and Bradley B. Olwin*
Department of Molecular, Cellular and Developmental Biology, University of Colorado, Boulder, Colorado 80309
Received 29 May 2001/ Returned for modification 2 July 2001/ Accepted 5 November 2001
| ABSTRACT |
|---|
|
|
|---|
and/or
) are downstream Ras effectors responsible for Ras-dependent inhibition of myogenic differentiation in a satellite cell line. First, ectopic expression of Ha-RasG12V induces translocation of PKC
from the cytosol to the nucleus, suggesting that aPKCs are activated by Ras in myoblasts. The aPKCs function as downstream Ras effectors since inhibition of aPKCs by expression of a dominant negative PKC
mutant or by treatment of cells with an inhibitor, GO6983, promotes myogenesis in skeletal muscle satellite cells expressing oncogenic Ha-Ras. Arresting cell proliferation synergistically enhances myogenic differentiation only when aPKCs are also inhibited. Thus, the repression of myogenic differentiation in a satellite cell line appears to be directly mediated by aPKCs acting as Ras effectors and indirectly mediated via stimulation of cell proliferation. | INTRODUCTION |
|---|
|
|
|---|
The downstream effector of activated Ha-Ras that inhibits skeletal muscle differentiation is not known and is unlikely to rely on activation of either Raf, PI3-K, or RalGDS either indirectly or in combination. This suggests that a novel, Ha-Ras-activated signaling pathway is critical for inhibition of myogenic differentiation (22, 26, 27). Atypical protein kinases (aPKCs) have been reported to play critical roles in Ha-Ras signal transduction (2, 8, 33), and to interact directly with Ha-Ras (7). PKCs are a large family of structurally related serine/threonine protein kinases that are catoregized into three major subgroups; the classical or conventional PKC isotypes (cPKCs) are Ca2+ and diacylglycerol (DAG) dependent, the novel PKCs (nPKCs) are Ca2+ independent but DAG responsive, and the aPKC isozymes (
/
and
) require neither Ca2+ nor DAG for activation. In contrast to cPKCs or nPKCs, aPKC isoforms also do not respond to phorbol ester treatment (23, 24, 31).
In this study, we demonstrated that the aPKCs are necessary effectors of Ha-Ras that repress myogenic differentiation in a satellite cell line. Using a reporter gene whose expression relies on muscle cell differentiation and myoblast fusion assays, we showed that either dominant negative mutants of aPKCs or an aPKC-specific pharmaceutical inhibitor, GO6983, can induce differentiation of Ha-RasG12V-expressing MM14 myoblasts. Inhibition of cell proliferation either by blocking the Raf/MKK1,2/ERK1,2 signaling pathway or by reducing serum synergistically enhances myogenesis only when aPKCs are inhibited. These data demonstrate that aPKCs are likely to function as direct Ras effectors in a Ras-dependent pathway that represses myogenic differentiation, which cooperates with Ras-dependent and Ras-independent pathways that indirectly repress myogenesis via stimulation of cell proliferation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA transfection.
Expression vectors encoding a constitutively active mutant of human Ha-Ras, Ha-RasG12V, and its derivatives (Ha-RasG12C40, Ha-RasG12S35, and Ha-RasG12G37), as well as wild-type and dominant negative mutants of PKC
and PKC
, are described elsewhere (1, 6, 16, 34).
DNA was transiently transfected into MM14 cells by a calcium phosphate-DNA precipitation method as described previously (18). A pcDNA3 vector (Invitrogen, Carlsbad, Calif.) was used as an empty control expression vector. Equivalent DNA concentrations were maintained by the addition of a pBS SK(+) plasmid (Stratagene, La Jolla, Calif.)
Reverse transcriptase (RT) PCR analysis of aPKCs.
