Previous Article | Next Article ![]()
Molecular and Cellular Biology, March 2002, p. 1317-1328, Vol. 22, No. 5
0270-7306/02/$04.00+0 DOI: 10.1128/MCB.22.5.1317-1328.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Albert Einstein College of Medicine, Bronx, New York 10461
Received 31 July 2001/ Returned for modification 7 September 2001/ Accepted 28 November 2001
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Bone morphogenetic proteins (BMPs) expressed after MBT influence the development of all three germ layers, and antagonism of BMP signaling is now recognized as a dominant feature of mesoderm and ectoderm patterning (12, 16, 20). Experiments inhibiting zygotic BMP function by ectopic expression of chordin, noggin, gremlin, or Wnt8 (2, 12, 30, 38) have demonstrated the critical role of BMPs in the development of ventral mesoderm and ectoderm during gastrulation. In presumptive ectoderm, BMPs activate expression of an epidermal differentiation program; in their absence, neural-system-specific transcription factors are expressed (49, 50). The phenotype of the mouse null mutation confirms that BMP4 is required for mesoderm development (51), although early embryonic lethality and potential compensation by related family members limit interpretation of the phenotype. How maternal components associated with the BMP pathway contribute to organizing the body plan and regulating cell survival remains entirely unclear, although it is expected that Smad proteins play a role in mediating the BMP signal.
The Smad proteins are intermediate signaling factors that function downstream of the transforming growth factor beta (TGF-ß), activin, and BMP receptors (8, 24). Smad activity is intricately regulated through further interactions with a large number of embryonic signaling pathways (52). Studies with Xenopus laevis and zebrafish show nonlocalized transcripts and proteins encoding Smad1, -2, -3, and -5 in unfertilized eggs, and expression patterns remain ubiquitous during early stages of development (9, 32). However, Smad activity is thought to be controlled primarily by posttranslational mechanisms. Smads of the receptor-associated subclass are phosphorylated; Smad2 and -3 are phosphorylated following activin stimulation, and Smad1, -5, and -8 are phosphorylated in response to BMPs (4, 17).
The normal function of Smad8 has not been reported previously. However, the mammalian Smad8 proteins are phosphorylated by constitutively active forms of ALK-2, ALK-3, and ALK-6 (7, 26), which are all type I serine/threonine kinase receptors associated with BMP signaling. Like Smad1 and Smad5, Smad8 associates with Smad4 following BMP-stimulated phosphorylation and activates transcription of BMP-responsive reporter genes (26, 57). Due to a lack of further information, the early embryonic functions of Smad1, -5, and -8 have been considered to be largely redundant with respect to ventral mesoderm patterning. We isolated the Xenopus cDNAs encoding the proteins most closely related to mammalian Smad8, one of which has since been submitted to GenBank as Xenopus Smad11 (14). Here we present a functional analysis of the endogenous activity. We show that depletion of maternal transcripts encoding xSmad8(11) activates programmed cell death at EGT, in addition to affecting ectoderm development and gastrulation. Our data indicate that Smad8(11) is a mediator of the maternally derived regulatory pathway that inhibits apoptosis prior to establishment of normal cellular checkpoints.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Misexpression and antisense techniques. The dominant-negative xSmad1 and xSmad8A constructs were generated by PCR, based on the same mutation characterized for mSmad8 (26), and the mutations were confirmed by sequencing. Full-length or mutant cDNAs were subcloned into the pCS2+ expression vector. The xSmad1 cDNA was kindly provided by G. Thomsen. Each of the cDNA constructs was linearized and used to synthesize capped mRNAs in vitro by using the mMessage mMachine kit (Ambion). RNA integrity and concentration were confirmed by gel electrophoresis and by in vitro translation. Fertilized eggs were injected with 2.3 ng of purified mRNA at the 1-cell stage; control embryos were injected either with equivalent volumes of water, with an irrelevant control RNA that does not encode functional protein, or with an mRNA encoding ß-galactosidase (each control yielded normal embryos).
The host transfer technique was used essentially as described previously (61) to eliminate maternal xSmad8(11) transcripts. Each oligomer was diluted in water, and 4.6 nl was injected into the cytoplasm of each oocyte above the grayish equatorial line. Several oocytes were always removed to confirm successful and specific depletion of xSmad8(11) mRNA by RT-PCR analysis. Embryos were staged as described previously (35). For rescue experiments, 1 ng of xSmad8A or xSmad1 mRNA was injected into fertilized eggs derived from the oligomer-injected oocytes.
