Previous Article | Next Article ![]()
Molecular and Cellular Biology, April 2002, p. 2318-2328, Vol. 22, No. 7
0270-7306/02/$04.00+0 DOI: 10.1128/MCB.22.7.2318-2328.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Wendy Kimber,2 Stephanie Halford,1,
Alisoun Carey,1,
Joshua M. Brickman,3 Anthony Wynshaw-Boris,4 and Peter J. Scambler1*
Molecular Medicine Unit, Institute of Child Health, London WC1N 1EH,1 Centre for Genome Research, University of Edinburgh, Edinburgh EH9 3JQ United Kingdom,3 National Institute on Aging, National Institutes of Health, Baltimore, Maryland 21224,2 Departments of Pediatrics and Medicine, University of California at San Diego School of Medicine, La Jolla, California 92093-06274
Received 30 October 2001/ Returned for modification 26 November 2001/ Accepted 27 December 2001
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Structurally, the N-terminal half of Hira is most similar to Hir1p, and the C-terminal half most similar to Hir2p (31, 35, 36). Hir1p and Hir2p interact with one another and with as-yet-unknown members of a protein complex to mediate cell cycle-dependent transcriptional repression of six of the eight yeast histones (including HTA1-HTB1) via a negative element in the respective promoters (50). Hir1p mutants also have an Spt (suppressor of Ty) phenotype, and Hir1p has been shown to interact functionally with the SPT4, SPT5, and SPT6 gene products and directly with the SPT4 gene product. Recently, biochemical and genetic studies demonstrated that transcription at the HTA1 or HTB1 locus is Swi-Snf dependent via interaction of the Swi-Snf complex and Hir proteins (expression at HTA1 is absent in Snf5 and Snf2 mutants [18]). Hir2 interacts genetically and biochemically with chromatin assembly factor 1 in yeast (27); in humans CAF1p60 is structurally similar to the N terminus of HIRA, with sequence matches at the DNA level, suggesting that they may be derived from an ancestral gene.
The role of Hira in higher eukaryotes is not known, but the protein is localized to the nucleus where a proportion is associated with the nuclear matrix (15). Hira is a target for cdk2/cyclin E phosphorylation, and ectopic expression of Hira can block cells in the S phase of the cell cycle (22). Taken together, existing data suggest that Hira may be involved in cell cycle-dependent transcriptional regulation of a wide range of target genes, possibly acting via altered chromatin structure.
Hira displays a dynamic expression pattern as embryogenesis proceeds. In both mice (59) and chicks (45), expression is seen in postgastrulation stages. At mouse embryonic day 8 (E8) and E9, chick stage 6 to 12, expression is detected in the neuroepithelium, premigratory and migratory neural crest, and head mesenchyme. At E9.5, stages 18 to 23, expression is seen in neural-crest-derived regions of the head and branchial arches and in a number of other tissues, including the somites and forelimb bud.
The chromosomal location, expression, and Pax3 interaction made Hira a good candidate for DiGeorge syndrome (47). However, Hira maps outside targeted deletions of mouse chromosome 16 which model the heart defects seen in 22q11DS (33, 34). This phenotype is now known to be secondary to Tbx1 haploinsufficiency (26, 34, 41). Thus, hemizygosity for Hira is not necessary for the production of this phenotype, although a murine deletion incorporating Hira has greater perinatal lethality (41), so it is possible that Hira hemizygosity contributes to the human phenotype as part of a multigene haploinsufficiency.
In order to examine the potential role of Hira in embryonic development, a mutation was generated in the gene by homologous recombination in embryonic stem (ES) cells. Homozygous mutants on an inbred background die by E10. When the mutation is crossed to an outbred background, embryos survive to E11. A wide range of phenotypes is seen on both genetic backgrounds, although embryonic lethality occurs at too early a stage to assess the morphogenesis of structures affected in 22q11DS. All embryos display growth retardation, with severely affected embryos being balls of disorganized tissue and more mildly affected embryos displaying recognizable head structures but lacking more caudal structures. All embryos demonstrate abnormal patterning in various degrees in most tissues, with mesendodermal tissues being the worst affected. We demonstrate that Hira is required for normal embryonic development and survival and suggest that the phenotype seen is the result of defective gastrulation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
Mice were routinely genotyped by Southern analysis and PCR of tail tip DNA. Embryos were typed by Southern analysis or PCR of yolk sac DNA at E9.5 and later and by PCR at earlier stages. The sequences of the primers used for the Hira targeting events were as follows: Hira6F, AACTCTGAGAGGTCATTCTGGC; neo, GGGACTGGCTGCTATTGGGC; loxP, GCTAGTCTAGACTGCAGGGCCAGTTTAAAC; and Hira6R, ACTCATCACAAGGCTTGGTG.
PCR comprised denaturation at 94°C for 3 min, followed by 35 cycles of 94°C for 15 s, 55°C for 30 s, and 72°C for 1 min. The targeted alleles were detected by using Hira6F and either the neo or loxP primers, which gave products of 600 and 180 bp, respectively. The normal allele was detected by using primers Hira6F and Hira6R under the same conditions, which gives a product of 150 bp.
The resulting seven chimeric males were identified by coat color and bred to C57BL/6 females. Heterozygous offspring identified by Southern analysis (Fig. 1) were then bred onto a 129Sv inbred background, with successive generations being bred to wild-type 129Sv females. Heterozygote 129Sv mice were also crossed onto CD1 outbred mice in the same fashion. The Hiraneoloxp mutation was also bred onto a mixed C57BL/6/129Sv genetic background. To collect embryos from all lines, heterozygous males and females were mated, and noon on the day of the plug was taken as 0.5 days post coitus (E0.5).