Total RNA was isolated from Ha-RasG12V-transfected cells 48 h after transfection, when the transfectants represent 50 to 75% of the total cell population. Reverse transcription and PCR were carried out as described previously (19). Each PCR amplification was performed for 40 cycles (1 min at 94°C, 1 min at 50°C, and 1 min at 72°C) using primers FGFR1 (positive control) (AGAGACCAGCTGTGATGA [forward] and GGCCACTTTGGTCACACG [reverse]) (19), atypical PKC
(CGCGAATTGTCAACGGACATCCTGATTACCAGCG [forward] and CGCGAATTGTCAACCGGTTGTTCTGGGATGCTTG [reverse]) (15), and atypical PKC
(CGCGAATTGTCAACAGTGAGGAGATGCCGACCCAGAGG [forward] and CGCGAATTGTCAACCTGAAAGCCTCTTCTAACTCCAAC [reverse]) (15). After the amplification, each reaction product was resolved on a 0.8% agarose gel containing ethidium bromide and visualized with a UV transilluminator.
Immunohistochemistry.
Cells were transfected as described below, plated on coverslips (treated as previously described [11]), grown for 36 h in growth medium containing FGF-2, washed in phosphate-buffered saline, and fixed in 4% paraformaldehyde for 10 min. Primary antibodies, which recognize PKC
(1:500) or PKC
(1:500) (Santa Cruz Biotechnology), were used to detect the expression of the corresponding proteins. A rabbit polyclonal anti-ß-galactosidase antibody (1:250; Sigma) was used to identify transfected cells. Primary antibodies were detected using fluorophor-conjugated secondary Alexa 488 (1:500) or Alexa 549 (1:500) donkey anti-goat or goat anti-rabbit antibodies (Molecular Probes). Nuclei were visualized by 4",6-diamidino-2-phenylindole (DAPI) staining. Alexa-conjugated antibody stains were detected using a Nikon E800 or Zeiss Axioplan2 fluorescence microscope equiped for digital confocal microscopy by Intelligent Imaging Innovations, Inc., Denver, Co.
Clonal growth assay. MM14 cells were grown on six-well plates to a density of 5 x 104 cells/well and transfected with the indicated expression vectors or control plasmids along with a cytomegalovirus (CMV)-LacZ expression plasmid encoding ß-galactosidase. Cells were trypsinized (0.05% trypsin, 0.53 mM EDTA) and replated at clonal density (1,000 cells per 10-cm plate) 1 h after transfection. The cells were maintained in the presence (0.3 nM) or absence of FGF-2, cultured for 36 h, and then processed for ß-galactosidase histochemistry as described elsewhere (29). The number of cells in ß-galactosidase-positive clones was determined.
Muscle-specific promoter assay.
A differentiation-sensitive muscle-specific reporter activity assay was used to determine the extent of MM14 differentiation following transient transfection. The reporter contained the firefly luciferase gene driven by a muscle-specific promoter (human
-cardiac actin promoter) (18). MM14 cells were assayed for relative luciferase activity as described previously (9).
Mitogen-activated protein (MAP) kinase activity assay. ERK1,2 kinase activity was determined using the Pathdetect ELK1 reporting system (Stratagene) (35). For this assay, MM14 cells were plated on six-well plates at a density of 104 cells/well and cotransfected with 2.5 µg of pFR-Luc reporter vector, 200 ng of pFA-Elk1 vector, and 1 µg of CMV-LacZ vector per well. The cells were harvested and assayed for luciferase and ß-galactosidase activities as described previously (9).