The sequences of the antisense oligomers (5' to 3') are as follows: oligomer 1, GGGGACGAAGAAGAAAAATGGGCAGAGAAAG (TE643); oligomer 2, GGCGTGCATTGGATTTGCTGTGTCTACC (TE658); oligomer 3, AGTCCACCGCTTTCTCTGCCCATTT (TE637); oligomer 4, GGTTGCCCTGGACAACTTAAAGCC (TE629); oligomer 5, CAAACCCGGCAATAGATGACATGGGAG (TE659); oligomer 6, GGCATTAGTGGTTCATTATTCAGCGAGGTG (TE644); oligomer 7, TGCATTGTGTGGCATTAGTGGTT (TE625); oligomer 8, CGTCTCTGTGATCTGGTAC (TE680); oligomer 9, GACAGAACACCAATGCAA (TE687); oligomer 10, GCGGGTGTTTTCAATAGTG (TE649); oligomer 11, CTGGGCAAATAGTTGGT (TE682); and oligomer 12, AGAGTTTACGATACGGAAGAGATTGGAT (TE650).
Gene expression analysis by semiquantitive RT-PCR and whole-mount in situ hybridization. Oocytes and embryos were homogenized in RNA extraction buffer (50 mM Tris-HCl [pH 7.4], 100 mM NaCl, 30 mM EDTA, 1% sodium dodecyl sulfate, and 1 mg of proteinase K/ml) and were incubated at 37°C for 1 h. After phenol-chloroform extraction, nucleic acids were digested with 1 U of RQ1 DNase (Promega) at 37°C for 3 h. Typically, 0.25, 0.50, or 1.00 µg was used to synthesize cDNA at 37°C for 3 h in the presence of Moloney murine leukemia virus reverse transcriptase (Gibco BRL) and p(dN)6 random primers. PCR was performed by using Z-Taq (Panvia/Takara Shuzo Co.), and products were analyzed to confirm the semiquantitative nature of the assay (dependent on cycle number). For xSmad8(11) PCR, denaturing was carried out at 94°C for 30 s, with annealing at 68°C for 30 s and extension at 72°C for 90 s. Under these conditions, PCR products were generated with a linear response to both cycle number and input RNA (29 cycles). The primers used for this study were designed to flank the positions of antisense oligomers; for xSmad8(11), the forward primer (TE643) was GGGACGAAGAAGAAAAATGGGCAGAGAAAG and the reverse primer (TE645) was TCCAATGTGTCTGCGGGTGTTTTCAATAGT. As a control for specificity, samples were also monitored for levels of xSmad1 with annealing at 59°C (28 cycles). For xSmad1, the forward primer (TE718) was GTCTTGCCACCTGTCCTTGTTCCAC and the reverse primer (TE719) was CGAGACCGAGGAGATGGGATTATGG. Other primer sequences are described in the Xenopus Molecular Marker Resource (http://vize222.zo.utexas.edu/Marker_pages/primers.html) or in the reference given in parentheses after the primer name, as follows: xGATA-2 (58), xVent-1 (15), xVent-2 (37), xChordin (39), and xSox17-ß (22).
For analysis by whole-mount in situ hybridization, albino embryos were fixed as described previously (3) at 4°C overnight and were rehydrated in 100% ethanol. An antisense probe for xSmad8A incorporating digoxigenin-UTP was prepared by in vitro transcription and used to analyze transcript patterns as described previously (3). Based on the pattern in whole-mount and Northern blotting experiments, the probe does not cross-react with transcripts encoding related Smads including xSmad1. BM-purple alkaline phosphatase substrate (Boehringer Mannheim) replaced nitroblue tetrazolium (NBT)/5-bromo-4-chloro-3-indolylphosphate (BCIP) as a substrate for color development. Control sense strand probes did not generate detectable signals.
Histology, terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL) staining, and caspase assays. Embryos were fixed in MEMFA buffer (0.1 M MOPS [pH 7.4], 2 mM EGTA, 1 mM MgSO4, and 3.7% formaldehyde) containing 0.025% glutaraldehyde for 30 min at room temperature. The samples were rehydrated through a graded series of ethanol, cleared in xylene for 1 h, and embedded in Paraplast (Oxford) at 60°C. Sections were cut at 10 µm and placed on glass slides. After being deparaffinized in xylene twice for 2 min, they were rehydrated in a graded ethanol series, stained in Harris modified hematoxylin (Fisher Scientific) for 1 min, and counterstained in 0.5% eosin Y for 1 min.
Whole-mount TUNEL staining of Xenopus embryos was carried out as described previously (18), except that BM-purple AP substrate (Boehringer Mannheim) replaced NBT/BCIP. As a positive control, 60 pg of
-amanitin was injected into both blastomeres of 2-cell-stage embryos (18, 41). After the TUNEL reaction, 14-µm sections were cut and placed on slides. Caspase assays were performed by using the fluorometric-based CaspACE Assay System (Promega) according to the manufacturer's directions. Embryos derived from control or antisense oligonucleotide-injected oocytes were collected following host transfer and fertilization and were lysed at stage 10.5 in hypotonic buffer by freeze-thawing. Protein concentrations were determined (Bio-Rad), and equal amounts of total protein were used, with a 96-well format, to measure interleukin-1ß-converting enzyme/caspase 1 or CPP32/caspase 3 activity in the absence or presence of specific inhibitors. Specific activities for each caspase subclass were calculated by comparison to standard calibration curves.