Reverse transcription-PCR (RT-PCR). CD1 background Hiraneo cross-embryos were collected and typed at E10 and then washed in phosphate-buffered saline (PBS), and RNA was prepared by using a Clontech total RNA isolation kit for ATLAS expression arrays, and cDNA was synthesized by using the Clontech SMART cDNA synthesis kit and Superscript II (Gibco-BRL). PCR conditions were as for typing, except the annealing temperature was 58°C, and three primer pairs were used: 1F-3R to amplify upstream of the neo insertion, 9F-10R to amplify just 3' to the neo insertion, and 23F-24R at the 3' end of the Hira transcript. The primer sequences were as follows: 1F, AGTTGATATTCACCCTGA; 3R, TGGTATCCAATGCATGTCCA; 9F, CTCACATGTTTGAAACGGCC; 10R, CTTTTCCTCCTCACTCAGGG; 23F, TCCAGTTCACTGCTCCACTG; and 24R, ATAGTGTGGTCCTGCCCTTG.
Western analysis. CD1 background Hiraneo cross-embryos were collected and typed at E10, washed in PBS, and homogenized in Buffer A (10 mM HEPES, pH 7.6; 85 mM KCl; 5.5% sucrose; 0.5 mM spermidine; 0.5 mM EDTA; 0.5 mM dithiothreitol; protease inhibitors). An equal volume of Buffer B (Buffer A plus 0.7% NP-40) was added, and cells were incubated on ice for 5 min. Nuclei were pelleted by centrifugation at 2,000 x g for 5 min at 4°C and then purified through a 0.8 M sucrose cushion in Buffer A. Purified nuclei were extracted in 10 mM HEPES (pH 7.6)-0.35 M KCl-1.5 mM MgCl2-0.25% NP-40-0.2 mM EDTA-0.5 mM EGTA-0.5 mM dithiothreitol-protease inhibitors for 1 h at 4°C. Insoluble material was removed by centrifugation at 12,000 x g for 10 min at 4°C. Nuclear extracts were separated on a sodium dodecyl sulfate-10% polyacrylamide gel and transferred to nitrocellulose. After being blocked with Tris-buffered saline containing 5% milk and 0.05% Tween 20, protein was detected with WC119 monoclonal antibody directed against Hira, with horseradish peroxidase-conjugated anti-mouse secondary antibody. The blots were washed in Tris-buffered saline containing 0.5% Tween 20 and developed by enhanced chemiluminescence reactions (Amersham). WC119 was a gift from Peter Adams (22).
Whole-mount in situ hybridization. Whole-mount hybridizations were performed essentially as described earlier (58) with minor modifications. CHAPS{3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate} detergent(0.5%) was included in the hybridization buffer, and hybridization temperatures varied depending on the length of the probe, with the majority being 68°C. Blocking buffer included 1% bovine serum albumin in addition to 10% serum. Boehringer-Mannheim purple-precipitating reagent was used in addition to nitroblue tetrazolium (NBT)-BCIP (5-bromo-4-chloro-3-indolylphosphate) as the coloring reagent. Digoxigenin-labeled antisense RNA probes were prepared as previously described (51).
Histologic analysis. Embryos were collected and wax embedded as described previously (57). Briefly, embryos were dissected in ice-cold PBS and fixed overnight in 4% paraformaldehyde-PBS. Embryos were then dehydrated through an ethanol series terminating in 100% ethanol. This was followed by two 30-min incubations in Histoclear, followed by one 20-min incubation in 50:50 Histoclear-wax at 60°C. After three changes of 100% wax, each for 20 min, embryos were placed in molds and wax and allowed to set. Sections were cut at 5 to 10 µm and floated onto 3-aminopropyltriethoxysilane (TESPA)-treated slides before being stained with either methylene green or hemotoxylin-eosin. Embryos sectioned after in situ hybridization were sectioned as described above and counterstained with eosin.
Whole-mount immunocytochemistry. For PECAM antibody staining, embryos were fixed for a minimum of 1 h in dimethyl sulfoxide-methanol (1:4) and then incubated in dimethyl sulfoxide-methanol-H2O2 (1:4:1) for 5 h at room temperature. The embryos were then rehydrated down through in 90, 75, 50, and 25% methanol-H2O two times for 10 min each time and then washed three times for 15 min each time in PBS plus 0.3% Triton X-100, two times for 15 min each time in 0.5%Triton X-100-PBS, and finally two times 15 min each time in 0.3% Triton X-100-PBS. Embryos were then blocked in 2% Boehringer blocking reagent in 0.3% Triton X-100-PBS for 1 h and incubated overnight at 4°C in primary antibody 1:50 anti-PECAM rat anti-mouse immunoglobulin G (Pharmingen) in blocking buffer. Two rinses in 0.3% Triton X-100-PBS were then performed, followed by three 1-h washes in 0.5% Triton X-100-PBS, two 30-min washes in 0.3% Triton X-100-PBS, and finally one 1-h incubation in blocking buffer. Embryos were then incubated in secondary antibody: goat anti-rat alkaline phosphatase (Chemicon) 1:200 in blocking buffer 4°C overnight. Two rinses and the first three 1-h washes were performed as after the primary antibody incubations. Embryos were then washed two times for 15 min each time in 0.3% Triton X-100 in Tris buffer (100 mM Tris, pH 9.5; 150 mM NaCl; 25 mM MgCl2) and developed in NBT (4.5 µl/ml)-BCIP (3.5 µl/ml) in 10% polyvinyl alcohol in Tris buffer.
Photography. Whole-mount embryos were photographed on a Nikon SMZ-U dissecting microscope, and sections were viewed on a Zeiss Axioskop 2 microscope.
| RESULTS |
|---|
|
|
|---|
129Sv inbred Hira-/- embryos die by E10. To investigate the phenotype of mice homozygous for the Hira targeted alleles, heterozygote intercrosses were performed, and offspring were examined at different developmental stages up to birth. No homozygous mutant mice were identified from 138 Hiraneo intercross liveborn offspring and 78 Hiraneoloxp intercross liveborn offspring, after genotyping from tail tip DNA by Southern blot and PCR. The null mutation is therefore embryonically lethal, and no live homozygous mutant embryos were detected after E9.5. At this stage, 122 embryos were genotyped by Southern blot analysis and, of these, 20 homozygous mutant embryos were identified (16%). However, a significant number of reabsorbing embryos and empty decidua were also recovered from the litters analyzed (n = 12).
