analysis of sensory neurons whichstrongly express NSCL-1 revealed that the spatiotemporal expressionof neuronal differentiation factors, such as NeuroD and SCG-10,was not altered in developing distal and proximal cranial gangliaof mutant mice. In the cerebellum expression of NSCL-1 was confinedto the proliferative and premigratory zone of the external granularlayer and the internal granular layer. Interestingly, unlikecerebella of Math1^-/- or NeuroD2^-/- mice, NSCL-1-deficient micehave no obvious developmental defect, and neurons of the cerebellumappeared fully differentiated. Despite similar expression patternsof NSCL-1 and NSCL-2 in various areas of the diencephalon, includingthe arcuate nucleus and paraventricular nucleus, NSCL-1^-/- miceare fertile and show no adult onset of obesity like NSCL-2 mutantmice. Double-mutant NSCL-1^-/--NSCL-2^-/- mice do not show anyadditional obvious malformations of the central nervous system,although both genes are expressed in a largely overlapping pattern.Our results argue against a simple functional redundancy withinthe NSCL gene family.

INTRODUCTION

Top

Introduction

Transcription factors of the basic helix-loop-helix (bHLH) familyplay important roles in the control of cell proliferation, determination,and differentiation in numerous tissues. A relatively largegroup of bHLH genes is expressed in the nervous system and hasbeen shown to be responsible for the development of specificsubsets of neurons (14, 15, 27). For example, the proneuralbHLH genes Ngn-1 and Ngn-2 are required for the developmentof several neuronal lineages, including proximal and epibranchialplacode-derived sensory ganglia, dorsal root ganglia, and thetelencephalon (9, 19, 20, 21, 31). Members of the NeuroD subgroup(NeuroD, Nex-1 [Math-2], Math-3, and NeuroD2 [NDRF]) are predominantlyexpressed at later stages of neuronal development (2, 22, 29,30). These genes appear to be involved in terminal steps ofneuronal differentiation since they are able to induce cellcycle arrest and to activate transcription of neuronal specificgenes (8, 16, 25). Interestingly, overexpression of NeuroD inXenopuslaevis embryos leads to a conversion of presumptive epidermalcells into neurons (17), although its expression in mammalianembryos suggests a role in neuronal differentiation rather thanin determination. NeuroD2 (NDRF), like NeuroD, is expressedin differentiating neurons (22) in the developing cerebellumand cortex. NeuroD2^-/- mice die several days after birth anddisplay a reduced cerebellar granular cell layer, possibly dueto increased apoptosis of cerebellar neurons (28). Math-1, anotherbHLH protein, has been shown to be essential for granule celldevelopment during the development of the cerebellum (5, 13).

Neuronal stem cell leukemia (NSCL-1) and NSCL-2 (18) genes forma subgroup within the bHLH superfamily. Both genes were originallycloned on the basis of their homology to the human hematopoieticstem cell leukemia gene SCL, also known as Tal-1 and Hen-1 (1,10). NSCl-1 and NSCL-2 show a high sequence identity of 98%on the amino acid level within the bHLH region. The expressionof NSCL-2 overlaps with but is distinct from that of NSCL-1.Inactivation of NSCL-2 results in disruption of the hypothalamic-gonadalaxis and leads to infertility and adult onset of obesity (11).NSCL-1 is expressed only in subependymal layers of the neuroepitheliumand is not detected in mitotic ventricular layers similar toNSCL-2 (3). NSCL-1 transcripts are first detected from mouseembryonic day 8.75 (E8.75) onwards in the proximal and distalepibranchial placodes (24). At E10.5 transcripts of NSCL-1 arepresent in different areas of the developing central nervoussystem (CNS) in the brain and the neural tube. Strong expressionwas found in dorsal root ganglia, cranial ganglia, the olfactoryepithelium, and the developing optic cup (3). At E16.5 to E18.5NSCL-1 transcripts were observed in the developing cerebellum,the subventricular layer of the cerebral cortex, and the olfactoryepithelium. After birth NSCL-1 is restricted to the externalgranular layer (EGL) and internal granular layer (IGL) of thedeveloping cerebellum (7, 32).