Nucleotide sequence accession number The sequences for xSmad8A, xSmad8B, and xSmad8C have been submitted to GenBank under accession no. AF464927, AF464928, and AF464929, respectively.
| RESULTS |
|---|
|
|
|---|
The predicted protein encoded by the xSmad8(11) cDNA is shown, in comparison to related Smad proteins, in Fig. 1A (only the Smad8A variant is shown; the GenBank sequence for Smad11 is essentially identical to the Smad8B sequence). The sequence is 466 amino acids, including a carboxyl SSVS motif, identical to that in other BMP-associated Smad family members. Within the linker region between the conserved MH1 and MH2 domains, there is a 34-amino-acid stretch that is missing in the reported rodent Smad8 proteins, although a related sequence is present in Smad1 and Smad5 from other species. Indeed, two human Smad8 cDNAs have been reported, one of which (hSmad8a) contains this linker sequence (48), apparently from differential splicing. The Xenopus protein is 88% identical to human Smad8a and clearly falls into the BMP subclass of receptor-regulated Smad proteins (Fig. 1B).
|
|
Smad8(11) does not have the ventralizing activity of Smad1. We used misexpression experiments in an attempt to gain insight into potential functions for Smad8(11). For this purpose, mRNA was transcribed in vitro and injected into fertilized eggs, and the embryos were allowed to develop to tadpole stages. The forced expression of xSmad8(11) failed to generate any obvious developmental abnormality, even when embryos were injected with relatively high levels of mRNA (1 to 5 ng) or when the mRNA was targeted to specific blastomeres at the 2- to 4-cell stages. The injected embryos appeared identical to control embryos injected with H2O or the same amount of an irrelevant mRNA (Fig. 3; compare Control and Smad8). This was somewhat surprising given the strong ventralized phenotype that is elicited by injection of mRNA encoding the closely related xSmad1 (Fig. 3). This negative result suggests that Smad8(11) does not contribute to regulating the specification of the ventral axis and is distinct in activity from Smad1 (noted also as "data not shown" by Fortuno et al. [14]).
|
) or with more subtle axis defects. In striking contrast, the mutant xSmad8(11) protein never caused overt axis defects, although it did generate a defect in gastrulation instead. In repeated experiments, approximately half the embryos expressing mutant xSmad8(11) failed to complete gastrulation, resulting in embryos with open dorsal structures at the posterior end, often associated with a bifid tail structure. Although we did not investigate the phenotype further, we believe it is specific, since it was not seen in cohorts of embryos injected with control, xSmad1, xSmad8(11), or mutant xSmad1 mRNAs. We conclude that, at least under conditions of forced expression, xSmad8(11) is not associated with the Smad1-related embryonic pathways that control ventral axis development. Depletion of maternal xSmad8 mRNA disrupts gastrulation and activates cell death. To analyze the normal function of Smad8(11) during early embryogenesis, we used the host transfer technique (61) to eliminate maternal xSmad8(11) mRNA. Briefly, isolated oocytes were injected with antisense oligomers and cultured to facilitate degradation of targeted mRNA. The oocytes were then matured in vitro, labeled for identification with vital dyes, and transferred into an egg-laying host female. Mature eggs were collected and fertilized in vitro. The sequences used for designing antisense oligonucleotides to target the maternal message are indicated in Fig. 1A. Of an initial set of 12 oligomers (including 1 control sense strand oligomer, oligomer 1), several effectively depleted maternal xSmad8 mRNA in cultured oocytes (Fig. 4A). As a control for specificity, transcript levels were also measured for xODC (a housekeeping gene) and xSmad1 [the xSmad gene that is most closely related to xSmad8(11)]. Oligomers that targeted xSmad8(11) were then synthesized with phosphorothioate modifications (PM). These oligomers were also effective at specifically depleting maternal xSmad8(11) mRNA (Fig. 4B). As shown in Fig. 4C, injection of PM oligomer 3 leads to degradation of xSmad8(11) mRNA, but not of xODC or xSmad1 mRNA, in a dose-dependent manner.