All normal embryos were homozygous wild type or heterozygous for the targeted allele. All homozygous Hiraneo and Hiraneoloxp embryos exhibited a complex phenotype, which was variable at all stages examined, even within a litter (see below). The Hiraneo/Hiraneo and Hiraneoloxp/Hiraneoloxp phenotypes were identical, so analysis was concentrated on Hiraneo/Hiraneo embryos (hereafter referred to as Hira mutant or Hira-/- embryos). Since the abnormalities observed were consistent with a defect occurring earlier during development, we examined gastrulation-stage embryos.
Gastrulation-stage embryos display characteristics consistent with early mesodermal defects. The Hira gene was found to be first expressed at gastrulation stages at the extraembryonic-embryonic boundary and in the proximal ectoderm (Fig. 2a, i to iv). It was therefore possible that an early phenotype affecting these stages of development would be present.
|
At the gastrulation stages studied, a range of mutant phenotypes was observed within litters. Some mutants were of relatively normal size compared to wild-type littermates but exhibited a distortion of the primitive streak so that it appeared to bulge out into the amniotic cavity (Fig. 2b, i to iii). Sections through these embryos revealed that the primitive streak contained many more cells than usual, resulting in the bulging out of the posterior side of the embryo into the amniotic cavity (Fig. 3a to j). The worst-affected embryos appeared as small relatively undifferentiated balls of cells compared to wild-type littermates (Fig. 2b, iv to vi). The phenotype of these embryos suggested that their development was severely delayed or arrested at early gastrulation. A subset of these embryos also had a constriction at the embryonic-extraembryonic junction (Fig. 2b, ii).
|
In other mutant embryos with distorted primitive streaks, expression was displaced but not expanded, being present only at the edge of the primitive streak bulging into the amniotic cavity (Fig. 2c, vi). Sections through these different embryos showed that expression of Brachyury was present in cells with epithelial morphology at the edge of the primitive streak and in a small number of cells of mesenchymal appearance directly adjacent (Fig. 3n).
Headfold-stage mutant embryos with the most severe early phenotype expressed Brachyury in a pattern consistent with that seen at E6.5 at the start of gastrulation (Fig. 2c, vii), as did mutant embryos with constrictions from E7.0 to E7.5 litters (Fig. 2c, viii). Fgf8 expression appeared to be appropriate for the stage of development of the embryo (not shown).
Foxa2 expression was also displaced or expanded in mutant embryos of headfold and earlier stages (Fig. 2d, i to iv), raising the possibility that axial mesendoderm is specified but cannot migrate out from the primitive streak. In addition, expression of Foxa2 in the anterior visceral endoderm (AVE) was reduced or absent (Fig. 2d, iv). Other early markers for the AVE Hex and mCerberus appear to be downregulated in gastrulation-stage (E6.5 to E7.5) Hira mutant embryos, particularly in those with the more severe phenotype (Fig. 2e, i to iii, and f, i and ii). This may be linked to the extraembryonic-embryonic constriction observed in some embryos. Finally, Bmp4 expression, required for normal mesodermal development, was also found to be downregulated in gastrulation-stage embryos (Fig. 2g, i to iv).
Mid-gestation embryos display a phenotype consistent with earlier gastrulation defects. At E9.5 all Hira-/- embryos examined (n = 167) displayed a developmental delay of up to 24 h, were much smaller than wild-type littermates, and had rarely undergone embryonic turning (Fig. 4a to e). A total of 53% of embryos were small balls of disorganized tissue with little overt sign of differentiation (Fig. 2e). A small number of -/- embryos (12%) had developed a little further than this, making attempts to develop an anterior-posterior axis (Fig. 6e and q). These embryos had disordered neuroepithelial vesicles anteriorly, associated with an elongated condensed tissue, which could be the embryonic trunk. These embryos are grouped under the term "severely affected class" and probably arise due to the failure of the embryo to gastrulate, thus not forming the mesendodermal layers required for further development.
|
|
|
CD1 outbred homozygous mutant embryos die by E11 and display a partially rescued phenotype. To investigate the possible effect of genetic background on the homozygous mutant phenotype, 129Sv Hira+/- females were backcrossed to CD1 outbred males. Embryonic development was less badly affected than on the 129Sv inbred background, and the majority of Hira-/- embryos survived one more day of gestation. E10.5 embryos were collected from heterozygous matings between fourth- and fifth-generation mice (93.8 and 96.9% CD1 genotype, respectively) and genotyped by Southern blot or PCR. The overall percentage of homozygous mutant embryos was 25% (77 of 307). All homozygous Hiraneo CD1 embryos were abnormal compared to heterozygous and wild-type littermates.
The phenotype of living Hira-/- embryos at E10.5 (n = 77) remained variable on the CD1 outbred genetic background. Developmental delay and retarded growth were evident, but this was less apparent than on the inbred background for many embryos. A total of 7% were disorganized balls of tissue. The next most severely affected CD1 Hira-/- embryos resembled the milder phenotype observed on the 129 background, and none of these embryos had undergone turning. All embryos in this class of phenotype had recognizable, though badly patterned head structures, and abnormal or absent caudal axial structures (Fig. 4l and m). These embryos accounted for 33% of those dissected and are referred to here as the CD1 severe phenotype.
The remaining 60% of embryos had a phenotype that was much milder than any observed on the inbred background. All of these embryos had turned and had relatively normal caudal structures, with notochord, neural tube, and somites all being present. In some cases the somites were small, malformed, or asymmetric (Fig. 4j and k). These "rescued" embryos continued to display head defects, particularly the failure of the brain to fuse, which resulted in the neuroepithelium of the brain forming large open everted cap-like structures (Fig. 4i). Distinct forebrain structures could not be discerned in some embryos (e.g., Fig. 4j). Defects of the allantois similar to those seen on the inbred background were also present across the phenotypic range (Fig. 4j to l), but only in 45% of embryos, implying that some recovery of the extraembryonic mesoderm had occurred.