We have mutated the NSCL-1 gene by homologous recombinationto decipher its role for neuronal cell formation. NSCL-1 homozygousmice are fully viable and do not show any obvious phenotype.NSCL-1 mutant neurons that are marked by ß-galactosidaseexpression were indistinguishable from their heterozygous counterparts.In order to analyze functional redundancy within the NSCL genefamily we have also generated NSCL-1–NSCL-2 double mutantmice. Surprisingly, no obvious differences in the architectureof the cerebellum or any other major malformation in the CNSwere observed in double mutant mice.

MATERIALS AND METHODS

Top

Materials and Methods

Generation and analysis of NSCL-1 knockout mice. To generate the targeting vector a 6.5-kbp ApaI fragment derivedfrom the 5' region of the NSCL-1 gene comprising the first exonand 260 bp of the second exon was cloned into the ApaI siteof the vector pWH9 in front of an internal ribosomal entry site,the coding region of the lacZ gene and the neomycin resistancecassette. A 1.3-kbp PflMI-BamHI fragment from the 3' regionof the NSCL-1 gene was inserted behind the selection cassetteto generate a 3'-homology fragment. The recombination vectorreplaced the entire DNA binding bHLH region and most of thecoding region with lacZ and neomycin resistance genes. Therefore,in the mutant locus, activity of the lacZ reporter gene is directedby NSCL-1 transcriptional control elements.

Electroporation and selection of J1 ES cells were done as describedpreviously (6). To identify correctly targeted clones a 3' externalprobe (BamHI/NcoI fragment) was used to detect a 25-kbp EcoRVfragment in the wild-type allele and a 15-kbp fragment in themutant allele by Southern blot hybridization.

Reverse transcription (RT)-PCR analysis. Total RNA was prepared from P1 mouse brains by column purification(RNeasy; Qiagen). First-strand cDNA was synthesized using 2µg of total RNA, Expand reverse transcriptase (Roche),and random primers pd(N)6 (Pharmacia). Ten percent of the reversetranscriptase reaction mixture was used in the PCR (40 cyclesof 94°C for 30 s, 55°C for 30 s, and 72°C for 2min) with a primer at position 45 (primer a forward, 5'GACTCCAGTTCTGGACTAAGTAAG)and two reverse primers at position 578 (primer b reverse, 5'GGACCACTCCTGGATCCCCGGATC)and at position 1104 (primer c reverse, 5' GCATGGACTCCATTCTGACCACTC).GAPDH transcripts were detected with a forward (5'GTGGCAAAGTGGAGATTGTTGCC)and a reverse (5'GATGATGACCCGTTTGGCTCC) primer.

Histology and immunohistochemistry. For immunohistochemistry mice were transcardially perfused withphosphate-buffered saline, followed by 4% paraformaldehyde.Brains were postfixed overnight with the same fixative followedby paraffin embedding or vibratome sectioning. Histologicalexamination of brain structures was performed on routine hematoxylin-eosin(H/E)- and Nissl-stained paraffin sections (8 µm thick).Immunohistological analysis was accomplished using serial frontaland sagittal free-floating vibratome sections (50 µm thick)from adult (4- to 6-month-old) NSCL-1^-/-, NSCL-1^+/-, and wild-typelittermates. The following antibodies were used: anti-calbindinD28K (diluted 1:4,000; Sigma), anticalretinin (1:2,000; Swant),anti-GFAP (1:500; DAKO), and anti-neurofilament (1:400; Sigma).Bound antibodies were visualized using the Vectastain Elitekit (Vector). Whole-mount in situ hybridizations were done accordingto the protocol of Wilkinson and Nieto (33). The NeuroD antisenseprobe was synthesized from a 1.3-kbp cDNA fragment (175 to 1,474bp) using T7 RNA polymerase. The SCG-10 antisense probe (giftfrom A. Mansouri) was synthesized from a rat cDNA clone. Id1transcripts were detected using a probe from plasmid pMH18 ${Delta}$ thatcontains an RsaI-EcoRI Id1 cDNA fragment (nucleotides 5 to 927)(gift from H. Weintraub). An Id2 probe was kindly provided byA. Mansouri, Göttingen, Germany. The probe for Math-1 wasgenerated by RT-PCR. LacZ staining of embryos and cryosections(20 µm) was performed as described by Zweigerdt et al.(34).

