![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Syuzo Kaneko, and James L. Manley*
Department of Biological Sciences, Columbia University, New York, New York 10027
Received 31 October 2001/ Returned for modification 12 December 2001/ Accepted 18 December 2001
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
26 or more repeats. These results are consistent with a scaffolding role for the RNAP II CTD in the pre-mRNA cleavage reaction. |
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Two monofunctional polypeptides could, in principle, be sufficient to carry out the basic enzymatic activities of cleavage and poly(A) synthesis. However, it is now well known that the process of 3'-end formation, in yeast as well as in higher eukaryotes, requires at least 12, undoubtedly reflecting the importance and complexity of its regulation (Fig. 1A) (34). Essentially all of the factors required for the process have been identified and cloned. Two multisubunit proteins, cleavage polyadenylation specificity factor (CPSF), consisting of four subunits, and cleavage stimulation factor (CstF), consisting of three subunits, serve to recognize and define the region surrounding the poly(A) site by binding cooperatively to this region. The CPSF-160 subunit binds specifically to the AAUAAA sequence just upstream of the poly(A) site, while CstF-64 binds a downstream G/U-rich sequence. PAP is also required for the cleavage reaction for most but not all substrates studied thus far and, in cooperation with CPSF, it synthesizes the poly(A) tail. Two other factors, CF I (two subunits) (33) and CF II (two or more subunits) (13) are also required for the cleavage reaction and likely function in precleavage complex assembly and stability. Despite years of detailed study into the function of the various factors and their subunits, the endonuclease itself has not been identified.
|
With the additional complexity of multiprotein processes comes the need for the organization and coordination of the various proteins. In recent years, the CTD has emerged as the factor most likely to play this role in pre-mRNA processing. The CTD has now been shown to be involved not only in cleavage and polyadenylation (17, 25) but also in initiation (20, 36), promoter clearance (11), 5'-end capping (7, 24, 40), and splicing (18, 25). It has become clear that mRNA synthesis and processing are coordinated events (a sort of mRNA factory [25]) and that the CTD is involved at each stage.
The RNAP II CTD is a highly repetitive domain unique among the RNA polymerases (Fig. 1B) (4, 9). In mammals it consists of 52 heptapeptides having the consensus sequence YSPTSPS (Fig. 1B). Of the 52 heptads, only 21 match this sequence exactly, while the remaining 31, occurring mostly in the C-terminal half of the CTD, consist of the related sequence YX2PX4SPX7, where X2, X4, and especially X7 can vary considerably (Fig. 1). While the CTD is essential for viability in cultured rodent (5, 21) and yeast (1, 30, 38) cells, significant numbers of the heptads are dispensable. Studies of partially deleted and rearranged forms of the CTD have shown that a minimum of about 30 heptads are needed for viability in mouse cells, whereas mutants carrying between 31 and 39 heptads exhibit a slow-growth phenotype. These studies also concluded that CTD function depends on both its sequence and its length, and they exemplified the difficulty of separating these variables when assessing the effect of changes made to an imperfectly repetitive domain like the CTD.
The role of the CTD in pre-mRNA 3' cleavage seems likely to be related, at least in part, to the requirement for the CTD in proper transcription and viability. In order to understand which portions of the CTD are responsible for its role in cleavage and, ultimately, to understand how it brings about the cleavage reaction, we made fusion proteins between GST and a series of truncated and deleted mouse CTDs, as well as a series of all-consensus GST-CTD constructs ranging in size from 13 to 52 heptads. Using these with the other general polyadenylation factors, we then assessed the various mutant CTDs for their ability to activate the reconstituted 3' cleavage reaction. These studies have enabled us to evaluate the contributions of the nonconsensus CTD residues and the variable of CTD length—apart from any consideration of sequence—to CTD activity in the cleavage reaction.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Quantitative Western blotting with the anti-CTD antibody 8WG16 (Babco) and the RNAP II O purified from HeLa cells (22) was used to estimate the amount of contaminating RNAP II largest subunit contributed by each of the factor preparations per 12.5-µl reaction volume: CPSF, 0.16 ng; CF I, 0.02 ng; CF I/CF II mixture, 0.1 ng. The sum of these is approximately equal to the amount of exogenous RNAP II largest subunit needed to detectably increase the amount of cleavage over background (e.g., Fig. 1, lane 2). It is therefore reasonable to assume that the background cleavage in our experiments is due to these trace amounts of contaminating RNAP II largest subunit in our factor preparations.