|
|
The results, compiled and presented graphically in Fig. 6, are consistent with a dose-dependent relationship of the phenotype. When either 7 or 3.5 ng of an antisense oligomer was injected, 100% of the embryos developed as either type I or type II mutants. At lower doses, the percentage of type I embryos decreased while the number of normal class embryos increased. Most importantly, subsequent coinjection of the mRNA-depleted embryos with in vitro-generated xSmad8(11) mRNA rescued the phenotype, while injection of xSmad1 mRNA, encoding the most closely related subfamily member, failed to rescue. Rescue by xSmad8(11) was progressively more effective when embryos were derived from oocytes injected with smaller amounts of antisense oligomers. In some experiments we found 100% rescue to normal development, although this was not always achieved with respect to the type II phenotype, which limits our ability to interpret this as a Smad8(11)-specific phenotype. In order to test if the C-terminal sequence that is a target for phosphorylation is required for xSmad8 function, we attempted to rescue xSmad8-depleted embryos by subsequent injection of xSmad8
mRNA. The mutant mRNA failed to rescue the cell death phenotype (see Fig. 6). When 1.8 ng of antisense oligomer 3 was used to deplete xSmad8 mRNA, the cell death phenotype occurred in 24% of the injected embryos, 0% of the embryos subsequently injected with xSmad8 mRNA, and 32% of the embryos subsequently injected with xSmad8
RNA.
|
Maternal xSmad8(11) regulates expression of genes in early ectoderm.
Semiquantitative RT-PCR assays were used to analyze the expression of differentiation markers in xSmad8(11)-depleted embryos compared to normal embryos (Fig. 7A). Because type I mutant embryos die, RNA was isolated from normal or type II mutant embryos at stages 9 to 12. The only consistent difference we found was for the transcription of ectoderm markers. Both neural (NCAM) and epidermal (keratin) transcript levels were decreased in xSmad8(11)-depleted embryos. Levels for xGATA-2, normally expressed in ectoderm and ventral mesoderm, were also reduced significantly. In contrast, mesoderm-specific genes were expressed, although the post-MBT increase in zygotic transcript levels was uniformly delayed relative to that for normal embryos (seen also for EF-1
and xBra levels, which are activated only beginning at MBT). No differences were found in expression of the endoderm marker xSox17-ß. Similar decreases in expression of ectoderm markers were found when type II embryos were analyzed at stage 17, and this was rescued by subsequent xSmad8 injection (Fig. 7B). Consistent with the gene expression analysis, histological analysis of surviving type II embryos showed differentiated mesoderm tissues and normal-appearing endoderm but not obvious differentiated neural structures (data not shown).
|
-amanitin has been used to demonstrate an embryonic program of cell survival that requires zygotic transcription (18, 41). TUNEL-positive embryos derived from
-amanitin injection began to collapse during gastrulation (stage 10.5 through 11-), like xSmad8(11)-depleted embryos. However, the sites that initiate apoptosis are different, since apoptotic cells were seen only below the surface monolayer of ectoderm in
-amanitin-treated embryos (Fig. 8Bi). In contrast, xSmad8-depleted embryos had TUNEL-positive cells in both inner and outer layers (Fig. 8Bii). To determine if apoptosis initiates prior to cell disaggregation, xSmad8(11)-depleted embryos were analyzed immediately after control embryos reached stage 10, before any overt phenotype manifested. The depleted embryos maintained apparently normal structure and cell layer associations at this stage. Nevertheless, TUNEL-positive cells were located in a wide distribution around these embryos, and apoptotic cells could be identified within presumptive ectoderm comprising three to four cell layers (Fig. 8Cii). In addition, TUNEL-positive cells were found in the marginal zone prior to blastocoel collapse or the appearance of dissociated cells. The results are consistent with a primary defect in cell survival rather than a cell adhesion defect that promotes apoptosis.
|
|
Maternal xSmad8(11) activity is essential for normal embryogenesis.
Maternal xSmad8(11) is required to mediate cell survival and morphological movements through early gastrula stages. This function is specific to xSmad8(11), as evidenced by the facts that it is rescued only by subsequent injection of this mRNA and that embryos containing closely related and relatively abundant BMP-associated Smads (including Smad1 and perhaps Smad5) fail to compensate for its loss. The total amounts of the Smad1 (5), Smad8, and Smad11 (13) proteins remain nearly constant across all three presumptive germ layers and the dorsal-ventral axis from stage 9 to 10+ (determined by use of an antiserum raised against a fully conserved epitope). Notably, the initial phosphorylation at stages 9 to 10 does not require zygotic transcription (13). Therefore, protein derived from maternal xSmad8(11) mRNA would be activated (phosphorylated) prior to MBT.