A total of 52 embryos of the CD1 genetic background had formed a heart or heart tube. In six embryos no looping had taken pace. Two chambers appeared to balloon out of the linear heart tube, resulting in a dumbbell-shaped appearance (Fig. 4m). This heart phenotype was always associated with severe caudal mesoderm disruption. However, failure of looping was not secondary to general developmental delay since the development of large blood vessels in the head was consistent with stage E10 embryos when looping should be well under way. Beating hearts were observed in some of these embryos, but in an irregular fashion, with blood being shuttled back and forth between the two chambers. Myocardial cells must therefore have differentiated within these mutant hearts. A small number of mild-phenotype 129Sv embryos were also observed to have hearts with similar defects. In embryos where looping had occurred normally (at least when developmental delay was taken into consideration) cardiac development was relatively normal by external morphology (69%), and these embryos were the best preserved generally. In other embryos with normal looping, chamber formation was disrupted, with a number of aberrantly formed chamber configurations being apparent (19%) (Fig. 7). These could be the result of delayed or defective folding of the heart relative to the ballooning of the primary myocardium. Severe pericardial edema was observed in some embryos (Fig. 4j, k, l, and particularly m) and was found more often in embryos with a linear heart tube.
Mesodermal markers show severe axial and paraxial defects consistent with early abnormal mesendodermal development. It was apparent from our analysis of E6.5 to E7.5 Hira-/- embryos and the morphology of older mutant embryos that axial and paraxial mesodermal derivatives were particularly affected by the gastrulation defects resulting from the loss of the Hira gene. To analyze these abnormalities in older embryos in more detail and to examine the extent of the rescue of these defects provided by the outbred genetic background, a number of molecular markers were employed to examine mesodermal structures in E9.5 to E10.5 mutant embryos.
Somite development was assessed by using Mox1 to detect presomitic and segmented somitic mesoderm. In all 129 and severe CD1 embryos, no segmentation was observed. Asymmetric stripes or patches of unsegmented somitic mesoderm were identified in these embryos (Fig. 5b to d). This phenotype was rescued in the mild CD1 class, for which segmented somites were clearly visible (Fig. 5d).
|
In milder inbred null embryos the prechordal plate or notochord, as delineated by staining for axial mesodermal markers (Foxa2, Shh, and Gsc), was often absent (Fig. 4p and q) or else detected only at the level of the mid- or hindbrain (Fig. 5j and o). Expression to the level of the heart was often accompanied by ventral shifting (Fig. 5h). In the embryos in which the notochord extended caudal to the heart, expression of the marker gene was reduced in patches (Fig. 5k). Ventral duplication of the notochord was seen in a few embryos (Fig. 5k). On the outbred background, less severely affected embryos demonstrated normal notochordal expression of Foxa2 extending along the midline over the entire length of the embryo (Fig. 5i). This suggests that, as for paraxial mesoderm, the CD1 genetic background mitigated axial mesodermal defects resulting from the Hira mutation.
Expression analysis of Hand1, a marker for the left ventricle and lateral plate mesoderm, revealed that, unlike axial mesendoderm, lateral plate mesoderm was relatively unaffected in Hira-/- embryos (not shown).
Neural markers indicate that the neuroepithelium is disorganized and abnormally patterned, a result of disrupted mesodermal development. Markers expressed along the entire anterior-posterior axis of the neuroepithelium (Pax3) and in the neural crest (cadherin-6) and regional brain markers such as Otx-1 and -2, En2, Krox20, Eph4A, and Fgf8 were examined (Fig. 6). In general, the expression of these markers in homozygous mutant embryos reflected the various levels of disorganization and developmental delay seen from embryo to embryo. This disorganization of neural patterning most probably results from the disruption of the axial mesoderm.
Pax3, which is normally expressed along the length of the nervous system in the dorsal neuroepithelium, is relatively well preserved in more mildly affected embryos, and the restriction to dorsal neuroepithelium was maintained in these embryos (Fig. 6b). Similarly, low level expression of cadherin-6 in most mutant types indicated some maintenance of dorsoventral patterning (data not shown).
Anterior-posterior regional neural markers showed variation in their expression across all phenotypic classes, illustrating the differing levels of pattern and tissue disorganization, both between and within these groups. Otx2 (forebrain marker) was found to be downregulated in the telencephalon in mild 129 and CD1 embryos and lost entirely in more severely affected embryos (Fig. 6c to e). However, normal En2 was present in all mutant embryos but the most severely affected (Fig. 6f, g, and i). Here aberrant spatial expression domains indicated the disruption of the development of the midbrain-hindbrain border (Fig. 6h). Hindbrain development was affected to various degrees, as illustrated by the expression of Krox20/EphA4 (Fig. 6j to q). Downregulation and asymmetry of expression were evident, with reduced expression in the center and lateral edges of rhombomeres 3 and 5 in some embryos and the loss of all transcripts from single rhombomeres apparent in others (Fig. 6l and m). In the more severely affected embryos, expression was either absent or not correlated to any known anatomical structure (Fig. 6m, n, and q).
Molecular markers delineate cardiovascular defects in Hiraneo/Hiraneo embryos. MLC-2a and MLC-2v are markers for presumptive atrial and ventricular tissue, respectively. Neither gene is expressed in severe Hira-/- embryos on the 129Sv background. In milder inbred Hira-/- embryos, some heart tubes were morphologically relatively normal. In some of these MLC-2a was expressed throughout the heart at E9.5 (Fig. 7a). Other embryos of this class had clearly developed abnormally. For example, at least one heart consisted of two apparently separate chambers, both expressing MLC-2a at very high levels (Fig. 7b). In similar embryos probed with MLC-2v, a number of embryos had staining in paired bilateral structures presumably corresponding to the developing ventricle (Fig. 7f). On a CD-1 background, expression of MLC-2a varied from absence (not shown), expression at similar levels throughout the heart tube, to the more normal situation of down regulated expression in the presumptive ventricular region (Fig. 7c to e). MLC-2v was expressed relatively normally in presumptive ventricular regions on the CD1 background (Fig. 7g and h).