C- and N-terminally deleted GST-CTD fusion proteins.
The C- and N-terminal GST-CTD deletion mutants were prepared by PCR using the original GST-CTD plasmid, pGCTD, as the template (31). In the C-terminal deletion series (Fig. 2A), the forward primer was, in each case 5'-TTGTCTGGATCCGTAGGTGGTGCTATGTC. The reverse primers (5'to 3') were H(1-48) GGTGGGACTGGTGGGCGAG, H(1-44) GACTGGAGAGGTTGGTGAGTA, H(1-37) CTCTGGTGAGCTGGGACTGTA, H(1-35) GGGTGAAGTGGGGCTGTAGCT, H(1-29) CGGAATTCACTGGGTGAGGTTGGGGAATAG, and H(1-21) CGGAATTCGCTTGGAGAAGTTGGTGAGTAG. This last primer was designed to prime at the 20th heptad repeat in order to produce the same number of heptads as H(33-52) but, due to the repetitive nature of the CTD cDNA, was found upon sequencing to have primed at the adjacent heptad 21 instead. In the N-terminal deletion series the reverse primer was, in each case, GGAATTCTTCGCCCTGTTCGC. The forward primers for the N-terminal deletion series were H(24-52) CGGGATCCTATACCCCGACATCACCCAG, H(33-52) CGGGATCCTACACACCAAGCTCACCAAG, and H(41-52) CGGGATCCTATTCTCCTACCAGCCCCAC. PCRs were performed on 10 ng of template DNA in a 50-µl volume using Vent DNA polymerase (New England Biolabs), the supplied buffer, and 0.5 µM concentrations of each primer for 30 cycles of 95°C for 30 s, 62°C for 30 s, and 75°C for 66 s. The products in the C-terminal deletion series were digested with BamHI, agarose gel purified, and ligated into the pGEX-2T plasmid (Amersham Pharmacia) after the plasmid had been cut with BamHI and SmaI and agarose gel purified. In the case of the N-terminal deletion series, the PCR product from H(41-52) was digested with EcoRI and BamHI and ligated into the EcoRI-BamHI-digested pGEXT-2T vector. The two longer N-terminal deletions were prepared differently. First, both the PCR products and pGCTD were separately digested with BamHI and SpeI and gel purified. The PCR fragment was then ligated into the BamHI-SpeI-digested pGCTD fragment. The ligation products were transformed into Escherichia coli DH5
cells. H(1-29), H(1-21), H(24-52), H(33-52), and H(41-52) were sequenced entirely. The other clones were partially sequenced. The plasmids corresponding to the foregoing constructs are designated pH(N-C), where N is the number of the N-terminal heptad and C is the number of the C-terminal heptad. For expression, the strain JM101 was used and the proteins were purified on glutathione-Sepharose and Superose 12 chromatography columns as described elsewhere for GST-CTD (17). The final proteins were checked by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and visualized with silver staining (Fig. 2).
|
, while protein expression was done in JM101. The resulting series of fusion proteins coding for GST-[TSPSYSP]n, where n = 13, 26, 39, or 52, was purified identically to GST-CTD and the deletion mutants described above. The cDNAs for CON 13 and CON 26 were completely sequenced. That of CON 39 was partially sequenced (93%), while only 30% of CON 52 could be read. To verify these sequences, the GST tag of the expressed fusion protein was removed by the PreScission protease (Amersham Pharmacia), and matrix-assisted desorption ionization-time of flight (MALDI-TOF) mass spectrometry was performed on a Perseptive Biosystems Voyager-DE Pro instrument. Values all fell within 0.16% of the calculated molecular weight, verifying that all multimerization junction ligations were in the correct orientation. All cDNAs were of the expected length, and Western blotting with the anti-RNAP II LS CTD antibody 8WG16 gave expected results on the entire series of fusion proteins (results not shown). The CTD is well known for its uncharacteristically slow mobility on SDS-PAGE (42). Substituting consensus for nonconsensus heptads exaggerates this trait.
