hMutS{beta} Is Required for the Recognition and Uncoupling of Psoralen Interstrand Cross-Links In Vitro

The removal of interstrand cross-links (ICLs) from DNA in highereucaryotes is not well understood. Here, we show that processingof psoralen ICLs in mammalian cell extracts is dependent uponthe mismatch repair complex hMutSß but is not dependentupon the hMutS ${alpha}$ complex or hMlh1. The processing of psoralenICLs is also dependent upon the nucleotide excision repair proteinsErcc1 and Xpf but not upon other components of the excisionstage of this pathway or upon Fanconi anemia proteins. Productsformed during the in vitro reaction indicated that the ICL hasbeen removed or uncoupled from the cross-linked substrate inthe mammalian cell extracts. Finally, the hMutSß complexis shown to specifically bind to psoralen ICLs, and this bindingis stimulated by the addition of PCNA. Thus, a novel pathwayfor processing ICLs has been identified in mammalian cells whichinvolves components of the mismatch repair and nucleotide excisionrepair pathways.

INTRODUCTION

Top

Introduction

DNA interstrand cross-linking agents have been widely used formore than 50 years as potent anticancer agents; nevertheless,the repair of the lesions created by these drugs in mammaliancells is not well understood. In Escherichia coli, two mechanismsfor the removal of interstrand cross-links (ICLs) have beendescribed as either recombination dependent or independent.The recombination-dependent pathway was first described by Coleand his colleagues and requires the products of the uvrA, uvrB,uvrC, uvrD, recA, and polA genes (17, 18), indicating that elementsof both the nucleotide excision repair (NER) and homologousrecombination pathways of E. coli were required for ICL repair.Cole (17) was unable to find evidence for a double-strand break(DSB) intermediate and therefore proposed a model for the removalof ICLs in E. coli in which repair is initiated by dual incisionsin one strand on either side of the ICL. The resulting gap isthen repaired by a recA-mediated recombination process usinga homologous template as a donor. The remaining monoadduct isrepaired by a second round of incision by the NER apparatus,and the resulting gap is filled in by the product of the polAgene (DNA polymerase I). Current findings suggest that thispathway is also largely conserved in Saccharomyces cerevisiae(36, 51), with the notable exception that DSBs have been observedduring the repair of ICLs in yeast (31, 48, 50). Thus, componentsof both the RAD3 and RAD52 epistasis groups have been shownto be required for ICL repair in S. cerevisiae. A recombination-independentpathway of ICL repair has also been described for E. coli whichrequires the products of the uvr and polB genes (6, 7), suggestingthat the gap created by NER is repaired by translesion synthesis.Recently a similar recombination-independent pathway requiringNER elements has been described for mammalian cells (61).

While NER plays a central role in repair of ICLs in E. coliand apparently yeast, the mammalian NER pathway does not appearto be required for recombination-dependent repair of ICLs. Withthe exception of mutants defective in ERCC1 and XPF, which arehighly sensitive to ICL-inducing drugs, mammalian mutants defectivein genes involved in NER are only mildly sensitive to theseagents (3, 35). In fact, recent in vivo findings have shownthat the Ercc1-Xpf heterodimer is required for the incisionor "unhooking" steps of ICL repair but that other componentsof the early stages of mammalian NER are not involved (20).In addition, it has been inferred from in vitro studies thatincisions that are formed by the NER pathway 5' to an ICL leadto a futile cycle of incision and gap filling that does notresult in repair (9, 52).

After the initial processing of ICLs in vivo, repair of theselesions appears to be funneled into the homologous recombinationpathway, since mutants defective in the RAD51-related genesXRCC2 and XRCC3 are extremely sensitive to cross-linking agents(47). Both XRCC2 and XRCC3 have been shown to be required ina conservative pathway of recombination after the introductionof DSBs by the I-SceI endonuclease (37, 55). However, Ku orDNA-PKcs mutants, which are defective in the nonhomologous endjoining pathway of DSB repair, do not exhibit an extreme sensitivityto ICL-inducing agents, suggesting that this pathway does notplay a major role in the repair of ICLs (53).

While the evidence is compelling that Ercc1 and Xpf are requiredfor the early stages of ICL repair in mammalian cells, othercomponents of this pathway remain to be elucidated. In additionto their role in NER, Ercc1 and Xpf have also been shown tocooperate with mismatch repair (MMR) proteins in removal ofinsertion/deletion loops (IDLs), and in some pathways of recombination(16, 39, 40, 56). MMR proteins have also been shown to be involvedin the recognition and excision repair of some types of alkylationdamage (23, 24). These findings prompted us to examine the roleof MMR proteins in the processing of ICLs in vitro. Here, weshow that hMutSß, but not hMutS ${alpha}$ or hMlh1, is requiredfor the initial processing of psoralen ICLs and that this processingleads to removal or uncoupling of the ICL. These findings identifya novel function for MutSß and indicate a cooperationbetween this MMR complex and the Ercc1-Xpf heterodimer in therepair of ICLs in mammalian cells.