Myotube formation assay. MM14 cells were plated at 105 cells/well in six-well plates and transfected as described for the clonal growth assay. The cells were harvested for assay 48 h after transfection and processed for ß-galactosidase histochemistry as described elsewhere (29). A minimum of 600 nuclei in ß-galactosidase-positive cells were scored per plate, and the percentage of nuclei in multinucleated cells (two or more nuclei) was determined.
| RESULTS |
|---|
|
|
|---|
Oncogenic Ha-Ras mutants (Ha-RasG12S35, Ha-RasG12G37, and Ha-RasG12C40) that are defective in activation of downstream Ha-Ras effectors such as RalGDS and PI3-K, Raf and PI3-K, or Raf and RalGDS, respectively, are fully capable of inhibiting muscle gene expression in the absence of FGF (Fig. 1). The capacity for Ha-Ras and the Ras effector domain mutants to inhibit muscle gene expression is dose dependent (Fig. 1), and control transfections with an empty vector (pcDNA3) have no detectable effect (data not shown).
|
and
aPKC isoforms as shown by RT-PCR (Fig. 2). Immunohistochemical analyses show that PKC
is localized to the cytoplasm in control transfected cells (Fig. 3 A and B)while PKC
staining is barely detectable (Fig. 3E and F) compared to that of control cells lacking primary antibody for PKC
(Fig. 3C and D) or PKC
(Fig. 3G and H). Western blot analysis of proliferating MM14 cells showed a single band for aPKC, whereas PKC
was undetectable (data not shown). We then asked if both PKC
and PKC
were readily detectable by immunohistochemistry in MM14 cells expressing the activated Ha-RasG12V mutant. We noted that PKC
in Ha-RasG12V-expressing cells (Fig. 3I) often appeared to be localized to the nucleus (Fig. 3J and K), in contrast to the cytoplasmic localization in control transfected cells (Fig. 3A and B). In contrast, PKC
was localized to the cytoplasm (Fig. 3M and N) in Ha-RasG12V-expressing cells (Fig. 3L).
|
|
or PKC
in the absence or presence of the activated Ha-RasG12V mutant (Fig. 4). While PKC
remained in the cytosol in both the absence and presence of ectopically expressed Ha-RasG12V (Fig. 4A to F), in over 200 cells scored we observed a 2.5-fold increase in the nuclear localization of PKC
in Ha-RasG12V-expressing cells (Fig. 4G to L). Since the known Ras effector mutants are fully capable of repressing myogenic differentiation and since Ha-RasG12V promotes translocation of aPKCs in MM14 cells, we asked if aPCKs were involved in transducing the Ras signals that inhibit myogenesis.
|
or PKC
and maintained under differentiation conditions. In cells overexpressing Ha-RasG12V, ectopic expression of dominant negative PKC
, which may operate in a heterologous fashion (12), induced muscle gene expression (Fig. 5a). Moreover, the induction of muscle gene expression by mutant PKC
is dose dependent (Fig. 5a). Consistent with this observation, cotransfection of MM14 cells with expression vectors encoding Ha-RasG12V, the mutant PKC
, and ß-galactosidase (to identify transfected cells) inhibited the ability of oncogenic Ha-Ras to repress myogenesis and thus significantly increased myotube formation (Fig. 5c and d) compared to control transfected cells (Fig. 5b). A quantitative analysis revealed a twofold increase in myotube formation when dominant negative PKC
was expressed (Fig. 5e). This was, however, significantly less fusion than that observed when mock-transfected cells were maintained under differentiation conditions. Transfection with a dominant negative mutant of PKC
had a similar effect on myotube formation when MM14 cells overexpressed Ha-RasG12V (data not shown).
|
, PKCß, and PKCµ (13), elicited no detectable effect on muscle gene expression. However, treatment with GO6983, an inhibitor of PKC
, PKCß, PKC
, PKC
, and PKC
(13) increased muscle gene expression 1.5-fold over control levels, but only at high concentrations of inhibitor (100 µM) that are required to inhibit PKC
(13) (Fig. 6a). Similarly, treatment of Ha-Ras-expressing MM14 cells with GO6983 (100 nM) increased myoblast fusion while treatment with GO6976 or GF109203X (a broad-specificity kinase inhibitor [32]) or long-term tetradecanoyl phorbol acetate exposure, which down regulates the conventional and novel PKC isoforms (5), did not detectably increase myotube formation (Fig. 6b). Together, these data suggest a direct involvement of PKC
and/or PKC
in repressing myogenic differentiation downstream of Ras.