RESULTS

Top

Results

We have generated NSCL-1 mutant mice by replacing the bHLH domainwith a promotorless cytoplasmatic lacZ reporter gene and a neomycinresistance cassette (Fig. 1A). Southern blot analysis of genomicDNA from F₂ littermates proved that the NSCL-1 genomic locushad been targeted as expected (Fig. 1B). No RNA transcriptswere generated from the mutant locus, while NSCL-1 mRNAs werereadily detectable in wild-type mice as shown by RT-PCR usingtwo different sets of primers (Fig. 1C).

View larger version (36K):
[in this window]
[in a new window]
FIG. 1. Targeted disruption of the NSCL-1 genomic locus. (A) Schematic representation of NSCL-1 locus (upper row), the targeting vector (middle row), and the disrupted allele generated by homologous recombination (lower row). Insertion of the lacZ gene-neo resistance cassette (white box) deleted the second exon, including almost the entire bHLH region. Noncoding regions of the NSCL-1 gene are indicated by grey boxes; the bHLH domain is represented by a black box. Abbreviations for restriction sites: A, ApaI; B, BamHI; E, EcoRV; N, NotI; P, PstI; X, XbaI. (B) Southern blot analysis of EcoRV-digested DNA isolated from F₂ progeny. The external probe detects a 25-kb fragment in wild-type mice and a 15-kb fragment in mutant mice. Mice heterozygous for the mutation show both the 25-kb and the 15-kb band. (C) RT-PCR analysis of NSCL-1 RNA isolated from brains of E18.5 wild-type and homozygous mutant mice. Locations of the primers in exons 1 and 2 are indicated by arrows (a to c) in panel A. Lane 1, molecular weight markers; lanes 2 and 4, primer pair a and c; lanes 3 and 5, primer pair a and b. In homozygous mutant mice (lanes 4 and 5), no transcripts were detectable. To ensure equal loadings, RT-PCR with primers specific for GAPDH was performed.

NSCL-1-deficient mice are viable, fertile, and not obese. In the F₂ generation (>200 offspring tested) wild-type, heterozygous,and homozygous mutant animals were found at the expected Mendelianratio. Both NSCL-1^-/- males and females were fertile and ableto give rise to normal numbers of progeny (data not shown).Despite the similar expression patterns of NSCL-1 mutant andNSCL-2 mice within various areas of the hypothalamus, such asthe arcuate nucleus and paraventricular nucleus, adult onsetof obesity was not observed in NSCL-1 male and female mutantmice. To determine the body weight, 20 wild-type and homozygouslittermates were raised in single cages for 1 year. The bodyweights of NSCL-1^-/- animals were not higher than those of theirwild-type littermates during the monitoring period (data notshown).

Development of cranial ganglia is not affected in NSCL-1-deficient mice. The epibranchial placodes are transient ectodermal thickeningspresent between E8.5 and E10.5 of mouse development. NSCL-1-expressingneuronal cells delaminate from placodes, migrate, and form thedistal aspect of cranial ganglia. Distal ganglia, which aremostly derived from epibranchial placodes, can be distinguishedfrom proximal ganglia that are mostly derived from neural crest.Nevertheless, a considerable variation exists in the relativecontributions of neural crest and placodal cells among distaland proximal ganglia.

Inactivation of the bHLH gene Ngn-1 prevents the determinationand development of proximal ganglia, including the trigeminal(Vth), superior, jugular, accessory, and vestibulo-cochlear(VIIIth) ganglia, while ganglia originating from the epibranchialplacodes, such as the geniculate (VIIth), petrosal (IXth), andnodose (Xth) ganglia, are dependent on the closely related bHLHgene Ngn-2 (9, 19). As shown in Fig. 2A and D, NSCL-1 lacZ-positivecells were present in both the distal (VIIth, IXth, and Xth)and proximal (Vth and VIIIth) ganglia in wild-type and mutantanimals. Expression was also observed in the midbrain, the diencephalon,the neural tube, and the dorsal root ganglia (Fig. 2A and D).In agreement with previous reports using an NSCL-1 antisenseprobe (3), NSCL-1 lacZ-positive cells were found in subependymallayers of the neuroepithelium and not in the mitotically activeventricular zone, with the exception of the developing cerebellum.