MATERIALS AND METHODS

Top

Materials and Methods

Cell lines and proteins. Human lymphoid cell lines were cultured in suspension in RPMI1640 medium supplemented with 20% fetal calf serum (FCS). HumanMMR deficient and hamster cell lines were cultured in minimalessential medium plus 10% FCS. HeLa cells were cultured in Joklitmedium plus 10% FCS.

hMutS ${alpha}$ and hMutSß complexes were isolated from nuclearextracts prepared from HeLa cells (21). The extract was subjectedto sequential chromatography on phosphocellulose and hydroxyapatitecolumns, and the fractions that contained hMutS ${alpha}$ and hMutSßwere identified by Western blotting. hMutS ${alpha}$ fractions were pooledand further purified by single-stranded DNA cellulose and monoQchromatography as described previously (22). hMutSßfractions were further purified by chromatography on heparinagarose, monoQ, CHT-1, and monoS columns. The Ercc1-Xpf complexwas purified from HeLa nuclear extracts as described previously(1). Human PCNA was expressed from the PT7-hPCNA plasmid inE. coli BL21(DE3) and purified by sequential chromatographysteps of phosphocellulose, Q-Sepharose, hydroxyapatite, andhydrophobic interaction chromatography essentially as describedpreviously (66).

Substrate preparation. Plasmids and psoralen interstrand cross-linked substrates forthe cross-link induced-repair synthesis (CRS) assay were preparedas previously described (45). Briefly, two complementary oligonucleotides,5' GCTCTCGTCTGTACACCGAAG and 5' GCTCTTCGGTGTACAGACGAG, weresynthesized and phosphorylated. One hundred micrograms of thisannealed substrate was added to 4,5',8-trimethylpsoralen ata concentration of 5 µg/ml in a solution containing 10mM Tris (pH 7.5), 0.5 mM EDTA, and 25 mM NaCl. The sample wasirradiated with 365-nm UV light (10 min at 9 mW/cm²) to effectformation of the interstrand cross-link, and the cross-linkedoligonucleotide was purified by denaturing polyacrylamide gelelectrophoresis (PAGE). To insert the cross-linked oligonucleotide,plasmids were digested with HindIII, and a single deoxyadenosineresidue was added to the 3' end of the cleavage site by incubationwith the Klenow fragment of DNA polymerase I. After ligationbetween the oligonucleotide and the linear plasmid, covalentlyclosed cross-linked template (CLT) DNA was purified by CsCl-ethidiumbromide gradient centrifugation. The control template (CT) anddonor template (DT) plasmids were prepared in bulk quantitiesfrom host cells and purified by CsCl-ethidium bromide gradientcentrifugation (see Fig. 1A).

View larger version (37K):
[in this window]
[in a new window]
FIG. 1. Examination of extracts from hMsh2-defective cell lines in the CRS assay. (A) The CLT plasmid contains a single psoralen cross-link at the site identified by an "X." The CT plasmid is identical to the CLT except for the presence of the cross-link. The DT (for donor template) plasmid is identical to the CT plasmid except for the presence of a short segment containing two SspI sites that replace the NcoI site. (B) Silver-stained gels of purified hMutSß and hMutS ${alpha}$ after sodium dodecyl sulfate-PAGE. (C) CRS assay with extracts prepared from HEC59 cells. The assays were performed as described in Materials and Methods. For the complementation assays, purified hMutSß and hMutS ${alpha}$ were added to a final concentration of 0.4 ng/ml. Subsequent to the incubation, the DNA was extracted, digested with NcoI and AvaII, subjected to agarose gel electrophoresis, and analyzed by autoradiography.

Substrates for electrophoretic mobility shift assays were preparedby digesting the CLT or CT with HincII and BamHI to releasethe 65-bp cross-linked (CL oligo) or non-cross-linked (NCL oligo)duplex DNA, respectively. The BamHI ends of the oligonucleotideswere labeled and converted to blunt ends by treatment with theKlenow fragment of DNA polymerase I in the presence of dATP,dGTP, dTTP, and [ ${alpha}$ -³²P]dCTP. The 65-bp substrates were purifiedby electrophoresis and extraction from an 8% polyacrylamidegel.