|
inhibitor, the levels of myoblast fusion obtained with either the PKC
inhibitor or ectopic expression of dominant negative aPKCs were lower than that observed in control cells under differentiation conditions. Therefore, it is likely that additional signaling cascades are involved in repressing myogenesis. We hypothesized that proliferative signals sent via Ha-Ras may indirectly contribute to the inhibition of myogenic differentiation. Consistent with this hypothesis, we have demonstrated that activation of the Raf/MKK1,2/ERK1,2 cascade in MM14 cells is necessary for stimulating proliferation but does not directly inhibit myogenic differentiation (14). We then asked if proliferative signals sent via Ha-RasG12V might indirectly function to repress myogenesis and thus reduce the levels of muscle-specific reporter expression and myotube formation when aPKCs are inhibited.
Ectopic expression of Ha-Ras increases ERK1,2 activity five- to sevenfold in MM14 cells as determined by an Elk reporter assay (data not shown). Consistent with previous results demonstrating that the signaling cascades stimulating cell proliferation and repressing myogenesis operate independently, cotransfection of expression vectors encoding the dominant negative PKC
and Ha-RasG12V does not inhibit Ha-RasG12V-stimulated Elk1 reporter activity (Fig. 7)(10, 14, 19). Moreover, these data show that, unlike some other cell types, skeletal muscle cells do not require activation of aPKCs for Ha-Ras-dependent ERK1,2 activation. Because signals stimulating myoblast proliferation and repressing terminal differentiation are distinct but are both required to maintain dividing cells, we suspected that proliferative signals may indirectly enhance repression of myogenesis. To test for such an indirect role of cell proliferation, myoblast proliferation was first inhibited by blocking the Raf/MKK1,2/ERK1,2 pathway. In the presence of Ha-RasG12V, addition of U0126 (a MKK1,2 inhibitor) blocked both ERK1,2 activity (Fig. 8a) and cell proliferation (Fig. 8b). Consistent with our previous data showing that inhibition of the Raf/MKK1,2/ERK1,2 pathway does not directly affect myogenesis (14), addition of U0126 had little effect on muscle gene expression in the presence of activated Ha-Ras (Fig. 8c). However, addition of U0126 to cells coexpressing constitutively active Ha-Ras and the dnPKC
mutant synergistically enhanced muscle gene induction (Fig. 8c). In the myoblast fusion assay, the combined effect of UO126 and the dnPKC
was comparable to the results obtained under differentiation conditions (Fig. 8d). These data suggest that activated Ha-Ras represses myogenesis directly via an aPKC-dependent pathway but also indirectly via stimulation of cell proliferation pathways.
|
|
expression vector, an enhancement of myogenesis similar to that observed on inhibition of ERK1,2 was seen (Fig. 9c). These data confirm our hypothesis suggesting that proliferative signals sent via Ha-RasG12V or serum participate to indirectly inhibit myogenesis. When cell proliferation was eliminated, the effect of the dnPKC
or aPKC mutants was dramatically enhanced. Therefore, the direct effect of aPKCs in repressing myogenesis appears to be indirectly modulated by proliferative signals sent via Ha-RasG12V or serum.