Internal deletion mutant D30/37. PCR-mediated gene fusion (39) was used to delete heptads 30 through 37 from the wild-type GST-CTD. The portion upstream of the deleted segment was amplified by PCR using the above conditions (with 68°C annealing temperature) from pH(1-35) with the following primers: forward 5'TTGTCTGGATCCGTAGGTGGTGCTATGTC; reverse 5'TTTGGGAGAAGCTGGGGTGTAACTGGGTGAGGTTGGGGAATA. The portion downstream of the deleted segment was amplified from pH(33-52) using the following primers: forward 5'TATTCCCCAACCTCACCCAGTTACACCCCAGCTTCTCCCAAA; reverse 5'GGAATTCTTCGCCCTGTTCGC. The PCR products were mixed, annealed, and amplified with the two extreme upstream and downstream primers, trimmed with BamHI and EcoRI, gel purified, and cloned into the modified pGEX-6P-1 described above. The sequence was verified by partial sequencing (95%, including the new heptad 29-heptad 38 junction) and MALDI-TOF mass spectrometry (within 0.16%) after protease treatment to release the GST tag.
Mutant H(30-37). Heptads 30 to 37 were amplified from pH(24-52) using the following primers: forward 5'CACGCGGATCCTATTCCCCCACCTCACCAAGC; reverse 5'CCGGAATTCTCACTCTGGTGAGCTGGGACTGTA. The resulting fragment was trimmed with BamHI and EcoRI, gel purified, cloned into the modified pGEX-6P-1 as described above, and completely sequenced. Where indicated, GST tag was cleaved as described above.
3' cleavage assays. The 5'-capped, internally 32P-labeled pre-mRNA substrate used in this study was transcribed in vitro from the template plasmid pG3L3-A (35) after digestion with BamHI. Cleavage assays were performed as previously described (17) except for the following differences: 2'-dATP was substituted for 3'-dATP, the final MgCl2 concentration was 0.5 mM, and reactions were incubated for 2 h at 30°C instead of for 1.5 h. The extent of cleavage was quantitated using a Molecular Dynamics phosphorimager. The background-subtracted ratios of the 5' cleavage products to the uncleaved precursor RNA were calculated. Ratios for control reactions employing the cleavage factors alone (no GST-CTD or mutant CTD proteins) were set arbitrarily to one, and all others were reported relative to this value.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To initiate our analysis of CTD requirements for 3' cleavage, we first constructed a series of mouse GST-CTD proteins lacking up to 31 C-terminal or 40 N-terminal CTD heptapeptides [Fig. 2; H(1-N) indicates a GST-CTD protein containing heptads 1-N, inclusive, except in H(1-37) and H(1-35), where the seventh residue in the last heptad is omitted]. Fusion proteins were expressed in E. coli and purified as described above (see Materials and Methods). The shortened forms of the CTD were then compared to full-length GST-CTD with respect to their ability to activate cleavage of the adenovirus L3 substrate with the same factors utilized in Fig. 1C. Two concentrations of CTD fusion proteins were analyzed, one near the high end of the linear range as previously determined with full-length GST-CTD (17) and the other well above this. Figure 3A shows an example of the data obtained at the higher concentration tested.
|
Deletion analysis with the CTD can lead to ambiguous results because each deletion simultaneously changes the two potentially important variables of length and sequence. It is therefore important to control for length when searching for important sequences among the various CTD heptads. As shown in Fig. 2A, H(1-29) and H(24-52) both contain 29 heptads, while H(1-21) and H(33-52) differ by only one consensus repeat, having 21 and 20 heptads, respectively. When the data in Fig. 3B are interpreted among only those mutants having the same or nearly the same numbers of heptads, it becomes clear that heptads in the C-terminal half of the CTD contributed more to cleavage than did those in the N-terminal half, in the context of these shortened CTDs. More precisely, heptads 24 to 52 contributed more than 1 to 29, while heptads 33 to 52 contributed more than 1 to 21. Since heptads 36 to 52 were largely dispensable for cleavage in the context of the C-terminal deletion series, it appeared that heptads in the approximate region of 30 to 37 might have special significance for the cleavage reaction.
Heptads 30 to 37 are slightly more important than other heptads to CTD cleavage activity. To test directly the importance of heptads 30 to 37, these heptads were deleted using PCR-mediated gene fusion (Fig. 4A; see Materials and Methods). This deletion, D30/37, resulted in a CTD of 44 total heptads. The fusion protein H(1-44) also contains 44 heptads and can be used to control for length since, as described above, heptads in its deleted region (45 to 52) have little or no effect on CTD-activated cleavage. In addition, we made another fusion protein, H(30-37), which contains only heptads 30 to 37, to test whether these heptads alone may be sufficient to activate cleavage. As shown in Fig. 4B, deletion of heptads 30 to 37 resulted in loss of about 20% of activity relative to full-length GST-CTD, while H(1-44) led to a loss of only 6%. H(30-37) did not activate cleavage above background, with or without the GST moiety (data not shown; see Materials and Methods). These results demonstrated that, in the context of a CTD shortened to 44 heptapeptide repeats, heptads 30 to 37 are slightly more important to cleavage than others known to be unimportant (i.e., heptads 45 to 52). An examination of heptads 30 to 37 (Fig. 4C) shows that this region of the CTD is notable for its high number of nonconsensus residues at positions 2 and 4 in the heptad repeat, as well as for its Ser 4-Ser 5 dipeptides. Whether or not these contribute to this modest effect is not clear.