As all Hira-/- embryos, regardless of genetic background, are dead or dying by E10.5 or E11, and allantoic development is abnormal in a high percentage of mutant embryos we examined the vascular system that would normally connect the embryo to the yolk sac and placenta. It was clear that even in the most mildly affected embryos the vasculature was compromised, with very few of the large blood vessels connecting the embryo to the placenta or to the yolk sac being apparent in mutant embryos (Fig. 7i and j). Closer examination of the vascularization of the yolk sac by PECAM staining, a marker for endothelial cells, revealed that, although high levels of staining were evident in mutant embryos, vascularization was abnormal. The number of large vessels branching off the main trunks was markedly decreased and the interlocking network of small blood vessels was disorganized (Fig. 7k and l). The complex vascularization of the embryo was also disrupted, with fewer vessels evident and as larger patches of staining rather than a fine network (data not shown).
| DISCUSSION |
|---|
|
|
|---|
Targeted mutation of the Hira gene results in gastrulation defects, specifically the expansion of the primitive streak into the amniotic cavity, which is suggestive of a failure of cells to exit the primitive streak normally. This leads to the loss of axial and paraxial mesendodermal structures such as the notochord and somites later in development, and this further leads to disorganization of neuroepithelial patterning. How the loss of Hira expression early in development could lead to the complex phenotypes seen later is discussed in more detail below.
In the absence of a good understanding of the cellular function of Hira, it is difficult to correlate the phenotype with defects at the level of the cell. However, given the regulation of Hira by cdk2/cyclin E and the role of the yeast Hir1p and Hir2p in cell cycle-regulated transcription there may be an underlying cellular proliferation defect responsible for the profound growth delay. TUNEL (terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling) staining of embryos (unpublished data) does not reveal any excess apoptosis, at least not at E8.5. Our unpublished work suggests Hira-/- ES cells show no gross differences in flow cytometry profiles, indicating altered cell cycling, and no retardation of population doubling time (in fact, cell division may be increased in -/- cells). Cell proliferation studies and blastocyst hatching studies will be of value in analyzing this further.
The mesendodermal defects in Hira mutants may be the result of a gastrulation block. The phenotype described above for the Hira-/- embryos bears a remarkable resemblance to those reported for Fgf8 and Fgfr1. Features in common at E9.5 include small, flat, disorganized embryonic disks that exhibit an expansion of axial mesendoderm or primitive streak markers, recognizable but disorganized head structures, truncated posterior regions, loss of axial and paraxial mesendodermal derivatives such as notochord and somites, and open extended neural plates with excess folding (12, 17, 52, 60). These parallels between the phenotypes of the different knockouts continue at gastrulation stages. The Hira mutant phenotype in which embryos arrest at early gastrulation was very similar to some Fgfr1-/- embryo phenotypes, both displaying developmental retardation, a shorter egg cylinder, and smaller proamniotic cavity. Constrictions at the extraembryonic-embryonic boundary were also present. The expanded primitive streak phenotype, which results in the posterior part of the embryo bulging into the amniotic cavity, was found in both Fgf8-/- and Fgfr1-/- embryos, as well as in Hira mutants.
In both the Fgf8 and Fgfr1 knockouts, the underlying defect is suggested to be the failure of primitive streak cells to migrate out of the streak to form the mesendodermal derivatives of the older embryo. Given the many phenotype similarities between Fgf8, Fgfr1, and Hira targeted mutations, this explanation may be extended to the Hira-/- phenotype at both gastrulation and neurulation. Our finding that extraembryonic mesoderm derivatives, such as the allantois, yolk sac, blood, and endothelial cells are present in Hira mutants indicates that the passage of cells through the proximal (posterior) end of the streak is relatively normal. The same is also true of the presumptive cardiac mesoderm that passes through the anterior streak relatively early at mid-streak (E7.0) stages. However, prospective axial and paraxial mesendoderm cells arising from the node and anterior primitive streak (notochord, prechordal plate, and somites) appear to be unable to exit the streak, resulting in the loss of these structures at postgastrulation stages.
In Fgfr1 mutants this problem is thought to occur because primitive streak cells do not undergo the required epithelial-mesenchymal transition (EMT) (12). However, Fgf8 primitive streak cells do undergo EMT but still fail to emigrate (52). Cells with a mesenchymal morphology are evident in Hira mutant streaks, suggesting that EMT has taken place and that the migration defect is therefore more analogous to that seen in the Fgf8-/- embryos, although we did not detect any gross abnormality of Fgf8 expression itself.
Corroboration for this idea comes from the expression of Foxa2, a marker for the node and later the notochord. Expression is expanded in Hira mutant primitive streaks (Fig. 7) but is lost at caudal levels at E9.5 concomitant with the truncation of the notochord, suggesting that although node and anterior streak cells are produced they cannot move away from the streak in the normal fashion.
A further contribution to the phenotype seen in Hira mutants may come from the downregulation of several genes known to be important in early patterning of the embryo. The AVE is known to be required for proper anterior patterning in the early mouse embryo. Hira mutants display constrictions of the extraembryonic-embryonic boundary similar to those seen in a number of knockout mice in which the AVE is defective, including Otx2, Lim1, and Foxa2 (1, 3, 6, 48, 56). Hex and mCerberus and Foxa2, markers for the AVE, are also downregulated in Hira mutant embryos, suggesting that the AVE may also be affected in these knockout mice. Chimera analysis and DiI labeling of mutant primitive streak cells could answer this question.