|
| DISCUSSION |
|---|
|
|
|---|
In this study we have identified a downstream component of the Ha-Ras signal transduction pathway that represses the differentiation of skeletal muscle cells. Several derivatives of oncogenic Ha-Ras mutants, including Ha-RasG12S35, Ha-RasG12C40, and Ha-RasG12G37 (16, 34), are capable of replacing endogenous FGF-dependent signals and repressing MM14 myoblast differentiation. Therefore, our data suggest that Raf, PI3-K, and Ral are not the downstream Ha-Ras effectors that mediate the repression of myogenic differentiation. Similar results have been previously observed for serum-mediated repression of myogenesis, but the growth factor signaling pathways involved were not identified (22, 26, 27). Interestingly, Ha-RasG12V also stimulates myoblast proliferation (10); however, none of these three Ha-Ras effector mutants, either alone or in combination, are sufficient to stimulate myoblast proliferation (Y. V. Fedorov et al., unpublished observation). Thus, oncogenic Ha-Ras appears to regulate myoblast differentiation and proliferation through multiple, independent signaling pathways. Since recent reports have demonstrated that PKC
and Ha-Ras interact directly with each other, it is possible that aPKCs are direct effectors for Ras (7). In support of the involvement of aPKCs in Ras signaling, PKC
is required for Ha-Ras-dependent maturation of Xenopus oocytes, for serum-activated DNA synthesis in mouse fibroblasts (2, 8), and for Ha-Ras-dependent induction of c-Fos (15).
Here we show that interference with aPKC signaling either by overexpressing a dominant negative mutant of PKC
or PKC
or by treating cells with a pharmaceutical inhibitor of aPKCs abrogates Ha-RasG12V-mediated repression of myogenesis. Together, these data demonstrate that aPKCs are required for Ha-Ras-mediated repression of myogenic differentiation and that the aPKCs function as downstream Ha-Ras effectors in a signaling cascade that represses myogenic differentiation. Although blocking aPKC signaling enhances myogenic differentiation, the extent of differentiation was often less than that observed under differentiation conditions. Since proliferation and terminal differentiation are mutually exclusive events and since we have previously shown that Ha-RasG12V promotes MM14 cell proliferation, we asked if proliferation signals indirectly repressed myogenesis. Two independent methods were used to block cell proliferation: inhibition of the Raf/MKK1,2/ERK1,2 pathway and reduction of the serum concentration. Although inhibition of the Raf/MKK1,2/MAPK pathway does not stimulate the differentiation of parental or of Ha-RasG12V expressing cells, it does block cell proliferation (14). Surprisingly, we found that inhibition of Ha-Ras/MAP kinase pathways has a synergistic effect on enhancement of the differentiation of MM14 cells when aPKCs are inhibited. Similarly, inhibition of cell proliferation by reducing the serum concentration from 15 to 2.5% also synergistically enhanced myogenesis when aPKCs were inhibited. These data support a direct role for aPKCs in transducing Ha-Ras signals that repress myogenesis and suggest that proliferative signals can enhance the repression of differentiation only if the direct repressive signals are present. Thus, consistent with our previous results, it is unlikely that ERK1,2 is directly involved in regulating myogenesis since ectopic expression of a dominant negative PKC
mutant had no effect on Ha-RasG12V-mediated increase of ERK1,2 activity. We propose that aPKCs are direct mediators of Ras signals that function to repress myogenic differentiation in proliferating and quiescent cells.
The specific molecular events that regulate proliferation and myogenesis in satellite cells are largely unknown. However, of particular interest is the observation that aPKCs interact directly with the FGF receptor substrate SNT (FRS-2) (20). FGFs are established regulators of myogenesis and are required for the development and maintenance of embryonic myoblasts in vivo (11), for growth of primary mouse myoblasts (21, 28), and for muscle satellite cell viability (unpublished data). These data illustrate that the relationship between aPKC interaction with Ha-Ras and SNTs is complex and may involve multiple downstream pathways. One possible scenario could provide activation of aPKCs by localizing both Ras and an aPKC to FGF receptor 1 via an SNT scaffold following FGF binding. Activation of the aPKCs would then promote their translocation to distinct subcellular compartments, reported to correlate with PKC activation. Consistent with aPKC activation by Ras, we found that ectopic expression of RasG12V stimulated the translocation of PKC
from the cytosol to the nucleus. Although RasG12V stimulated the nuclear localization of PKC
but had no apparent effect on the localization of PKC
, PKC translocation is a dynamic process where both association and dissociation with or from subcellular compartments appears to be important (21). Therefore, the data do not preclude the involvement of either aPKC, and additional experiments are needed to identify which protein is involved in Ras signaling.