|
Construction of an all-consensus CTD to separate the contributions of length and sequence. The lack of conclusive results implicating specific CTD heptads in the cleavage reaction, along with the possibility of heptad redundancy, discouraged us from continuing with a targeted mutational strategy. Instead, we decided to create a nonnatural, full-length CTD consisting entirely of the consensus repeat (CON 52; Fig. 5A). In this way we would be able, in one experiment, to evaluate the aggregate contribution of all nonconsensus residues, and to do so completely independent of the variable of length. We anticipated that there would remain at least some residual activity in such a CTD construct because of the dependence of the cleavage reaction, at least in part, on length. If that proved true, we would then be in a position to evaluate the variable of length independent of sequence by constructing truncated versions of CON 52. As diagrammed in Fig. 5A, in addition to CON 52, we made truncated consensus CTDs of 13 (CON 13), 26 (CON 26), and 39 (CON 39) heptads and expressed each as a GST fusion protein (Fig. 5C).
|
We first tested the full-length all-consensus protein (CON 52) in the reconstituted processing reaction (40 ng per 12.5-µl reaction volume). Strikingly, substituting consensus residues for all of the nonconsensus residues led to only a 20% reduction in cleavage activity compared to the activity of GST-CTD (Fig. 5D). That is, in the context of a CTD of natural length, all nonconsensus residues together account for only 20% of the cleavage-activating property of GST-CTD.
The fact that CON 52 retained almost all of the GST-CTD cleavage activity permitted us to test cleavage as a function of CTD length while keeping sequence constant. We determined the cleavage properties of the all-consensus series at intermediate concentrations (Fig. 6A, 40 ng per 12.5-µl reaction volume; concentrations from 50 to 120 nM) and at a lower, equimolar concentration (Fig. 6B, 5 nM, or 1.7 to 5 ng of GST fusion protein). The results are summarized graphically in Fig. 6C. Progressively reducing the number of consensus heptads from 52 to 13 led to corresponding decreases in cleavage of from 80 to 85% of wild-type GST-CTD activity to 0%. At both low and intermediate concentrations, the largest reduction in activity occurred upon reducing the number of heptads from 39 to 26. This was similar to the trend observed in the natural CTD deletion series (Fig. 3B). At 5 nM CON 26, no cleavage above background was observed, though a small amount could be restored by increasing the concentration approximately 10-fold to 40 ng per reaction mixture. No cleavage activity was observed for CON 13 at either concentration. Consistent with this, no activity was observed (data not shown) for a four-heptad synthetic consensus peptide (19). Therefore, the physical length of the CTD, formed as a consequence of the repeated YSPTSPS motif, accounts for approximately 80% of the in vitro cleavage activity of GST-CTD. We conclude that the principle determinant of CTD activity is length, not sequence, and that a length equivalent to roughly half the full-length mammalian CTD, i.e., about 26 repeats, is required to activate 3' cleavage.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
While most mutational studies of the CTD have been carried out in yeast (1, 30, 38), one detailed study has been done on heptad requirements of the mouse CTD. Corden and coworkers (5) made extensive deletions and rearrangements in the wild-type CTD, attached them to an -amanitin-resistant RNAP II largest subunit, and tested them for their ability to confer amanitin resistance to cultured rat myoblast cells. Although the CTD was found to be essential, a significant number of heptads could be removed without preventing the transfer of amanitin resistance. With respect to total CTD length, it was found that a C-terminally deleted CTD consisting of 36 N-terminal heptads (Del 36-Ter) resulted in wild-type behavior. The minimum number of heptads required for viability was 25, and a gradual loss in the ability to confer the resistant phenotype was found in the range from 36 to 25 heptads. Intriguingly, we found that H(1-35), which is nearly identical to Del 36-Ter, supported nearly full-strength cleavage activity. Furthermore, we also detected intermediate 3' cleavage activity in the same range as they did for viability and a lack of significant activity in CTDs having fewer than 29 heptads. When heptads 23 to 36 were deleted, amanitin resistance was reduced to 64%, while we found mutant D30/37 (44 total heptads) reduced activity similarly, to about 80%. Similar results were obtained in a more recent study by the same group, in which they produced mice homozygous for a 13-heptad deletion from Ser-5, heptad 22 through Thr-4, heptad 36 (21). These mice were viable, but they were smaller than normal and showed a high degree of neonatal lethality. Neither rodent study addressed specific functional roles of the CTD, but rather they assayed the CTD for all its parts essential for viability. Nevertheless, our findings regarding CTD-activated 3' processing are surprisingly similar to the profile of CTD essential requirements found in the two in vivo studies. All three studies indicate that heptads in the region of heptads 23 to 36, while not essential for viability and/or for 3' cleavage, might be especially important, and that a length greater than 26 is necessary. This similarity supports the possibility that the defective mutants analyzed by Corden and colleagues were inactive at least in part due to impaired 3' processing.