In vitro repair assays. Mammalian whole-cell extracts were prepared by the method ofManley et al. (49). Where appropriate, before use in the invitro cross-link assays, each extract was tested for competencyin an in vitro NER assay (63). The incorporation assay (referredto as CRS) was performed as previously described (45). Briefly,50-µl reaction mixtures contained (final concentration)100 µg of extract, 30 ng of CLT or CT, 100 ng of DT, 45mM HEPES-KOH (pH 7.8), 75 mM KCl, 7.4 mM MgCl₂, 0.9 mM dithiothreitol,0.4 mM EDTA, 2 mM ATP, 20 µM (each) dATP, dGTP, and TTP,and 8 µM dCTP, 2 µCi of [ ${alpha}$ -³²P]dCTP (3,000 Ci/mmol),40 mM phosphocreatine, 2.5 µg of creatine phosphokinase,3% glycerol, and 18 µg of bovine serum albumin. The reactionswere incubated for 3 h at 22°C. After incubation, the reactionswere stopped by addition of EDTA and the samples were processedto remove RNA and protein. Plasmids were sequentially digestedwith the appropriate restriction enzymes and analyzed by agarosegel electrophoresis. After gel electrophoresis and stainingwith ethidium bromide, the gels were photographed and subsequentlydried down for autoradiography.

To analyze the products that formed from the CLT during incubationin the mammalian extracts, CRS assays were performed as describedabove except that the extracted DNAs were digested with theindicated restriction enzymes and examined by 6% sequencingPAGE.

DNA sequencing. The primer 5'-CGCGCGTAATACGACTCACTAT, located at the leftmostBssHII site of the plasmid substrate (see Fig. 2A), was usedfor sequencing reactions carried out with the Sequenase Version2.0 DNA sequencing kit from U.S. Biochemicals according to themanufacturer's recommendations. The CT plasmid was used as thesequencing template.

View larger version (57K):
[in this window]
[in a new window]
FIG. 2. Analysis of products created by processing of psoralen ICLs in HeLa extracts. CRS assays were performed as described in Materials and Methods, and extracted DNAs were digested with the indicated restriction enzymes and examined by denaturing PAGE. (A) The local sequence map of the region surrounding the defined ICL in the CLT. Cleavage sites of the appropriate restriction enzymes on both strands of the DNA are indicated by vertical bars. The numbers between the vertical bars indicate the distances in nucleotides between the cleavage sites. The boxed characters represent the thymine nucleotides that are cross-linked by the psoralen adduct. The horizontal bar represents the location of the sequencing primer. (B) Denaturing PAGE analysis of reaction products after digestion by the indicated restriction enzymes. DNAs (CLT and DT) recovered after incubation in HeLa extract were digested with the indicated enzymes (even-numbered lanes). U and L indicate the bands derived from the upper and lower strands, respectively. For size markers, the CT was digested with BsrGI and the appropriate restriction enzyme and radiolabeled by incubation with T4 polynucleotide kinase and [ ${gamma}$ -³²P]ATP (odd-numbered lanes). Lanes M indicate the 10-bp marker. (C) Determination by sequencing gel analysis of the 3' terminus of the fragment resulting from incision and DNA synthesis occurring at the site of the psoralen ICL in HeLa extracts. Sequencing reactions (lanes 1 to 4) were performed with the CT plasmid as template and the indicated primer (seeMaterials and Methods). Assays were conducted with the CLT in the absence of the DT. After incubation, the recovered DNA was digested with BssHII, and loaded either alone (lane 6) or in combination with the "G" sequencing reaction (lane 5). Fragments resulting from digestion of the CT with BssHII and BsrGI are also shown as an additional marker (lane 7). The bands derived from the CLT and CT (lanes 6 and 7) are indicated by arrows on the right side of the panel. On the left side of the panel, the cross-linked thymine residue is indicated by an asterisk, and the 3' end of the reaction product is indicated by an arrow.

Electrophoresis mobility shift assay. Binding assays were performed in 20-µl volumes containing25 mM HEPES-KOH (pH 7.8), 5 mM MgCl2, 80 mM KCl, 1 mM EDTA,1 mM dithiothreitol, 10% glycerol, 1 mg/ml bovine serum albumin,and the indicated concentrations of hMutSß at roomtemperature for 10 min. Carrier/competitor DNA consisted of75 fmol of 195-bp unlabeled duplex DNA. Approximately 3.5 fmolof labeled 65-bp CL oligo or NCL oligo was added to each reaction.Reactions were separated by electrophoresis on 5% polyacrylamidegels at 4°C in TBE buffer (89 mM Tris borate, 2 mM EDTA).The gels were dried down for autoradiography, and quantificationwas performed by scanning autoradiograms with Adobe Photoshopsoftware and determining band intensities with Intelligent Quantifiersoftware (Bio Image).