View larger version (82K):
[in this window]
[in a new window]
FIG. 2. Normal development of cranial ganglia of E10.5 NSCL-1^-/- embryos. (A and D) Whole-mount NSCL-1 lacZ staining of heterozygous (A) and homozygous (D) mutant embryos. (B, C, E, and F) In situ hybridization of heterozygous (B and C) and homozygous (E and F) mutant embryos with cRNA probes for NeuroD (B and E) and SCG-10 (C and F). Note that no differences in the distribution and strength of NeuroD and SCG-10 signals (indicated by arrows) are discernible, indicating a normal development of proximal and distal ganglia. Abbreviations: t, trigeminal; g, geniculate; v, vestibulo-cochlear; p, petrosal; n, nodose ganglia; ov, otic vesicle.

To analyze at the molecular level whether successive steps ofcranial ganglion cell development occurred normally in NSCL-1mutants, in situ hybridization experiments were performed. Nodifferences were found at E9.5 (not shown) and E10.5 (Fig. 2B to F)in the expression of the bHLH gene encoding NeuroD, whichmarks an early stage of neuronal cell development, and of SCG-10,which detects differentiated neurons.

Expression pattern of NSCL-1 in developing cerebral cortex and cerebellum. Next, we took advantage of the lacZ reporter gene and comparedthe appearances of NSCL-1-expressing, lacZ-positive neuronsbetween heterozygous and homozygous mutant animals in differentareas of the brain during development and adult life. Basically,no significant differences were found, with the exception ofa more intense staining in homozygous mutant animals, whichis due to the higher copy number of the reporter gene. Strongand widespread lacZ staining was detected in distinct laminatedstructures of the brain, including the cerebral cortex, cerebellum,hippocampus, and olfactory bulb. Between E14.5 and E16.5 NSCL-1was expressed in the subventricular layer of the developingcortex with no detectable expression in the mitotically activeventricular layer (Fig. 3A to D). At E18.5, in addition to theexpression in the subventricular layer, NSCL-1 was expressedin the intermediate zone and marginal zone of the cortex (Fig.3E and F). Postnatally, NSCL-1 expression decreased and becameundetectable in the adult cerebral cortex (data not shown).Additional expression domains were found in the dentate gyrus,in CA1, CA2, and CA3 fields of the developing hippocampus, andin dorsal areas of the diencephalon, including subsets of thalamicnuclei and the anterior lobe of the developing pituitary gland(data not shown).

View larger version (115K):
[in this window]
[in a new window]
FIG. 3. Normal distribution of lacZ-positive cells in NSCL-1 heterozygous and homozygous mutant mice. (A to F) Frontal sections through subventricular layers of the developing cortex of heterozygous (A, C, and E) and homozygous (B, D, and F) mutant embryos at E14.5 to 16.5 and through the intermediate and marginal zones of the cortexes of E18.5 fetuses (E and F). In the cerebellum at E16.5 NSCL-1 expression in heterozygous (G) and homozygous (H) animals is restricted to the EGL. At E18.5 identical distributions of lacZ-positive cells were found in the proliferating and premigratory zones of the EGL in heterozygous (I) and homozygous (J) animals. A weaker expression is present in the developing IGL (I and J). Postnatally (P10), lacZ-positive cells were localized in the EGL and in the newly formed IGL of heterozygous (K) and homozygous (L) animals. Abbreviations: vz, ventricular zone; svz, subventricular zone; iz, intermediate zone; cp, cortical plate; mz, marginal zone; m, molecular layer.