Replacing each of the nonconsensus heptads one at a time by their consensus counterparts might be expected to reveal the identity of those heptads having critical importance to the cleavage reaction in the context of a full-length CTD. However, the prospect of functional redundancy among the heptads might render even this thorough an analysis uninterpretable. Mindful of this potential problem, we instead removed all of the nonconsensus residues simultaneously in order to assess their collective importance. The resulting all-consensus CTD, CON 52, showed that the nonconsensus residues contribute 20% of the wild-type cleavage activity in the context of a 52-heptad CTD. This approach completely separated the two variables of CTD length and sequence. The result was surprising not only because it was a relatively small effect but also because it was approximately the same amount lost upon deletion of heptads 30 to 37 (mutant D30/37). In view of the cleavage results with other mutants [H(1-35), H(1-37), and H(24-56)], it is quite possible that wild-type heptads 30 to 37 contain all or nearly all of the nonconsensus heptad contribution to cleavage. Since this effect is small, the most important aspect of the CTD in cleavage must be length.
Recently, using transient-transfection experiments with -amanitin-resistant fusion proteins, Fong and Bentley reported that a mutant CTD consisting of heptads 27 to 52 is as effective as the full-length wild-type CTD at promoting cleavage/polyadenylation of a cotransfected reporter transcript, whereas a CTD containing only heptads 1 to 25 is comparable to having no CTD at all (15). They concluded that the C-terminal half of the CTD is "sufficient to enhance 3' processing," whereas the N-terminal half is not. The results of our initial deletion analysis are largely in agreement with these findings, as H(24-52) produced on average from 72 to 88% of wild-type cleavage activity and H(1-21) and H(1-29) produced almost none. It is reasonable to conclude that the C-terminal half more effectively activates cleavage than the N-terminal half, as assayed by two different systems, when in the context of a CTD truncated to approximately half the natural length. However, the all-consensus series of CTDs permitted us to perform the more relevant experiment where the CTD was kept at its natural length, which revealed that the identity of the C-terminal heptads makes only a minor contribution. We conclude that the unique sequence of the C-terminal half of the wild-type CTD is not necessary for cleavage. For unknown reasons, it appears that the C-terminal half of the CTD assumes greater than normal activity in the context of a CTD artificially shortened to half its natural length. It also may be that it plays a more significant role in the context of intact nuclei, which contain numerous other proteins that may compete for binding the CTD. Nevertheless, our experiments show that the nonconsensus heptads play only a minimal role in the reconstituted cleavage reaction.
It is now known that, in addition to 3' processing, the CTD also participates directly in the other processing events of capping (7, 24, 40), cap methylation (32), and pre-mRNA splicing (18, 25, 41). The role of the CTD in capping has been studied in the most detail. The CTD (24), and in particular the hyperphosphorylated CTD (7), stimulates 5' capping by recruiting the capping enzyme to the nascent transcript. It was later found in vitro that synthetic CTD peptides as short as two heptads bearing a phosphate on Ser-5 can stimulate the capping reaction, while the corresponding Ser-2 phosphorylated peptides could mediate binding without stimulating capping (19). The nonphosphorylated consensus peptides do neither. Thus, in both mammals (19) and yeast (6) the phosphorylated CTD recruits the capping enzyme to the nascent RNA and allosterically stimulates the reaction by increasing the affinity of the capping enzyme for GTP. Our data for the CTD-activated cleavage reaction show both contrasts and similarities to the capping reaction. In contrast to capping, the phosphorylation state of the CTD appears to have no effect on cleavage (17). Also, CTD peptides from 4 to 26 repeats fail to stimulate cleavage. On the other hand, neither process requires the presence of any nonconsensus residues, and increasing numbers of tandem heptads increasingly stimulate both capping (19) and cleavage (this work). In view of the contrasts and length requirement, it is unlikely that the CTD plays an allosteric role in cleavage. Since the endonuclease has not yet been identified, it is impossible to say whether the CTD specifically recruits that activity to the pre-mRNA or participates in the actual catalysis of the cleavage reaction. However, the results of the all-consensus series do rule out the possibility that the nonconsensus residues function catalytically during cleavage.