RESULTS

Top

Results

hMutSß is required for interstrand cross-link-induced DNA synthesis. To understand the repair of ICLs in mammalian cells, we havedeveloped an in vitro assay, referred to as CRS, using cellextracts, that measures DNA synthesis induced by a single psoralenICL introduced at a defined site in a plasmid. The substratesfor this assay are depicted in Fig. 1A. This single ICL wasfound previously to induce synthesis in the damaged plasmidand, interestingly, in an undamaged plasmid coincubated in thesame extract (45), although the mechanism of incorporation inthe undamaged plasmids remains unclear. We also showed thatthe undamaged plasmid was required only for stimulation of incorporationinto the CLT at low levels of the latter plasmid, presumablydue to a carrier effect in which the soluble concentration ofinhibitory DNA binding proteins are reduced. The assay was alsoshown to be dependent upon Ercc1, Xpf, RPA, and PCNA but notupon other proteins involved in the disease xeroderma pigmentosum(XP) (45, 46, 65).

To identify additional factors involved in processing of psoralenICLs, we focused on MMR proteins since they have been shownto cooperate with the Ercc1-Xpf heterodimer in other pathwaysof DNA repair (16, 39, 40, 56). We first used the CRS assayto examine extracts from the human tumor cell line HEC59. Thiscell line is defective in hMSH2 and thus deficient in both hMutSßand hMutS ${alpha}$ (11). As shown in Fig. 1C, extract prepared from HEC59cells was defective in the ICL-induced DNA synthesis. To determineif this deficiency could be rectified by the addition of MMRproteins, we purified hMutSß and hMutS ${alpha}$ from HeLa nuclearextracts as described in Materials and Methods (Fig. 1B). Additionof purified hMutSß, but not purified hMutS ${alpha}$ , resultedin the complementation of the HEC59 extracts (Fig. 1C) and indicatedthat hMutSß was specifically required for the observedICL-induced DNA synthesis. Similar findings (data not shown)were also obtained with the hMSH2-defective human tumor cellline LoVo (11).

Psoralen ICLs are uncoupled during incubation in mammalian cell extracts. The initial stages of ICL repair processing require the introductionof incisions at or near the site of cross-links, which is followedin vitro by the observed DNA synthesis. To examine the natureof the products formed during the reaction, we performed theCRS assay with HeLa extract, and after digestion with variousrestriction enzymes (Fig. 2A), the samples were analyzed bydenaturing PAGE. For convenience sake, we will refer to thisas the incision assay. As shown (Fig. 2B), digestion of therecovered plasmids with BssHII, SacI, NotI, XhoI, or KpnI allyielded unique bands that indicated that specific incisionshad occurred at or near the site of the psoralen ICL. As anexample, the digests with BssHII yielded two specific fragmentsthat migrated just slightly more slowly than fragments producedfrom the CT by digestion with a combination of BssHII and BsrGIand labeling by incubation with T4 polynucleotide kinase and[ ${gamma}$ -³²P]ATP (Fig. 2B, lanes 1 and 2). An analysis of the bandscreated by the other restriction enzymes (Fig. 2B) indicatedthat these two bands represented the 5' ends of the upper andlower strands shown in Fig. 2A. Again, as an example, considerthe digest with SacI (Fig. 2B, lanes 7 and 8). Digestion ofthe CT with SacI and BsrGI yielded a fragment of 73 nucleotides,representing a portion of the upper strand (lane 7). (It alsoyielded a fragment of 81 nucleotides representing the lowerstrand). Digestion of the CLT with SacI after incubation andlabeling in the HeLa extract yielded a fragment estimated at75 nucleotides (lane 8). Since cleavage by BssHII and SacI resultsin 5' and 3' nucleotide overhangs, respectively, the only scenariothat is consistent with the combined results from the BssHII,SacI, and NotI digestions is that the 5' end of the upper strandis labeled during the assay and that the resulting 3' end islocated an apparent two nucleotides to the 3' side of the BsrGIcleavage site. A similar analysis with KpnI and XhoI (Fig. 2B,lanes 3, 4, 9, and 10) indicates that the 5' end of the lowerstrand is also labeled during the assay, with the resulting3' end also located to the 3' side of the BsrGI site. Interestingly,the sites of these incisions appear to be located exactly 3'to the ICL, which would indicate that the ICL must be uncoupledin order to release fragments of the observed sizes.