Smad8 is believed to mediate BMP signaling, yet the phenotype caused by loss of maternal xSmad8(11) mRNA has not been observed in contexts of disrupted BMP signaling, for example, by using BMP antagonists that promote either a dorsal mesoderm or neural fate. We note that the Smad5 (55) and BMP7 (11) null mutations result in patterned apoptosis of mesenchymal cells later in development, while in some cases, including BMP2 and BMP4 knockouts, abnormal apoptosis may not be ruled out. The BMP4 null mutation (51) did not reveal a function for cell survival, and this may be due in part to difficulties in evaluating maternal functions by mouse knockout approaches. Indeed, the lack of penetrance for the BMP4 null phenotype suggested a developmental function for maternal BMP signaling (51). Likewise, experiments with Xenopus have defined a zygotic function for BMP signaling in ventral mesoderm patterning (25, 43), but these studies did not consider the maternal contribution. It is also possible that currently used inhibitors and antagonists do not specifically target the ligand/receptor combinations that are responsible for regulating xSmad8(11). Given that our limited knowledge is so far restricted mostly to in vitro or ectopic expression experiments, it is also possible that xSmad8(11) has BMP-independent functions. It is clear from this and previous studies that Smads of the 1/5/8/11 subfamily have specific nonredundant embryonic functions at the earliest stages of embryogenesis (6, 10, 46, 55).
Smad8(11) regulates a maternal program that inhibits apoptosis.
The existence of maternal cell survival cues that play out their function at EGT has been suggested from previous experiments (1, 18, 41, 42). This maternal program may be necessary because of the lack during early development of the typical cell cycle-regulated checkpoints. In amphibian development, a fertilized embryo carries out rapid cycles of DNA replication and mitosis (33, 34), controlled by the degradation and synthesis of cyclins A and B (28). The apoptotic response is never elicited prior to stage 10.5, either due to an intrinsic inability to activate a cell death pathway or due to an inhibitor of programmed cell death (18). At MBT the cell cycle lengthens to accommodate checkpoints and zygotic transcription begins. After MBT and until EGT, this maternally encoded program persists and inhibits apoptosis. If embryos are developmentally arrested at EGT by prior treatment with hydroxyurea or cycloheximide, ICE-like caspases are activated and degrade cyclins A1 and B1, leading to apoptosis (42). The early events of apoptosis at the beginning of gastrulation are described as randomly distributed in cells of the animal hemisphere; after EGT, apoptosis is patterned in the developing neural plate (19). Our results indicate that xSmad8(11) is part of a maternal program that regulates cell survival prior to the EGT. This may not be the same pathway that is triggered by treating pre-MBT embryos with DNA synthesis inhibitors, since this induces ICE-like caspases (23, 42). Instead, maternal xSmad8(11) depletion causes apoptosis by activation of CPP32/caspase 3-related enzymes at EGT.
Is this program regulated by BMP signaling? Certainly there is a large body of literature linking BMP signaling with regulation of apoptosis in several contexts, and Smad8 is capable of being activated by BMP signaling (26). The C-terminal phosphorylation target of xSmad8 is required for regulating cell survival, but this only demonstrates the importance of the sequence and is not direct evidence of BMP-mediated regulation. A possible link between BMPs and cell survival comes from studies of a mitogen-activated protein kinase kinase kinase called xTAK1 (54). A kinase-negative xTAK1 mutant protein inhibits ventral mesoderm induction caused by ectopic BMP or Smad1 or -5 (40), and in tissue culture cells, the negative regulatory protein Smad6 can inhibit BMP2-induced activation of TAK1 (27). Forced expression of xTAK1 or of its activator, xTAB1, causes cell death and the dissociation of embryonic cells at the beginning of gastrulation (40); this phenotype is remarkably similar to our type I Smad8(11)-depleted embryos. The ventralizing activity of TAK1 is revealed only if the apoptotic pathway is inhibited, and an inhibitor of apoptosis (XIAP) has been linked to the TAK1/TAB1 complex (53). We were unable to rescue xTAK1-induced apoptosis by coinjection of xSmad8(11) mRNA (data not shown). This does not rule out a connection to BMP signaling, since TAK1 could act downstream of xSmad8, but our data are also consistent with a BMP-independent function for xSmad8. Future experiments will seek to determine if the function of xSmad8 in regulating early embryonic cell survival is controlled by the BMP pathway or represents a BMP-independent function of Smad8.
| ACKNOWLEDGMENTS |
|---|
This work was supported by a grant to T.E. from the NIH (HL56182).
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2.
Baker, J. C., R. S. Beddington, and R. M. Harland. 1999. Wnt signaling in Xenopus embryos inhibits bmp4 expression and activates neural development. Genes Dev. 13:3149-3159.