The CTD has been described as a "landing pad" for factors that process pre-mRNA, because many of these factors have been shown to bind to it. Among the mammalian 3' processing factors, CPSF (25) and CstF (15, 25), which have long been known to bind sequence-specifically to the pre-mRNA itself, bind to the CTD irrespective of its phosphorylation status. In yeast a third factor, PCF IIp, has recently been shown to bind the phospho-CTD (3). The other factors may in turn bind indirectly through these factors. Having such a platform on the polymerase allows the factors to be recruited, even as early as during the initiation process (12), and carried along during transcription elongation, which is postulated to facilitate the channeling of the nascent transcript to the processing machinery (25). The recently reported crystal structure of RNAP II is consistent with this hypothesis (10). Although the CTD is too disordered to be visible, the last discernible residue is located near the RNA exit channel, implying that the CTD is able to survey the nascent RNA as it leaves the enzyme.
Our in vitro cleavage reactions are performed in the absence of transcription and, hence, must reflect a role for the CTD in 3' processing distinct from channeling the nascent transcript, one in which the CTD participates either directly in the cleavage event or indirectly by preparing those factors that do participate directly. One possibility is that the staging area becomes a scaffold on which the factors align in a specific array. This differs from the coordination role described above in that the CTD here is postulated to remain with the factors and the poly(A) sequences (Fig. 1A) rather than depositing the factors on the RNA while passing. This type of role would require a minimum number of heptads to accommodate all of the multisubunit factors along with other non-CTD-binding subunits, and indeed our data indicate that more than 26 heptads are necessary. We speculate that CPSF (perhaps with PAP), CstF, CF I, and CF II all must bind the CTD in order to activate cleavage and that binding to the CTD either enhances the factor-factor interaction or prepares them conformationally to cleave the RNA. A CTD shorter than 26 to 29 heptads, we suggest, cannot sterically accommodate all of the factors simultaneously, and hence cleavage efficiency is reduced. Our results support the idea that the physical size of the CTD platform, or scaffold, is critical for CTD-dependent cleavage activity, apart from a catalytic or allosteric role and, presumably, in addition to a coordinating function. Our data rule out what was at the beginning of this study a realistic and interesting possibility: that the nonconsensus sequences might act to position in the proper alignment those cleavage factors that must occupy the CTD simultaneously. Instead, our results with the all-consensus CTDs indicate that the proper alignment must be coded for within the protein-protein interactions between the factors themselves, and not between the CTD and the factors. One such interaction, between CPSF-160 and Cstf-77 (29), is already known.
Finally, any explanation concerning how the RNAP II largest subunit CTD activates cleavage should also explain how the small molecule creatine phosphate and related phosphoamino acids produce the same 3' processing results in the reconstituted system (16, 17). We can only speculate that creatine phosphate may circumvent the need for the CTD by enhancing the protein-protein recognition among the factors so they can attain an active cleavage complex with the RNA. In any event, the important conclusion from our studies is that all-consensus heptad repeats can suffice for activation of 3' cleavage but that a large number, roughly half the length of the mammalian CTD, is necessary.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by National Institutes of Health grant RO1-GM28983 and a National Research Service Award (5F32AI09655-03) to K.R.
|
FOOTNOTES |
|---|
Present address: Inotek Corporation, Beverly, MA 01915.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Barabino, S. M., and W. Keller. 1999. Last but not least: regulated poly(A) tail formation. Cell 99:9-11.[CrossRef][Medline]
3.
Barilla, D., B. A. Lee, and N. J. Proudfoot. 2001. Cleavage/polyadenylation factor IA associates with the carboxyl-terminal domain of RNA polymerase II in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 98:445-450.
4. Barron-Casella, E., and J. L. Corden. 1992. Conservation of the mammalian RNA polymerase II largest-subunit C-terminal domain. J. Mol. Evol. 35:405-410.