Disorganization of the neuroepithelium may be the result of mesendodermal defects in Hira mutants. The axial mesendoderm in the mouse comprises the notochord and prechordal plate and is known to be required for the normal anterior-posterior position of the neural tube (2, 3, 5, 9, 53, 54). As might be expected, the severity of the neuroepithelial abnormalities seen in Hira-/- embryos correlated with the severity of the axial mesendoderm defects observed. In the most mildly affected Hira-/- mutants (CD1 mild) markers for the notochord such as Foxa2 showed normal ventral midline expression, with the overlying neural tissue being normally patterned. In the next class of severity (mild 129Sv, severe CD11), Hira-/- embryos had reduced or absent notochordal expression of Foxa2/Shh. The overlying neuroepithelium in these embryos was severely affected, displaying a variety of patterning defects such as loss or misexpression of anterior-posterior markers.
In the majority of 129 mild/CD1 severe Hira mutant embryos that formed a recognizable nervous system, both the cranial and trunk neural folds failed to fuse and were poorly elevated. In CD1 mild embryos the trunk phenotype was rescued but cranial fusion was not. The closure of the cranial neural folds depends upon interactions with the underlying head mesenchyme (10). This tissue underlying the mid- and hindbrain is derived from cells from the anterior and mid-level streak at E7.0. Head mesenchyme found below the forebrain may emanate from the primitive streak earlier than this (29). Histologic analysis of cranial mesenchyme in Hira mutants revealed that in many embryos it was significantly diminished and did not populate the region below the neural folds in a normal fashion. Somitic mesoderm that normally lies beneath the trunk neural plate also failed to form, possibly also affecting neural tube elevation and fusion.
Hira mutants show failure of embryonic turning and heart looping. Normal mouse embryos undergo a clockwise axial rotation early in development (E8.5 to E9) which results in the establishment of the normal fetal position (20, 28). This process accompanies the formation and right-sided looping of the heart. In all Hira mutant embryos, except the CD1 mild class, embryonic turning failed to take place. In some embryos, heart looping did not take place or failed to complete. A number of mouse knockouts with phenotypes similar to that of the Hira mutant mouse and for which the phenotype was ascribed to abnormal mesoderm development also exhibit laterality defects such as abnormal heart looping and embryonic turning, e.g., Fgf8 (42), Bmp4 (32, 60), Brachyury (30), and Foxa2 (13, 19).
Intact midline structures such as the notochord and floor plate are essential for the development of left-right asymmetry (14, 37). Mutants such as no tail and floating head (zebra fish) and SIL and no turning (mouse), which have compromised notochordal development, also display aberrant heart looping and again altered expression of left-right transcripts (14, 25, 40, 44, 46). Our results demonstrate that in all but the least-affected Hira mutant embryos the notochord does not develop normally. These embryos fail to undergo embryonic turning, and the majority also have abnormal looping of the heart.
Some of the Hira mutant embryos that fail to undergo heart looping also display a second characteristic, which is interesting with regard to the process of heart development. Current theory suggests that cardiogenic mesodermal sheets form a crescent which folds toward the ventral midline, forming a linear primitive heart tube composed of primary myocardium. This primary myocardial tube then loops rightward and, concomitantly, secondary working myocardium balloons out from the outer curvature (ventral side linear heart tube) at sites defined by the expression of a specific gene pattern (11, 23). Both processes are crucial for the formation of the four-chambered heart in which all chambers and major connections to blood vessels are correctly juxtaposed. In some Hira mutants, although the hearts have not looped, the ballooning out of secondary myocardium to form two distinct chambers is visible. This suggests that under some conditions looping of the primary heart tube and the ballooning out of the working chambers can be uncoupled. This phenomenon may be linked to the decreased Bmp4 expression seen in Hira mutant embryos. Breckenridge et al. (7) have recently demonstrated that inhibition of Bmp4 in the heart can prevent looping but allow normal chamber and anterior-posterior development.
Embryonic lethality in Hira-/- embryos. Homozygous mutant Hira embryos probably die due to the failure of normal placentation, compounded by abnormal heart development. In half to two-thirds of embryos the allantois is formed but is abnormally large and often blood filled. It does not fuse with the chorion, so the chorioallantoic placenta and umbilical connection do not form. This leads to death due to failure of proper nutrition when the embryo switches from nutrients supplied by the yolk sac to that supplied by the placenta at E10.5 to E11.
In some Hira-/- embryos chorioallantoic fusion and the subsequent development of the placenta and its vascular connections occurred relatively normally. However, all Hira mutants die by E10 or E11. A possible explanation is that in embryos in which fusion has occurred a more subtle defect is present in the allantoic mesoderm, such as that seen in other mutants, e.g., Gcm1 (4), which die at E10.
In conclusion, Hira inactivation leads to a midgestational embryonic lethality. The wide variety of malformations seen in midgestation embryos reflect earlier defects seen in gastrulation stage embryos, in particular defects of primitive streak elongation. The cellular role of Hira has yet to be fully elucidated, but it may involve regulation of cell cycle-dependent aspects of transcription. Cell lines derived from Hira-/- embryos will be useful in investigating this topic further.
| ACKNOWLEDGMENTS |
|---|
J.M.B. holds a Wellcome Trust career development award. This work was carried out under the appropriate British Home Office license.