We propose that oncogenic Ha-Ras represses differentiation directly through an aPKC-dependent pathway(s) and indirectly through stimulation of cell proliferation. Inhibition of two independent Ha-Ras signaling pathways, one inhibiting differentiation and the second promoting proliferation, is necessary for myoblasts to completely commit to terminal differentiation. Further experimentation is aimed at identifying the aPKC substrates involved and their contribution to repression of myogenesis via FGF-dependent pathways.
| ACKNOWLEDGMENTS |
|---|
This work was supported by a grant from the National Institutes of Health (AR39467) and the Muscular Dystrophy Association to B.B.O.
| FOOTNOTES |
|---|
Present address: Department of Biochemistry and Molecular Genetics, University of Colorado Health Sciences Center, Denver, CO 80262. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Berra, E., M. T. Diaz-Meco, I. Dominguez, M. M. Municio, L. Sanz, J. Lozano, R. S. Chapkin, and J. Moscat. 1993. Protein kinase C zeta isoform is critical for mitogenic signal transduction. Cell 74:555-563.[CrossRef][Medline]
3. Campbell, S. L., R. Khosravi-Far, K. L. Rossman, G. J. Clark, and C. J. Der. 1998. Increasing complexity of Ras signaling. Oncogene 17:1395-1413.[CrossRef][Medline]
4.
Clegg, C. H., T. A. Linkhart, B. B. Olwin, and S. D. Hauschka. 1987. Growth factor control of skeletal muscle differentiation: commitment to terminal differentiation occurs in G1 phase and is repressed by fibroblast growth factor. J. Cell Biol. 105:949-956.
5. Cooper, D. R., J. E. Watson, M. Acevedo-Duncan, R. J. Pollet, M. L. Standaert, and R. V. Farese. 1989. Retention of specific protein kinase C isozymes following chronic phorbol ester treatment in BC3H-1 myocytes. Biochem. Biophys. Res. Commun. 161:327-334.[CrossRef][Medline]
6. Crespo, P., H. Mischak, and J. S. Gutkind. 1995. Overexpression of mammalian protein kinase C-zeta does not affect the growth characteristics of NIH 3T3 cells Biochem. Biophys. Res. Commun. 213:266-272.[CrossRef][Medline]
7.
Diaz-Meco, M. T., J. Lozano, M. M. Municio, E. Berra, S. Frutos, L. Sanz, and J. Moscat. 1994. Evidence for the in vitro and in vivo interaction of Ras with protein kinase C zeta. J. Biol. Chem. 269:31706-31710.
8.
Dominguez, I., M. T. Diaz-Meco, M. M. Municio, E. Berra, A. Garcia de Herreros, M. E. Cornet, L. Sanz, and J. Moscat. 1992. Evidence for a role of protein kinase C zeta subspecies in maturation of Xenopus laevis oocytes. Mol. Cell. Biol. 12:3776-3783.
9.
Fedorov, Y. V., N. C. Jones, and B. B. Olwin. 1998. Regulation of myogenesis by fibroblast growth factors requires beta- gamma subunits of pertussis toxin-sensitive G proteins. Mol. Cell. Biol. 18:5780-5787.
10.
Fedorov, Y. V., R. S. Rosenthal, and B. B. Olwin. 2001. Oncogenic ras-induced proliferation requires autocrine fibroblast growth factor 2 signaling in skeletal muscle cells. J. Cell Biol. 152:1301-1306.