5.
Bartolomei, M. S., N. F. Halden, C. R. Cullen, and J. L. Corden. 1988. Genetic analysis of the repetitive carboxyl-terminal domain of the largest subunit of mouse RNA polymerase II. Mol. Cell. Biol. 8:330-339.
6.
Cho, E. J., C. R. Rodriguez, T. Takagi, and S. Buratowski. 1998. Allosteric interactions between capping enzyme subunits and the RNA polymerase II carboxy-terminal domain. Genes Dev. 12:3482-3487.
7.
Cho, E. J., T. Takagi, C. R. Moore, and S. Buratowski. 1997. mRNA capping enzyme is recruited to the transcription complex by phosphorylation of the RNA polymerase II carboxy-terminal domain. Genes Dev. 11:3319-3326.
8.
Colgan, D. F., and J. L. Manley. 1997. Mechanism and regulation of mRNA polyadenylation. Genes Dev. 11:2755-2766.
9.
Corden, J. L., D. L. Cadena, J. M. Ahearn, Jr., and M. E. Dahmus. 1985. A unique structure at the carboxyl terminus of the largest subunit of eukaryotic RNA polymerase II. Proc. Natl. Acad. Sci. USA 82:7934-7938.
10. Cramer, P., D. A. Bushnell, and R. D. Kornberg. 2001. Structural basis of transcription: RNA polymerase II at 2.8 angstrom resolution. Science 292:1863-1876.
11.
Dahmus, M. E. 1996. Reversible phosphorylation of the C-terminal domain of RNA polymerase II. J. Biol. Chem. 271:19009-19012.
12. Dantonel, J. C., K. G. Murthy, J. L. Manley, and L. Tora. 1997. Transcription factor TFIID recruits factor CPSF for formation of 3' end of mRNA. Nature 389:399-402.[CrossRef][Medline]
13. de Vries, H., U. Ruegsegger, W. Hubner, A. Friedlein, H. Langen, and W. Keller. 2000. Human pre-mRNA cleavage factor II(m) contains homologs of yeast proteins and bridges two other cleavage factors. EMBO J. 19:5895-5904.[CrossRef][Medline]
14.
Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475-1489.
15.
Fong, N., and D. L. Bentley. 2001. Capping, splicing, and 3' processing are independently stimulated by RNA polymerase II: different functions for different segments of the CTD. Genes Dev. 15:1783-1795.
16.
Hirose, Y., and J. L. Manley. 1997. Creatine phosphate, not ATP, is required for 3' end cleavage of mammalian pre-mRNA in vitro. J. Biol. Chem. 272:29636-29642.
17. Hirose, Y., and J. L. Manley. 1998. RNA polymerase II is an essential mRNA polyadenylation factor. Nature 395:93-96.[CrossRef][Medline]
18.
Hirose, Y., R. Tacke, and J. L. Manley. 1999. Phosphorylated RNA polymerase II stimulates pre-mRNA splicing. Genes Dev. 13:1234-1239.
19. Ho, C. K., and S. Shuman. 1999. Distinct roles for CTD Ser-2 and Ser-5 phosphorylation in the recruitment and allosteric activation of mammalian mRNA capping enzyme. Mol. Cell 3:405-411.[CrossRef][Medline]
20.
Liao, S. M., I. C. Taylor, R. E. Kingston, and R. A. Young. 1991. RNA polymerase II carboxy-terminal domain contributes to the response to multiple acidic activators in vitro. Genes Dev. 5:2431-2440.
21. Litingtung, Y., A. M. Lawler, S. M. Sebald, E. Lee, J. D. Gearhart, H. Westphal, and J. L. Corden. 1999. Growth retardation and neonatal lethality in mice with a homozygous deletion in the C-terminal domain of RNA polymerase II. Mol. Gen. Genet. 261:100-105.[CrossRef][Medline]
22.
Lu, H., O. Flores, R. Weinmann, and D. Reinberg. 1991. The nonphosphorylated form of RNA polymerase II preferentially associates with the preinitiation complex. Proc. Natl. Acad. Sci. USA 88:10004-10008.
23. Maquat, L. E., and G. G. Carmichael. 2001. Quality control of mRNA function. Cell 104:173-176.[CrossRef][Medline]
24.
McCracken, S., N. Fong, E. Rosonina, K. Yankulov, G. Brothers, D. Siderovski, A. Hessel, S. Foster, S. Shuman, and D. L. Bentley. 1997. 5'-Capping enzymes are targeted to pre-mRNA by binding to the phosphorylated carboxy-terminal domain of RNA polymerase II. Genes Dev. 11:3306-3318.