| FOOTNOTES |
|---|
Present address: Institute for Cancer Research, London SW3 6JB, United Kingdom. ![]()
Present address: ICSM, Hammersmith Hospital, London W12 0NN, United Kingdom. ![]()
Present address: Oxagen, Inc., Abingdon OX14 4RY, United Kingdom. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Ang, S. L., and J. Rossant. 1993. Anterior mesendoderm induces mouse Engrailed genes in explant cultures. Development 118:139-149.[Abstract]
3. Ang, S. L., and J. Rossant. 1994. HNF-3ß is essential for node and notochord formation in mouse development. Cell 78:561-574.[CrossRef][Medline]
4. Anson-Cartwright, L., K. Dawson, D. Holmyard, S. J. Fisher, R. A. Lazzarini, and J. C. Cross. 2000. The glial cells missing-1 protein is essential for branching morphogenesis in the chorioallantoic placenta. Nat. Genet. 25:311-314.[CrossRef][Medline]
5. Bachiller, D., J. Klingensmith, C. Kemp, J. A. Belo, R. M. Anderson, S. R. May, J. A. McMahon, A. P. McMahon, R. M. Harland, J. Rossant, and E. M. De Robertis. 2000 The organizer factors Chordin and Noggin are required for mouse forebrain development. Nature 403:658-661.[CrossRef][Medline]
6. Beddington, R. S., and E. J. Robertson. 1999. Axis development and early asymmetry in mammals. Cell 96:195-209.[CrossRef][Medline]
7. Breckenridge, R. A., T. J. Mohun, and E. Amaya. 2001 A role for BMP signalling in heart looping morphogenesis in Xenopus. Dev. Biol. 232:191-203.[CrossRef][Medline]
8. Brookes, A. J., B. J. Stevenson, D. J. Porteus, and J. R. Dorin. 1993. A series of vectors that simplify mammalian gene targeting. Transgen. Res. 2:238-244.[CrossRef][Medline]
9. Camus, A., B. P. Davidson, S. Billiards, P. Khoo, J. A. Rivera-Perez, M. Wakamiya, R. R. Behringer, and P. P. Tam. 2000 The morphogenetic role of midline mesendoderm and ectoderm in the development of the forebrain and the midbrain of the mouse embryo. Development 127:1799-1813.[Abstract]
10.
Chen, Z. F., and R. R. Behringer. 1995. Twist is required in head mesenchyme for cranial neural tube morphogenesis. Genes Dev. 9:686-699.
11. Christoffels, V. M., P. E. Habets, D. Franco, M. Campione, F. de Jong, W. H. Lamers, Z. Z. Bao, S. Palmer, C. Biben, R. P. Harvey, and A. F. Moorman. 2000. Chamber formation and morphogenesis in the developing mammalian heart. Dev. Biol. 223:266-278.[CrossRef][Medline]
12. Ciruna, B. G., L. Schwartz, K. Harpal, T. P. Yamaguchi, and J. Rossant. 1997. Chimeric analysis of fibroblast growth factor receptor-1 (Fgfr1) function: a role for FGFR1 in morphogenetic movement through the primitive streak. Development 124:2829-2841.[Abstract]
13. Collignon, J., I. Varlet, and E. J. Robertson. 1996. Relationship between asymmetric nodal expression and the direction of embryonic turning. Nature 381:155-158.[CrossRef][Medline]
14. Danos, M. C., and H. J. Yost. 1996. Role of notochord in specification of cardiac left-right orientation in zebrafish and Xenopus. Dev. Biol. 177:96-103.[CrossRef][Medline]
15. De Lucia, F., S. Lorain, C. Scamps, F. Galisson, J. MacHold, and M. Lipinski. 2001. Subnuclear localization and mitotic phosphorylation of HIRA, the human homologue of Saccharomyces cerevisiae transcriptional regulators Hir1p/Hir2p. Biochem. J. 358:447-455.[CrossRef][Medline]
16. Deng, C., A. Wynshaw-Boris, F. Zhou, A. Kuo, and P. Leder. 1996. Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell 84:911-921.[CrossRef][Medline]
17.
Deng, C. X., A. Wynshaw-Boris, M. M. Shen, C. Daugherty, D. M. Ornitz, and P. Leder. 1994. Murine FGFR-1 is required for early postimplantation growth and axial organization. Genes Dev. 8:3045-3057.
18. Dimova, D., Z. Nackerdien, S. Furgeson, S. Eguchi, and M. A. Osley. 1999. A role for transcriptional repressors in targeting the yeast Swi/Snf complex. Mol. Cell 4:75-83.[CrossRef][Medline]
19. Dufort, D., L. Schwartz, K. Harpal, and J. Rossant. 1998. The transcription factor HNF3ß is required in visceral endoderm for normal primitive streak morphogenesis. Development 125:3015-3025.[Abstract]
20. Fuginaga, M. 2001. Development of sidedness of asymmetric body structures in vertebrates. Int. J. Dev. Biol. 41:153-186.
21.
Halford, S., R. Wadey, C. Roberts, S. C. M. Daw, J. A. Whiting, H. O'Donnell, I. Dunham, D. Bentley, E. Lindsay, A. Baldini, F. Francis, H. Lehrach, R. Williamson, D. I. Wilson, J. Goodship, I. Cross, J. Burn, and P. J. Scambler. 1993. Isolation of a putative transcriptional regulator from the region of 22q11 deleted in DiGeorge Syndrome, Shprintzen syndrome, and familial congenital heart disease. Hum. Mol. Genet. 2:2099-2107.
22.
Hall, C., D. M. Nelson, X. Ye, K. Baker, J. A. DeCaprio, S. Seeholzer, M. Lipinski, and P. D. Adams. 2001. HIRA, the human homologue of yeast Hir1p and Hir2p, is a novel cyclin-cdk2 substrate whose expression blocks S-phase progression. Mol. Cell. Biol. 21:1854-1865.
23. Harvey, R. P. 1999. Seeking a regulatory roadmap for heart morphogenesis. Semin. Cell Dev. Biol. 10:99-107.[CrossRef][Medline]
24. Hogan, B. L. M., F. Constantini, and E. Lacy. 1993. Manipulating the mouse embryo: a laboratory manual. Cold Spring Harbor laboratory Press, Cold Spring Harbor, N.Y.
25. Izraeli, S., L. A. Lowe, V. L. Bertness, D. J. Good, D. W. Dorward, I. R. Kirsch, and M. R. Kuehn. 1999. The SIL gene is required for mouse embryonic axial development and left-right specification. Nature 399:691-694.[CrossRef][Medline]
26. Jerome, L. A., and V. E. Papaioannou. 2001. DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1. Nat. Genet. 27:286-291.[CrossRef][Medline]
27. Kaufman, P. D., J. L. Cohen, and M. A. Osley. 1998. Hir proteins are required for position-dependent gene silencing in Saccharomyces cerevisiae in the absence of chromatin assembly factor I. Mol. Cell. Biol. 18:4793-4806.