11. Flanagan-Steet, H., K. Hannon, M. J. McAvoy, R. Hullinger, and B. B. Olwin. 2000. Loss of FGF receptor 1 signaling reduces skeletal muscle mass and disrupts myofiber organization in the developing limb. Dev. Biol. 218:21-37.[CrossRef][Medline]
12. Garcia-Paramio, P., Y. Cabrerizo, F. Bornancin, P. J. Parker, D. Toullec, P. Pianetti, H. Coste, P. Bellevergue, T. Grand-Perret, M. Ajakane, V. Baudet, P. Boissin, E. Boursier, F. Loriolle, et al. 1998. The broad specificity of dominant inhibitory protein kinase C mutants infers a common step in phosphorylation. Biochem. J. 333:631-636.
13. Gschwendt, M., S. Dieterich, J. Rennecke, W. Kittstein, H. J. Mueller, F. J. Johannes, G. Bandyopadhyay, M. L. Standaert, U. Kikkawa, Y. Ono, J. Moscat, and R. V. Farese. 1996. Inhibition of protein kinase C mu by various inhibitors. Differentiation from protein kinase c isoenzymes. FEBS Lett. 392:77-80.[CrossRef][Medline]
14. Jones, N. C., Y. V. Fedorov, R. S. Rosenthal, and B. B. Olwin. 2001. ERK1/2 is required for myoblast proliferation but is dispensable for muscle gene expression and cell fusion. J. Cell. Physiol. 186:104-115.[CrossRef][Medline]
15. Kampfer, S., K. Hellbert, A. Villunger, W. Doppler, G. Baier, H. H. Grunicke, F. Uberall, G. Bandyopadhyay, M. L. Standaert, U. Kikkawa, Y. Ono, J. Moscat, and R. V. Farese. 1998. Transcriptional activation of c-fos by oncogenic Ha-Ras in mouse mammary epithelial cells requires the combined activities of PKC-lambda, epsilon and zeta. EMBO J. 17:4046-4055.[CrossRef][Medline]
16. Khosravi-Far, R., M. A. White, J. K. Westwick, P. A. Solski, M. Chrzanowska-Wodnicka, L. Van Aelst, M. H. Wigler, and C. J. Der. 1996. Oncogenic Ras activation of Raf/mitogen-activated protein kinase-independent pathways is sufficient to cause tumorigenic transformation. Mol. Cell. Biol. 16:3923-3933.[Abstract]
17. Konieczny, S. F., B. L. Drobes, S. L. Menke, and E. J. Taparowsky. 1989. Inhibition of myogenic differentiation by the H-ras oncogene is associated with the down regulation of the MyoD1 gene. Oncogene 4:473-481.[Medline]
18. Kudla, A. J., M. L. John, D. F. Bowen-Pope, B. Rainish, and B. B. Olwin. 1995. A requirement for fibroblast growth factor in regulation of skeletal muscle growth and differentiation cannot be replaced by activation of platelet-derived growth factor signaling pathways. Mol. Cell. Biol. 15:3238-3246.[Abstract]
19.
Kudla, A. J., N. C. Jones, R. S. Rosenthal, K. Arthur, K. L. Clase, and B. B. Olwin. 1998. The FGF receptor-1 tyrosine kinase domain regulates myogenesis but is not sufficient to stimulate proliferation. J. Cell Biol. 142:241-250.
20.
Lim, Y. P., B. C. Low, J. Lim, E. S. Wong, and G. R. Guy. 1999. Association of atypical protein kinase C isotypes with the docker protein FRS2 in fibroblast growth factor signaling. J. Biol. Chem. 274:19025-19034.
21. Linkhart, T. A., C. H. Clegg, and S. D. Hauschka. 1980. Control of mouse myoblast commitment to terminal differentiation by mitogens. J. Supramol. Struct. 14:483-498.[CrossRef][Medline]
22. Mitin, N., A. J. Kudla, S. F. Konieczny, and E. J. Taparowsky. 2001. Differential effects of Ras signaling through NFkappaB on skeletal myogenesis. Oncogene 20:1276-1286.[CrossRef][Medline]
23.