25. McCracken, S., N. Fong, K. Yankulov, S. Ballantyne, G. Pan, J. Greenblatt, S. D. Patterson, M. Wickens, and D. L. Bentley. 1997. The C-terminal domain of RNA polymerase II couples mRNA processing to transcription. Nature 385:357-361.[CrossRef][Medline]
26. Minvielle-Sebastia, L., and W. Keller. 1999. mRNA polyadenylation and its coupling to other RNA processing reactions and to transcription. Curr. Opin. Cell Biol. 11:352-357.[CrossRef][Medline]
27. Mitchell, P., and D. Tollervey. 2001. mRNA turnover. Curr. Opin. Cell Biol. 13:320-325.[CrossRef][Medline]
28. Morris, D. P., J. M. Lee, D. E. Sterner, W. J. Brickey, and A. L. Greenleaf. 1997. Assaying CTD kinases in vitro and phosphorylation-modulated properties of RNA polymerase II in vivo. Methods 12:264-275.[CrossRef][Medline]
29.
Murthy, K. G., and J. L. Manley. 1995. The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3'-end formation. Genes Dev. 9:2672-2683.
30. Nonet, M., D. Sweetser, and R. A. Young. 1987. Functional redundancy and structural polymorphism in the large subunit of RNA polymerase II. Cell 50:909-915.[CrossRef][Medline]
31.
Peterson, S. R., A. Dvir, C. W. Anderson, and W. S. Dynan. 1992. DNA binding provides a signal for phosphorylation of the RNA polymerase II heptapeptide repeats. Genes Dev. 6:426-438.
32.
Pillutla, R. C., Z. Yue, E. Maldonado, and A. J. Shatkin. 1998. Recombinant human mRNA cap methyltransferase binds capping enzyme/RNA polymerase IIo complexes. J. Biol. Chem. 273:21443-21446.
33. Ruegsegger, U., D. Blank, and W. Keller. 1998. Human pre-mRNA cleavage factor Im is related to spliceosomal SR proteins and can be reconstituted in vitro from recombinant subunits. Mol. Cell 1:243-253.[CrossRef][Medline]
34. Shatkin, A. J., and J. L. Manley. 2000. The ends of the affair: capping and polyadenylation. Nat. Struct. Biol. 7:838-842.[CrossRef][Medline]
35. Takagaki, Y., L. C. Ryner, and J. L. Manley. 1988. Separation and characterization of a poly(A) polymerase and a cleavage/specificity factor required for pre-mRNA polyadenylation. Cell 52:731-742.[CrossRef][Medline]
36. Thompson, C. M., A. J. Koleske, D. M. Chao, and R. A. Young. 1993. A multisubunit complex associated with the RNA polymerase II CTD and TATA-binding protein in yeast. Cell 73:1361-1375.[CrossRef][Medline]
37. Wahle, E., and U. Ruegsegger. 1999. 3'-End processing of pre-mRNA in eukaryotes. FEMS Microbiol. Rev. 23:277-295.[Medline]
38. West, M. L., and J. L. Corden. 1995. Construction and analysis of yeast RNA polymerase II CTD deletion and substitution mutations. Genetics 140:1223-1233.[Abstract]
39.
Yon, J., and M. Fried. 1989. Precise gene fusion by PCR. Nucleic Acids Res. 17:4895.
40.
Yue, Z., E. Maldonado, R. Pillutla, H. Cho, D. Reinberg, and A. J. Shatkin. 1997. Mammalian capping enzyme complements mutant Saccharomyces cerevisiae lacking mRNA guanylyltransferase and selectively binds the elongating form of RNA polymerase II. Proc. Natl. Acad. Sci. USA 94:12898-12903.
41.
Zeng, C., and S. M. Berget. 2000. Participation of the C-terminal domain of RNA polymerase II in exon definition during pre-mRNA splicing. Mol. Cell. Biol. 20:8290-8301.
42.
Zhang, J., and J. L. Corden. 1991. Phosphorylation causes a conformational change in the carboxyl-terminal domain of the mouse RNA polymerase II largest subunit. J. Biol. Chem. 266:2297-2302.
43.
Zhao, J., L. Hyman, and C. Moore. 1999. Formation of mRNA 3' ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis. Microbiol. Mol. Biol. Rev. 63:405-445.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