A similar comparison between lacZ-positive cells of wild-typeand mutant animals was performed for the cerebellum betweenE12.5 and postnatal day 10 (P10). NSCL-1 was first detectedat E12.5 in the cerebellar primordium (data not shown), in agreementwith previous results using RNA probes (32). Between E14.5 andE16.5 NSCL-1 expression became confined to migrating granuleprecursor cells of the ventricular zone of the cerebellar epithelium(Fig. 3G and H), which originate from the rhombic lip. At E18.5,NSCL-1 expression persisted in the single-cell layer over theentire surface of the EGL in the developing cerebellum (Fig.3I and J). At P10 lacZ-positive cells were found in the EGLand the newly formed IGL (Fig. 3K and L).

Neuronal differentiation of the cortex and cerebellum in the absence of NSCL-1. The tissue architecture of the cortex was investigated usingNissl and H/E staining. The diameters of the different layersof the cortex were measured, and the number of cells withineach layer was counted. At least 10 sections were counted permouse. No obvious differences in the laminar organization ofthe adult cortex were apparent between heterozygous (Fig. 4A, C, and E)and homozygous (Fig. 4B, D, and F) mice. Immunostainingusing antibodies against calbindin-D28K and calretinin revealedthe presence of distinct subpopulations of interneurons throughoutthe cortex in the absence of NSCL-1 (Fig. 4B, D, and F). Theexpression of calretinin indicated the presence of hippocampaldendrites of dentate gyrus granule cells that were differentiatednormally both in wild-type and NSCL-1 mutant brains (data notshown). Likewise, no morphological differences were detectedbetween the cerebella of wild-type and mutant mice using H/Eand Nissl stainings (Fig. 5A to H). Mid-sagittal sections demonstratedthe same number of folia and no changes in the size of molecularand granule cell layers. The use of antibodies against calbindinand neurofilament revealed the presence of distinct neuronalcell types, such as Purkinje cells and basket cell interneurons,respectively, in normal numbers and in a normal distributionin various areas of the cerebellum of adult NSCL-1^-/- animals(Fig. 5I to L). At least 1,000 cells were counted per animal.Similarly, staining with a GFAP antibody yielded no obviousalterations (data not shown).

View larger version (75K):
[in this window]
[in a new window]
FIG. 4. Normal laminar organization of the cortex of NSCL-1 mutant mice. Frontal sections were taken from NSCL-1^+/- (A, C, and E) and NSCL-1^-/- (B, D, and F) mice. Sections were Nissl stained (A and B) or stained with antibodies against calretinin (C and D) or calbindin (E and F). No differences between NSCL-1⁺/^- and NSCL-1^-/- mice are evident. Note that no changes in the thickness of the cortex or the distribution of calretinin- or calbindin-positive cells between heterozygous and homozygous animals are apparent.

View larger version (70K):
[in this window]
[in a new window]
FIG. 5. Normal organization of the cerebellum of adult NSCL-1 mutant mice. Sagittal sections through the cerebellum of wild-type (WT) (A, C, E, G, H, I, and K) and NSCL-1 mutant (B, D, F, H, J, and L) mice are shown. (A to H) No differences in the lobulation of the cerebellum and morphology of the molecular layer (ml) and IGL (gl) are discernible by H/E (A to D) and Nissl (E to H) staining. No significant differences were found in the distribution of Purkinje (p) cells that were identified by staining with an anticalbindin antibody (I and J) and basket cell interneurons (K and L) (stained with antineurofilament).

NSCL-1–NSCL-2 double mutant mice show normal neuronal differentiation in the cerebellum and no major malformation in the CNS. One reason for the absence of any obvious phenotypic defectsin NSCL-1 knockout mice is the existence of partially overlappingexpression patterns of NSCL-1 and NSCL-2 in most parts of theCNS. To elucidate possible functional redundancy between NSCL-1and NSCL-2, we generated NSCL-1 and NSCL-2 double homozygousmutants. Although NSCL-1–NSCL-2 double mutants die withinthe first day after birth, histological analysis of varioussections of the CNS failed to reveal morphological differencesbetween wild type and NSCL-1–NSCL-2 double homozygousmutants (data not shown). Likewise, in situ hybridization analysisusing the neuronal markers NeuroD and Math-1 disclosed onlyminor differences in expression pattern between double heterozygousand homozygous animals at E18. 5 (Fig. 6A to H). Similarly,NSCL-1 has been postulated to regulate the expression of Id1and/or Id2, two inhibitory HLH proteins that are strongly expressedin the cerebellum. In agreement with previous reports, strong(26) expression of Id1 was detected in the IGL of the cerebellumat E18.5, while expression of Id2 was confined to the Purkinjecell layer of the cerebellum. We did not observe any alterationof the expression of Id1 in double homozygous compared to doubleheterozygous mice at E18.5 (Fig. 6I to N). In contrast, we founda slight reduction of Id2 expression within the Purkinje celllayer of the cerebellum in double-knockout mice (Fig. 6K to P).Although these differences were only minor, they were repeatedlyobserved in several animals in separate experiments.