28. Kaufmann, M. H. 1992. The atlas of mouse development. Academic Press, London, England.
29. Kinder, S. J., T. E. Tsang, G. A. Quinlan, A. K. Hadjantonakis, A. Nagy, and P. P. Tam. 1999. The orderly allocation of mesodermal cells to the extraembryonic structures and the anteroposterior axis during gastrulation of the mouse embryo. Development 126:4691-4701.[Abstract]
30. King, T., R. S. Beddington, and N. A. Brown. 1998. The role of the brachyury gene in heart development and left-right specification in the mouse. Mech. Dev. 79:29-37.[CrossRef][Medline]
31.
Lamour, V., Y. Lecluse, C. Desmaze, M. Spector, M. Bodescot, A. Aurias, M. A. Osley, and M. Lipinski. 1995. A human homolog of the S. cerevisiae HIR1 and HIR2 transcriptional repressors cloned from the DiGeorge syndrome critical region. Hum. Mol. Genet. 4:791-799.
32.
Lawson, K. A., N. R. Dunn, B. A. Roelen, L. M. Zeinstra, A. M. Davis, C. V. Wright, J. P. Korving, and B. L. Hogan. 1999. Bmp4 is required for the generation of primordial germ cells in the mouse embryo. Genes Dev. 13:424-436.
33. Lindsay, E. A., A. Botta, V. Jurecic, S. Carattini-Rivera, Y.-C. Cheah, H. M. Rosenblatt, A. Bradley, and A. Baldini. 1999. Congenital heart disease in mice deficient for the DiGeorge syndrome region. Nature 401:379-383.[CrossRef][Medline]
34. Lindsay, E. A., F. Vitelli, H. Su, M. Morishima, T. Huynh, T. Pramparo, V. Jurecic, G. Ogunrinu, H. F. Sutherland, P. J. Scambler, A. Bradley, and A. Baldini. 2001. Tbx1 haploinsufficiency identified by functional scanning of the DiGeorge syndrome region is the cause of aortic arch defects in mice. Nature 401:97-101.
35. Llevadot, R., X. Estivill, P. Scambler, and L. E. Pritchard. 1998. Isolation and genomic characterization of the TUPLE1/HIRA gene of the pufferfish Fugu rubripes. Gene 208:279-283.[CrossRef][Medline]
36. Llevadot, R., G. Marques, M. Pritchard, X. Estivill, A. Ferrus, and P. Scambler. 1998. Cloning, chromosome mapping and expression analysis of the HIRA gene from Drosophila melanogaster. Biochem. Biophys. Res. Commun. 249:486-491.[CrossRef][Medline]
37. Lohr, J. L., M. C. Danos, and H. J. Yost. 1997. Left-right asymmetry of a nodal-related gene is regulated by dorsoanterior midline structures during Xenopus development. Development 124:1465-1472.[Abstract]
38.
Lorain, S., J.-P. Quivy, F. Monier-Gavelle, C. Scamps, Y. Lecluse, G. Almouzni, and M. Lipinski. 1998. Core histones and HIRIP3, a novel histone-binding protein, directly interact with the WD repeat protein HIRA. Mol. Cell. Biol. 18:5546-5556.
39. Magnaghi, P., C. Roberts, S. Lorain, M. Lipinski, and P. J. Scambler. 1998. HIRA, a mammalian homologue of Saccharomyces cerevisiae transcriptional co-repressors, interacts with Pax3. Nat. Genet. 20:74-77.[CrossRef][Medline]
40. Melloy, P. G., J. L. Ewart, M. F. Cohen, M. E. Desmond, M. R. Kuehn, and C. W. Lo. 1998. No turning, a mouse mutation causing left-right and axial patterning defects. Dev. Biol. 193:77-89.[CrossRef][Medline]
41. Merscher, S., B. Funke, J. A. Epstein, J. Heyer, A. Puech, M. M. Lu, R. J. Xavier, M. B. Demay, R. G. Russell, S. Factor, K. Tokooya, B. St. Jore, M. Lopez, R. K. Pandita, M. Lia, D. Carrion, H. Schorle, J. R. Kobler, P. J. Scambler, A. Wynshaw-Boris, A. Skoultchi, B. E. Morrow, and R. Kucherlapati. 2001. TBX1 is responsible for the cardiovascular defects in velo-cardio-facial/DiGeorge syndrome. Cell 104:619-629.[CrossRef][Medline]
42.
Meyers, E. N., and G. R. Martin. 1999. Differences in left-right axis pathways in mouse and chick: functions of FGF8 and SHH. Science 285:403-406.
43. Neer, E. J., C. J. Schmidt, R. Nambudripad, and T. F. Smith. 1994. The ancient regulatory-protein family of WD-repeat proteins. Nature 371:397-400.
44.
Rebagliati, M. R., R. Toyama, P. Haffter, and I. B. Dawid. 1998. cyclops encodes a nodal-related factor involved in midline signaling. Proc. Natl. Acad. Sci. USA 95:9932-9937.
45.
Roberts, C., S. C. Daw, S. Halford, and P. J. Scambler. 1997. Cloning and developmental expression analysis of chick Hira (Chira), a candidate gene for DiGeorge syndrome. Hum. Mol. Genet. 6:237-245.
46. Sampath, K., A. L. Rubinstein, A. M. Cheng, J. O. Liang, K. Fekany, L. Solnica-Krezel, V. Korzh, M. E. Halpern, and C. V. Wright. 1998. Induction of the zebrafish ventral brain and floorplate requires cyclops/nodal signalling. Nature 395:185-189.[CrossRef][Medline]
47. Scambler, P. J. 2000. The 22q11 deletion syndromes. Hum. Mol. Genet. 9:2421-2426.