To determine precisely the sizes of the released fragments,and thus map the terminus of the 3' ends, a sequencing gel analysiswas performed. As shown (Fig. 2C), sequencing of the CT usingthe primer shown in Fig. 2A, and comparison to the productsderived from the CLT after digestion with BssHII, demonstratedthat these bands migrated at 113 and 86 nucleotides, indicatingthat the 3' incisions resulting from incubation in HeLa extractsoccurred precisely 3' to the psoralen ICL on both strands. Takentogether, our analyses of the products of the in vitro processingof psoralen ICLs indicate that DNA synthesis occurs 5' to thecross-link in either strand and that the ICL is uncoupled duringthe reaction.

DSBs are created at the site of psoralen ICLs. A direct prediction of the findings described above is thatif these incisions occurred in both strands in the same molecule,a DSB would be created. DSBs have been observed in vivo in bothyeast and mammalian cells during the repair of ICLs (5, 19,20, 31, 50). To assay for DSBs, we performed the CRS assay andoverexposed the film to allow easier visualization of productsthat would be produced if a DSB occurred at the site of theICL. With the restriction enzymes used for linearization, theseproducts would be predicted to migrate at approximately 1.7and 0.7 kb. As shown (Fig. 3, top), bands migrating at thesepositions were observed after agarose gel electrophoresis, whichis consistent with the formation of DSBs in the HeLa extract.In addition, the presence of these bands was stimulated by theaddition of the DT plasmid, which is consistent with our previousresults reported on the CRS assay (45). These results have alsobeen confirmed with other extracts that are positive in theCRS and incision assays. We have also performed kinetic studieson the production of these bands, and the intensity of thesebands increases with time of incubation, indicating that theyare created as a result of exposure to the extract (data notshown). In addition, the two lower bands shown in Fig. 3, toppanel, were purified from the agarose gel and examined by denaturingPAGE. This analysis showed that both bands migrated at the positionexpected for single-stranded DNA and that, therefore, the DNAin both fragments was not cross-linked (data not shown). Thisobservation is consistent with the findings described abovedemonstrating that the ICL had been removed or uncoupled fromthe substrate. Nevertheless, it is possible that these fragmentswere derived from preexisting linear contaminants in our CLTpreparations that become labeled during incubation in the HeLaextract. To rule out this possibility, we prepared a prelabeledcross-linked fragment by digestion of the CLT with BssHII andlabeling of the ends with Klenow fragment. Incubation of thissubstrate with HeLa extract, in the absence of [ ${alpha}$ -³²P]dNTPs,again yielded bands upon PAGE, consistent with the formationof DSBs at the site of the ICL, whereas no bands were observedupon mock incubation without extract, or in the same fragmentderived from the CT (Fig. 3, bottom). Taken together, theseresults indicate that mammalian cell extracts can remove oruncouple psoralen ICLs and convert them into DSBs, consistentwith in vivo results obtained in yeast and mammalian cells (5,19, 20, 31, 50).

View larger version (49K):
[in this window]
[in a new window]
FIG. 3. DSBs are created at the site of psoralen ICLs in HeLa cell extracts. Arrows to the left in each panel indicate fragments resulting from the formation of DSBs. Restriction enzyme maps are shown to the right of each gel figure, indicating the expected products from a DSB created at the site of the ICL, indicated by an X. Top, CRS assay demonstrating the formation of DSBs in vitro as a function of the concentration of the DT plasmid. After incubation in the extract, recovered DNAs were digested with NcoI and AvaII and examined by agarose gel electrophoresis followed by autoradiography. Bottom, DSB formation at the site of psoralen ICLs in a prelabeled cross-linked substrate requires the HeLa cell extract. CLT or CT plasmids were digested with BssHII and labeled by filling in the 3' ends with Klenow fragment in the presence of [ ${alpha}$ -³²P]dCTP. The labeled substrates were incubated with HeLa extract in the absence of the DT plasmid. Recovered DNAs were extracted and examined by PAGE followed by autoradiography.