3. Brivanlou, A. H., and R. M. Harland. 1989. Expression of an engrailed-related protein is induced in the anterior neural ectoderm of early Xenopus embryos. Development 106:611-617.[Abstract]
4. Candia, A. F., T. Watabe, S. H. B. Hawley, D. Onichtchouk, Y. Zhang, R. Derynck, C. Niehrs, and K. W. Y. Cho. 1997. Cellular interpretation of multiple TGF-ß signals: intracellular antagonism between activin/BVg1 and BMP-2/4 signaling mediated by Smads. Development 124:4467-4480.[Abstract]
5. Chang, C., and A. Hemmati-Brivanlou. 2000. A post-mid-blastula transition requirement for TGF-ß signaling in early endodermal specification. Mech. Dev. 90:227-235.[CrossRef][Medline]
6. Chang, H., D. Huylebroeck, K. Verschueren, Q. Guo, M. M. Matzuk, and A. Zwijsen. 1999. Smad5 knockout mice die at mid-gestation due to multiple embryonic and extraembryonic defects. Development 126:1631-1642.[Abstract]
7.
Chen, Y., A. Bhushan, and W. Vale. 1997. Smad8 mediates the signaling of the ALK-2 receptor serine kinase. Proc. Natl. Acad. Sci. USA 94:12938-12943.
8. Derynck, R., Y. Zhang, and X.-H. Feng. 1998. Smads: transcriptional activators of TGF-ß responses. Cell 11:737-740.
9. Dick, A., T. Mayr, H. Bauer, A. Meier, and M. Hammerschmidt. 2000. Cloning and characterization of zebrafish smad2, smad3 and smad4. Gene 246:69-80.[CrossRef][Medline]
10. Dick, A., A. Meier, and M. Hammerschmidt. 1999. Smad1 and Smad5 have distinct roles during dorsoventral patterning of the zebrafish embryo. Dev. Dyn. 216:285-298.[CrossRef][Medline]
11.
Dudley, A. T., R. E. Godin, and E. J. Robertson. 1999. Interaction between FGF and BMP signaling pathways regulates development of metanephric mesenchyme. Genes Dev. 13:1601-1613.
12. Eimon, P. M., and R. M. Harland. 1999. In Xenopus embryos, BMP heterodimers are not required for mesoderm induction, but BMP activity is necessary for dorsal/ventral patterning. Dev. Biol. 216:29-40.[CrossRef][Medline]
13. Faure, S., M. A. Lee, T. Keller, P. ten Dijke, and M. Whitman. 2000. Endogenous patterns of TGF-ß superfamily signaling during early Xenopus development. Development 127:2917-2931.[Abstract]
14. Fortuno, E. S., J. A. LeSueur, and J. M. Graff. 2001. The amino acid terminus of Smads permits transcriptional specificity. Dev. Biol. 230:110-124.[CrossRef][Medline]
15. Gawantka, V., H. Delius, K. Hirschfeld, C. Blumenstock, and C. Niehrs. 1995. Antagonizing the Spemann organizer: role of the homeobox gene Xvent-1. EMBO J. 14:6268-6279.[Medline]
16. Graff, J. M. 1997. Embryonic patterning: to BMP or not to BMP, that is the question. Cell 89:171-174.[CrossRef][Medline]
17. Graff, J. M., A. Bansal, and D. A. Melton. 1996. Xenopus Mad proteins transduce distinct subsets of signals for the TGF-ß superfamily. Cell 85:479-487.[CrossRef][Medline]
18. Hensey, C., and J. Gautier. 1997. A developmental timer that regulates apoptosis at the onset of gastrulation. Mech. Dev. 69:183-195.[CrossRef][Medline]
19. Hensey, C., and J. Gautier. 1998. Programmed cell death during Xenopus development: a spatio-temporal analysis. Dev. Biol. 203:36-48.[CrossRef][Medline]
20.
Hogan, B. L. M. 1996. Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev. 10:1580-1594.
21.
Howe, J. A., M. Howell, T. Hunt, and J. W. Newport. 1995. Identification of a developmental timer regulating the stability of embryonic cyclin A and a new somatic A-type cyclin at gastrulation. Genes Dev. 9:1164-1176.
22.
Hudson, C., D. Clements, R. V. Friday, D. Stott, and H. R. Woodland. 1997. Xsox17
and -ß mediate endoderm formation in Xenopus. Cell 91:397-405.[CrossRef][Medline]
23. Ikegami, R., P. Hunter, and T. D. Yager. 1999. Developmental activation of the capability to undergo checkpoint-induced apoptosis in the early zebrafish embryo. Dev. Biol. 209:409-433.[CrossRef][Medline]
24. Itoh, S., F. Itoh, M. J. Goumans, and P. Ten Dijke. 2000. Signaling of transforming growth factor-beta family members through Smad proteins. Eur. J. Biochem. 267:6954-6967.[Medline]
25. Jones, C. M., L. Dale, B. L. M. Hogan, C. V. E. Wright, and J. C. Smith. 1996. Bone morphogenetic protein-4 (BMP-4) acts during gastrula stages to cause ventralization of Xenopus embryos. Development 122:1545-1554.[Abstract]
26. Kawai, S., C. Faucheu, S. Gallea, S. Spinella-Jaegle, A. Atfi, R. Baron, and S. R. Roman. 2000. Mouse smad8 phosphorylation downstream of BMP receptors ALK-2, ALK-3, and ALK-6 induces its association with Smad4 and transcriptional activity. Biochem. Biophys. Res. Commun. 271:682-687.[CrossRef][Medline]
27.