View larger version (123K):
[in this window]
[in a new window]
FIG. 6. Normal expression of neuronal HLH genes in cerebella of NSCL-1–NSCL-2 double mutant mice at E18.5. Matched frontal and sagittal sections from NSCL-1–NSCL-2 double heterozygous (A, C, E, G, I, K, M, and O) and NSCL-1–NSCL-2 double homozygous mice (B, D, F, H, J, L, N, and P) were hybridized with riboprobes specific for NeuroD (A, B, E, and F), Math-1 (C, D, G, and H), Id1 (I, J, M, and N), and Id2 (K, L, O, and P). Panels E to H and M to P represent higher magnification of sections shown in panels A to D and I to P, respectively. No major differences in the expression of NeuroD, Math-1, and Id1 were detected between double heterozygous and double homozygous littermates. A minor reduction of Id2 expression is apparent in the Purkinje cell layer of double homozygous mutants (O and P) when compared to double heterozygous control animals. pcl, Purkinje cell layer.

DISCUSSION

Top

Discussion

Two separate groups of neuronal bHLH transcription factors havebeen distinguished based on their expression profile and assumedfunction: (i) determination factors, which regulate early eventsin neurogenesis, such as Ngn-1/2, and (ii) differentiation factorswhich are expressed either transiently in migrating and/or differentiatingneurons, such as NSCL-1/2 and NeuroM, or enduringly in terminallydifferentiated neurons, such as NeuroD (15). The concept ofdetermination and differentiation factors governing neuronalcell development reflects similar observations made and conclusionsdrawn originally for myogenic cells (6, 27).

Our analysis of NSCL-1 homozygous mutant mice revealed thatthese animals were phenotypically indistinguishable from heterozygousand wild-type mice. Cortical and cerebellar neurons, which representmajor expression domains of NSCL-1, develop and differentiatewithout obvious morphological defects based on histologicalanalysis, antibody and lacZ staining, and whole-mount in situhybridization. Despite a very similar expression pattern ofNSCL-2 in the thalamus and hypothalamus, including the paraventricularnucleus and the arcuate nucleus, NSCL-1-deficient mice do notshow infertility or adult onset obesity such as that seen inNSCL-2-deficient mice.

The presence of a lacZ reporter gene in the NSCL-1 locus enabledus to monitor the fate of NSCL-1-expressing homozygous and heterozygousmutant precursors of cranial sensory neurons that delaminatefrom the placodal ectoderm and migrate to a site of ganglioncondensation. Initially, the expression of NSCL-1 in both proximaland distal cranial ganglia had led to the idea that NSCL-1 mightfunction as an early migration and differentiation factor fordeveloping cranial ganglia. Surprisingly, no change in the migrationpattern and cellular behavior of NSCL-1 mutant cells was detectable,thus excluding this idea. In both homozygous and heterozygousmutant embryos NSCL-1 lacZ expression became apparent at E8.75(14 to 16 somites) in cells of the proximal placodes (Ngn1 dependent)that give rise to trigeminal and vestibulo-cochlear ganglia.An identical situation was observed in the distal ganglia (Ngn2dependent), such as geniculate, petrosal, and nodose ganglia,where NSCL-1 first appeared at E9.0. In addition, the normalexpression of NeuroD and SCG-10 that is representative for differentstages of neuronal cell differentiation in cranial ganglia suggestedthat NSCL-1 is dispensable for normal differentiation of sensoryneurons.