Proteins involved in the NER and MMR pathways are required for induction of incisions at psoralen ICLs. The Ercc1-Xpf heterodimer has been shown to be required forthe incision of ICLs in vivo (20), and we have shown that itis required for the CRS assay in vitro (45, 65). We thereforeexamined extracts from the hamster mutant cell lines UV20 andUV41, which are defective in ERCC1 and XPF, respectively, inthe incision assay as described above (Fig. 2B, lane 2). Extractsfrom both mutant cell lines were deficient in producing incisionsat the site of the psoralen ICL, whereas extract from the parentalcell line, AA8, was positive (Fig. 4A). Both mutant extractswere complemented by the addition of purified Ercc1-Xpf. SinceErcc1 and Xpf are components of the NER pathway, we next examinedwhether the observed incisions were due to NER (9, 52) or toa distinct mechanism. As shown (Fig. 4B), extracts from lymphoidcell lines derived from XP patients defective in XPC or XPGwere as proficient in the incision assay as the repair-normallymphoid cell line WI-L2. Consistent with previous results reportedby others, extracts from each of the two XP cell lines wereexamined in the mammalian cell-free NER assay (63) and foundto be negative (data not shown). These findings indicate thanan intact NER pathway is not required for the observed ICL processing.

View larger version (65K):
[in this window]
[in a new window]
FIG. 4. Incisions and DNA synthesis during psoralen ICL processing in vitro are dependent upon Ercc1-Xpf and hMutSß. Assay were performed as described in the legend to Fig. 2 using the BssHII restriction enzyme, which generates fragments of 113 and 86 nucleotides (see Fig. 2B, lane 2). (A) Assay of extracts from Chinese hamster ovary cells defective in either ERCC1 or XPF. UV20 and UV41 were derived from the repair-normal cell line AA8 used as a control. For complementation assays, purified Ercc1-Xpf was added to a final concentration of 0.5 ng/ml. (B) Assay of extracts from XP lymphoid cell lines defective in XPC (XP1BE) or XPG (XPG83). WI-L2 is a repair-normal human lymphoid cell line used as a control. (C) Assay of extracts from Fanconi anemia lymphoid cell line defective in FANCA (GM13022A), FANCB (GM13071), or FANCC (GM13020). (D) Assay of MMR-deficient human tumor cell lines defective in hMSH2 (HEC59, LoVo), hMSH6 (DLD1), or hMLH1 (SW48, A2780/CP70). For complementation assays, hMutSß or hMutS ${alpha}$ was added to a final concentration of 0.4 ng/ml.

Fanconi anemia (FA) cells exhibit a pronounced hypersensitivityto cross-linking agents, suggesting that FA proteins may playa role in ICL repair (13, 27). We therefore examined extractsfrom cells representing FA complementation groups A, B, andC in the incision assay, and we found that all three were proficient(Fig. 4C) and are therefore not required for the early stagesof processing psoralen ICLs in vitro.

To determine whether MMR proteins play a role in the introductionof the observed incisions at psoralen ICLs, we examined extractsfrom the two hMSH2-defective cell lines described above, LoVoand HEC59 (11). We also examined a third line, DLD1, which isdefective in hMSH6 (11) and, therefore, deficient in hMutS ${alpha}$ butnot hMutSß (Fig. 4D). Of these three cell lines, LoVoand HEC59 extracts were negative in the incision assay but couldbe complemented by the addition of purified hMutSß,whereas the DLD1 extract was positive in the incision assay.These findings confirm the results described above and indicatethat hMutSß, but not hMutS ${alpha}$ , has a unique role in theprocessing of psoralen ICLs in vitro. We also examined extractsfrom two human tumor cell lines, SW48 (11) and A2780/CP70 (60),defective in hMLH1. Extracts from both were positive in theincision assay, indicating that hMlh1 was not required for thisactivity (Fig. 4D).

MutSß recognizes psoralen ICLs. The demonstrated role of MutSß in MMR is to recognizesmall IDLs and thus initiate MMR repair processing (29, 33,54, 62). To determine whether hMutSß plays the samerole in lesion recognition of psoralen ICLs, we performed gelmobility shift studies using a psoralen cross-linked duplexoligonucleotide as a substrate. As shown (Fig. 5A), hMutSßinduced the formation of two specific bands (S1 and S2) andone nonspecific (NS) band. Also, addition of unlabeled cross-linkedtemplate reduced binding to the labeled cross-linked probe,indicating that the binding is specific to the ICL (data notshown). These results indicate that hMutSß can recognizeand bind a psoralen ICL with a specificity similar to that previouslyobserved for IDLs.

View larger version (62K):
[in this window]
[in a new window]
FIG. 5. Binding of hMutSß complex to psoralen DNA ICLs as determined by EMSA. Binding assays were performed as described in Materials and Methods. The positions of the specific (S1 and S2) and nonspecific (NS) complexes are indicated (arrows). (A) hMutSß binds specifically to DNA containing psoralen ICLs. (B) Effect of ADP and ATP on binding of hMutSß to psoralen ICLs. (C) PCNA stimulates binding of hMutSß to psoralen ICLs. A nonspecific band created by incubation of the CL oligo or NCL oligo with PCNA alone is indicated (asterisk). (D) Quantitation of the gel shown in panel C. The S and NS complexes in each lane were quantified by densitometry.