Kimura, N., R. Matsuo, H. Shibuya, K. Nakashima, and T. Taga. 2000. BMP2-induced apoptosis is mediated by activation of the TAK1-p38 kinase pathway that is negatively regulated by Smad6. J. Biol. Chem. 275:17647-17652.
28. King, R. W., P. K. Jackson, and M. W. Kirschner. 1994. Mitosis in transition. Cell 79:563-571.[CrossRef][Medline]
29. Kofron, M., T. Demel, J. Xanthos, J. Lohr, B. Sun, H. Sive, S. Osada, C. Wright, C. Wylie, and J. Heasman. 1999. Mesoderm induction in Xenopus is a zygotic event regulated by maternal VegT via TGF-ß growth factors. Development 126:5759-5770.[Abstract]
30. Larrain, J., D. Bachiller, B. Lu, E. Agius, S. Piccolo, and E. M. De Robertis. 2000. BMP-binding modules in chordin: a model for signalling regulation in the extracellular space. Development 127:821-830.[Abstract]
31.
Miller, J. R., B. A. Rowning, C. A. Larabell, J. A. Yang-Snyder, R. L. Bates, and R. T. Moon. 1999. Establishment of the dorsal-ventral axis in Xenopus embryos coincides with the dorsal enrichment of dishevelled that is dependent on cortical rotation. J. Cell Biol. 146:427-437.
32. Muller, F., P. Blader, S. Rastegar, N. Fischer, W. Knochel, and U. Strahle. 1999. Characterization of zebrafish smad1, smad2 and smad5: the amino-terminus of smad1 and smad5 is required for specific function in the embryo. Mech. Dev. 88:73-88.[CrossRef][Medline]
33. Newport, J., and M. Kirschner. 1982. A major developmental transition in early Xenopus embryos. I. Characterization and timing of cellular changes at the midblastula stage. Cell 30:675-686.[CrossRef][Medline]
34. Newport, J., and M. Kirschner. 1982. A major developmental transition in early Xenopus embryos. II. Control of the onset of transcription. Cell 30:687-696.[CrossRef][Medline]
35. Nieuwkoop, P. D., and J. Faber. 1967. Normal table of Xenopus laevis (Daudin). North-Holland Publishing Co., Amsterdam, The Netherlands.
36. Nishita, M., N. Ueno, and H. Shibuya. 1999. Smad8B, a Smad8 splice variant lacking the SSXS site that inhibits Smad8-mediated signalling. Genes Cells 4:583-591.[Abstract]
37. Onichtchouk, D., V. Gawantka, R. Dosch, H. Delius, K. Hirschfeld, C. Blumenstock, and C. Niehrs. 1996. The Xvent-2 homeobox gene is part of the BMP-4 signalling pathway controlling dorsoventral patterning of Xenopus mesoderm. Development 122:3045-3053.[Abstract]
38. Sasai, Y., B. Lu, H. Steinbeisser, and E. M. De Robertis. 1995. Regulation of neural induction by the Chd and Bmp-4 antagonistic patterning signals in Xenopus. Nature 376:333-336.[CrossRef][Medline]
39. Sasai, Y., B. Lu, H. Steinbeisser, D. Geissert, L. K. Gont, and E. M. De Robertis. 1994. Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79:779-790.[CrossRef][Medline]
40. Shibuya, H., H. Iwata, N. Masuyama, Y. Gotoh, K. Yamaguchi, K. Irie, K. Matsumoto, E. Nishida, and N. Ueno. 1998. Role of TAK1 and TAB1 in BMP signaling in early Xenopus development. EMBO J. 17:1019-1028.[CrossRef][Medline]
41. Sible, J. C., J. A. Anderson, A. L. Lewellyn, and J. L. Maller. 1997. Zygotic transcription is required to block a maternal program of apoptosis in Xenopus embryos. Dev. Biol. 189:335-346.[CrossRef][Medline]
42. Stack, J. H., and J. W. Newport. 1997. Developmentally regulated activation of apoptosis early in Xenopus gastrulation results in cyclin A degradation during interphase of the cell cycle. Development 124:3185-3195.[Abstract]
43. Steinbeisser, H., A. Fainsod, C. Niehrs, Y. Sasai, and E. M. De Robertis. 1995. The role of gsc and BMP-4 in dorsal-ventral patterning of the marginal zone in Xenopus: a loss-of-function study using antisense RNA. EMBO J. 14:5230-5243.[Medline]
44. Suzuki, A., C. Chang, J. M. Yingling, X.-F. Wang, and A. Hemmati-Brivanlou. 1997. Smad5 induces ventral fates in Xenopus embryos. Dev. Biol. 184:402-405.[CrossRef][Medline]
45. Thomsen, G. H. 1996. Xenopus mothers against decapentaplegic is an embryonic ventralizing agent that acts downstream of the BMP-2/4 receptor. Development 122:2359-2366.[Abstract]
46.