Similar findings were made in the cerebellum and in the cortex.In the cerebellum NSCL-1 is expressed in the outer and innerportions of EGL (this study and reference 32) correspondingto the proliferative and premigratory zones, whereas the closelyrelated NSCL-2 gene is restricted to the inner layer of cerebellarEGL (12). The partially overlapping expression pattern of NSCL-1and NSCL-2 within the developing EGL indicated that NSCL-2 mightrescue the function of NSCL-1, at least in the inner EGL. Wetherefore reasoned that animals lacking both NSCL-1 and NSCL-2would exhibit a more severe phenotype. However, our analysisof NSCL-1–NSCL-2 double-knockout mice demonstrated thatthe presence of NSCL-2 is not critically needed to compensatefor the loss of NSCL-1, since double homozygous NSCL-1–NSCL-2mice did not show any additional morphological malformationsin the CNS.

It should be noted, however, that numerous bHLH proteins areexpressed in a complex pattern in the cerebellum. Many bHLHproteins are highly expressed in the outer and inner zones ofthe EGL. For example, Math-1 is expressed in the outer proliferatingEGL of the cerebellum, and Math-1^-/- mice fail to make any granulecells in the cerebellum, indicating that Math-1 has a criticalrole in the generation of granule precursors (4). Another memberof the bHLH protein family, NeuroD, is expressed only in theinner postmitotic zone of the EGL. Postnatally, NeuroD^-/- transgenicmice display a massive reduction in the number of granule cellsof the cerebellum and a complete loss of DG granule cells inthe hippocampus (23). Other bHLH proteins, such as NeuroD2 (NDRF),NEX-1 (Math-2), and Math-3, also have related developmentalprofiles and partially overlapping expression domains (28, 29).

In principle, the function of individual bHLH genes can be rescuedby other bHLH genes as first demonstrated for myogenic bHLHgenes of the MyoD family (see reference 27 for a review). Itseems therefore likely that the lack of an obvious phenotypein NSCL-1^-/- mice is due to a functional compensation by otherneuronal bHLH proteins. In Nex1^-/- mice, which also show norecognizable defect (30), Schwab and coworkers postulate a functionalcompensation of the lack of Nex1 by NeuroD and NeuroD2.

At the moment no clear candidate has emerged that might rescuethe function of NSCL-1 in all parts of the brain in which NSCL-1is expressed at a high level. The generation and analysis ofdouble homozygous NSCL-1–NSLC-2 mutant mice clearly ruledout that the NSCL-2 gene alone, which is closely related toNSCL-1, is required to compensate for the loss of NSCL-1. Inthis context it is interesting that in general the targeteddisruption of early determination factors, such as Ngn-1 or-2 or Math-1, gives rise to rather severe phenotypes, such asa complete lack of distinct neuronal sublineages. Mutationsof bHLH genes that are expressed late in the determination ordifferentiation process, however, like Nex1, NSCL-1 or NeuroD2,lead to only mild phenotypes. It might be possible that neuronalcells are able to use bHLH genes, which normally act as differentiationfactors in different neuronal sublineages, to promote a comparabledifferentiation step in another cell types, while early determinationevents, which are based on a less-complicated network, do nothave this choice. Nevertheless, it is surprising that the NSCLgenes that form a distinct subgroup within the family of neuronalbHLH genes that are highly expressed and evolutionarily wellconserved are dispensable to generate a morphologically normalCNS. Ultimately, the high number of and the complex relationsbetween different neuronal bHLH might require the generationof triple- and quadruple-knockout mice to pinpoint specificand overlapping functions of individual neuronal bHLH genes.

ACKNOWLEDGMENTS

We are indebted to Sonja Hoffmann for excellent technical assistance.We thank E. Bober for critically reading the manuscript andA. Mansouri for the SCG-10 probe.

This work was supported by the Deutsche Forschungsgemeinschaft,the Volkswagen Foundation, and the Fonds der Chemischen Industrie.

FOOTNOTES

* Corresponding author. Mailing address: Institute of Physiological Chemistry, University of Halle-Wittenberg, Hollystr. 1, 06097 Halle, Germany. Phone: 49 0 345 557 3813. Fax: 49 0 345 557 3811. E-mail: thomas.braun{at}medizin.uni-halle.de.

REFERENCES

Top