Binding of MutS proteins to mismatched DNAs is reduced uponthe addition of ATP, although the interpretation of this findinghas proved to be controversial (10, 30, 38). To determine ifthis binding pattern is maintained in the recognition of psoralenICLs by hMutSß, we performed a gel mobility shiftassay in the presence of ATP and observed that formation ofthe S complexes was dramatically reduced (Fig. 5B). Furthermore,addition of ADP reversed this effect, as has been observed forthe binding of hMutSß to mismatched DNA (29). (Fora discussion of current theories on the roles of ADP and ATPin MMR see references 14, 38, and 41).

PCNA has been shown to interact with both Msh3 and Msh6 andto act at a step prior to DNA synthesis by enhancing mismatchrecognition by MutS proteins (15, 26, 32, 58). To determineif PCNA affected the binding of hMutSß to psoralenICLs, we again performed gel mobility shift assays with thepsoralen cross-linked duplex oligonucleotide. As shown (Fig.5C and D), addition of PCNA produced approximately 11-fold and2-fold increases in the formation of the S1 and S2 complexes,respectively. Taken together, the mobility shift assay resultsindicate that hMutSß efficiently discriminated betweenpsoralen cross-linked DNA and undamaged DNA and responded tothe addition of nucleotide factors and PCNA similarly to thepreviously observed binding of MutS proteins to mismatched DNA.

DISCUSSION

Top

Discussion

To summarize our findings, we have shown that processing ofpsoralen ICLs in mammalian cell extracts results in specificproducts that are produced as a result of incisions near theICL followed by extension or gap-filling DNA synthesis. Theformation of these products also requires that the ICL be uncoupledor removed from the substrate, and this conclusion is confirmedby our finding that DSBs are also formed during the in vitroreaction. A putative model explaining our findings is shownin Fig. 6. Initially, incisions are formed on both sides ofthe ICL, although the exact sites of these incisions remainsto be determined. DNA synthesis then fills in the resultinggap until it reaches the adducted thymine in the template strand,where the polymerase is stalled from further progression, thusgiving rise to the fragments we identified after restrictionenzyme digestion. Processing of both strands in the same manneror the induction of a single nick at either of the indicatedlocations (Fig. 6c) would give rise to DSBs, as we have observed.These DSBs and/or the gapped structure (Fig. 6b) may be intermediatesthat are further processed by homologous recombination pathwaysto yield fully repaired chromosomes in vivo. DSBs have beenobserved as intermediates of ICL repair in both yeast and mammaliancells, although the process by which they are produced has notbeen identified (5, 19, 20, 31, 50). Some support for this modelcomes from a recent report in which a substrate containing apsoralen ICL placed in a duplex four to six bases from a junctionwith unpaired DNA was incised in the duplex region on eitherside of the adduct by purified Ercc1-Xpf (43). Such a structurecould arise during replication or it could be formed by recognitionand processing of ICLs by repair factors.

View larger version (9K):
[in this window]
[in a new window]
FIG. 6. Model for processing of a psoralen DNA ICLs in mammalian cell extracts. An ICL in duplex DNA stimulates cleavage (indicated by arrows) on both sides of the cross-link in one strand (a), creating a gapped intermediate (b). DNA synthesis (dashed line) fills in the gap but is blocked at the adducted thymine in the template strand from further progression (c). A second incision(s) in the opposite strand at either or both of the indicated points (arrows) would result in the formation of DSBs (d).