Nishizuka, Y., F. Uberall, K. Hellbert, S. Kampfer, K. Maly, A. Villunger, M. Spitaler, J. Mwanjewe, G. Baier-Bitterlich, G. Baier, and H. H. Grunicke. 1992. Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C. Science 258:607-614.
24. Nishizuka, Y., F. Uberall, K. Hellbert, S. Kampfer, K. Maly, A. Villunger, M. Spitaler, J. Mwanjewe, G. Baier-Bitterlich, G. Baier, and H. H. Grunicke. 1995. Protein kinase C and lipid signaling for sustained cellular responses. FASEB J. 9:484-496.[Abstract]
25.
Olson, E. N., G. Spizz, and M. A. Tainsky. 1987. The oncogenic forms of N-ras or H-ras prevent skeletal myoblast differentiation. Mol. Cell. Biol. 7:2104-2111.
26. Ramocki, M. B., S. E. Johnson, M. A. White, C. L. Ashendel, S. F. Konieczny, and E. J. Taparowsky. 1997. Signaling through mitogen-activated protein kinase and Rac/Rho does not duplicate the effects of activated Ras on skeletal myogenesis. Mol. Cell. Biol. 17:3547-3555.[Abstract]
27.
Ramocki, M. B., M. A. White, S. F. Konieczny, and E. J. Taparowsky. 1998. A role for RalGDS and a novel Ras effector in the Ras-mediated inhibition of skeletal myogenesis. J. Biol. Chem. 273:17696-17701.
28. Rando, T. A., and H. M. Blau. 1994. Primary mouse myoblast purification, characterization, and transplantation for cell-mediated gene therapy J. Cell Biol. 125:1275-1287.
29. Sanes, J. R., J. L. Rubenstein, J. F. Nicolas, G. Bandyopadhyay, M. L. Standaert, U. Kikkawa, Y. Ono, J. Moscat, and R. V. Farese. 1986. Use of a recombinant retrovirus to study post-implantation cell lineage in mouse embryos. EMBO J. 5:3133-3142.[Medline]
30.
Stratton, M. R., C. Fisher, B. A. Gusterson, and C. S. Cooper. 1989. Detection of point mutations in N-ras and K-ras genes of human embryonal rhabdomyosarcomas using oligonucleotide probes and the polymerase chain reaction. Cancer Res. 49:6324-6327.
31. Toker, A., F. Uberall, K. Hellbert, S. Kampfer, K. Maly, A. Villunger, M. Spitaler, J. Mwanjewe, G. Baier-Bitterlich, G. Baier, and H. H. Grunicke. 1998. Signaling through protein kinase C. Front. Biosci. 3:D1134-D1147.[Medline]
32.
Toullec, D., P. Pianetti, H. Coste, P. Bellevergue, T. Grand-Perret, M. Ajakane, V. Baudet, P. Boissin, E. Boursier, F. Loriolle, et al. 1991. The bisindolylmaleimide GF 109203X is a potent and selective inhibitor of protein kinase C. J. Biol. Chem. 266:15771-15781.
33.
Uberall, F., K. Hellbert, S. Kampfer, K. Maly, A. Villunger, M. Spitaler, J. Mwanjewe, G. Baier-Bitterlich, G. Baier, and H. H. Grunicke. 1999. Evidence that atypical protein kinase C-lambda and atypical protein kinase C-zeta participate in Ras-mediated reorganization of the F-actin cytoskeleton. J. Cell Biol. 144:413-425.
34. White, M. A., C. Nicolette, A. Minden, A. Polverino, L. Van Aelst, M. Karin, and M. H. Wigler. 1995. Multiple Ras functions can contribute to mammalian cell transformation. Cell 80:533-541.[CrossRef][Medline]
35.
Xu, S., and M. H. Cobb. 1997. MEKK1 binds directly to the c-Jun N-terminal kinases/stress-activated protein kinases. J. Biol. Chem. 272:32056-32060.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|