Tremblay, K. D., N. R. Dunn, and E. J. Robertson. 2001. Mouse embryos lacking Smad1 signals display defects in extra-embryonic tissues and germ cell formation. Development 128:3609-3621.
47. Wallingford, J. B., B. A. Rowning, K. M. Vogeli, U. Rothbacher, S. E. Fraser, and R. M. Harland. 2000. Dishevelled controls cell polarity during Xenopus gastrulation. Nature 405:81-85.[CrossRef][Medline]
48. Watanabe, T. K., M. Suzuki, Y. Omori, H. Hishigaki, M. Horie, N. Kanemoto, T. Fujiwara, Y. Nakamura, and E. Takahashi. 1997. Cloning and characterization of a novel member of the human Mad gene family (MADH6). Genomics 42:446-451.[CrossRef][Medline]
49. Wilson, P. A., and A. Hemmati-Brivanlou. 1995. Induction of epidermis and inhibition of neural fate by Bmp-4. Nature 376:331-333.[CrossRef][Medline]
50. Wilson, P. A., G. Lagna, A. Suzuki, and A. Hemmati-Brivanlou. 1997. Concentration-dependent patterning of the Xenopus ectoderm by BMP4 and its signal transducer Smad1. Development 124:3177-3184.[Abstract]
51.
Winnier, G., M. Blessing, P. A. Labosky, and B. L. Hogan. 1995. Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse. Genes Dev. 9:2105-2116.
52. Wrana, J. L. 2000. Regulation of Smad activity. Cell 100:189-192.[CrossRef][Medline]
53. Yamaguchi, K., S. Nagai, J. Ninomiya-Tsuji, M. Nishita, K. Tamai, K. Irie, N. Ueno, E. Nishida, H. Shibuya, and K. Matsumoto. 1999. XIAP, a cellular member of the inhibitor of apoptosis protein family, links the receptors to TAB1-TAK1 in the BMP signaling pathway. EMBO J. 18:179-187.[CrossRef][Medline]
54.
Yamaguchi, K., K. Shirakabe, H. Shibuya, K. Irie, I. Oishi, N. Ueno, T. Taniguchi, E. Nishida, and K. Matsumoto. 1995. Identification of a member of the MAPKKK family as a potential mediator of TGF-ß signal transduction. Science 270:2008-2011.
55. Yang, X., L. H. Castilla, X. Xu, C. Li, J. Gotay, M. Weinstein, P. P. Liu, and C. X. Deng. 1999. Angiogenesis defects and mesenchymal apoptosis in mice lacking SMAD5. Development 126:1571-1580.[Abstract]
56. Yisraeli, J. K., and D. A. Melton. 1988. The material mRNA Vg1 is correctly localized following injection into Xenopus oocytes. Nature 336:592-595.[CrossRef][Medline]
57. Yoshida, Y., S. Tanaka, H. Umemori, O. Minowa, M. Usui, N. Ikematsu, E. Hosoda, T. Imamura, J. Kuno, T. Yamashita, K. Miyazono, M. Noda, T. Noda, and T. Yamamoto. 2000. Negative regulation of BMP/Smad signaling by Tob in osteoblasts. Cell 103:1085-1097.[CrossRef][Medline]
58. Zhang, C., and T. Evans. 1996. BMP-like signals are required after the midblastula transition for blood cell development. Dev. Genet. 18:267-278.[CrossRef][Medline]
59. Zhang, J., D. W. Houston, M. L. King, C. Payne, C. Wylie, and J. Heasman. 1998. The role of maternal VegT in establishing the primary germ layers in Xenopus embryos. Cell 94:515-524.[CrossRef][Medline]
60. Zhu, H., P. Kavsak, S. Abdollah, J. L. Wrana, and G. H. Thomsen. 1999. A SMAD ubiquitin ligase targets the BMP pathway and affects embryonic pattern formation. Nature 400:687-693.[CrossRef][Medline]
61. Zuck, M. V., C. C. Wylie, and J. Heasman. 1999. Studying the function of maternal mRNAs in Xenopus embryos: an antisense approach, p. 341-354. In J. D. Richter (ed.), A comparative methods approach to the study of oocytes and embryos. Oxford University Press, New York, N.Y.
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||