We have also identified a number of proteins that are requiredfor the in vitro processing of psoralen ICLs. Previous in vivoand in vitro findings (3, 20, 35, 45, 65) have demonstratedthat the Ercc1-Xpf heterodimer, but not other components ofthe NER pathway, is required for the initial stages of the majorpathway of ICL repair in mammalian cells. However, it shouldbe noted that NER has been shown in vivo to participate in anapparently minor, but mutagenic, pathway of ICL repair thatpresumably entails translesion bypass synthesis (61). Our resultsconfirm the role of Ercc1-Xpf and also implicate hMutSßand PCNA as proteins involved in the recognition step of ICLprocessing. These conclusions are based on both the lack ofactivity in Msh2-deficient cell extracts, which can be complementedby addition of purified MutSß but not by MutS ${alpha}$ , andthe demonstration of direct binding of psoralen ICLs by MutSßwhich is stimulated by PCNA. Interestingly, our findings ruleout hMlh1 as being required for the incisions observed at psoralenICLs. The precise function of Mlh1 in MMR repair is not completelyunderstood, but it is required for the repair of both base-basemismatches and IDLs (14, 41). The lack of a requirement forhMlh1 and the involvement of Ercc1-Xpf suggest that the initialprocessing of psoralen ICLs represents a pathway distinct fromthe archetypal MMR pathway that repairs DNA mismatches. Theyeast homologs of Ercc1 and Xpf (Rad10 and Rad1, respectively)and Msh proteins have been shown to function together in severalbiochemical pathways. The repair of large IDLs has been shownto require Msh2 and Rad1 (40), and the removal of nonhomologousends during some types of recombination requires the Rad1-Rad10heterodimer and MutSß (16, 56). Both Rad1 and Rad10have also been shown to physically interact with Msh2 (8). Ourfindings indicate that the Ercc1-Xpf heterodimer, hMutSß,and PCNA also cooperate in a novel pathway involved in the earlystages of processing of psoralen ICLs in mammalian cells. Also,recent in vivo results have shown that cell cycle arrest andrepair of psoralen ICLs in primary human fibroblasts requirespassage through S phase (2). A requirement for DNA replicationfor removal of ICLs would be consistent with an involvementof MMR components, since current models suggest a direct associationbetween these proteins and the replication machinery.

Our results indicate that proteins involved in FA complementationgroups A, B, and C are not required for the observed in vitroprocessing of psoralen ICLs. Although there have been reportsof an involvement of FA proteins in forming incisions at sitesof ICLs (42), their function still remains unclear (13). However,the recent cloning and characterization of the FANCD2 gene hasresulted in the discovery of a signal transduction pathway thatresponds to DNA damage by the mono-ubiquitination of the FANCD2protein (28, 57). This ubiquitination pathway is dependent uponother FA proteins, and it targets FANCD2 to nuclear foci containingBRCA1. Our findings described here suggest that the ultimatetarget of this pathway does not involve the initial recognitionand processing of ICLs. However, it should be noted that FAproteins may comprise a separate pathway of ICL repair thatdoes not involve the Ercc1-Xpf heterodimer.

MMR proteins have been shown to be involved in the cellularresponse to DNA damage caused by alkylating agents (12). Defectsin MSH2, MSH6, MLH1, and PMS2 in mammalian cells lead to anincreased resistance to compounds such as N-methyl-N'-nitro-N-nitrosoguanidineand N-methyl-N-nitrosourea of more than 100-fold compared towild-type cell lines (44, 59). This increased resistance isapparently due to a defect in both cell cycle arrest and apoptoticresponses in these MMR-deficient cells. In wild-type cells thisresponse is mediated by MutS ${alpha}$ and MutL ${alpha}$ (24, 34, 64). Interestingly,treatment of MMR-defective cells with bifunctional alkylatingagents, such as 1,3-bis(2-chloroethyl)-1-nitrosourea, 1-(2-chloroethyl)-3-cyclohexyl-nitrosourea,and mitomycin C results in resistance that is typically somewhatless than that of wild-type cells (4, 25, 34). This phenotypesuggests the possibility that MMR proteins are involved in theapoptotic response in the case of monoalkylation but are involvedin both apoptosis and DNA repair in the case of ICLs inducedby alkylating agents. In this situation, the lack of both apoptosisand DNA repair may effectively offset each other, resultingin the observed level of sensitivity to these drugs that isless than that of wild-type cells. Current findings indicatethat MutSß is not involved in these signaling pathwaysfor O⁶-alkylguanine lesions (24, 34); however, since we haveshown that hMutSß binds to psoralen ICLs, it is possiblethat it may also play a dual role in DNA repair and signal transduction.

Our findings indicate a previously unidentified role for hMutSßin combination with Ercc1-Xpf and possibly PCNA in the recognitionand processing of psoralen ICLs. If these findings are applicableto lesions induced by other types of bifunctional alkylatingcompounds, they could have important implications for theiruse as chemotherapeutic agents.

ACKNOWLEDGMENTS

Nianxiang Zhang and Xiaoyan Lu contributed equally to this work.

We thank Stephen Chaney, Tom Kunkel, and Marsha Frazier forproviding cell lines.

This work was supported by grants CA52461 and CA75160 from theNational Institutes of Health.

FOOTNOTES

* Corresponding author. Mailing address: Department of Molecular Genetics, The University of Texas M. D. Anderson Cancer Center, Houston, TX 77030. Phone: (713) 792-8941. Fax: (713) 794-4295. E-mail: rlegersk{at}mdanderson.org.

REFERENCES

Top